Gene 545 (2014) 262–270

Contents lists available at ScienceDirect

Gene

j ourna l homepage: www.e lsev ie r .com/ locate /gene

Characterization of NADPH–cytochrome P450 reductase gene from thecotton bollworm, Helicoverpa armigera

Dong Liu a,b, Xiaojie Zhou a,b,c, Mei Li a, Shunyi Zhu a, Xinghui Qiu a,b,⁎a State Key Laboratory of Integrated Management of Pest Insects and Rodents, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, Chinab University of Chinese Academy of Sciences, Beijing 100049, Chinac Beijing Center for Disease Control and Prevention, Institute of Disinfection and Vector Control, Beijing 100013, China

Abbreviations: CYP, cytochrome P450; CPR, NADPH–cdiphenyleneiodonium chloride; NADPH, nicotinamide adFMN, flavin mononucleotide; FAD, flavin adenine dinucle⁎ Corresponding author at: State Key Laboratory of In

Insects and Rodents, Institute of Zoology, Chinese AcademChina.

E-mail address: qiuxh@ioz.ac.cn (X. Qiu).

http://dx.doi.org/10.1016/j.gene.2014.04.0540378-1119/© 2014 Elsevier B.V. All rights reserved.

a b s t r a c t

a r t i c l e i n f o

Article history:Received 24 November 2013Received in revised form 17 April 2014Accepted 24 April 2014Available online 24 April 2014

Keywords:Helicoverpa armigeraNADPH–cytochrome P-450 reductaseGene structureSpatial and temporal expressionEnzymatic kineticsInhibition

A complete cDNA encoding the NADPH–cytochrome P450 reductase (haCPR) and its genomic sequence from thecotton bollworm Helicoverpa armigerawere cloned and sequenced. The open reading frame of haCPR codes for aprotein of 687 amino acid residues with a calculated molecular mass of 77.4 kDa. The haCPR gene spans over11 kb and its coding region is interrupted by 11 introns. haCPR is ubiquitously expressed in various tissues andat various stages of development. Escherichia coli produced haCPR enzyme exhibited catalytic activity forNADPH-dependent reduction of cytochrome c, following Michaelis–Menten kinetics. The functionality ofCPR was further demonstrated by its capacity to support cytochrome P450 (e.g. haCYP9A14 and chickenCYP1A5) mediated O-dealkylation activity of alkoxyresorufins. The flavoprotein-specific inhibitor(diphenyleneiodonium chloride, DPI) showed a potent inhibition to haCPR activity (IC50 = 1.69 μM).Inhibitory effect of secondary metabolites in the host plants (tannic acid, quercetin and gossypol) onCPR activity (with an IC50 value ranged from 15 to 90 μM) was also observed.

© 2014 Elsevier B.V. All rights reserved.

1. Introduction

Cytochrome P450 monooxygenases (CYPs) catalyze the oxidativemetabolism of various endogenous and exogenous substrates (seeFeyereisen, 2012). Microsomal CYPs function in partnership with theirelectron donor enzyme, NADPH–cytochrome P450 reductase (EC1.6.2.4,hereafter called CPR) (Riddick et al., 2013). In eukaryotes including in-sects, CPR is the only obligatory flavoprotein intermediate that transferselectrons from reduced nicotinamide adenine dinucleotide phosphate(NADPH) to P450 enzymes through flavin mononucleotide (FMN) andflavin adenine dinucleotide (FAD) cofactors (Louerat-Oriou et al., 2001;Paine et al., 2001). CPR is recognized as a key factor of rate limitation forcatalytic activities of P450s (Cheng et al., 2006). In addition, CPRs donateelectrons to multiple acceptors (e.g. cytochrome b5, squalene mono-oxygenase, and heme oxygenase), and can directly catalyze the one-electron reductive bioactivation of some prodrugs (e.g. mitomycin Dand tirapazamine) (Riddick et al., 2013).

Typically, as with other animals, there is only one CPR gene in eachinsect genome. Since the first insect CPR gene (house fly CPR) was

ytochrome P450 reductase; DPI,enine dinucleotide phosphate;otide.tegrated Management of Pesty of Sciences, Beijing 100101,

cloned and sequenced in 1993 (Koener et al., 1993), around 20 CPR se-quences have been identified in insects (Zhu et al., 2012). Heterologous-ly expressed house fly CPR has been widely used to investigate thefunction of a given cytochrome P450 of eukaryotic origins (Sandstromet al., 2006; Wen et al., 2003). The enzymatic kinetics of insect CPRswere investigated using heterologously expressed CPR enzymes(Andersen et al., 1994; Kaewpa et al., 2007; McLaughlin et al., 2008;Sarapusit et al., 2008; Wen et al., 2003). Biochemical comparisons re-vealed key differences in thebinding of smallmolecules (cofactors or in-hibitors) between mosquito and human CPRs (Lian et al., 2011). RNAi-mediated in vivo knockdown of CPR increased pyrethroid susceptibilityin Anopheles gambiae, Cimex lectularius andHelicoverpa armigera (Lycettet al., 2006; Tang et al., 2012; Zhu et al., 2012).

The cotton bollworm H. armigera is an extremely detrimentalpolyphagous pest that may cause severe crop loss (d'Alencon et al.,2010; Fitt, 1989). It has been long known that CYPmediated detoxifica-tion of secondary metabolites and insecticides is responsible for itsadaptation to host plant toxins and resistance to insecticides in thispest. To better understand the molecular mechanisms of insecticideresistance or host adaptation, it is necessary to dissect the substratespecificity of individual P450s. However, previous attempts in thisdirection have been hampered by the difficulty in obtaining homoge-neous individual P450 and its redox partners required for the reconsti-tution of P450 reaction systems. As a crucial step towards functionalcharacterization of themultiple functions of versatile CYPs in the cottonbollworm, in this study, we identified a CPR (haCPR) gene from

263D. Liu et al. / Gene 545 (2014) 262–270

H. armigera. The expression profile and enzymatic properties were alsoinvestigated.

2. Materials and methods

2.1. Insects

A colony of cotton bollworm H. armigera (Hübner) was establishedfrom a field collection from Hebei Province, China, and was maintainedin the laboratory without exposure to any insecticide. Larvaewere indi-vidually reared in glass tubes on a wheat germ based artificial diet (WuandGong, 1997), at 25±1 °C and a relative humidity of 70%with a pho-toperiod of 16-h light/8-h dark. Adults were kept under the same tem-perature and light conditions, and provided with a 10% honey solution.

