1
THE ROLE OF ECTOPIC LYMPHOID TISSUE IN THE PATHOGENESIS OF HUMORAL AUTOIMMUNITY
By
JASON SCOTT WEINSTEIN
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2009
2
©2009 Jason Scott Weinstein
3
To my wife, who has always been there for me.
4
ACKNOWLEDGMENTS
I would like to acknowledge the following people that have helped shape me as a person
and scientist that I am today, without whom I would not have been able to accomplish the goals
and aspirations I had set forth for me.
I would like to thank my mentor Dr. Westley for continuing to inspire me to be a well
rounded scientist. He taught me to focus not only on the specifics of my projects but to
understand it in relation to the different facets of immunology. I want to thank my committee
members Drs. John Petitto, Minoru Satoh, and Eric Sobel for their thoughtful guidance and
always leaving their doors open to me throughout my graduate career. I would like to thank our
collaborators at the University of Florida, including Drs. Lyle Moldawer and Matt Delano for
giving me a chance to explore B cells in other avenues of inflammation. I also want to thank Dr.
Laurence Morel for her insightful discussions on lymphocytes.
I am grateful for the collaboration and camaraderie from member of the Reeves’s
laboratory. In particular I would like to thank Dina Nacionales who always unselfishly helped
me with experiments and provided a guiding force through any problems that arose in lab. Dr.
Pui Lee for teaching me about the “other side” of the immune response and participating in our
many scientific debates. Yi Li for allowing me to possess a sense of humor in lab. Tolga Barker
and Rob Lyons for joining me in the daily trenches of the lab. I also would like to thank Drs.
Kindra and Phil Scumpia for always being there and especially for their brutally honest opinions
about all of my scientific endeavors.
I would like to extend my appreciation to Dr. Theresa O’Keefe who provided a young
naïve undergrad with a role model of what a scientist should be. I want to thank all my friends in
the IDP program that helped me enjoy my time outside of lab. I especially want to thank my
wife Cara for all her support and understanding through the long days in lab. Lastly I would like
5
to thank my parents and siblings who without their conditional love I would have not made it this
far.
6
TABLE OF CONTENTS page
ACKNOWLEDGMENTS ...............................................................................................................4
LIST OF TABLES ...........................................................................................................................9
LIST OF FIGURES .......................................................................................................................10
LIST OF ABBREVATIONS .........................................................................................................11
ABSTRACT ...................................................................................................................................13
CHAPTER
1 INTRODUCTION ..................................................................................................................15
Chemical, Inflammatory, and Carcinogenic Properties of Hydrocarbon Oils ........................15 Adjuvant Properties of Hydrocarbon Oils .......................................................................15 Inflammatory Effects of Hydrocarbons in Humans ........................................................16 Autoantibodies and Other Humoral Immune Abnormalities in TMPD-Treated Mice ...16 Polyclonal Hypergammaglobulinemia ............................................................................17 Induction of Autoantibodies by TMPD ...........................................................................18 T Cell Requirement for Autoantibody Production in TMPD-Treated Mice ...................19 Effects of IL-6, IFNγ, IL-4, and Il-12 on Autoantibody Production ...............................19 Efficacy of Other Hydrocarbons at Inducing Autoantibodies .........................................20
Autoimmune Disease in TMPD-Treated Mice .......................................................................21 Immune Complex-Mediated Glomerulonephritis ...........................................................21 Relevance of TMPD-Induced Lupus to SLE ...................................................................23 Abnormal Production of IFN-I TMPD-Induced Lupus ...................................................24 Immature Monocytes are a Major Source of IFN-I in TMPD-Lupus .............................25 Mechanism of IFN-I Production in TMPD Lupus ..........................................................26
Lymphoid Neogenesis In TMPD Treated Mice .....................................................................29 Association of Lymphoid Neogenesis with Autoimmunity. ...........................................29 Pristane Induces Ectopic Lymphoid Tissue ....................................................................31 Antigen Specific B Cell Responses in TMPD-Induced Ectopic Lymphoid Tissue ........31 Anti-RNP Autoantibody Production in Ectopic Lymphoid Tissue .................................33
2 CO-LOCALIZATION OF ANTIGEN-SPECIFIC B AND T CELLS WITHIN ECTOPIC LYMPHOID TISSUE FOLLOWING IMMUNIZATION WITH EXOGENOUS ANTIGEN .....................................................................................................35
Introduction .............................................................................................................................35 Materials and Methods ...........................................................................................................37
Mice .................................................................................................................................37 Anti-4-hydroxy-3-nitrophenyl (NP) IgM and IgG ELISA ..............................................37 Bromodeoxyuridine (BrdU) Labeling of B and T Cells ..................................................38 Kappa/Lambda Light Chain Staining ..............................................................................38
7
Anti-4-Hydroxy-3-Nitrophenyl (NP) ELISPOT Assay ...................................................39 Variable Heavy Chain Gene Sequences ..........................................................................39 Transfer of Antigen-Specific T Cells ..............................................................................39 T Cell Proliferation Assay ...............................................................................................40 Polymerase Chain Reaction Analysis of T Cell Cytokines .............................................40
Results .....................................................................................................................................41 Antigen-Specific B Cell Responses in Ectopic Lymphoid Tissue ..................................41 Ovalbumin-Specific T Cells Localize and Expand in Ectopic Lymphoid Tissue ...........42 4-Hydroxy-3-Nitrophenyl NP-Specific B Cells and Anti-NP Antibody Production
in Ectopic Lymphoid Tissue ........................................................................................44 Heavy-Chain Sequences from Spleen and Ectopic Lymphoid Tissue of NP-KLH
Immunized Mice ..........................................................................................................44 Discussion ...............................................................................................................................46
3 B CELL PROLIFERATION, SOMATIC HYPERMUTATION, CLASS SWITCH RECOMBINATION, AND AUTOANTIBODY PRODUCTION IN ECTOPIC LYMPHOID TISSUE IN MURINE LUPUS .........................................................................57
Introduction .............................................................................................................................57 Materials and Methods ...........................................................................................................59
Mice .................................................................................................................................59 Immunohistochemistry and Immunofluorescence ..........................................................59 Bromodeoxyuridine (BrdU) Labeling of B and T Cells ..................................................60 Ki-67 Staining of B and T Cells ......................................................................................61 Real Time-PCR Analysis of Aid and Class Switched H-Chain Transcripts ...................61 Class Switch Recombination Assay ................................................................................62 Immunoglobulin V-D-J Sequence Analysis ....................................................................62 Enzyme Linked Immunosorbent Assay ...........................................................................63 Quantification of Plasmablasts ........................................................................................63 ELISPOT Assay for Total Immunoglobulin ...................................................................63 ELISPOT Assay for Anti-RNP Autoantibodies ..............................................................64
Results .....................................................................................................................................65 Lymphocyte Proliferation in TMPD-Induced Ectopic Lymphoid Tissue .......................65 Expression of AID and CSR in TMPD-Induced Ectopic Lymphoid Tissue ...................66 Individual Lipogranulomas from a Single Mouse Contain Different Populations of
B Cells ..........................................................................................................................67 Somatic Hyper Mutation in TMPD-Treated Mice is T Cell-Dependent. ........................69 Pristane-Induced Hypergammaglobulinemia and Autoantibody Production are also
T Cell Dependent .........................................................................................................70 Discussion ...............................................................................................................................73
4 MAINTENANCE OF ANTI-SM/RNP AUTOANTIBODY PRODUCTION IN EXPERIMENTAL LUPUS BY PLASMA CELLS RESIDING IN ECTOPIC LYMPHOID TISSUE AND MEMORY B CELLS RESIDING IN THE BONE MARROW ..............................................................................................................................87
Introduction .............................................................................................................................87
8
Methods and Materials ...........................................................................................................88 Mice .................................................................................................................................88 Lipogranuloma Transplantation ......................................................................................89 Flow Cytometry ...............................................................................................................89 Anti-U1A (RNP) ELISA .................................................................................................90 Detection of Autoantibodies by Immunoprecipitation ....................................................90 Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) ......................................90 Quantitative PCR .............................................................................................................91 ELISPOT Assay for Anti-RNP Autoantibody Secreting Cells .......................................91 Statistical Analysis. .........................................................................................................91
Results .....................................................................................................................................92 Discussion ...............................................................................................................................99
Ectopic Lymphoid Tissue is a Major Site of Autoantibody Production in TMPD-Lupus..........................................................................................................................101
Regulation of Autoantibody Production in Transplanted Ectopic Lymphoid Tissue ...101 Altered Bone Marrow Plasma Cell Homeostasis in TMPD-Treated Mice ...................103
5 FUTURE DIRECTIONS ......................................................................................................113
B Cells in the TMPD Model .................................................................................................113 T Cells in the TMPD Model .................................................................................................113 Bone Marrow in the TMPD Model ......................................................................................114 Conclusion ............................................................................................................................114
REFERENCES ............................................................................................................................117
BIOGRAPHICAL SKECTH .......................................................................................................133
9
LIST OF TABLES
Table page 2-1 V186.2 sequences from mice undergoing primary NP-KLH immunization .....................56
3-1 Somatic hypermutation of H-chains from ectopic lymphoid tissue ...................................85
3-2 Somatic hypermutation in ectopic lymphoid tissue from TcR deficient mice ...................86
10
LIST OF FIGURES
Figure page 2-1 Serum anti-NP response after immunization with NP-KLH. ............................................51
2-2 OVA-specific T cells in lipogranulomas. ..........................................................................52
2-3 Anti-NP B cells in ectopic lymphoid tissue. ......................................................................53
2 4 VH segment usage in lipogranulomas and spleen .............................................................54
2-5 Oligoclonal VH sequences from lipogranulomas of immunized mice. .............................55
2-6 CDR1 and CDR2 sequences from H-chains isolated from lipogranulomas.. ....................56
3-1 B and T cell proliferation in lipogranulomas. ....................................................................77
3-2 TMPD lipogranulomas contain class switched B cells. .....................................................78
3-3 Individual TMPD-induced lipogranulomas contain distinctive populations of B cells. ....80
3-4 VH sequences from TMPD-induced lipogranulomas. .......................................................81
3-5 IgG1 and IgG2a induced hypergammaglobulinemia in TMPD-treated mice is T cell dependent.. .........................................................................................................................82
3-6 Ig G anti-nRNP/Sm autoantibody production in TMPD-treated mice is T cell dependent. ..........................................................................................................................83
4-1 Transplanted lipogranuloma become vascularized. .........................................................105
4-2 Serum levels of anti-U1A antibodies in recipient mice. ..................................................106
4-3 Recipient T cells repopulate transplanted lipogranulomas ..............................................107
4-4 Anti-U1A antibodies are made exclusively from donor lipogranulomas. .......................108
4-5 Serum anti-U1A antibodies in transplanted mice persist after T cell depletion.. ............109
4-6 IgG anti-U1A antibody levels are decreased but not abolished after T cell depletion. ...110
4-7 TMPD treatment depletes plasma cells from the bone marrow. ......................................111
4-8 The effect of IFN-I on lymphocyte activation. ................................................................112
5-1 Lipogranulomas contain an increased IgM-IgD+ B cell population. ..............................115
5-2 TMPD drives an increase in CD11b+ cells in the bone marrow .....................................116
11
LIST OF ABBREVATIONS
AID Activation-induced cytidine deaminase
ANA antinuclear antibodies
BLC B lymphocyte chemoattractant
CSR Class switch recombination
DNA Deoxyribonucleic acid
dsDNA double-stranded DNA
ELC EBI1 ligand chemokine
FcγR Fcγ receptor
IFN interferon
IFN-I type-I interferons
IFNAR Interferon alpha receptor
IPS-1 interferon-β promoter stimulator-1
ISG Interferon stimulated gene
MCP monocyte chemoattractant protein
MyD88 myeloid differentiation factor 88
NZB/W (New Zealand Black X New Zealand White) F1
NP-KLH 4-hydroxy-3-nitrophenyl acetyl-conjugated keyhole limpet hemocyanin
OVA ovalbumin
PDCs Plasmacytoid dendritic cells
RA Rheumatoid arthritis
SHM somatic hypermutation
SLC secondary lymphoid-tissue chemokine
12
SLE systemic lupus erythematosus
snRNP small nuclear ribonucleoprotein
TCR T cell receptor
TMPD tetramethylpentadecane
TLR Toll-like receptor
TRIF TIR domain-containing adaptor inducing IFN-I
13
Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy
THE ROLE OF ECTOPIC LYMPHOID TISSUE IN THE PATHOGENISIS OF HUMORAL
AUTOIMMUNITY
By
Jason Scott Weinstein
May 2009
Chair: Westly Hubbard Reeves Major: Medical Sciences--Immunology and Microbiology
Intraperitoneal administration of tetramethylpecadentane (TMPD) causes chronic
inflammation that result in a lupus-like disease including autoantibody production and
lipogranuloma formation, a form of ectopic lymphoid tissue. Although ectopic lymphoid tissue
formation is associated with many humoral autoimmune diseases, it remains unclear whether this
tissue has a functional role in autoimmune responses. We examined whether an immune
response to NP-KLH develops within lipogranulomas. Following primary immunization, NP-
specific B cells bearing V186.2 and related heavy chains as well as lambda-light chains
accumulated within lipogranulomas. Remarkably, the H-chain sequences isolated from
individual lipogranulomas from these mice had unique oligoclonal populations of NP-specific B
cells. In mice adoptively transferred with transgenic CD4 T cells, there was a striking
accumulation of transgenic-specific T cells in lipogranulomas after immunization. The selective
co-localization of proliferating, antigen-specific T and B lymphocytes in lipogranulomas
undergoing primary immunization implicates ectopic lymphoid tissue as a site where antigen-
specific humoral immune responses can develop.
