©2001 Timothy G. Standish

Isaiah 40:4, 5 4 Every valley shall be exalted, and

every mountain and hill shall be made low: and the crooked shall be made straight, and the rough places plain:

5 And the glory of the LORD shall be revealed, and all flesh shall see it together: for the mouth of the LORD hath spoken it.

©2001 Timothy G. Standish

Getting MeaningGetting MeaningFromFrom

Molecular DataMolecular DataTimothy G. Standish, Ph. D.

©2001 Timothy G. Standish

What are Genes?What are Genes? The one-gene, one-enzyme hypothesis has

been refined to mean each gene codes for a polypeptide

Things get fuzzy when a specific locus codes for more than one polypeptide

For the purposes of this class, we will define genes as segments of DNA that are transcribed and associated regions that control their transcription

Genes may code for both polypeptides or RNAs

©2001 Timothy G. Standish

Determination of Gene NumbersDetermination of Gene Numbers DNA sequences are considered to be the gold

standard for determining the number of genes in an organism’s genome

The problem is that most organisms have un-sequenced genomes and, even when genomes are sequenced, deciding if a segment of DNA represents a region that is transcribed can frequently be difficult

Searching DNA for open reading frames seems to be the most logical way of finding genes, but just because an open reading frame exists does not definitively answer whether it is transcribed

©2001 Timothy G. Standish

Indirect EstimatesIndirect Estimates DNA hybridization etc.

©2001 Timothy G. Standish

Denaturation and RenaturationDenaturation and Renaturation Heating double-stranded DNA can overcome the

hydrogen bonds holding it together and cause the strands to separate resulting in denaturation of the DNA

When cooled relatively weak hydrogen bonds between bases can reform and the DNA renatures

TACTCGACATGCTAGCACATGAGCTGTACGATCGTG

Double-stranded DNA

TACTCGACATGCTAGCACATGAGCTGTACGATCGTG

Double-stranded DNA

Renaturation

TACTCGACATGCTAGCAC

ATGAGCTGTACGATCGTG

Denatured DNA

Denaturat

ion

Single-stranded DNA

©2001 Timothy G. Standish

Denaturation and RenaturationDenaturation and Renaturation DNA with a high guanine and cytosine content has

relatively more hydrogen bonds between strands This is because for every GC base pair 3 hydrogen bonds

are made while for AT base pairs only 2 bonds are made Thus higher GC content is reflected in higher melting or

denaturation temperature

Intermediate melting temperature

Low melting temperature High melting temperature67 % GC content -

TGCTCGACGTGCTCGACGAGCTGCACGAGC

33 % GC content -

TACTAGACATTCTAGATGATCTGTAAGATC

TACTCGACAGGCTAGATGAGCTGTCCGATC

50 % GC content -

©2001 Timothy G. Standish

Determination of GC ContentDetermination of GC Content Comparison of melting temperatures can be used to

determine the GC content of an organisms genome To do this it is necessary to be able to detect

whether DNA is melted or not Absorbance at 260 nm of DNA in solution provides

a means of determining how much is single stranded Single-stranded DNA absorbs 260 nm ultraviolet

light more strongly than double-stranded DNA does, although both absorb at this wavelength

Thus, increasing absorbance at 260 nm during heating indicates increasing concentration of single- stranded DNA

©2001 Timothy G. Standish

Determination of GC ContentDetermination of GC Content

OD260

0

1.0

65 70 75 80 85 90 95

Temperature (oC)

Tm = 85 oCTm = 75 oC

Double- stranded DNA

Single- stranded DNA

Relatively low GC content

Relatively high GC content

Tm is the temperature at which half the DNA is melted

©2001 Timothy G. Standish

GC Content Of Some GenomesGC Content Of Some Genomes

Phage T7 48.0 %

Organism % GC

Homo sapiens 39.7 %

Sheep 42.4 %

Hen 42.0 %

Turtle 43.3 %

Salmon 41.2 %

Sea urchin 35.0 %

E. coli 51.7 %

Staphylococcus aureus 50.0 %

Phage 55.8 %

©2001 Timothy G. Standish

HybridizationHybridization The bases in DNA will only pair in very specific ways, G with