2.2. Enzymes and chemicals

E. coli strainDH5α (Transgen Biotech, Beijing, China)was used as thehost cells for cloning and expression. Restriction enzymes, ligase,pMD19-T Simple vector, pGEM Easy vector, Pfu polymerase, MLV re-verse transcriptase and Genome Walking Kit were purchased fromTakara (Takara, Dalian, China). Rapid amplification of cDNA ends(RACE) was carried out using SMARTer™ RACE cDNA AmplificationKit (Clontech, CA, USA). Polymerase chain reaction (PCR) reagents,gel purification kit and TIANcombi DNA Lyse & Amp PCR Kit werepurchased from Tiangen Biotech (Beijing, China). TRIzol was obtain-ed from Invitrogen (Invitrogen, CA, USA). Oligonucleotide primerswere commercially synthesized by Invitrogen. Gossypol (≥95%)was purchased from China Cotton UNIS (Beijing, China). All theother chemicals were obtained from Sigma (St. Louis, MO, USA) in-cluding cytochrome c, NADPH, glucose-6-phosphate, glucose-6-phosphate dehydrogenase, isopropyl-β-D-thiogalactopyranoside(IPTG), 5-aminolevulinic acid hydrochloride (ALA, 98%), resorufin,7-ethoxyresorufin, 7-methoxyresorufin, 7-benzyloxyresorufin, quercetin,tannic acid, xanthotoxin, diphenyleneiodonium chloride (DPI), piperonylbutoxide (PBO), permethrin, deltamethrin and DDT. The pB54(pCWmod4) vector was kindly provided by Dr. Thomas Friedberg(University of Dundee, Scotland).

2.3. Isolation of NADPH–cytochrome P450 reductase gene from theH. armigera

Total RNA was extracted from midguts of H. armigera 5th instar lar-vae by using TRIzol (Invitrogen, CA, USA) according to themanufacturer's protocol. First-strand cDNA was synthesized from totalRNA (1 μg) using MLV reverse transcriptase according to themanufacturer's instructions (Takara, Dalian, China). Total genomicDNA was isolated from cotton bollworm larvae by using TIANcombiDNA Lyse & Amp PCR kit (Tiangen, Beijing, China).

A pair of degenerate primers (Degenerate F/CPR and Degenerate R,Table 1) was synthesized based on the conserved regions of the identi-fied CPR genes from other insects, includingMusca domestica (Q07994),Drosophila melanogaster (NP_477158), Bombyx mori (NP_001104834)and A. gambiae (AAO24765) (Horike et al., 2000). A 1402 bp productwas amplified. The 3′-end and 5′-end of this cDNA fragment were ob-tained by using SMART™ RACE cDNA amplification kit according tothe manufacturer's protocol. The gene-specific primers used for 3′-RACE and 5′-RACE were 3′GSP-F and 5′GSP-R respectively (Table 1).

The full-length gene was cloned using CPR-F/CPR-R primers(Table 1), which were designed based on the sequence information ob-tained from 3′- and 5′-RACE ends. In order to detect potential geneticpolymorphisms of H. armigera CPR, the cDNA pool synthesized fromRNA of 60 individuals was used as templates. Products amplified usingthe high-fidelity DNA polymerase (Pfu) were gel purified (Tiangen,Beijing, China) and then subcloned into pGEM-T vector (Takara, Dalian,China). Twenty positive clones were sequenced.

The genomic sequence of the CPR gene in H. armigera was obtainedby a combination of PCR and genome walking techniques. Genomewalking was performed according to the manufacturer's instructionsin theGenomeWalkingKit (Takara, Dalian, China). All primers are listedin Table 1.

2.4. Sequence analysis and three-dimensional model

The molecular weight and isoelectric point (pI) of deduced haCPRprotein were predicted by using ProtParam software (http://web.expasy.org/protparam/). BLASTP search against the non-redundant da-tabase of GenBankwas performed under default parameters. Alignmentof amino acid sequence was performed by using Sequence Alignmenttools MEGA4 and GeneDoc. The homology structure of haCPR was con-structed through SWISS-MODELworkspace service (http://swissmodel.expasy.org/workspace/) based on the structure of human CPR [PDB:3QE2] (Xia et al., 2011). The haCPR structure was displayed withSwiss-PDB viewer (Guex and Peitsch, 1997).

2.5. Spatial and temporal expression analysis

The expression profile of CPRwas examined in various tissues and atvarious developmental stages of H. armigera by RT-PCR. Total RNA fromeggs, female pupae, male pupae, various tissues (head, midgut, malpi-ghian tubules, fat bodies and integument) of the fifth-instar larvae,and different parts (antennae, heads, thoraxes and abdomens) from fe-male and male adults, was prepared using TRIzol (Invitrogen, Carlsbad,CA) according to the manufacturer's protocol. To remove potentialgenomic DNA contamination, the RNA samples were treated withRNase-free DNase I (Takara, Dalian, China).

The first-strand cDNA was synthesized from 1 μg RNA with anoligo(dT) primer using the MLV reverse transcriptase. The RT-PCR am-plifications were carried out in a final volume of 25 μL reaction contain-ing 2 μL of 10×diluted template cDNA, 12.5 μL TaqMasterMix (Tiangen,Beijing, China), 0.5 μL (10 μM) of each primer and sterilized water up tothe final volume. The primers used for the semi-quantitative PCR analy-sis were qCPR-F and qCPR-R (Table 1). The elongation factor-1α gene(EF-1α, qEF-F/qEF-R primer set, Table 1) was used as a reference gene(Zhou et al., 2009). The thermal cycling profile consisted of an initialstep of denaturation at 95 °C for 5 min, followed by 30 cycles of 95 °Cfor 30 s, 55–60 °C for 30 s and 72 °C for 30 s, and a final extensionstep of 72 °C for 5 min. Aliquots of 7.5 μL PCR products were analyzedon a 2% agarose gel.

2.6. Construction of recombinant haCPR and CYP9A14 plasmids

2.6.1. Recombinant haCPR plasmidA DNA sequence containing the intact ORF (Open Reading Frame) of

CPR and digestion sites was amplified by PCR using KpnI CPR-F andHindIII CPR-R as primers (Table 1) and cDNA as the template. Pfu DNApolymerasewas employed in the PCR to reduce the incidence of replica-tion error. PCR product was cloned into pMD19-T simple vector to forma plasmid named CPR-PMD.

To construct a recombinant plasmid for functional expression of CPRin E. coli, we followed the pelB strategy (Pritchard et al., 2006). Briefly,the vector pB54 was modified by inserting the bacterial pelB leader se-quence (21 amino acid residues) at the Nde I and EcoR I restrictionsites. The pelB oligonucleotide leader sequence flanking with digestionsites (5′-CATATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCG CTGCCCAGCCGGCGATGGCCGAATTC-3′) was commercially syn-thesized by Invitrogen.We named themodified vector as pB508 hereaf-ter. The ORF of haCPR was cut out from CPR-PMD and ligated into thederived pB508 vector between the Kpn I and Hind III restriction sites.The resulting recombinant plasmid pB508-CPR was transformed intoan E. coli DH5α strain.