14
We demonstrated that lipogranulomas induced by TMPD not only resembles secondary
lymphoid tissue morphologically, but also displays characteristics of germinal center reactions.
Proliferating T and B lymphocytes, activation-induced cytidine deaminase expression, and class
switched B cells were present within lipogranulomas. Class-switched anti-RNP autoantibody
producing cells were also found in the lipogranulomas. Somatic hypermutation in the
lipogranulomas was T cell dependent, as was the production of isotype-switched anti-Sm/RNP
autoantibodies.
A novel transplantation model was developed to show that lipogranulomas not only
continues to retain its lymphoid cell components but also the ability to produce autoantibodies,
without further TMPD treatment of recipient mice. The donor derived anti-U1A IgG production
in recipient mice remains elevated for up to two months post transplant. We identified plasma
cells from transplanted lipogranulomas as the source of secreted autoantibodies in recipients,
even in the absence of CD4 T cells. Our model provides direct evidence that lipogranulomas are
not only capable of transplantable autoimmunity, but identifying long lived plasma cells within
ectopic lymphoid tissue as the cells responsible for autoantibody production. This has
implications for understanding the strong association of humoral autoimmunity with lymphoid
neogenesis, which may be associated with deficient censoring of autoreactive cells
15
CHAPTER 1 INTRODUCTION
Chemical, Inflammatory, and Carcinogenic Properties of Hydrocarbon Oils
Mineral oil is a byproduct of the fractional distillation of petroleum. It is a complex
mixture of straight- and branched-chain paraffinic, naphthenic, and aromatic hydrocarbons with
15 or more carbons and boiling points between 300-600° C. Medicinal (pharmaceutical or food
grade) mineral oils, which are free of aromatic and unsaturated compounds, are used widely as
laxatives, protective coatings for foods, and in cosmetics. Estimates of dietary exposure to
mineral oil in western countries range from 9-45 grams per year(1). Some of this is absorbed
through the intestine and can be detected in lymph nodes, spleen, liver, kidneys, and brain (2, 3)
In 1962, Potter and associates reported that mineral oil can induce plasmacytomas in BALB/c
mice when injected into the peritoneal cavity(4). Subsequently, it was found that the component
most potent in inducing plasmacytomas was pristane (2,6,10,14-tetramethylpentadecane, TMPD)
(5). The development of plasmacytomas following three intraperitoneal (i.p.) TMPD injections
requires 10 months or more, is highly strain dependent (the BALB/cAnPt substrain is particularly
susceptible), and requires IL-6 (6). The plasmacytomas arise from plasma cells found within
structures termed “lipogranulomas”, which represent a chronic inflammatory response to the
hydrocarbon oil. TMPD-induced plasmacytomas have been studied extensively as a model of
multiple myeloma(7). However, so far, there is little evidence that TMPD or other hydrocarbons
can induce plasma cell neoplasms in humans.
Adjuvant Properties of Hydrocarbon Oils
Hydrocarbons such as turpentine and certain alkanes have been used to study inflammatory
responses in experimental models (8-10). Some, such as the mineral oil Bayol F (Freund’s
adjuvant), squalene (MF59), and TMPD, have adjuvant effects. Straight chain hydrocarbons
16
(C15-20) can substitute for the mineral oil (a complex mixture of hydrocarbons) in Freund's
adjuvant, allowing induction of experimental autoimmune encephalomyelitis, whereas longer
and shorter carbon chains are ineffective(9). The optimum chain length for adjuvanticity is 12
carbons(11). Although the mechanism of this adjuvant effect is incompletely understood (12),
squalene is internalized by macrophages, which are transported to regional lymph nodes where
they undergo apoptosis and are engulfed by dendritic cells(12, 13). This may promote the T and
B cell activation seen in hydrocarbon-treated mice.
Inflammatory Effects of Hydrocarbons in Humans
Hydrocarbons are potent inducers of inflammation in humans as well as mice. Inadvertent
injection of hydrocarbon oils into the skin, even through a minute wound (e.g. grease gun or
paint spray gun injuries) leads to rapid subcutaneous spreading of the oil and an intense
inflammatory reaction usually resulting in swelling, pain, and edema within 6 hours and
followed by permanent loss of function(14). Similarly, the ingestion of mineral oil as a laxative
may lead to aspiration, resulting in a pulmonary inflammatory response known as “lipoid
pneumonia”(15, 16). This causes abnormalities on chest radiographs and the formation of
inflammatory lesions called lipogranulomas, which can be shown to contain mineral oil droplets
using oil red staining or other histopathological techniques. The mechanism(s) responsible for
this intense inflammatory response remain unknown.
Autoantibodies and Other Humoral Immune Abnormalities in TMPD-Treated Mice
It was noted as early as 1981 that BALB/c mice injected i.p. with TMPD into the
peritoneal cavity can develop an erosive arthritis resembling rheumatoid arthritis (RA)(17). In
1994, it was found that TMPD treatment induces autoantibodies associated with SLE along with
clinical manifestations of the disease, such as glomerulonephritis, arthritis, and pulmonary
hemorrhage(18). Susceptibility to TMPD-induced lupus among non-autoimmune prone mice is
17
widespread, although there are strain-to-strain differences in autoantibodies and clinical
manifestations(19). The autoantibodies induced by TMPD are primarily isotype switched IgGs
and include anti-double-stranded (ds) DNA, single-stranded (ss) DNA, chromatin, Sm, RNP, Su,
and ribosomal P, all of which are associated with SLE. TMPD treatment also leads to polyclonal
hypergammaglobulinemia, another common immunological feature of human SLE.
Polyclonal Hypergammaglobulinemia
One of effects of intraperitoneal exposure to TMPD is IL-6 production, which promotes
plasmacytoma development in BALB/cAnPt mice(6). IL-6 is a pleiotropic cytokine with effects
on T cells and the late phase of B cell development(20). In SLE patients, polyclonal
hypergammaglobulinemia may reflect both the over-expression of IL-6 receptors on B cells (21,
22) and increased IL-6 production(23). In the murine lupus model MRL/lpr, IL-6 is derived
from an expanded macrophage subset. IL-6 overproduction by atrial myxomas and in
Castleman’s disease, also is associated with hypergammaglobulinemia and autoimmunity (20,
24, 25).
In TMPD-induced lupus, one of the earliest abnormalities is a striking increase in total
serum IgM at ~ 2 weeks, which is followed by increased IgG1, IgG2a, and IgG2b (26, 27).
IgG2a is increased out of proportion to IgG1. Unexpectedly, IL-6 deficiency has relatively little
effect on IgM and IgG polyclonal hypergammaglobulinemia, suggesting that other factors may
contribute to hypergammaglobulinemia and/or compensate for the lack of IL-6(28). In contrast,
a substantial reduction in polyclonal IgG2a following TMPD treatment is seen in IFNγ -/- mice
and polyclonal IgG1 is reduced in IL-4 -/- mice(29). This is not surprising in view of the
dependence of IgG2a and IgG1 on IFNγ and IL-4, respectively. Thus, polyclonal
18
hypergammaglobulinemia induced by TMPD appears to be at least partially a response to
sustained cytokine production in response to the oil.
Induction of Autoantibodies by TMPD
In early studies of arthritis, TMPD was reported to induce autoantibodies against type II
collagen as well as low levels of rheumatoid factor. Subsequent studies indicated that
autoantibodies associated with SLE may be more prominent(18). Strikingly, the autoantibodies
induced by TMPD are highly restricted. Lupus autoantibodies commonly seen in TMPD-treated
mice include anti-Sm, RNP, dsDNA, chromatin, ribosomal P, and Su/argonaute 2. Interestingly,
although there are differences among strains, the autoantibody response in all strains tested so is
limited to combinations of anti-Sm/RNP, Su, ribosomal P, and/or DNA/chromatin. Other
specificities are unusual. Intraperitoneal injection of TMPD (in contrast to the induction of
plasmacytomas, only a single dose is necessary) induces an autoantibody response against the
RNP/Sm and Su autoantigens in 60-90% of BALB/c mice over 4-6 months and against dsDNA
at 6-10 months (18, 26). C57BL/6 and SJL mice injected with TMPD frequently develop anti-
ribosomal P autoantibodies, but have a lower rate of anti-RNP/Sm and anti-dsDNA autoantibody
induction(30). TMPD-induced lupus autoantibodies are primarily IgG2a isotype and their high
affinity allows for selective immunoprecipitation of target autoantigens from radiolabeled cell
extracts(18). The titers of anti-RNP and anti-Sm are as high as 1:106 or more(31). Incomplete
Freund’s adjuvant and squalene induce a similar spectrum of autoantibodies, but less efficiently
than TMPD(32). In contrast, medicinal mineral oil does not induce any of these
autoantibodies(33). The ability to induce autoantibodies is independent of exogenous infectious
agents, as germ-free mice produce the same spectrum of autoantibodies(34).