C and A with T In short DNA sequences, imprecise base pairing will not be

tolerated Long sequences can tolerate some mispairing only if -G of

the majority of bases in a sequence exceeds the energy required to keep mispaired bases together

Because the source of any single strand of DNA is irrelevant, merely the sequence is important, DNA from different sources can form a double helix as long as their sequences are compatible

Thus, this phenomenon of base pairing of single-stranded DNA strands to form a double helix is called hybridization as it may be used to make hybrid DNA composed of strands which came from different sources

©2001 Timothy G. Standish

HybridizationHybridization

DNA from source “Y”

TACTCGACAGGCTAG

CTGATGGTCATGAGCTGTCCGATCGATCAT

DNA from source “X”

TACTCGACAGGCTAG

HybridizationHybridization

©2001 Timothy G. Standish

HybridizationHybridization Because DNA sequences will seek out and hybridize with

other sequences with which they base pair in a specific way much information can be gained about unknown DNA using single-stranded DNA of known sequence

Short sequences of single-stranded DNA can be used as “probes” to detect the presence of their complimentary sequence in any number of applications including:– Southern blots– Northern blots (in which RNA is probed)– In situ hybridization– Dot blots . . .

In addition, the renaturation or hybridization of DNA in solution can tell much about the nature of organism’s genomes

©2001 Timothy G. Standish

Reassociation KineticsReassociation Kinetics An organism’s DNA can be heated in solution

until it melts, then cooled to allow DNA strands to reassociate forming double-stranded DNA

This is typically done after shearing the DNA to form many fragments a few hundred bases in length

The larger and more complex an organisms genome is, the longer it will take for complimentary strands to bump into one another and hybridize

Reassociation follows second order kinetics

©2001 Timothy G. Standish

Reassociation KineticsReassociation Kinetics The following equation describes the second order

rate kinetics of DNA reassociation:

11 + kCot

=CCo

Concentration of single-stranded DNA after time t

Initial concentration of single-stranded DNA

Second order rate constant (the important thing is that it is a constant)

Co (measured in moles/liter) x t (seconds). Generally graphed on a log10 scale.

Cot1/2 is the point at which half the initial concentration of single- stranded DNA has annealed to form double-stranded DNA

©2001 Timothy G. Standish

Reassociation KineticsReassociation Kinetics

Fraction remaining single-stranded (C/Co)

0

0.5

10-4 10-3 10-2 10-1 1 101 102 103 104

Cot (mole x sec./l)

1.0Higher Cot1/2 values indicate greater genome complexityCot1/2

©2001 Timothy G. Standish

Reassociation KineticsReassociation Kinetics

0.5

Fraction remaining single-stranded (C/Co)

010-4 10-3 10-2 10-1 1 101 102 103 104

Cot (mole x sec./l)

1.0

Eukaryotic DNA

Prokaryotic DNA

Repetitive DNA Unique

sequence complex DNA

©2001 Timothy G. Standish

Repetitive DNARepetitive DNAOrganism % Repetitive DNA

Homo sapiens 21 %

Mouse 35 %

Calf 42 %

Drosophila 70 %

Wheat 42 %

Pea 52 %

Maize 60 %

Saccharomycetes cerevisiae 5 %

E. coli 0.3 %

©2001 Timothy G. Standish

The Globin Gene FamilyThe Globin Gene Family Globin genes code for the

protein portion of hemoglobin In adults, hemoglobin is made

up of an iron containing heme molecule surrounded by 4 globin proteins: 2 globins and 2 globins

During development, different globin genes are expressed which alter the oxygen affinity of embryonic and fetal hemoglobin

Fe

©2001 Timothy G. Standish

Model For Evolution Of The Model For Evolution Of The Globin Gene FamilyGlobin Gene Family

Ancestral

Globin geneDuplication

Duplication and Mutation

Chromosome 16 Chromosome 11

Transposition

Mutation

Duplication and Mutation

AdultEmbryo FetusEmbryo Fetus andAdult

Pseudogenes () resemble genes, but may lack introns and, along with other differences typically have stop codons that come soon after the start codons.

©2001 Timothy G. Standish