Table 1Primers used in this study.

Primer name Usage Sequence (5′–3′)

CPR Degenerate F cDNA Cloning TT(C/T)GGI(C/T)TIGGIAA(C/T)AA(A/G)AC(A/G/C/T)TA(C/T)GACPR Degenerate R cDNA Cloning GCCAT(G/A)TTITTIGC(G/A)TC(G/A/T/C)CC(G/A)CA5′GSP-R 5′-RACE AGGACCTGTCGCCGCCTTTGTGTAGC3′GSP-F 3′-RACE GTAATCGCAACGGTCACTTCTACATCTGCPR-F cDNA Cloning ATGTCAGACAGCGCACAGGCPR-R cDNA Cloning TTAACTCCATACATCTGCTGCPR-gDNAF1 Genomic CPR cloning Same to CPR-FCPR-gDNAR1 Genomic CPR cloning GCAACCATGCCTTTCATCTTCPR-gDNAF2 Genomic CPR cloning AAGATGAAAGGCATGGTTGCCPR-gDNAR2 Genomic CPR cloning TTGTAGAGAGTGCAGCCTGGCPR-gDNAF3 Genomic CPR cloning CCAGGCTGCACTCTCTACAACPR-gDNAR3 Genomic CPR cloning TGGTAGTTACGCCCTTGTTAACPR-gDNAF4 Genomic CPR cloning TTAACAAGGGCGTAACTACCACPR-gDNAR4 Genomic CPR cloning Same to CPR-RCPR-gDNASP1 Genomic CPR cloning GCAATAGCCCTTAGATAAGTACTGGCPR-gDNASP2 Genomic CPR cloning GGTACTCACGGCATAATTCAAACCCPR-gDNASP3 Genomic CPR cloning CCTCGCCATATGTTGCCATACAGAqCPR-F qRT-PCR AAGACATACCATCTTGTAAGCCTCqCPR-R qRT-PCR AGAAGTGACCGTTGCGATTACCqEF-F qRT-PCR GACAAACGTACCATCGAGAAGqEF-R qRT-PCR GATACCAGCCTCGAACTCACKpnI CPR-F Expression plasmid construction GGTACCATGTCAGACAACGCACAGGHindIII CPR-R Expression plasmid construction AAGCTTTTAACTCCATACATCTGCTGCYP9A14 NdeI-F Expression plasmid construction AGGAGGTCATATGGCTCTGTTATTAGCAGTTTTTGTACTC

GTCGCAGCTCTGACGCYP9A14 KpnI-R Expression plasmid construction CGGGGTACCTTACTGGCGCAGCTTGACCCT

264 D. Liu et al. / Gene 545 (2014) 262–270

2.6.2. Recombinant haCYP9A14 plasmidIn order to express CYP9A14 in E. coli, we followed the 17α

N-terminal modification strategy, where the first eight amino acidresidues of the CYP9A14 N-terminus were replaced with a sequence(MALLLAVF) derived from the bovine steroid 17α-hydroxylase(Barnes et al., 1991). The forward primer (CYP9A14 NdeIF, 5′AGGAGGTCATATGGCTCTGTTATTAGCAGTTTTTGTACTCGTCGCAGCTCTGACG-3′) introduced the Nde I restriction site (underlined) as the initiationcodon and a 17α sequence modification (italic). The reverse primer(CYP9A14 KpnIR, 5′-CGGGGTACCTTACTGGCGCAGCTTGACCCT-3′) in-troduced the Kpn I site (underlined sequence). The resulting PCR prod-uct was digested and ligated into pB54 at the Nde I and Kpn I sites tocreate the recombinant plasmid pB54-17αCYP9A14. The recombinantplasmid was sequenced to ensure right nucleotide sequence. The expres-sion plasmid pB54-17αCYP9A14 was transformed into E. coli Rosseta(DE3) (Transgen, Beijing, China) for functional expression.

2.7. Bacterial expression and membrane isolation

The functional expression of chicken CYP1A5 was described previ-ously (Yang et al., 2013), and a similar protocol was used to expresshaCPR and haCYP9A14. Briefly, a single E. coli colony carrying the plas-mid of interest was inoculated in 5 mL of Luria Broth (LB) containingampicillin (100 μg/mL) and allowed to grow overnight at 37 °C and200 rpm. One milliliter of overnight cultures was used to inoculate100 mL of modified terrific broth with ampicillin (100 μg/mL) in a 500mL conical flask. The cultures were grown at 37 °C and 200 rpm untilan OD600 of 0.7 to 1.0. Then 1 mM IPTG (and 75 mM ALA for CYP9A14)was added and the cultures were incubated for additional 22–24 h at 30°C and 150 rpm. The cells were harvested by centrifugation at 2800 gfor 20 min at 4 °C (Pritchard et al., 2006). The harvested cells from100 mL cultures were resuspended in 10 mL of 1× TSE buffer [50 mMTris-acetate (pH 7.6), 250mMsucrose, and 0.25mMEDTA]. The proteaseinhibitors PMSF (phenylmethylsulfonylfluoride) andDTT (dithiothreitol)

Fig. 1.Alignment of the amino-acid sequence of haCPRwith those from Bombyxmori, Aedes aegyLinepithema humile, Rattus norvegicus andHomo sapiens. Identical amino acids are shaded in blain gray and noted in lowercase letters in the consensus line. Regions reported to be the bindininsect species are labeled with arrows.

were added to final concentrations of 1 mM and 0.1 mM respectively.The resuspended cells were disrupted using an ultrasonic processor(Scienta-IID, China), and cell debris was removed by centrifugationat 12,000 g for 30 min at 4 °C. To pellet membranes, the 12,000 g su-pernatant was centrifuged at 180,000 g for 1 h. The membrane frac-tions were resuspended in 1 mL of 1× TSE buffer containing PMSFand DTT.

2.8. Protein concentration, SDS-PAGE and P450 content

The protein concentration was determined by the Bradford method(Bradford, 1976). 10% (w/v) sodium-dodecyl-sulfate polyacrylamidegel electrophoresis (SDS-PAGE)was performed to detect the expressionof the recombinant CPR protein. About 20 μg of protein was loaded intoeach lane of the gel. Protein bands were visualized by staining withCoomassie Blue R-250. Total P450 content was determined accordingto the method described by Omura and Sato (1964).