Autoantibodies against the U1, U2, U4-6, and U5 small nuclear ribonucleoproteins
(snRNPs) are strongly associated with SLE, and anti-Sm antibodies (recognizing the Sm core
19
proteins B’/B, D, E, F, and G, components of U1-U6 snRNPs) are used as a diagnostic marker.
Anti-nRNP antibodies, which are associated with lupus but less specific than anti-Sm, recognize
the U1-A, U1-C, and U1-70K components of U1 snRNPs. Anti- dsDNA antibodies and
autoantibodies against the ribosomal P0, P1, and P2 proteins, like anti-Sm, are specific for SLE.
The Su autoantigen is identical to the micro-RNA associated protein argonaute 2(35).
Autoantibodies against this antigen are associated with lupus, but also are seen in other systemic
autoimmune disorders(36).
T Cell Requirement for Autoantibody Production in TMPD-Treated Mice
The production of anti-Sm/RNP and other lupus autoantibodies requires T cells. IgG anti-
Sm/RNP autoantibodies do not develop in BALB/c nu/nu (nude) mice or T cell receptor deficient
(C57BL6 TcRß -/-, TcRδ -/-) mice following TMPD(37). Similarly, nude mice do not develop
TMPD-induced arthritis(38), but although the depletion of CD4+ T cells reduces the incidence of
arthritis, it has no effect on IgM rheumatoid factor(39). For IgG anti-Sm/RNP autoantibodies,
CD4+ T cells appear to be required continuously, and not just in the induction phase, since
depletion of CD4+ T cells from mice with established anti-Sm/RNP autoantibody production
leads to a significant decline in serum anti-Sm/RNP autoantibody levels (J Weinstein, et al.,
unpublished data).
Effects of IL-6, IFNγ, IL-4, and Il-12 on Autoantibody Production
Along with IFN-α/ß , IL-6, IFNγ, and IL-12 promote autoantibody production in TMPD-
treated mice. IL-6 deficiency abrogates the induction of IgG anti-ssDNA, anti-dsDNA, and anti-
chromatin autoantibodies by TMPD(28). Interestingly, the mild age-dependent increase in anti-
chromatin antibodies that develops in wild type mice also is abolished by IL-6 deficiency. In
contrast, induction of anti-nRNP/Sm and anti-Su autoantibodies is unaffected by IL-6 deficiency,
although their levels are lower consistent with the effect of IL-6 on plasma cell differentiation.
20
IFNγ deficient mice are resistant to the induction of IgG anti-chromatin autoantibodies by
TMPD, whereas the effect on anti-Sm/RNP and anti-Su is less clear(29). In some, but not all,
experiments, the frequency of these autoantibodies is reduced. However, there is little or no
effect on the levels of autoantibodies in those mice that develop anti-Sm/RNP or anti-Su
[(29)and J Weinstein, unpublished data]. Remarkably, although switching to IgG2a is IFNγ
dependent, anti-Sm/RNP autoantibodies induced in IFNγ -/- mice are primarily IgG2a, indicating
the existence of compensatory mechanisms. IFNα/ß signaling, which is essential for anti-
Sm/RNP and anti-Su autoantibodies (40), also promotes switching to IgG2a(41). There is
considerable cross-talk between the IFNα/ß, IFNγ, and IL-6 signaling pathways (42). Since
IFNα/ß deficient mice do not exhibit increased IL-12 levels following TMPD treatment(40), IL-
12 and IFNγ may be downstream of IFNα/ß signaling. This possibility is consistent with the fact
that although TMPD treatment profoundly increases IL-12 production, IL-12 deficiency has little
effect on autoantibody production(43). In contrast, IL-12 or IFNγ deficiency greatly diminishes
the severity of renal disease in TMPD-treated mice. In contrast to IL-6 and the interferons, IL-4
deficiency has no effect or perhaps a stimulatory effect on autoantibody production(29),
suggesting that it may play a suppressive role. NKT cells produce IL-4 (44, 45) and also have a
suppressive effect on autoantibody production(46).
Efficacy of Other Hydrocarbons at Inducing Autoantibodies
Other hydrocarbons besides TMPD can induce a similar spectrum of autoantibodies,
including hexadecane, squalene, and the adjuvant mineral oil Bayol F (Freund’s incomplete
adjuvant) (38, 47, 48). However, they are not as potent as TMPD. In contrast, medicinal
mineral oil does not stimulate the production of “lupus autoantibodies” such as anti-dsDNA,
anti-Sm/RNP, anti-Su, or anti-RNP, although antinuclear antibodies of other (non-disease
associated) specificities may develop(33). In general, a hydrocarbon’s ability to promote lupus
21
relates to its ability to act as an adjuvant (see above) and its ability to stimulate the release of
IFN-I producing cells from the bone marrow. Like TMPD, medicinal mineral oil promotes
ectopic lymphoid tissue formation in the peritoneum, making it a useful control for TMPD.
Autoimmune Disease in TMPD-Treated Mice
Besides developing serum autoantibodies closely resembling those in SLE patients, TMPD
treated mice develop clinical manifestations of lupus, including arthritis, immune complex-
mediated glomerulonephritis, and pulmonary capillaritis. Inflammation of the serosal surfaces,
including those of the heart (pericardium) and lungs (pleura) is present, but it is unclear whether
this is autoimmune or due to chemical inflammation from infiltration of the oil. SLE patients
develop similar manifestations along with other disease manifestations not seen in TMPD-treated
mice, such as cutaneous, hematological, and neurological manifestations. SLE is a syndrome
classified using a set of 11 criteria(49). TMPD-treated mice would fulfill the criteria used to
classify SLE in humans. In humans, the disease is primarily a disease of women (female to
male ratio ~ 9:1). The same is true in murine lupus induced by TMPD(50).
Immune Complex-Mediated Glomerulonephritis
TMPD injection leads to immune complex-mediated glomerulonephritis manifested by
glomerular IgG and complement associated with cellular proliferation and proteinuria in BALB/c
and SJL mice, whereas C57BL/6 mice develop glomerular immune deposits either without
proliferative changes/proteinuria or with milder glomerular changes (WHO Class II lesions) (26,
31, 51).
Immune-mediated renal injury can be the result of antibody deposition with complement
activation or the local release of proinflammatory cytokines from infiltrating or resident
cells(52). Local activation of the membrane attack complex (C5b-9) causes non-inflammatory
renal lesions distinct from the inflammatory lesions of lupus nephritis(52). In contrast, the
22
interaction of the immune complexes with FcγRI (CD64) or FcγRIII (CD16) on phagocytic cells
results in the production of production of proinflammatory cytokines(53). Significantly, renal
disease is abolished in (NZB X NZW)F1 (NZB/W) mice deficient in the common γ chain shared
by FcγRI and FcγRIII, although they still develop glomerular immune complexes(54).
TMPD-treated BALB/c and SJL mice develop mesangial immune complex deposits early
in the disease course, but later develop subendothelial lesions consistent with diffuse
proliferative lupus nephritis(26). Epithelial crescents, a manifestation that may be related to
IFNγ production, sometimes develop(55). Prominent mesangial expansion is frequent (26, 30).
IL-6 stimulates mesangial cell proliferation (56, 57) and IL-6 deficient mice are highly resistant
to the induction of renal disease by TMPD(28). Thus, IL-6 may play a direct or indirect role in
the pathogenesis of the immune complex-mediated glomerulonephritis. The proteinuria (often ≥
3+) and histopathological changes induced by TMPD in wild type BALB/c mice also are nearly
abolished by IFNγ deficiency. There is a reduction in glomerular immune complex deposition
(especially IgG2a and complement) in IFNγ -/- mice(28). In contrast, IL-4 deficiency has little
effect on renal disease in TMPD-treated mice. Not surprisingly, IL-12 p35 -/- mice also develop
only mild renal disease(43). Mice deficient in the type I interferon receptor (IFNAR -/-) have
greatly decreased proteinuria following TMPD treatment, although glomerular immune complex
deposition is unchanged(40). Interestingly, the numbers of infiltrating cells are similar to those
in untreated wild type controls, suggesting that the absence of IFNAR signaling diminishes the
recruitment of phagocytic cells, such as monocytes, into the renal glomeruli. These infiltrating
monocytes are thought to play a major role in the pathogenesis of lupus nephritis(58). As several
key chemokines involved in monocyte recruitment, notably CCL2 (MCP-1), are the products of
IFNα/ß-inducible (e.g. CCL2/MCP-1) and/or IFNγ-inducible (e.g. IP-10) genes, it is plausible
23
that decreased production of interferon-inducible chemokines by intrinsic glomerular cells in
response to immune complexes is partly responsible for the greatly diminished severity of renal
disease in IFNAR-/- or IFNγ -/- mice.
Relevance of TMPD-Induced Lupus to SLE
The TMPD model has been criticized by some as being not relevant to lupus, whereas the
NZB/W model is widely accepted as relevant. However, this view may be overly simplistic.
Animal models are useful if they reproduce all or some of the clinical features of a disease.
Unfortunately, SLE is not a disease but a syndrome defined clinically as a constellation of 4 or
more of 11 classification criteria(49). NZB/W mice meet three of these criteria:
glomerulonephritis, antinuclear antibodies (ANA), and anti-dsDNA antibodies. NZB mice
develop autoimmune hemolytic anemia but this is not a major feature in (NZB X NZW) F1 mice.
In contrast, TMPD treated BALB/c mice have less severe glomerulonephritis, with 3-4+
proteinuria and diffuse proliferative changes(26), late onset arthritis(17), a positive ANA, and a
more diverse spectrum of lupus associated autoantibodies, including anti-dsDNA and anti-
Sm(19). Thus, in terms of the lupus criteria(49), the TMPD-induced model is as good as or
better than the NZB/W model. There is evidence that both models are associated with
abnormalities of IFNα/ß production, a cytokine abnormality thought to contribute to SLE .
As SLE has a strong genetic component, the fact that NZB/W mice have genetically
mediated disease is an advantage. In contrast, TMPD induces lupus in BALB/c and other mice
that are not genetically prone to the disease. Thus, TMPD-lupus is not a good model for
spontaneous (genetic) lupus in humans. However, if one supposes that IFN-I over-production is
one of the key contributing factors to lupus, as suggested by the induction of lupus by IFNα
therapy in humans (59-61) or its exacerbation by IFNα in mice(62), the complexity of lupus
24
genetics takes on a new perspective. Complex signaling pathways regulate IFN production (see
below), raising the possibility that multiple genetic defects could promote IFN production and
the induction of SLE. TMPD lupus has the advantage that the role of these pathways can be
examined by gene targeting and gene expression techniques. TMPD induced lupus appears to be
a good model for lupus associated with high IFN production that may be more amenable than
NZB/W for defining the critical pathways involved in disease pathogenesis. Once the relevant
pathways are identified, studies of patients and mice with genetic forms of lupus may define
which of the multiple genes in these pathways contribute to disease. Neither the NZB/W nor the
TMPD model completely reproduces human SLE, but both are “relevant” in the sense that they
exhibit important similarities to SLE. Although the TMPD model is not appropriate for studying
the lupus genetics, it is well suited for examining the role of chronic inflammation and defining
pathways leading to lupus .
