Date post: | 22-Dec-2015 |
Category: |
Documents |
Upload: | ashley-johnson |
View: | 216 times |
Download: | 1 times |
©2001 Timothy G. Standish
Isaiah 40:4, 5 4 Every valley shall be exalted, and
every mountain and hill shall be made low: and the crooked shall be made straight, and the rough places plain:
5 And the glory of the LORD shall be revealed, and all flesh shall see it together: for the mouth of the LORD hath spoken it.
©2001 Timothy G. Standish
Getting MeaningGetting MeaningFromFrom
Molecular DataMolecular DataTimothy G. Standish, Ph. D.
©2001 Timothy G. Standish
What are Genes?What are Genes? The one-gene, one-enzyme hypothesis has
been refined to mean each gene codes for a polypeptide
Things get fuzzy when a specific locus codes for more than one polypeptide
For the purposes of this class, we will define genes as segments of DNA that are transcribed and associated regions that control their transcription
Genes may code for both polypeptides or RNAs
©2001 Timothy G. Standish
Determination of Gene NumbersDetermination of Gene Numbers DNA sequences are considered to be the gold
standard for determining the number of genes in an organism’s genome
The problem is that most organisms have un-sequenced genomes and, even when genomes are sequenced, deciding if a segment of DNA represents a region that is transcribed can frequently be difficult
Searching DNA for open reading frames seems to be the most logical way of finding genes, but just because an open reading frame exists does not definitively answer whether it is transcribed
©2001 Timothy G. Standish
Indirect EstimatesIndirect Estimates DNA hybridization etc.
©2001 Timothy G. Standish
Denaturation and RenaturationDenaturation and Renaturation Heating double-stranded DNA can overcome the
hydrogen bonds holding it together and cause the strands to separate resulting in denaturation of the DNA
When cooled relatively weak hydrogen bonds between bases can reform and the DNA renatures
TACTCGACATGCTAGCACATGAGCTGTACGATCGTG
Double-stranded DNA
TACTCGACATGCTAGCACATGAGCTGTACGATCGTG
Double-stranded DNA
Renaturation
TACTCGACATGCTAGCAC
ATGAGCTGTACGATCGTG
Denatured DNA
Denaturat
ion
Single-stranded DNA
©2001 Timothy G. Standish
Denaturation and RenaturationDenaturation and Renaturation DNA with a high guanine and cytosine content has
relatively more hydrogen bonds between strands This is because for every GC base pair 3 hydrogen bonds
are made while for AT base pairs only 2 bonds are made Thus higher GC content is reflected in higher melting or
denaturation temperature
Intermediate melting temperature
Low melting temperature High melting temperature67 % GC content -
TGCTCGACGTGCTCGACGAGCTGCACGAGC
33 % GC content -
TACTAGACATTCTAGATGATCTGTAAGATC
TACTCGACAGGCTAGATGAGCTGTCCGATC
50 % GC content -
©2001 Timothy G. Standish
Determination of GC ContentDetermination of GC Content Comparison of melting temperatures can be used to
determine the GC content of an organisms genome To do this it is necessary to be able to detect
whether DNA is melted or not Absorbance at 260 nm of DNA in solution provides
a means of determining how much is single stranded Single-stranded DNA absorbs 260 nm ultraviolet
light more strongly than double-stranded DNA does, although both absorb at this wavelength
Thus, increasing absorbance at 260 nm during heating indicates increasing concentration of single- stranded DNA
©2001 Timothy G. Standish
Determination of GC ContentDetermination of GC Content
OD260
0
1.0
65 70 75 80 85 90 95
Temperature (oC)
Tm = 85 oCTm = 75 oC
Double- stranded DNA
Single- stranded DNA
Relatively low GC content
Relatively high GC content
Tm is the temperature at which half the DNA is melted
©2001 Timothy G. Standish
GC Content Of Some GenomesGC Content Of Some Genomes
Phage T7 48.0 %
Organism % GC
Homo sapiens 39.7 %
Sheep 42.4 %
Hen 42.0 %
Turtle 43.3 %
Salmon 41.2 %
Sea urchin 35.0 %
E. coli 51.7 %
Staphylococcus aureus 50.0 %
Phage 55.8 %
©2001 Timothy G. Standish
HybridizationHybridization The bases in DNA will only pair in very specific ways, G with