2.9. CPR activity assay

CPR activity was determined by measuring its NADPH-dependentcytochrome c reductase activity at 30 °C (Capdevila et al., 1973; Fenget al., 1992; Lian et al., 2011). The activity assay mixture contained thehaCPR enzyme in the membrane fractions, 50 μM cytochrome c, and50 μM NADPH in 0.3 M potassium phosphate buffer (pH 7.6) in a totalvolume of 1 mL (Schonbrod and Terriere, 1971). The reaction was initi-ated by the addition of NADPH. Time-dependent absorbance change at550 nm was monitored up to 3 min by a DU800 spectrophotometer(Beckman, USA). The extinction coefficient of 21 mM−1 cm−1 wasused to determine the amount of cytochrome c reduction. A parallelassay with membranes from cells harboring pB508 vector was per-formed as a control.

Kinetic experiments for cytochrome c reduction were performed at afixed 50 μM NADPH concentration with varying cytochrome c

pti, Pediculus humanus, Tribolium castaneum, Acyrthosiphon pisum,Drosophilamelanogaster,ck and noted in capital letters in the consensus line.Weakly conserved residues are shadedg sites of the cofactors are boxed. Insertion positions of the four conserved introns among

265D. Liu et al. / Gene 545 (2014) 262–270

266 D. Liu et al. / Gene 545 (2014) 262–270

concentrations, and vice versa for NADPH (Zhou et al., 2010). Kinetic pa-rameters were determined by the nonlinear regression Michaelis–Menten equation by using GraphPad Prism 5 (San Diego, CA, USA).

For inhibition experiments, the reaction volume was 1 mL,consisting of enzyme preparations and cytochrome c (50 μM) in thepresence or absence of NADPH (50 μM) in 0.3 M potassium phosphatebuffer (pH 7.6). The enzyme preparationwas pre-incubatedwith inhib-itors for 10 min at 30 °C. Because background activity of cytochrome creduction was observed for tannic acid and gossypol, we measuredthe activity of haCPR by subtracting the rate of cytochrome c reductionin the absence of NADPH from that in the presence of NADPHwhen tan-nic or gossypol was included in the reactions as previously reported(Pillai and Mehvar, 2011). IC50 values (the concentration giving 50% in-hibition) for each inhibitor were calculated using a non-linear regres-sion analysis program GraphPad Prism 5.

2.10. Alkoxyresorufin O-dealkylase assay

The alkoxyresorufin O-dealkylation (AROD) activities including7-methoxyresorufin (MROD), 7-ethoxyresorufin (EROD), and 7-benzyloxyresorufin (BROD) were assayed according to the methoddescribed elsewhere (Mayer et al., 1977). The reaction mixturescontained the substrate (3 μM 7-methoxyresofurin for MROD,5 μM 7-ethoxyresofurin for EROD, and 4 μM 7-benzyloxyresofurinfor BROD) and reconstituted enzymes in the phosphate buffer(pH 7.4, 50 mM). The reconstituted enzymes were prepared by com-bining the membranes containing individual CYP (0.1 μM) and themembranes containing CPR (0.5 μM CPR) and mildly mixing on icefor 5 min. The reaction mixtures in a final volume of 750 μL werepre-incubated in a water bath at 30 °C for 5 min. Reactions werestarted by the addition of 10 mM NADPH. Enzyme activity was mea-sured at an excitation wavelength of 530 nm (slit 5 nm), and anemission wavelength of 585 nm (slit 5 nm). Three other enzymaticreactions (CYP alone, CPR alone, and NADPH minus) were performed ascontrols. AROD activities were expressed as nmol of resorufin per nmolP450 per minute.

3. Results

3.1. Identification of the haCPR gene

A full length cDNA sequence named as haCPR was isolated fromH. armigera. This cDNAwas 3526 bp long,with anORF of 2064 bp codingfor a protein of 687 amino acids, a 5′-UTR of 168 bp and a 3′-UTR of1294 bp. The pI and MW of the deduced protein were 5.55 and77.4 kDa respectively. Three cDNA forms (GenBank No. 1KF419215,1KF555286, 1KF555287) with 17 synonymous nucleotide substitutionsin their coding regions were identified from 20 clones (Fig. S1). No mis-sense mutation was discovered.

Sequence comparison showed that the protein encoded by thiscDNA had the highest amino acid identity (N90%) to cytochrome P450reductase from other two noctuid insects (Spodoptera exigua andMamestra brassicae), followed by those from other lepidopterans(N80% for B. mori and Danaus plexippus). Similarly, haCPR exhibited63%–70% identity at the amino acid level when compared with thosefrom other insects. The overall similarity of haCPR to those from mam-mals (i. e. rats and humans) was approximately 55% (Table S1).

Alignment analysis revealed that haCPR shared many highly con-served amino acid residues with other CPR orthologs (Fig. 1). Severalof these residues were crucial for CPR activity in rats (Shen et al.,1989). For example, Tyr-149 (haCPR numbering) was necessary forFMN binding, and Thr-99, Tyr-187 and Asp-217 were essential for effi-cient electron transfer (Lamb et al., 2001; Shen et al., 1989). ResiduesSer-468, Cys-639, Asp-684, and Trp-686 formed the catalytic residues(active site) of the rat CPR (Hubbard et al., 2001; Shen et al., 1989).

The homology structure of haCPR modeled by SWISS-MODELdisplayed three distinct structural domains, i.e. FMN-binding domain,the connecting domain, and the FAD-/NADP-binding domains (Figs. 1and S2). Consistent with the structures of CPR from rats (Wang et al.,1997) and humans (Xia et al., 2011), the FMN domain, structurally sim-ilar to flavodoxins, was located at the N-terminus. The FAD/NADPH do-main was located at the C-terminus and structurally similar toferredoxin reductases. The connecting domain, situated between thetwo flavin domains, was thought to be responsible for bringing thetwo flavins together and also for modulating electron transfer betweenthe two flavins (Wang et al., 1997). A hinge region joining the FMN-binding domain to the connecting domain was also observed in thehaCPR, as reported in the rat CPR (Wang et al., 1997).

The haCPR gene spanned at least 11 kb (GenBank No. 1KF419216).Eleven introns were identified interrupting the coding region (Fig. 2).The length of introns in haCPR ranged from 86 to 6678 bp (Fig. S3). Incomparison with the exon–intron organization of CPR genes fromother insects (Figs. 2 and S3), haCPR showed a highly similar genomicstructure to that of B. mori CPR (bmCPR). Both haCPR and bmCPR had11 introns and, interestingly, they shared identical insertion phase, po-sition for each corresponding intron, and length for each correspondingexon. Notably, for all the insect CPRs under investigation, the last exon(145 bp) encoding FAD/NADPH binding domain region was found tobe highly conserved in length and sequence identity. However, thelength of introns differed considerably among these CPR genes.