Abnormal Production of IFN-I TMPD-Induced Lupus
Initial evidence for excess IFN-I production in TMPD-treated mice arose in the analysis of
ectopic lymphoid tissue. In addition to the expression of chemokines relevant to lymphoid
neogenesis, ectopic lymphoid tissue induced by TMPD displays increased expression of many
ISGs including Mx-1, IRF7, ISG15, and IP-10(63). This pattern was not observed in ectopic
lymphoid tissue from mice treated with medicinal mineral oil, which does not induce lupus
autoantibodies or glomerulonephritis. Subsequently this IFN signature was identified in the
peripheral blood of TMPD-treated mice(40). Upregulation of ISGs was specifically induced by
IFN-I as deficiency of the IFNAR fully abrogated the IFN signature. Although IFN-I has been
implicated in spontaneous murine lupus (62, 64, 65), the TMPD model is the first shown to
recapitulate the IFN signature, which is found in more than half of SLE patients.
25
IFN-I has a profound effect on the pathogenesis of TMPD-induced lupus. In the absence
of IFN-I signaling (IFNAR -/- mice), the development of autoantibodies against dsDNA,
chromatin, ssDNA, chromatin, RNP/Sm, and Su is abolished(40). The lack of autoantibodies
was accompanied by a marked reduction in the severity of glomerulonephritis and proteinuria.
Similar findings were reported recently in mice deficient in IRF9 or STAT1, two key signaling
molecules downstream of IFNAR(66). This study further found that IgG antibodies against
ribosomal P and histones were dependent on intact IFN-I signaling. Curiously, TMPD-treated
IFNAR-/- mice still develop low titer ANA of unknown specificity(40). These IFN-I-
independent ANA may be analogous to the ANA in a subset of healthy humans who have neither
IFN-I dysregulation nor manifestations of lupus(67). It is also interesting that IFNAR-/- mice
develop glomerular immune complex deposits despite the absence of nephritis. Perhaps the
recruitment of inflammatory monocyte/macrophages mediated by IFN-I-inducible chemokines
(e.g. MCP-1) is an essential step in the development of lupus nephritis(68).
Although lipogranulomas and autoantibodies develop 3-4 months after TMPD injection,
IFN-I is an early event. IFN-I and ISGs are up-regulated in peritoneal exudate cells (PECs)
within two weeks of TMPD treatment(69). At this time, circulating B and T lymphocytes (in
C57BL/6 and 129/Sv strains) also display increased surface expression of the ISG stem cell
antigen-1 (Sca-1), consistent with a systemic increase in IFN-I(70). In contrast, these early
markers of IFN-I dysregulation are not observed in mice treated with mineral oil or squalene
Immature Monocytes are a Major Source of IFN-I in TMPD-Lupus
Analysis of the early inflammatory response to TMPD also shed light on the source of
IFN-I. Plasmacytoid dendritic cells (PDCs) are thought to be the primary source of IFN-I in
human lupus due to their ability to secrete the cytokine in response to viral infection and nucleic
acid-containing immune complexes (71-73). However, the role of these potent IFN-I producing
26
cells may be limited in the TMPD model as depletion of dendritic cells has no appreciable effect
on the expression of IFN-I or ISGs(69). Instead, inflammatory monocytes with intense surface
expression of Ly6C are a major source of IFN-I . Normally absent in the peritoneal cavity, Ly6hi
monocytes are attracted to the peritoneum by the chemokine MCP-1 (CCL2), and comprise
about 30% of PECs two weeks after TMPD injection. Their depletion by clodronate-containing
liposomes rapidly eliminates the IFN signature(69). These cells also persist in the ectopic
lymphoid tissue induced by TMPD. Ly6Chi monocytes do not accumulate in mice treated with
mineral oil or squalene. In contrast to TMPD-treatment, mineral oil treatment leads to an influx
of Ly6Chi monocytes into the peritoneal cavity followed by their rapid maturation into Ly6C-,
F4/80+ monocyte/macrophages with more abundant cytoplasm and prominent phagosomes(69).
These more mature monocytes are nearly absent in TMPD-treated mice. Mineral oil-treated
animals display neither the IFN signature nor significant autoantibody production. It is
noteworthy that other populations of peritoneal cells express lower levels of IFN-I, including
within the peritoneal cavity (e.g. mesothelial cells) is sufficient to induce the manifestations of
lupus remains to be determined.
Mechanism of IFN-I Production in TMPD Lupus
The mechanism(s) of IFN-I over-production in SLE is a topic of ongoing research.
Mammalian cells utilize several innate receptors to initiate IFN-I production in response to
pathogen-associated molecular patterns (PAMPs) found in different cellular compartments (74,
75) . Toll-like receptors (TLR)7 and -8, which recognize viral ssRNA, and TLR9, the innate
sensor for unmethylated CpG DNA, have received considerable attention due to their ability to
recognize endogenous nucleic acids(76-78). These endosomal TLRs trigger IFN-I secretion via
the adaptor myeloid differentiation factor-88 (MyD88)(79, 80). In contrast, TLR3 and TLR4
mediate IFN-I production through TIR domain-containing adaptor inducing IFNβ (TRIF) upon
27
encountering dsRNA or lipopolysaccharide, respectively(81). In the cytoplasm, viral RNA binds
to the RIG-like helicases (RLH) retinoic acid inducible gene-I (RIG-I) or melanoma
differentiation associated gene-5 (MDA-5) to trigger IFN-I activation via IFNβ promoter
stimulator-1 (IPS-1)(82-84), whereas cytoplasmic DNA activates a TANK-binding kinase-1
(TBK-1)-dependent pathway(85, 86).
Using mice deficient in components of these four major pathways of IFN-I production, it
can be shown that TMPD elicits IFN-I production and ISG upregulation exclusively through the
TLR7-MyD88 pathway(70). The accumulation of Ly6Chi monocytes and production of anti-
nRNP/Sm and anti-Su autoantibodies are abolished in the absence of MyD88 or TLR7. Similar
to their IFNAR-/- counterparts, TLR7-/- mice are protected from the development of
glomerulonephritis(87). Ly6Chi monocytes recruited to the peritoneal cavity express high levels
of TLR7, consistent with their role as major IFN-I producing cells. The effects of TMPD are
augmented further by TLR7 gene duplication in Y-linked autoimmune accelerated (Yaa) mutant
mice(70). Conversely, other TLRs and cytoplasmic nucleic acid sensors are dispensable for
IFN-I production in this model, as deficiency of TRIF, IPS-1, or TBK-1 has no effect on the
induction of lupus by TMPD.
It has been hypothesized that aberrant clearance of apoptotic or necrotic cells in SLE
results in the formation if immune complexes consisting of autoantibodies and RNA- or DNA-
containing autoantigens(88, 89). In vitro, Fcγ receptors (FcγR) on PDCs mediate the transport of
DNA- or RNA-containing immune complexes into endosomes, allowing the activation of
TLR7/8 or TLR9 by the internalized endogenous nucleic acids(90, 91). This hypothesis implies
that generation of lupus autoantibodies is a prerequisite to chronic IFN-I production. In TMPD-
lupus, however, the production of IFN-I occurs within 1-2 weeks, long before the appearance of
28
anti-dsDNA or anti-nRNP/Sm autoantibodies. Moreover, intact production of IFN-I and
autoantibodies in FcγR-deficient animals excludes a major role of immune complexes in the
initial generation of interferon responses(70, 92). Together with the absence of autoantibody
production in IFNAR-/- mice, these data indicate an upstream effect of IFN-I on autoantibody
production. This view is supported by the development of autoantibodies in patients following
therapeutic administration of recombinant IFNα(61). The dependence of lupus autoantibodies on
intact IFN-I signaling also has been shown in other lupus models(64, 65).
The exact mechanism of TMPD-induced TLR7 activation remains to be defined. The
chemical structure of TMPD is distinct from known TLR7 ligands and in vitro studies suggest
that TMPD is not a TLR7 ligand(70). Instead, pretreatment with TMPD enhances the
stimulatory effects of TLR7 ligands such as R848. This property is not observed with mineral
oil or squalene, consistent with the inability of these hydrocarbons to induce IFN-I in vivo. It is
possible that TMPD augments the response to endogenous TLR7 ligands such as the U1 RNA
component of the Sm/RNP antigen, although how these ligands gain access to endosomes in the
absence of immune complexes is unclear. Alternatively, the incorporation of TMPD into the cell
membrane may disturb the endosomal location of TLR7 and provide access to endogenous
ligands(93). TMPD also might interfere with the normal degradation of cellular debris,
increasing the availability of endogenous nucleic acids. Thus far these hypotheses are not
supported by in vitro data, as neither TLR7 localization nor cellular endocytosis/phagocytosis is
affected by TMPD treatment(70). Moreover, TMPD treatment does not seem to up-regulate
TLR7, as its expression (protein and mRNA) is unaffected. Interestingly, the ability of TMPD to
promote autoantibody production is dependent on intact Fas-Fas ligand signaling(94). Although
C57BL/6 (B6) mice are susceptible to TMPD-induced lupus, both B6-lpr/lpr and B6-gld/gld
29
mice are highly resistant. Although the mechanism of the protective effect remains uncertain, it
is possible that Fas-mediated apoptosis is involved in the generation of endogenous TLR7
ligands responsible for the chronic IFN-I production characteristic of TMPD-lupus. Further
studies are needed to better define both the mechanism of TLR7 activation and the role of Fas-
Fas ligand interactions in this model.
In summary, TMPD-induced lupus uniquely recapitulates the “interferon signature” seen in
more than half of lupus patients. IFN-I is essential to disease development and is elicited
through a TLR7 and MyD88-dependent, but FcγR-independent pathway. These recent advances
in understanding the etiology of lupus in TMPD-treated mice place this inducible lupus model in
a new light. Although not suitable for genetic studies of SLE, the inducible nature of TMPD-
induced lupus offers an advantage over the genetic models as it allows temporal assessment of
upstream and downstream effects of IFN-I dysregulation. In addition to the potential for
yielding valuable new insights into the pathogenesis of SLE, this model is well adapted to
examining the efficacy of therapies targeting components of the TLR7/MyD88/IFN-I pathway.
Lymphoid Neogenesis In TMPD Treated Mice
Association of Lymphoid Neogenesis with Autoimmunity.
Lymphoid neogenesis, defined as the formation of ectopic lymphoid tissue at sites of
inflammation(95), is strongly associated with autoantibody production(96). Ectopic lymphoid
tissue bears a close resemblance to lymph nodes and other secondary lymphoid tissue and arises
by a similar developmental pathway(97). A frequent characteristic of ectopic lymphoid tissue is
the compartmentalization of B lymphocytes and T lymphocytes/dendritic cells into discrete B-
cell and T-cell areas comparable to those in secondary lymphoid tissue. The T cell areas are
vascularized by specialized high endothelial venules (HEV) allowing cells to migrate into the
tissue(98). HEV also express chemokines, enzymes, and scaffolding proteins essential for the
30
function of lymphoid tissue (87, 96, 98-100). In particular, the lymphoid chemokines CC-
chemokine ligand 19 (CCL19, ELC), CCL21 (SLC), CXC-chemokine ligand 12 (CXCL12,
CXCL12), and CXCL13 (BLC) play an important role in lymphocyte homing and
compartmentalization in lymphoid tissue(101-104). It is not fully understood how ectopic
lymphoid tissue is derived. One hypothesis is that during chronic inflammation there is
constitutive chemokine/cytokine expression that promotes the formation of lymphoid tissue,
sometimes exhibiting well-formed B cell follicles and germinal centers(105).