C and A with T In short DNA sequences, imprecise base pairing will not be
tolerated Long sequences can tolerate some mispairing only if -G of
the majority of bases in a sequence exceeds the energy required to keep mispaired bases together
Because the source of any single strand of DNA is irrelevant, merely the sequence is important, DNA from different sources can form a double helix as long as their sequences are compatible
Thus, this phenomenon of base pairing of single-stranded DNA strands to form a double helix is called hybridization as it may be used to make hybrid DNA composed of strands which came from different sources
©2001 Timothy G. Standish
HybridizationHybridization
DNA from source “Y”
TACTCGACAGGCTAG
CTGATGGTCATGAGCTGTCCGATCGATCAT
DNA from source “X”
TACTCGACAGGCTAG
HybridizationHybridization
©2001 Timothy G. Standish
HybridizationHybridization Because DNA sequences will seek out and hybridize with
other sequences with which they base pair in a specific way much information can be gained about unknown DNA using single-stranded DNA of known sequence
Short sequences of single-stranded DNA can be used as “probes” to detect the presence of their complimentary sequence in any number of applications including:– Southern blots– Northern blots (in which RNA is probed)– In situ hybridization– Dot blots . . .
In addition, the renaturation or hybridization of DNA in solution can tell much about the nature of organism’s genomes
©2001 Timothy G. Standish
Reassociation KineticsReassociation Kinetics An organism’s DNA can be heated in solution
until it melts, then cooled to allow DNA strands to reassociate forming double-stranded DNA
This is typically done after shearing the DNA to form many fragments a few hundred bases in length
The larger and more complex an organisms genome is, the longer it will take for complimentary strands to bump into one another and hybridize
Reassociation follows second order kinetics
©2001 Timothy G. Standish
Reassociation KineticsReassociation Kinetics The following equation describes the second order
rate kinetics of DNA reassociation:
11 + kCot
=CCo
Concentration of single-stranded DNA after time t
Initial concentration of single-stranded DNA
Second order rate constant (the important thing is that it is a constant)
Co (measured in moles/liter) x t (seconds). Generally graphed on a log10 scale.
Cot1/2 is the point at which half the initial concentration of single- stranded DNA has annealed to form double-stranded DNA
©2001 Timothy G. Standish
Reassociation KineticsReassociation Kinetics
Fraction remaining single-stranded (C/Co)
0
0.5
10-4 10-3 10-2 10-1 1 101 102 103 104
Cot (mole x sec./l)
1.0Higher Cot1/2 values indicate greater genome complexityCot1/2
©2001 Timothy G. Standish
Reassociation KineticsReassociation Kinetics
0.5
Fraction remaining single-stranded (C/Co)
010-4 10-3 10-2 10-1 1 101 102 103 104
Cot (mole x sec./l)
1.0
Eukaryotic DNA
Prokaryotic DNA
Repetitive DNA Unique
sequence complex DNA
©2001 Timothy G. Standish
Repetitive DNARepetitive DNAOrganism % Repetitive DNA
Homo sapiens 21 %
Mouse 35 %
Calf 42 %
Drosophila 70 %
Wheat 42 %
Pea 52 %
Maize 60 %
Saccharomycetes cerevisiae 5 %
E. coli 0.3 %
©2001 Timothy G. Standish
The Globin Gene FamilyThe Globin Gene Family Globin genes code for the
protein portion of hemoglobin In adults, hemoglobin is made
up of an iron containing heme molecule surrounded by 4 globin proteins: 2 globins and 2 globins
During development, different globin genes are expressed which alter the oxygen affinity of embryonic and fetal hemoglobin
Fe
©2001 Timothy G. Standish
Model For Evolution Of The Model For Evolution Of The Globin Gene FamilyGlobin Gene Family
Ancestral
Globin geneDuplication
Duplication and Mutation
Chromosome 16 Chromosome 11
Transposition
Mutation
Duplication and Mutation
AdultEmbryo FetusEmbryo Fetus andAdult
Pseudogenes () resemble genes, but may lack introns and, along with other differences typically have stop codons that come soon after the start codons.
©2001 Timothy G. Standish