3.2. Spatial and temporal patterns of CPR expression

The spatial and temporal patterns of haCPR expression were de-termined by RT-PCR, and the elongation factor-1α (EF-1α) wasused as a reference. Similar to EF-1α expression, haCPR mRNA wasdetected ubiquitously in various tissues including larva integumentand adult antennae, during all developmental stages (egg, larvae,pupae, and adults) (Fig. 3).

3.3. Heterologous expression of CPR and CYP9A14

Recombinant haCPR was expressed by fusing the bacterial pelB se-quence with haCPR. Translation initiated at the pelB ATG initiationcodon was expected to produce a precursor protein, and the fusedpelB leading sequence was proteolytically removedwhen the precursorproteinwas transported to the periplasmic space of E. coli cell (Pritchardet al., 2006). SDS-PAGE showed that the target haCPR protein (with anexpected protein band of 77.4 kDa) was present in the membrane frac-tion, but absent in the cytosolic fraction of cells transformedwith the re-combinant haCPR plasmid; this band was not observed in samplesprepared from cells transformed with the control plasmid (Fig. 4). Thecytochrome c reduction assay showed that the specific activity in themembrane fractionwas 6-fold higher than that in the corresponding cy-tosolic fraction of cells transformed with the haCPR recombinant plas-mid. In contrast, much lower activity was detected in the cytosolicfraction and no detectable activity was observed in themembrane frac-tion of cells transformed with the control plasmid. These results clearlyindicated that haCPRwas functionally expressed and localized primarilyin the membrane of E. coli cells (Table 2).

By applying 17α N-terminal modification strategy, a high yield ofhaCYP9A14 (700–900 nmol/L culture) was produced in E. coli as de-termined using whole cells. The membranes prepared from E. colicells expressing haCYP9A14 showed a typical CO difference spec-trum at 450 nm (Fig. 5). The content of haCYP19A14 in the mem-brane preparations was 0.67–1.51 nmol/mg protein.

3.4. Kinetics of recombinant haCPR

Kinetic studieswere conducted usingmembrane fractions as sourcesof enzymes. Results showed that haCPR obeyed Michaelis–Menten

Fig. 2. Exon–intron organization of nine insect CPR genes from six orders. Vertical lines indicate introns located at the same position. ●: phase-0 intron (splicing between codons),▲: phase-1 intron (splicing between the first and second nucleotides of a codon), ■: phase-2 intron (splicing between the second and third nucleotides of a codon). The CPR genomesequences of Aedes aegypti (Transcript ID: AAEL00349) and Pediculus humanus (Transcript ID: PHUM101680) are from VectorBase. Sequences for Tribolium castaneum (Transcript ID:XM966081.2) and Acyrthosiphon pisum (Transcript ID: XM001945227.2) are from GenBank. Sequences for Drosophila melanogaster (FlyBase ID: FBgn0015623) and Drosophila grimshawi(FlyBase ID: FBgn0118220) were from FlyBase. The genomic CPR sequence for Bombyx mori (Load ID: KBtr3006767) is obtained from the database of SGP (silkworm genome program).Sequence for Linepithema humile is from Hymenoptera Genome Database (Load ID: LH22946). Positions of conserved motifs of CPR are shown on the top. Human CPR (Transcript ID:NM00941.2) at the bottom is used as a reference.

267D. Liu et al. / Gene 545 (2014) 262–270

kinetics with respect to both cytochrome c and NADPH (Fig. 6). The Kmvalues for cytochrome c and NADPH were 19.35 ± 1.54 μM and 3.29 ±0.17 μM, respectively.

3.5. Alkoxyresorufin O-dealkylation (AROD) activity assay

To examine whether recombinant haCPR supports P450 mediat-ed metabolism, the O-dealkylation activities (AROD) were assayedusing a reconstituted CYP system. 7-Methoxyresorufin (MROD), 7-ethoxyresorufin (EROD), and 7-benzyloxyresorufin (BROD) were usedas substrates (Table 3). Chicken CYP1A5-haCPR and haCYP9A14-haCPRreconstituted systems showed AROD activities (Table 3), while no detect-able AROD activity was observed in the CPR alone, CYP alone, andNADPHminus controls.

3.6. CPR inhibition

Potential inhibitory effects of nine chemicals on CPR were investigat-ed. The nine chemicals included the classical flavoprotein inhibitor(DPI), fourmain allelochemicals in the host plants ofH. armigera (querce-tin, tannic acid, xanthotoxin, and gossypol), three insecticides (permeth-rin, deltamethrin, andDDT), and PBO (a P450 inhibitor commonly used asinsecticidal synergist). The results showed that four of the nine testedchemicals (quercetin, tannic acid, gossypol, and DPI) significantlyinhibited haCPR activity, while other chemicals had no significant inhibi-tory effect at a dose up to 50 μM (data not shown). The four inhibitorswere found to cause a concentration-dependent inhibition of cytochrome

Fig. 3. Spatial and temporal expression of haCPR detected by RT-PCR analysis. Egg; LMi: larva mtubules; FPu: female pupae; FAn: female adult antennae; FHe: female adult head; FTh: femaleMHe: male adult head; MTh: male adult thorax; MAb: male adult abdomen The elongation fac

c reduction catalyzed by the haCPR enzyme (Fig. 7). DPI showed thestrongest inhibitory effect among all the tested chemicals with IC50value of 1.69 μM. The IC50 values of the three allelochemicals on cyto-chrome c reduction activity ranged from 10.5 to 88.6 μM. It was also no-ticed that tannic acid and gossypol, neither DPI nor quercetin, coulddirectly reduce cytochrome c in the absence of either haCPR enzyme orNADPH.

4. Discussion

The haCPR gene was identified from the cotton bollworm in thisstudy. Sequence and structural alignments indicate that haCPR sharesa high similarity with the known CPRs from other species (Table S1,Figs. 1 and S2). However, the N-terminal hydrophobic domain responsi-ble for membrane anchor is diverse, possibly due to its involvement ininteraction with cytochrome P450 within each species (Muratalievet al., 2004).

A previous study showed that vertebrate CPR genes had highly con-served genomic structure (Zhou et al., 2010). By examining the intron–exon organization of the available insect CPRs, we found that althoughvarying intron amount (4–12) and intron size (49–19,124 bp) are presentamong the nine representative insect CPRs (Fig. 2, S3), high conservationin gene structure is evident. For instance, four introns (at positions 1, 3, 4,and 14) are conserved in all these sequences (and in human CPR) andthey share the same insertion position and the samephase (Fig. 2). Partic-ularly, the insertion phase of the last intron is identical, and the length ofthe last exon is exactly the same (145 bp), reflecting the evolutionary

idgut; LFa: larva fatbody; Lin: larva integument; LHe: larva head; LMt: larva malpighianadult thorax; FAb: female adult abdomen; MPu: male pupae; MAn: male adult antennae;tor-1α gene serves as a reference.