Ectopic lymphoid tissue forms when the immune response fails to eliminate certain
pathogens, such as hepatitis C (106) or Helicobacter pylori(107). It also is common in
autoimmune diseases such as autoimmune (Hashimoto’s) thyroiditis (autoantibodies against
thyroid peroxidase and thyroglobulin), Sjogren’s syndrome (anti-Ro/La autoantibodies), and RA
(autoantibodies against citrullinated proteins and rheumatoid factor)(108-111).
An important issue is whether ectopic lymphoid tissue is a site of class switching, somatic
hypermutation, and/or the generation of autoantibody secreting plasma cells. Lymphocytic foci
in rheumatoid synovium contain restricted κ-light chain rearrangements and there is evidence of
extensive somatic hypermutation(110, 112). Ectopic lymphoid tissue could represent a milieu
deficient in the censoring mechanisms that remove self-reactive B cells arising during the
germinal center reaction(113). B cells specific for Ro/La antigens can be detected in the salivary
glands of patients with Sjogren’s syndrome, rheumatoid factor specific B cells in rheumatoid
synovium(111, 114), and anti-nRNP specific B cells in ectopic lymphoid tissue in TMPD lupus.
IFN-I produced in ectopic lymphoid tissue (40) may play a role in autoantibody production,
since IFNα/β and IL-6 act sequentially to generate plasma cells, with IFNα/β generating non-Ig-
secreting plasma blasts and IL-6 promoting their differentiation into Ig-secreting plasma
31
cells(115). Although it was previously assumed that autoantibody production is maintained by
the continuous activation of autoreactive T and B cells and generation of short-lived plasma
cells, it is now apparent that a subset of plasma cells can survive in the bone marrow for
years(116). These long-lived plasma cells maintain antibody levels after immunization and
depend on survival factors produced by bone marrow stromal cells, including IL-6, IL-5, TNFα,
BAFF, CXCL12 (SDF-1), and CD44 ligands(116). Importantly, many (40%) of the
autoantibody secreting plasma cells in NZB/W lupus mice are long-lived(117).
Pristane Induces Ectopic Lymphoid Tissue
Ectopic lymphoid tissue forms in the peritoneum of mice treated with TMPD and this
chronic inflammatory tissue is a site of substantial IFN-I production (40) . The chronic
inflammatory response to TMPD was originally described as “lipogranuloma” formation(118,
119). However, lipogranulomas are not true granulomas, but rather are more akin to secondary
lymphoid tissue morphologically, since they contain B- and T-cell/dendritic cell zones as well as
blood vessels expressing peripheral lymph node addressin (PNAd), a high endothelial venule
marker (31). Expression of the lymphoid chemokines CXCL13 (BLC), CCL19 (ELC), and
CCL21 (SLC) is found within the lipogranulomas (31).
Antigen Specific B Cell Responses in TMPD-Induced Ectopic Lymphoid Tissue
Although associated with humoral autoimmunity, it is not known whether antibody
responses develop within ectopic lymphoid tissue or if B cells only secondarily migrate there.
The formation of lipogranulomas affords an opportunity to explore this question. Following
primary immunization with NP-KLH, NP-specific B cells bearing V186.2 and related heavy
chains as well as λ-light chains accumulate within the lipogranulomas(120). The number of anti-
NP secreting B cells in the lipogranuloma is greatly enhanced by immunization with NP-KLH.
In contrast to the relatively diverse heavy chain sequences found in individual lipogranulomas
32
from unimmunized mice, immunoglobulin heavy-chain sequences from individual
lipogranulomas isolated 12 days after primary immunization are derived from unique oligo- or
monoclonal populations of NP-specific B cells. Heavy-chain complementarity determining
region sequences recovered from lipogranulomas have numerous replacement mutations,
suggesting that they are a site of ongoing antigen-driven and T cell-mediated immune responses.
Consistent with that possibility, lipogranulomas from TMPD-treated mice adoptively transferred
with OT-II or DO11.10 (ovalbumin-specific) transgenic T cells accumulate transgenic T cells
after subcutaneous immunization with OVA. The selective co-localization of proliferating,
antigen-specific T and B lymphocytes in lipogranulomas during primary immunization
implicates ectopic lymphoid tissue as a site where antigen-specific cognate T-B cell interaction
may occur(120).
Germinal centers are the morphological feature most closely associated with T cell
dependent expansion of antigen-specific B cells(121). The germinal center reaction regulates
antigen-specific clonal evolution during the development of the humoral response.
Lipogranulomas display many characteristics of germinal center reactions such as proliferating T
and B lymphocytes, activation-induced cytidine deaminase (AID) expression, and the presence
of class switched B cells(37). Circular DNA intermediates, a hallmark of active class switch
recombination, are found in the lipogranulomas, suggesting that class switching occurs locally.
After immunization with exogenous antigen, T cells from the lipogranulomas secrete IL-21,
which has been shown to play a role in plasma cell differentiation and class switching(122).
Analysis of immunoglobulin heavy and light chain gene sequences from different
lipogranulomas of the same mouse revealed that after primary immunization with an exogenous
test antigen (NP-KLH or NP-OVA), each lipogranuloma contains a unique and, in general
33
oligoclonal or monoclonal, B cell repertoire, consistent with local clonal expansion(120).
Moreover, antigen-specific DO11.10 transgenic T cells accumulate in the lipogranulomas after
NP-OVA immunization(120), suggesting that the ectopic lymphoid tissue is a site of cognate T
cell-B cell interactions.
Anti-RNP Autoantibody Production in Ectopic Lymphoid Tissue
The striking association between ectopic lymphoid tissue formation, autoimmunity, and B
cell neoplasia in Sjogren’s syndrome, RA, hepatitis C and H. pylori infection (96) raises the
question of what role the lipogranulomas play in TMPD-induced lupus. Both IgM and IgG
antibody forming cells (AFCs) producing autoantibodies to recombinant U1-A protein, a
component of U1 snRNPs, are found at a higher frequency in the ectopic lymphoid tissue of
TMPD-treated mice than in the spleen(37). The presence of IgM anti-U1-A AFCs in the ectopic
lymphoid tissue suggests that, consistent with the data in the immunization model(120),
lipogranulomas may be a site where autoantibody producing B cells become activated.
Moreover, the prominence of IgG anti-U1-A secreting cells and the absence of anti-Sm/RNP
responses in TMPD-treated BALB/c nu/nu (nude) mice (123) or T cell receptor deficient
(C57BL6 TcRß -/-, TcRδ -/-) mice (37) raises the possibility that post-germinal center B cells
(memory B cells) specific for U1-A might be stimulated to undergo plasma cell differentiation
within the lipogranulomas, either by autoantigen specific T cells or independently of T cells
through the engagement of Toll-like receptors (123). Indeed, the Sm/RNP antigens are
associated with U1, U2, U4-U6, and/or U5 small RNAs , which are endogenous TLR 7 ligands
(43), suggesting that the autoantibody production might be driven by TLR7 signaling. However,
stimulation of TLR7 by endogenous TLR7 ligands in TMPD-induced ectopic lymphoid tissue
appears to be insufficient to stimulate IgM or IgG anti-Sm/RNP autoantibody production T cell
receptor deficient mice. Another possibility is that the IgG anti-U1-A AFCs represent long-lived
34
plasma cells, which accumulate at sites of chronic inflammation, such as the nephritic kidneys
and spleens of NZB/W mice (25, 26). However, the relative paucity of CD138+ cells in the
lipogranulomas vs. spleen of TMPD-treated mice (37)and the fact that the number of anti-U1-A
AFCs can be suppressed by administering cytotoxic anti-CD4 antibodies to TMPD-treated mice
(J Weinstein, et al., unpublished data) may argue in favor of a model involving the activation of
anti-U1-A memory B cells.
Lupus induced by hydrocarbons such as TMPD is a valuable model of human SLE
associated with the over-expression of IFN-I. The pathogenesis of lupus autoantibodies (anti-
DNA, anti-Sm/RNP, and others) and glomerulonephritis in this model is strictly dependent on
signaling through the IFNAR. Most of the interferon is produced by immature monocytes
instead of PDCs, and its production is mediated exclusively by the TLR7-MyD88 pathway. It is
likely that endogenous TLR7 ligands such as U1 RNA are involved, as germ-free mice remain
susceptible to disease induction. However, immune complex uptake via Fc receptors is
dispensable. Autoantibody production is concentrated in ectopic lymphoid tissue found in the
peritoneum following TMPD treatment. In many respects, this chronic inflammatory tissue
mimics secondary lymphoid tissue, and most data so far suggest that cognate T-B interactions
take place within the ectopic lymphoid tissue. However, the precise nature of the inciting TLR
ligand(s), how they are generated, and the mechanisms responsible for the escape of autoreactive
B cells from censoring mechanisms remain areas of active investigation. In light of the strong
association between lymphoid neogenesis and humoral autoimmunity, elucidating the
mechanisms of lupus induction in TMPD treated mice may have broader implications for the
pathogenesis of other autoimmune disorders, including RA, Sjogren’s syndrome, myasthenia
gravis, and chronic hepatitis C-induced autoimmune syndromes, such as mixed cryoglobulinemia
35
CHAPTER 21 CO-LOCALIZATION OF ANTIGEN-SPECIFIC B AND T CELLS WITHIN ECTOPIC
LYMPHOID TISSUE FOLLOWING IMMUNIZATION WITH EXOGENOUS ANTIGEN
Introduction
Lymphoid neogenesis, the formation of ectopic (tertiary) lymphoid tissue in response to
inflammation (95, 105), is associated with the production of autoantibodies in several diseases
including Sjogren’s syndrome, rheumatoid arthritis, and myasthenia gravis (96). Whether
ectopic lymphoid tissue participates directly in generating autoreactive B cells (e.g. by allowing
the autoreactive cells to escape self-tolerance) or indirectly as a site where mature antibody-
secreting cells can persist(124) is unknown. Intraperitoneal injection of non-autoimmune-prone
mice such as BALB/c with the hydrocarbon oil 2, 6, 10, 14-tetramethylpentadecane (TMPD)
triggers the formation of ectopic lymphoid tissue (“lipogranulomas”) and the development of
lupus-like autoimmune disease with autoantibodies against small nuclear ribonucleoproteins
(snRNPs) and dsDNA, immune complex-mediated glomerulonephritis, arthritis, and
vasculitis(18, 26, 63). Within the ectopic lymphoid tissue induced by TMPD are CD11c+
dendritic cells (DCs) expressing the co-stimulatory molecule CD86. Expression of the lymphoid
chemokines CXCL13 (BLC), CCL19 (ELC), and CCL21 (SLC) is likely to play a role in the
accumulation of B cells, T cells, and DCs in TMPD-induced tertiary lymphoid tissue (125).
Although individual TMPD-induced lipogranulomas bear some resemblance histologically to
germinal centers, there are differences, including the absence of peanut agglutinin+ B cells and
FDC-M1+ follicular dendritic cells(126). Nevertheless, proliferating (Ki-67+) lymphocytes can
be demonstrated in these structures. Moreover, the B cells bear somatically mutated and isotype-
1 Reprinted with permission from The Association of American Immunologists, Inc. Copyright 2008 Weinstein JS et. al.. Colocalization of Antigen-Specific B and T Cells Within Ectopic Lymphoid Tissue Following Immunization With Exogenous Antigen. J Immunol. 2008 Sep 1;181(5):3259-67.