Fig. 4. SDS-PAGE profiles of different fractions isolated from E. coli cells, harboring recom-binant plasmid (with haCPR, lanes 1 and 3), harvested 24 h after IPTG induction and con-trol plasmid (without haCPR, lanes 2 and 4). The gel is stained with Coomassie Brilliant R-250. Lanes 1 and 2: membrane fractions; lanes 3 and 4: cytosolic fractions; The arrow in-dicates the expected band of CPR protein with a size of about 77.4 kDa. LaneM representsthe protein molecular weight of standard.

Fig. 5. Reduced CO-difference spectra of E. coli membranes expressing haCYP9A14.

268 D. Liu et al. / Gene 545 (2014) 262–270

constraint acting upon this exon. The genomic structure of insect CPRs ismore conserved between evolutionarily close species than distant spe-cies. For example, there are very similar genomic structures of CPRgenes from cotton bollworm and silkworm, and among the 12Drosophila(Figs. 2 and S3).Most of the observed variations in intron–exon orga-nization may be attributable to intron loss or gain. For example, onlythe four aforementioned conserved introns were identified in Triboliumcastaneum, and in five Drosophila species, which suggest that several in-trons may be lost in these species. It seems that haCPR has experiencedloss of two introns (at positions 7 and 12). The unique intron (at position9) observed in 7 Drosophila species implies that an event of intron gainhas occurred in the evolution of Drosophila CPRs.

CPR is amembrane-bound protein. Reliablemeasurement of CPR ac-tivity and reconstitutionwith CYP and/or cytochromeb5 require the useof its membrane-bound form. Heterologous expression of cloned insectCPRs has been achieved in E. coli (Andersen et al., 1994; Kaewpa et al.,2007; Lian et al., 2011; McLaughlin et al., 2008; Sarapusit et al., 2008)

Table 2The specific activity of cytochrome c reduction of recombinant haCPR.

Fractions Specific activitya

Vector control Cytosol 0.018 ± 0.001Membrane NDb

haCPR Cytosol 0.151 ± 0.007Membrane 1.054 ± 0.039

a The specific activity of cytochrome c reduction is determined using different fractionsisolated from the E. coli cells harboring control plasmid (pB508) and recombinant plasmid(pB508-CPR) for 24 h cultivation after IPTG induction. Values aremeans ± SE of three inde-pendent experiments with each determination in triplicate (μmol cytochrome c/min/mgprotein).

b ND = not detectable.

Fig. 6. Kinetic analysis of the recombinant haCPR. Substrate saturation of CPR withincreasing cytochrome c concentrations at 50 μM NADPH (A) and increasingNADPH concentrations at 50 μM cytochrome c (B). Velocities are expressed as micromolereduced cytochrome c produced per minute per microgram of membrane protein. Resultsare expressed as mean± SE from three independent experiments with each determinationin duplicate.

Table 3AROD activity of the enzymes recombinant CYP-CPR systema.

MROD EROD BROD

CYP9A14-haCPR 3.94 ± 0.16 2.63 ± 0.14 0.36 ± 0.04CYP1A5-haCPR 1.04 ± 0.09 1.02 ± 0.06 0.25 ± 0.03

a The alkoxyresorufin O-dealkylation (AROD) activity is determined using thereconstituted CYP–CPR system by combining membrane fractions isolated from theE. coli cells that expressed CYP9A14, CYP1A5 and CPR respectively. AROD activities includingMROD, EROD, and BROD are expressed as nmol resorufin per nmol P450 and per minute.Values are means ± SE of three independent experiments with each determination intriplicate.

269D. Liu et al. / Gene 545 (2014) 262–270

and in the baculovirus expression system (Wen et al., 2003). Our resultsdemonstrate that the active haCPR protein can be successfullyexpressed in E. coli by fusing the pelB signal peptide to the N-terminalof haCPR using pB54 as the vector. The E. coli produced haCPR is mainlylocalized in the membrane fraction (Table 2). This heterologouslyexpressed enzymehas the capacity to reduce cytochrome c, and transferreducing equivalent from NADPH to CYP of different origins, as evi-denced by the findings that both haCYP9A14/haCPR and chickenCYP1A5/haCPR catalyze NADPH-dependent AROD reactions (Table 3).Investigation of substrate specificity of CYPs could be accomplished byreconstitution of heterologously expressed P450 and CPR enzymesin vitro (Andersen et al., 1994; Kaewpa et al., 2007). Therefore, the avail-ability of thehaCPR enzymewill undoubtedly facilitate further function-al characterization of CYPs in this dreaded pest.

So far, kinetics studies of few insect CPRs have been conducted (seeFeyereisen, 2012). We used the recombinant haCPR in the membranefraction of E. coli cells to performapreliminary kinetic analysis. Our resultsshowed that the estimated Km values of haCPR for cytochrome c(Kmcytc = 19.35 ± 1.54 μM) and NADPH (KmNADPH = 3.29 ±0.17 μM) were higher than those of CPR from the mosquito [1.24 ±0.25/2.58 ± 0.28 μM (Kaewpa et al., 2007)], but similar to those of CPRsfrom chickens [21.9 ± 2.3/2.4 ± 0.3 μM (Zhou et al., 2010)] and rats

Fig. 7. Inhibitory effects of chemicals on the cytochrome c reduction activity of recombinant hadetermination in triplicates. IC50 (μM) represents the concentration exhibiting 50% inhibition o

[21.1 ± 2.5/6.4 ± 1.0 μM (Shen et al., 1989)]. In addition, the bindingaffinity of haCPR was similar for cytochrome c to that of A. gambiaeCPR (AgCPR, Kmcytc = 23 μM, Lian et al., 2011), while haCPR exhibitedmuch stronger affinity for NADPH than AgCPR (KmNADPH = 30 μM,Lian et al., 2011). Differences in protein structure and assay condi-tions may partly explain the variation in the reported kinetic param-eters among these CPRs. The Vmax of haCPR cannot be estimatedaccurately from the present set of data, as the protein used for theenzymatic assay was obtained from the membrane fraction, wherelots of other proteins were present (Fig. 4).