36
switched immunoglobulin heavy chains, suggesting that lipogranulomas may support antigen-
specific immune responses and may be a location where tolerance to autoantigens can be
overcome.
The germinal center reaction regulates antigen-specific clonal evolution during the
development of B cell memory (126). B cells in newly formed germinal centers may be
oligoclonal (127), whereas those in TMPD-induced lipogranulomas are usually more diverse (D.
Nacionales, et al., Submitted). The existence in TMPD-treated mice of occasional
lipogranulomas containing oligoclonal B cells is currently unexplained.
Previous studies have shown that following immunization with NP-KLH, two anatomically
and phenotypically distinct populations of antibody-forming cells arise in the spleen. As early as
2 days after immunization, primary foci consisting of antigen-binding B cells are seen along the
periphery of the periarteriolar lymphoid sheaths (128). Initially these foci expand, but by day 14,
they disappear, giving rise to a second responding population in the follicle, germinal center B
cells, which appear on day 8-10 and persist at least until day 30 post- immunization. The
primary foci are sites of interclonal competition for antigen among unmutated B cells, whereas
germinal centers are sites of intraclonal competition between mutated sister lymphocytes (128)
as well as interclonal competition between pre-existing germinal center B cells and follicular
“visitors” that can join the germinal center reaction if they have a sufficiently high antigen-
binding affinity (129).
In the present study, we analyzed antigen-specific B and T cells in TMPD-induced ectopic
lymphoid tissue at 12 days after primary subcutaneous immunization with a test antigen, NP-
KLH. We show that oligoclonal populations of NP-specific B cells develop in TMPD-induced
ectopic lymphoid tissue and may displace or overgrow more diverse populations of non-NP
37
specific B cells present prior to immunization. Along with the hapten-specific B cells, the
TMPD-induced lipogranulomas contain carrier-specific T cells, strongly suggesting that ectopic
lymphoid tissue can participate directly in the generation of antigen-specific B cell responses.
Materials and Methods
Mice
Six-week-old female C57BL/6, BALBC/J, T cell transgenic C.Cg-Tg(DO11.10)10Dlo/J
(DO11.10), and C57BL/6-Tg(TcraTcrb)425Cbn/J (OT-II) mice were purchased from Jackson
Laboratory (Bar Harbor, ME) and housed in barrier cages. At 2 months of age, C57BL/6 and
DO11.10 mice received 0.5 ml of 2, 6, 10, 14 tetramethylpentadecane (TMPD, Sigma-Aldrich,
St. Louis, MO) i.p. or left untreated. Three months later, the mice were injected subcutaneously
in the lower abdomen with 100 µg of 4-hydroxy-3-nitrophenyl acetyl (NP)17-19-conjugated
keyhole limpet hemocyanin (KLH) (NP-KLH, Biosearch Technologies, Novato, CA)
precipitated in alum (Pierce, Rockford, IL). Lipogranulomas, spleen, and blood were harvested 4
to12 days later. These studies were approved by the Institutional Animal Care and Use
Committee.
Anti-4-hydroxy-3-nitrophenyl (NP) IgM and IgG ELISA
Pre-immune sera and sera obtained at the time of euthanasia were tested for IgM and IgG
anti-NP antibodies (ELISA). Microtiter plates were coated with NP19-, NP30-, or NP3-
conjugated BSA (Biosearch Technologies). Serially diluted serum samples were added for 1
hour at room temperature. Anti-NP IgM and IgG antibodies were detected using alkaline
phosphatase conjugated goat anti-mouse IgM or IgG antibodies (1:1000 dilution, Southern
Biotechnology, Birmingham, AL) followed by phosphatase substrate (Sigma-Aldrich). Optical
density was converted to concentration based on standard curves with sera from C57BL/6 mice
38
immunized with NP-KLH using a four-parameter logistic equation (Softmax Pro 3.1 software,
Molecular Devices Corporation, Sunnyvale, CA).
Bromodeoxyuridine (BrdU) Labeling of B and T Cells
BrdU was administered to BALB/cJ mice (0.2 mg BrdU i.p. every 4 hours for 3 doses)
and again one day before euthanasia. Single cell suspensions of lipogranuloma or spleen tissue
were made by collagenase treatment (95). The isolated cells were incubated with APC-
conjugated anti-BrdU antibodies plus anti-CD3-FITC and anti-CD19-PE antibodies (BD
Biosciences) and analyzed by flow cytometry. Isotype controls were employed to evaluate
background fluorescence. Isolated lipogranuloma cells were washed in staining buffer (PBS
supplemented with 0.1% NaN3 and 1% bovine serum albumin) and pre-incubated for 20 minutes
with 1 µg of anti-CD16 (BD Biosciences) and 0.5 µl rat serum (Sigma Aldrich) at 4°C in 20 µl
of staining buffer to block Fc binding. Primary antibodies were then added at pre-titrated
amounts and incubated for 20 minutes at 4°C, followed by washing in staining buffer.
Intracellular BrdU labeling was performed using the APC BrdU flow kit following the
manufacturer’s instructions (BD Biosciences). Data were acquired on a CyAn ADP flow
cytometer (Dako, Fort Collins, Colorado) and analyzed with FCS Express Version 3 (DeNovo
Software, Thornhill, Ontario, Canada). At least 50,000 events per sample were acquired and
analyzed using size gating to exclude dead cells.
Kappa/Lambda Light Chain Staining
Lipogranulomas and spleen were fixed and embedded as previously described(63).
Sections (4 μm) were stained with horse radish peroxidase (HRP)-conjugated goat anti-mouse κ-
or -λ light chain antibodies (Southern Biotechnology), developed with DAB (Vector
Laboratories, Burlingame, CA), and viewed under a light microscope.
39
Anti-4-Hydroxy-3-Nitrophenyl (NP) ELISPOT Assay
Lipogranulomas and spleen (104 cells/well) from NP-KLH/TMPD treated mice were
collagenase treated as described (63) and single cell suspensions were plated on Multiscreen
HTS plates (Millipore, Billerica, MA) coated with NP19-BSA. Lipogranuloma and spleen cells
from non-immunized TMPD treated mice were used as the negative control. The cells were
incubated overnight before adding alkaline phosphatase-conjugated goat anti-mouse IgM
antibodies. Spots were developed with BCIP/NBT (Pierce) and incubated overnight before
counting using a dissecting microscope.
Variable Heavy Chain Gene Sequences
Lipogranulomas and spleen were harvested at day 12 and mRNA was isolated using
TRIzol reagent (Invitrogen Life Technologies, Carlsbad, California). The pellets were washed
with cold 75% (v/v) ethanol and resuspended in diethyl pyrocarbonate (DEPC)-treated water.
One μg of RNA was treated with DNase I (Invitrogen) to remove genomic DNA and reverse
transcribed to cDNA using Superscript First-Strand Synthesis System for RT-PCR (Invitrogen).
PCR amplification of immunoglobulin H-chain cDNA was performed using a mixture of 8
forward primers (VHF1-8) and a consensus reverse primer (VHR2) as described (130) (D
Nacionales, et al. Submitted). The PCR products were cloned into a TOPO vector (pCR4,
Invitrogen) and the VDJ heavy chain sequences were determined by dideoxy sequencing and
analyzed using the MacVector V 7.2.3 program (Accelrys Inc., San Diego CA).
Transfer of Antigen-Specific T Cells
5 x 106 CD4+ T cells from OT-II or DO11.10 mice were transferred i.v. to C57BL/6J or
BALB/cJ TMPD-treated recipients. Three days after T cell transfer, the mice were immunized
s.c. with 200 µg NP17-OVA precipitated in alum. Seven days after immunization single cell
suspensions of the draining lymph nodes, spleen, and lipogranulomas were prepared as above.
40
Lipogranuloma cell suspensions from C57BL/6J recipients of OT-II T cells were analyzed by
FACS using anti-CD3-FITC, anti-CD4-APC, anti-Vα2-PE, and anti-Vβ5-Biotin-Av/Pac Blue
antibodies (BD Biosciences). BALB/cJ recipients of DO11.10 T cells were analyzed using anti-
DO11.10 (KJI-26)-APC antibodies (Invitrogen, Caltag Laboratories, Carlsbad, CA).
T Cell Proliferation Assay
Three months after TMPD or saline treatment, DO11.10 mice were immunized with 50 μg
of specific peptide corresponding to amino acids 323-339 of ovalbumin (Ova323-339; Genscript
Corporation, Piscataway, NJ) in alum. Five days later, CD4+ T cells were sorted using MACS
anti-CD4 beads (Miltenyi Biotec, Auburn, CA). 2.5 X 104 CD4+ T cells were cultured with
irradiated (3000 R), CD4-depleted APCs (2.5 X 105 cells/well) in quadruplicate. 2.5 µg/ml of
soluble anti-CD3 or 10 μg/ml of OVA323-339 was added for 48-72 hours in a total volume of 200
µl of complete RPMI medium. One µCi [3H]-thymidine (Amersham Biosciences, Piscataway,
NJ) was added for the final 16 h of culture and proliferation was determined using a liquid
scintillation counter.
Polymerase Chain Reaction Analysis of T Cell Cytokines
Lipogranulomas and spleen were harvested 10 days after immunization with NP-KLH
followed by isolation of mRNA and cDNA synthesis as described above. PCR amplification of
β-actin, IL-4, IFNγ, and IL-21 was performed using the following primers: β-actin forward:
(TGGAATCCTGTGGCATCCATGAAAC); β-actin reverse
(TAAAACGCAGCTCAGTAACAGTCCG); (IL-4 forward:
(CGAAGAACACCACAGAGAGTGAGCT); IL-4 reverse:
(GACTCATTCATGGTGCAGCTTATCG); IFNγ forward:
(AGCGGCTGACTGAACTCAGATTGTAG); IFNγ reverse:
41
(GTCACAGTTTTCAGCTGTATAGGG); IL-21 forward: (ATGGAGAGGACCCTTGTCTG);
IL-21 reverse: (GCTTGAGTTTGGCCTTCTGA). One μl of cDNA was added to a mixture
containing 1X PCR buffer, 2.5 mM MgCl2, 400 μM dNTPs, 0.025 U of Taq DNA polymerase
(Invitrogen), 1 μM each of forward and reverse primers, and DEPC-water in a 20 μl volume.
Amplification was carried out for 5 min at 94°C, followed by 35 cycles of denaturation at 94°C
for 2 min, annealing at 55°C for 30 sec, extension at 72°C for 45 sec and a final extension of
72°C for 10 min in a PTC-100 Programmable Thermal Controller (MJ Research, Inc., Waltham,
MA). PCR products were visualized on 1% agarose gel.
Results
Antigen-Specific B Cell Responses in Ectopic Lymphoid Tissue
Intraperitoneal injection of TMPD leads to the formation of ectopic lymphoid tissue
containing B and T lymphocytes as well as activated DCs (40). We asked whether
lipogranulomas are a site where specific T cell-dependent antibody responses develop. TMPD-
treated B6 mice were immunized s.c. with NP-KLH, which induces a highly restricted antibody
response dominated by B cells bearing V186.2 H-chains and λ1 light chain specific for the NP
hapten (127, 131). Compared with controls, NP-KLH immunized mice displayed significantly
higher levels of serum anti-NP IgM and IgG 12 days post-immunization (Fig. 2-1A-B). Both
TMPD-treated and untreated mice developed a typical IgG1-dominated response following
immunization with NP-KLH in alum (Fig. 2-1C). NP-specific IgG1, IgG2a, and total IgG levels
were unaffected by TMPD treatment (Fig. 2-1C).