CPR is a vital component of P450 monooxygenase systems, there-fore, disruption or inhibition of CPR should affect the activities of micro-somal P450 enzymes. We compared the inhibitory effect of ninechemicals on haCPR in vitro and found that the flavoprotein specific in-hibitor (DPI) has potent inhibitory activity against haCPR, consistentwith the results of other studies (Doussiere and Vignais, 1992; Lianet al., 2011; Portal et al., 2008). Notably, haCPR (IC50 = 1.69 μM) ismuch more sensitive to DPI than AgCPR (IC50 = 28 μM, Lian et al.,2011). Our data (Fig. 7) also demonstrate that some secondarymetabo-lites existing in the host plants (e.g. tannic acid, quercetin and gossypol)ofH. armigera have a strong inhibitory effect on haCPR. Similarly, tannicacid is able to inhibit the CPR enzyme from rats and humans (Xia et al.,2011; Yao et al., 2008) and quercetin can reduce CPR activity in humanliver microsomes (Liu et al., 2006).

Conflict of interest

The authors declair there is no conflict of interest.

Acknowledgments

This workwas supported by grants from theNational Basic ResearchProgram of China (973 program, No. 2012CB114103) and the State Key

CPR. Each data point represents mean ± SE of three independent experiments with eachf the initial CPR activity and the 95% confidence interval of IC50 is given in bracket.

270 D. Liu et al. / Gene 545 (2014) 262–270

Laboratory of Integrated Management of Pest Insects and Rodents(Chinese IPM1201). The authors thank the reviewers for their helpfulsuggestions.

Appendix A. Supplementary data

Supplementary data to this article can be found online at http://dx.doi.org/10.1016/j.gene.2014.04.054.

References

Andersen, J.F., Utermohlen, J.G., Feyereisen, R., 1994. Expression of housefly CYP6A1 andNADPH–cytochrome P450 reductase in Escherichia coli and reconstitution of aninsecticide-metabolizing P450 system. Biochemistry 33, 2171–2177.

Barnes, H.J., Arlotto, M.P., Waterman, M.R., 1991. Expression and enzymatic activity of re-combinant cytochrome P450 17 alpha-hydroxylase in Escherichia coli. Proceedings ofthe National Academy of Sciences of the United States of America 88, 5597–5601.

Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgramquantities of protein utilizing the principle of protein–dye binding. Analytical Bio-chemistry 72, 248–254.

Capdevila, J., Morello, A., Perry, A.S., Agosin, M., 1973. Effect of phenobarbital and naphtha-lene on some of the components of the electron transport system and the hydroxylatingactivity of house fly microsomes. Biochemistry 12, 1445–1451.

Cheng, J., Wan, D.F., Gu, J.R., Gong, Y., Yang, S.L., Hao, D.C., Yang, L., 2006. Establishment ofa yeast system that stably expresses human cytochrome P450 reductase: applicationfor the study of drug metabolism of cytochrome P450s in vitro. Protein Expressionand Purification 47, 467–476.

d'Alencon, E., Sezutsu, H., Legeai, F., Permal, E., Bernard-Samain, S., Gimenez, S., Gagneur,C., Cousserans, F., Shimomura, M., Brun-Barale, A., 2010. Extensive synteny conserva-tion of holocentric chromosomes in Lepidoptera despite high rates of local genomerearrangements. Proceedings of the National Academy of Sciences of the UnitedStates of America 107, 7680–7685.

Doussiere, J., Vignais, P.V., 1992. Diphenylene iodonium as an inhibitor of the NADPH ox-idase complex of bovine neutrophils. European Journal of Biochemistry 208, 61–71.

Feng, R., Houseman, J.G., Downe, A., Atkinson, J., Arnason, J., 1992. Effects of 2, 4-dihydroxy-7-methoxy-1, 4-benzoxazin-3-one (DIMBOA) and 6-methoxybenzoxazolinone (MBOA)on the detoxification processes in the larval midgut of the European corn borer. Pesti-cide Biochemistry and Physiology 44, 147–154.

Feyereisen, R., 2012. Insect CYP genes and P450 enzymes. In: Gilbert, L.I. (Ed.), InsectMolecular Biology and Biochemistry. Elsevier B.V., London.

Fitt, G.P., 1989. The ecology of Heliothis species in relation to agroecosystems. AnnualReview of Entomology 34, 17–53.

Guex, N., Peitsch, M.C., 1997. SWISS‐MODEL and the Swiss‐Pdb Viewer: an environmentfor comparative protein modeling. Electrophoresis 18, 2714–2723.

Horike, N., Takemori, H., Nonaka, Y., Sonobe, H., Okamoto, M., 2000. Molecular cloning ofNADPH–cytochrome P450 oxidoreductase from silkworm eggs. European Journal ofBiochemistry 267, 6914–6920.

Hubbard, P.A., Shen, A.L., Paschke, R., Kasper, C.B., Kim, J.J.P., 2001. NADPH-cytochromeP450 oxidoreductase structural basis for hydride and electron transfer. Journal of Bi-ological Chemistry 276, 29163–29170.

Kaewpa, D., Boonsuepsakul, S., Rongnoparut, P., 2007. Functional expression of mosquitoNADPH–cytochrome P450 reductase in Escherichia coli. Journal of Economic Entomol-ogy 100, 946–953.

Koener, J., Carino, F., Feyereisen, R., 1993. The cDNA and deduced protein sequence ofhouse fly NADPH–cytochrome P450 reductase. Insect Biochemistry andMolecular Bi-ology 23, 439–447.

Lamb, D.C., Warrilow, A.G.S., Venkateswarlu, K., Kelly, D.E., Kelly, S.L., 2001. Activities andkinetic mechanisms of native and soluble NADPH–cytochrome P450 reductase.Biochemical and Biophysical Research Communications 286, 48–54.

Lian, L., Widdowson, P., McLaughlin, L.A., Paine, J.I., 2011. Biochemical comparison ofAnopheles gambiae and human NADPH P450 reductases reveals different 2′–5′ ADPand FMN binding traits. PLoS One 6 (5), e20574.

Liu, K., Kim, M., Jeon, B., Shon, J., Cha, I., Cho, K., Lee, S., Shin, J., 2006. Inhibition of humancytochrome P450 isoforms and NADPH–CYP reductase in vitro by 15 herbalmedicines, including Epimedii herba. Journal of Clinical Pharmacy and Therapeutics31, 83–91.

Louerat-Oriou, B., Perret, A., Pompon, D., 2001. Differential redox and electron-transferproperties of purified yeast, plant and human NADPH–cytochrome P-450 reductaseshighly modulate cytochrome P-450 activities. European Journal of Biochemistry 258,1040–1049.

Lycett, G.J., McLaughlin, L.A., Ranson, H., Hemingway, J., Kafatos, F.C., Loukeris, T.G., Paine,M.J.I., 2006. Anopheles gambiae P450 reductase is highly expressed in oenocytes and

in vivo knockdown increases permethrin susceptibility. Insect Molecular Biology15, 321–327.

Mayer, R.T., Jermyn, J.W., Burke, M.D., 1977. Methoxyresorufin as a substrate for the flu-orometric assay of insect microsomal O-dealkylase. Pesticide Biochemistry and Phys-iology 7, 349–354.

McLaughlin, L., Niazi, U., Bibby, J., David, J.P., Vontas, J., Hemingway, J., Ranson, H., Sutcliffe,M., Paine, M., 2008. Characterization of inhibitors and substrates of Anophelesgambiae CYP6Z2. Insect Molecular Biology 17, 125–135.

Murataliev, M.B., Feyereisen, R., Walker, F.A., 2004. Electron transfer by diflavin reductases.Biochimica et Biophysica Acta (BBA) - Proteins and Proteomics 1698, 1–26.

Omura, T., Sato, R., 1964. The carbon monoxide-binding pigment of liver microsomes. I.Evidence for its hemoprotein nature. The Journal of Biological Chemistry 239,2370–2378.

Paine, M.J.I., Ayivor, S., Munro, A., Tsan, P., Lian, L.Y., Roberts, G.C.K., Wolf, C.R., 2001. Roleof the conserved phenylalanine 181 of NADPH–cytochrome P450 oxidoreductase inFMN binding and catalytic activity. Biochemistry 40, 13439–13447.

Pillai, V.C., Mehvar, R., 2011. Inhibition of NADPH–cytochrome P450 reductase by tannicacid in rat liver microsomes and primary hepatocytes: methodological artifacts andapplication to ischemia–reperfusion injury. Journal of Pharmaceutical Sciences 100,3495–3505.

Portal, P., Villamil, S.F., Alonso, G.D., De Vas, M.G., Flawiá, M.M., Torres, H.N., Paveto, C.,2008. Multiple NADPH–cytochrome P450 reductases from Trypanosoma cruzi: sug-gested role on drug resistance. Molecular and Biochemical Parasitology 160, 42–51.

Pritchard, M.P., McLaughlin, L., Friedberg, T., 2006. Establishment of Functional HumanCytochrome P450 Monooxygenase Systems in Escherichia coli, Cytochrome P450Protocols. Springer pp. 19–29.

Riddick, D.S., Ding, X., Wolf, C.R., Porter, T.D., Pandey, A.V., Zhang, Q.-Y., Gu, J., Finn, R.D.,Ronseaux, S., McLaughlin, L.A., 2013. NADPH–cytochrome P450 oxidoreductase:roles in physiology, pharmacology, and toxicology. Drug Metabolism and Disposition41, 12–23.

Sandstrom, P., Welch, W.H., Blomquist, G.J., Tittiger, C., 2006. Functional expression of abark beetle cytochrome P450 that hydroxylates myrcene to ipsdienol. Insect Bio-chemistry and Molecular Biology 36, 835–845.

Sarapusit, S., Xia, C., Misra, I., Rongnoparut, P., Kim, J.-J.P., 2008. NADPH–cytochrome P450oxidoreductase from the mosquito Anopheles minimus: kinetic studies and the influ-ence of Leu86 and Leu219 on cofactor binding and protein stability. Archives of Bio-chemistry and Biophysics 477, 53–59.

Schonbrod, R.D., Terriere, L.C., 1971. Inhibition of housefly microsomal epoxidase by theeye pigment, xanthommatin. Pesticide Biochemistry and Physiology 1, 409–417.

Shen, A.L., Porter, T.D.,Wilson, T.E., Kasper, C.B., 1989. Structural analysis of the FMN bind-ing domain of NADPH–cytochrome P-450 oxidoreductase by site-directed mutagen-esis. The Journal of Biological Chemistry 264, 7584–7589.

Tang, T., Zhao, C., Feng, X., Liu, X., Qiu, L., 2012. Knockdown of several components of cy-tochrome P450 enzyme systems by RNA interference enhances the susceptibility ofHelicoverpa armigera to fenvalerate. Pest Management Science 68, 1501–1511.

Wang, M., Roberts, D.L., Paschke, R., Shea, T.M., Masters, B.S.S., Kim, J.J.P., 1997. Three-dimensional structure of NADPH–cytochrome P450 reductase: prototype for FMN-and FAD-containing enzymes. Proceedings of the National Academy of Sciences ofthe United States of America 94, 8411–8416.

Wen, Z., Pan, L., Berenbaum, M.R., Schuler, M.A., 2003. Metabolism of linear and angularfuranocoumarins by Papilio polyxenes CYP6B1 co-expressed with NADPH cytochromeP450 reductase. Insect Biochemistry and Molecular Biology 33, 937–947.

Wu, K., Gong, P., 1997. A new and practical artificial diet for the cotton bollworm. InsectScience 4, 277–282.

Xia, C., Panda, S.P., Marohnic, C.C., Martásek, P., Masters, B.S., Kim, J.-J.P., 2011. Structuralbasis for human NADPH–cytochrome P450 oxidoreductase deficiency. Proceedings ofthe National Academy of Sciences of the United States of America 108, 13486–13491.

Yang, J., An, J., Li, M., Hou, X., Qiu, X., 2013. Characterization of chicken cytochrome P4501A4 and 1A5: inter-paralog comparisons of substrate preference and inhibitor selec-tivity. Comparative Biochemistry and Physiology — Part C 157, 337–343.

Yao, H.-T., Chang, Y.-W., Lan, S.-J., Yeh, T.-K., 2008. The inhibitory effect of tannic acid oncytochrome P450 enzymes and NADPH–CYP reductase in rat and human liver micro-somes. Food and Chemical Toxicology 46, 645–653.

Zhou, X., Ma, C., Li, M., Sheng, C., Liu, H., Qiu, X., 2009. CYP9A12 and CYP9A17 in the cottonbollworm, Helicoverpa armigera: sequence similarity, expression profile and xenobi-otic response. Pest Management Science 66, 65–73.

Zhou, X., Li, M., Sheng, C., Qiu, X., 2010. NADPH–cytochrome P450 oxidoreductase fromthe chicken Gallus gallus: sequence characterization, functional expression and kinet-ic study. Comparative Biochemistry and Physiology — Part C 153, 53–59.

Zhu, F., Sams, S., Moural, T., Haynes, K.F., Potter, M.F., Palli, S.R., 2012. RNA interference ofNADPH–cytochrome P450 reductase results in reduced insecticide resistance in thebed bug, Cimex lectularius. PLoS One 7 (2), e31037.