To evaluate the affinity of the antibody responses, reactivity with NP30-BSA and NP3-
BSA was determined by ELISA. Interestingly, although the total serum levels of antibodies
reactive with NP30-BSA in mice pre-treated with TMPD were similar to those in untreated mice,
42
reactivity of sera from the TMPD-pre-treated mice with NP3-BSA was significantly less than the
reactivity of sera from untreated mice (Fig. 2-1D). Thus, the affinity of the anti-NP antibodies
induced by immunization with NP-KLH was lower in mice with TMPD-induced ectopic
lymphoid tissue than in controls.
Because one of the characteristics of secondary lymphoid tissue is the proliferation of
antigen-specific B and T lymphocytes, it was of interest to examine T and B cell proliferation in
the ectopic lymphoid tissue induced by TMPD. Mice were fed BrdU in the drinking water and
immunized with NP-KLH. Following immunization, there was a progressive increase in the
number of B220+ cells and CD3+ cells labeled with anti-BrdU antibodies both in the spleen and
in the lipogranulomas, which was apparent as early as day 4-8 after immunization and peaked
around day 10 (Fig. 2-1E). These data indicate that primary immunization with an exogenous
antigen stimulated lymphocyte proliferation within ectopic lymphoid tissue and that the
magnitude of this proliferative response was comparable to that in a secondary lymphoid organ,
the spleen.
Ovalbumin-Specific T Cells Localize and Expand in Ectopic Lymphoid Tissue
To further address whether ectopic tissue facilitates the development of de novo immune
responses, we analyzed antigen-specific CD4+ T cell responses within the lipogranulomas
following immunization. CD4+ ovalbumin (OVA) 323-339 peptide-specific T cells were
transferred from either OT-II or DO11.10 mice into TMPD treated recipients. Either PBS or
CD4+ OVA-specific T cells from OT-II mice were injected into TMPD-treated B6 mice,
followed by immunization with NP-OVA 3 days later. Seven days after immunization, we
identified the OVA transgenic T cells (Vα2+Vβ5+CD4+ cells) (132) in various lymphoid tissues
using flow cytometry. There was a significant increase of Vα2+Vβ5+CD4+ T cells in the
draining lymph nodes and lipogranulomas from mice injected with OT-II T cells compared to the
43
control PBS injection (Fig. 2-2A). As expected, the DO11.10 antigen-specific T cells also were
present at increased frequency in the lipogranulomas of BALB/c mice after immunization (Fig.
2-2B). Transfer of DO11.10 T cells to non-immunized mice verified that the increased numbers
of antigen-specific T cells in the lipogranulomas were not merely related to the transfer of CD4+
T cells (Fig. 2-2B). We also treated DO11.10 mice with TMPD and 3 months later immunized
with OVA323-339. Seven days after immunization, the lipogranulomas contained almost
exclusively antigen-specific KJI-26+ CD4+ T cells, whereas both spleen and draining lymph
nodes contained a population of KJI-26- CD4+ T cells (Fig. 2-2C). In contrast, lipogranulomas
from non-immunized mice contained a population of non-transgenic (KJI-26-) T cells. We
further assessed the presence of OVA-specific T cells in the lipogranulomas by isolating CD4+ T
cells from TMPD treated DO11.0 mice and stimulating in vitro with OVA323-339. Antigen-
specific CD4+ T cells from lipogranulomas, spleen, and draining lymph nodes all proliferated
similarly (Fig. 2-2D). The expansion of antigen-specific CD4+ T cells in the lipogranulomas
upon immunization coupled with their ability to proliferate when stimulated in vitro provides the
first evidence that ectopic lymphoid tissue is a site of antigen-specific T cell activation and
proliferation.
To further demonstrate that the T cells in the lipogranuloma are active participants in an
antigen-specific immune response, we looked at the production of T cell inflammatory cytokines
in lipogranulomas and spleen after immunization with the test antigen NP-KLH. Compared to
the spleen, lipogranulomas from the same mouse expressed higher levels of IFNγ mRNA but
lower levels of IL-4 and IL-21 (Fig. 2-2E). Thus, following immunization, T cells in the
lipogranulomas were proliferating (Fig. 2-1E), there was an increased number of antigen-specific
44
CD4+ cells (Fig. 2B-C), and there was production of T cell cytokines, particularly IFNγ (Fig. 2-
2E), consistent with the presence of effector T cells.
4-Hydroxy-3-Nitrophenyl NP-Specific B Cells and Anti-NP Antibody Production in Ectopic Lymphoid Tissue
In view of the preferential pairing of λ1 L-chains with V186.2 H chains, paraffin-
embedded tissue was stained for κ and λ light chains (Fig. 2-3A). Lipogranulomas from both
immunized and non-immunized mice contained large numbers κ light chain bearing B cells,
showing that immunization does not substantially affect the total number of B cells in the
lipogranulomas. The lipogranulomas from mice immunized with NP-KLH had discrete areas of
strong λ light chain staining, whereas non-immunized mice had very weak λ staining (Fig. 2-3A).
Immunized mice had significantly more λ light chain bearing cells in the lipogranulomas than
controls, an expected response to NP-KLH (Fig. 2-3B). To determine whether these B cells
secreted anti-NP antibodies, ELISPOT assays were performed using NP-BSA as antigen. The
lipogranuloma cells from NP-KLH immunized, TMPD-treated mice displayed more spots than
those from TMPD-treated, non-immunized mice (Fig. 2-3C). Interestingly the spots from the
spleen, although less numerous than those from lipogranulomas, were larger (Fig. 2-3D),
suggesting that the antigen-specific cells in the spleen secreted more immunoglobulin per cell
than those from lipogranulomas and/or that the antibody affinity was lower in the
lipogranulomas, as suggested earlier (Fig. 2-1D).
Heavy-Chain Sequences from Spleen and Ectopic Lymphoid Tissue of NP-KLH Immunized Mice
To further verify that the lipogranulomas contained NP-specific B cells, we amplified and
sequenced VH genes from lipogranulomas and spleens. A preponderance of V186.2 and other
VH genes (CH10, V303, V102) implicated in the formation of anti-NP antibodies (131) was
found in the lipogranulomas and spleens of immunized mice (Fig. 2-4). B cells from the
45
lipogranulomas expressed almost exclusively V186.2 or other VH genes implicated in the anti-
NP response, representing >90% of the total sequences (including 20% V186.2). In comparison,
60% of VH sequences from the spleen were V186.2, CH10, V303, or V102 (7% V186.2).
V186.2 and other genes encoding presumptive NP-specific antibodies were infrequent in the
lipogranulomas from un-immunized mice. The higher percentage of likely NP-specific VH
genes in lipogranulomas vs. spleen from immunized mice is consistent with the possibility that T
cell-dependent clonal expansion of antigen-specific B cells may be ongoing within the
lipogranulomas.
To assess the clonality of B cells in ectopic lymphoid tissue induced by TMPD following
immunization with the test antigen, we sequenced the VH genes expressed by B cells in
individual lipogranulomas and spleen. As shown in Fig. 2-5A, diverse VH sequences were
recovered from the spleens of TMPD-treated mice immunized with NP-KLH. In some instances
the same VH-D-JH combination was obtained from two individual clones from the same spleen.
Interestingly, the combination CH10-DSP2.X-JH1 (CH10 is implicated in the formation of anti-
NP antibodies) was recovered in duplicate clones from two different mice (Fig. 2-5A). In
striking contrast to spleen, individual lipogranulomas from TMPD-treated mice, immunized 12
days earlier with NP-KLH, contained highly oligoclonal populations of B cells expressing VH
sequences associated with anti-NP reactivity (V186.2 and related sequences) (Fig. 2-5A, Mouse
#1 and #2, lipogranulomas 1 and 2). The lipogranulomas from immunized mice displayed
almost exclusively (95%) V186.2 and analogous VH sequences vs. 50% of the VH genes
recovered from the spleens of NP-KLH immunized mice (Fig. 2-5B). Lipogranulomas from
TMPD-treated mice that were not immunized with NP-KLH contained more diverse populations
of B cells with few V186.2 and related sequences (Fig. 2-5A-B). The “anti-NP” sequences
46
found in individual lipogranulomas were distinct from those isolated in spleen and other
lipogranulomas from the same mouse.
Analysis of somatic mutation frequencies in V186.2 sequences revealed that 8/9 (88%) of
the lipogranuloma V186.2 sequences were somatically mutated (Table 2-1). Lipogranuloma and
spleen sequences both had R/S ratios > 5.7, suggestive of the occurrence of somatic
hypermutation during a primary response to NP (133). None of the somatically mutated
sequences contained the prototypical 33 (W → L) mutation characteristic of affinity maturation
(134), consistent with an early NP-specific response in the lipogranulomas from these mice that
had received only a primary immunization.
To help address the issue of whether the lipogranuloma B cells were undergoing a primary
anti-NP response locally as opposed to migrating there from other sites, such as secondary
lymphoid tissue, the CDRs of related sequences isolated from lipogranulomas were compared
(Fig. 2-6). Sequences obtained from individual lipogranulomas displayed identical or closely
related somatic mutations, as might be expected if they underwent expansion locally (e.g. Mouse
#2, lipogranuloma 1, V303-DSP2.8-JH4 sequences) (Fig. 2-6, top). However, although
occasional new somatic mutations were found (e.g. sequence VH6-2) extensive “clonal trees”
were not seen. In other cases (e.g. Mouse #1, lipogranuloma 2, V303-DSP2.9-JH1) collections
of identical germline sequences were found (Fig. 2-6, bottom). Individual somatic mutations
seen in the CDR sequences recovered from lipogranulomas were not found in the spleen of the
same mouse, providing further evidence that the splenic and lipogranuloma anti-NP responses
developed independently of each other.
Discussion
There are many examples of structures resembling secondary lymphoid tissue arising at
sites of chronic inflammation (105), but it remains unclear whether this ectopic lymphoid tissue
47
is a site of cognate T-B interactions. Specifically, although autoantigen-specific B cells have
been reported in ectopic lymphoid tissue (112, 135), it is not known whether immune responses
actually develop there or whether antigen-specific B cells arising in secondary lymphoid tissues
subsequently colonize the ectopic lymphoid tissue. Here, we addressed this question by active
subcutaneous immunization coupled with tracking of antigen-specific B and T lymphocytes to
peritoneal ectopic lymphoid tissue induced by TMPD. To our knowledge, this is the first study
to show that both hapten-specific B cells and proliferating, carrier-specific, T effector cells are
present within ectopic lymphoid tissue.
Our data strongly suggest that cognate antigen-specific T-B interactions occur in ectopic
lymphoid tissue. Following subcutaneous immunization with antigens such as NP-OVA, T and
B-cell proliferation was seen in the TMPD-induced ectopic lymphoid tissue (Fig. 2-1E) and both
OVA-specific T cells and NP hapten-specific B cells accumulated there (Figs. 2-2-2-3). T cells
in the ectopic lymphoid tissue also produced IFNγ and other cytokines (Fig. 2-2E). Heavy chain
sequences isolated from ectopic lymphoid tissue were highly enriched for V186.2 and other H-
chains known to generate NP-specific antibodies (Figs. 2-4-2-5) and the proportion of such
sequences was higher than in the spleen. Lipogranulomas also exhibited strong λ light chain
staining consistent with an anti-NP response (Fig. 2-3). Moreover, anti-NP antibody secreting
cells were enriched in ectopic lymphoid tissue in comparison with the spleen. Taken together,
these data suggest that antigen-specific B cell and T cell responses may preferentially develop
within the ectopic lymphoid tissue.
Individual lipogranulomas from pre-immune mice contain relatively diverse populations of
B cells (Fig. 2-5;(37). In contrast, following subcutaneous immunization, the B cells present in
individual lipogranulomas were highly oligoclonal or even monoclonal (Fig. 2-5-2-6) and
48
preferentially utilized H-chains previously reported in anti-NP responses. Oligoclonal B cell
expansions also are seen in individual germinal centers microdissected form secondary lymphoid
tissues (127), suggesting that individual lipogranulomas from TMPD-treated mice are in some
respects analogous to single germinal centers. The oligoclonal B cell proliferation apparent in
TMPD-induced ectopic lymphoid tissue is consistent with previous observations in ectopic
lymphoid tissues from rheumatoid arthritis, Sjogren’s syndrome, and myasthenia gravis patients
(108, 110, 135).
A key question is whether the B cells in ectopic lymphoid tissue develop in situ or migrate
into the ectopic lymphoid tissue from secondary lymphoid organs, such as the lymph nodes or
spleen. In view of the timing of immunization and the VH sequences obtained, it is unlikely that
the B cells found in lipogranulomas 10-12 days after immunization originated from the germinal
centers of secondary lymphoid tissues followed by migration to the tertiary lymphoid tissues.
The fact that individual lipogranulomas contained non-overlapping and unrelated sets of clonal B
cells also suggests they were not “seeded” with the products of previous germinal center
reactions in the lymph nodes or spleen. Moreover, the sequences recovered from spleen did not
overlap with the lipogranuloma sequences.
We did not find the extensive clonal trees reported previously from spleen of MRL mice
(136). However, extensive clonal trees were not seen in individual germinal centers, either (127)
and the sequences illustrated in Fig. 2-6 (Mouse #2, Granuloma #1) are not that dissimilar from
those reported previously from individual germinal centers. The lack of clonal trees could reflect
the relatively small number of sequences analyzed per lipogranuloma or a lower rate of somatic
hypermutation in ectopic lymphoid tissue vs. secondary lymphoid tissues.
49
There are other important differences between the ectopic lymphoid tissue induced by
TMPD and authentic germinal center reactions, notably the absence of well-developed FDC
networks and PNA+ B cells (63). ELISPOTs were larger using spleen cells vs. cells from the
ectopic lymphoid tissue, suggesting that the splenic anti-NP B cells secrete more antibody than
those from ectopic lymphoid tissue or that affinity maturation of B cells in the lipogranuloma is
less efficient than in the spleen, an interpretation consistent with the lower affinity of anti-NP
antibodies in the sera of TMPD-treated mice vs. controls (Fig. 2-1D) and the paucity of clonal
trees. Together, these data suggest that 1) a significant portion of the low affinity serum anti-NP
response in TMPD-treated mice may derive from the ectopic lymphoid tissue and 2) affinity
maturation may be defective in the ectopic lymphoid tissue- i.e. high affinity B cells may enjoy
less of a competitive advantage over lower affinity cells in ectopic lymphoid tissue than in
authentic secondary lymphoid tissues. We speculate that reduced affinity maturation in the
lipogranulomas might reflect an absence of follicular dendritic cells in view of the lack of FDC-
M1+ staining (63). Further studies will be necessary, however, to determine whether the low
affinity of serum anti-NP antibodies in TMPD-treated mice is due to their production in ectopic
lymphoid tissue or is a systemic effect of TMPD treatment.
The presence of oligoclonal B cell populations in individual lipogranulomas, lack of shared
H-chain sequences between lipogranulomas and spleen and between individual lipogranulomas
from the same mouse, expression of AID and the presence of circular DNA intermediates
generated during active class switch recombination(37), as well as the presence of proliferating B
and T cells in these structures lead us to conclude that TMPD-induced ectopic lymphoid tissue is
a site of germinal center-like cognate T-B interactions. However, the lipogranulomas may not be
true germinal centers and instead could be analogous to the previously reported extrafollicular
50
sites of antigen-driven somatic hypermutation of rheumatoid factor B cells (137). Recently,
ectopic lymphoid tissue also was found to express AID in the salivary glands of patients with
Sjogren’s syndrome (138), supporting the idea that this may be a general feature of ectopic
lymphoid tissue in a variety of locations.
The formation of ectopic lymphoid tissue is strongly associated with autoimmunity and
autoantibody production in a variety of disorders (105), including the rheumatoid synovium,
salivary glands in Sjogren’s syndrome (110, 139), thymus in myasthenia gravis (135), and the
thyroid in Hashimoto’s thyroiditis (99). In several examples of organ-specific autoimmune
disease, autoreactive B cells have been found within ectopic lymphoid tissue in the target tissues.
We have shown recently that anti-RNP autoantibody-producing B cells are enriched in ectopic
lymphoid tissue of TMPD-treated mice, strongly suggesting that this may be a site where
autoreactivity may develop preferentially (37). It will be of interest to determine where the
antigen presenting cells responsible for activating autoreactive T cells acquire self-antigens, as
the present data indicate that APCs from remote (e.g. subcutaneous) locations are capable of
homing to ectopic lymphoid tissue located within the peritoneum. The role of chemokines, such
as CXCL19, CXCL21, and CXCL13, expressed at high levels in the ectopic lymphoid tissue (63)
in establishing autoantibody production in ectopic sites remains to be determined. Finally, it will
be of interest to see if therapy aimed at disrupting the formation of ectopic lymphoid tissue will
prevent the development of lupus in TMPD-treated mice.
51
Figure 2-1. Serum anti-NP response after immunization with NP-KLH. A and B, B6 mice injected with TMPD 3 months earlier were immunized with NP-KLH. At day 12, sera were tested for IgM (A) and IgG (B) anti-NP antibodies by ELISA using NP-BSA. There was a significant increase in both IgM and IgG anti-NP from pre-immune sera to day 12 immune sera. C, Isotypes of anti-NP antibodies (ELISA) from mice either pre-treated or not pre-treated with TMPD prior to immunization with NP-KLH. D, Affinity of anti-NP antibodies developing in TMPD-treated mice vs. controls (no Rx) immunized with NP-KLH. Serum binding activity (measured in arbitrary units using a standard curve) was measured using NP30-BSA (low and high avidity/affinity antibodies) and NP3-BSA (high avidity/affinity antibodies). E, In vivo BrdU labeling of T and B cells in the lipogranulomas and spleens of TMPD-treated and NP-KLH immunized mice (n = 3). Single cell suspensions were stained with anti-CD45R (B220) and anti-CD3 antibodies and with an anti-BrdU antibody. Data are expressed as the % of BrdU+ B cells or T cells, respectively, at 4, 8, 10, or 14 days after immunization with NP-KLH.
52
Figure 2-2. OVA-specific T cells in lipogranulomas. A, Single cell suspensions from spleen, lymph nodes, or lipogranulomas of mice injected i.v. with OT-II T cells (n = 6) or PBS (n = 5) were analyzed by flow cytometry 7 days after immunization with NP-OVA. The Vα2+Vβ5+ values represent the total percentage of CD3+CD4+ T cells. (* Lymph nodes, P = 0.009; Lipogranuloma, P = 0.02, Mann Whitney test) B, Mice were injected i.v. with DO11.10 T cells (n = 12) or PBS (n = 5) were analyzed by flow cytometry. Some mice that received DO11.10 T cells were immunized with NP-OVA (n = 7) and others were not (n = 5). (* Spleen, P = 0.0006; Lymph node, P = 0.01, Lipogranuloma, P = 0.02, Mann Whitney test) C, Single cell suspensions of lipogranulomas, spleen and draining lymph nodes from immunized or non-immunized mice were gated on live CD3+CD4+ cells (cytox blue) and then the % of KJI-26+ (DO11.10 T cells) was determined from CD3+ CD4+ cells (representative of three independent experiments). D, Isolated CD4+ T cells were cultured with or without OVA323-339 for 72 h. T cell proliferation was measured by [3H] incorporation (representative of three independent experiments). E, cDNA was synthesized from two lipogranulomas (Lipo) or spleen from a TMPD treated mice immunized with NP-KLH. IL-4, IFNγ, and IL-21 expression was determined by RT-PCR and normalized to β-actin expression (representative of four different mice)
53
Figure 2-3. Anti-NP B cells in ectopic lymphoid tissue. A, Light chain staining of B cells in lipogranulomas from B6 mice treated with TMPD alone or treated with TMPD and then immunized with NP-KLH. Paraformaldehyde-fixed tissue was analyzed 12 days after NP-KLH immunization. Paraffin sections were stained with anti-κ and anti-λ light chain antibodies. B, Number of κ and λ positive cells per high power field in mice treated with TMPD + NP-KLH immunization or with TMPD alone (* P = 0.02, Mann Whitney test; representative of five independent experiments). C, ELISPOT assay for anti-NP B cells. MultiScreen HTS IP plates containing a 0.45 µm Immobilon-P membrane were coated with 1 µg/mL NP-BSA. Lipogranuloma and spleen cells from TMPD treated mice (n = 2) or TMPD-treated and NP-KLH immunized mice (n = 2) were added to triplicate wells for 24 h before adding biotinylated goat anti-mouse IgM antibodies, streptavidin-peroxidase, and BCIP-NBT substrate. Number of spots per well was determined (* P = 0.03 for both mouse A and mouse B, Mann Whitney test; representative of three independent experiments). D, Relative sizes of individual spots in ELISPOT assays using lipogranuloma (Lipo) or spleen (Spl) cells from TMPD treated mice either with or without NP-KLH immunization.
54
Figure 2 4. VH segment usage in lipogranulomas and spleen. Lipogranulomas from a TMPD-treated mouse immunized with NP-KLH were pooled at day 12 and RNA was isolated. Immunoglobulin VH sequences were determined from lipogranulomas (n = 50) and spleen (n = 50) from the same mouse. All of the sequences recovered from lipogranulomas bore V186.2, CH10, V303, V102, or V124 vs. 62.6% of the sequences recovered from the spleen (representative of three independent experiments).
55
Figure 2-5. Oligoclonal VH sequences from lipogranulomas of immunized mice. Heavy chain
sequences are shown from spleen and lipogranulomas of two mice immunized with NP-KLH (day 12) and two pre-immune (not immunized) mice. V-D-J sequences were amplified from cDNA by PCR and sequenced to determine VH, D, and JH usage. Boxed sequences utilize VH sequences associated with anti-NP reactivity. Related sequences are shown in the same format.
56
Figure 2-6. CDR1 and CDR2 sequences from H-chains isolated from lipogranulomas. Sequences of H-chains from Mouse #1, lipogranuloma 2 (V303-DSP2.9-JH1) and Mouse #2, Lipogranuloma 1 (V303-DSP2.8-JH4) are aligned. Somatic mutations are indicated. Replacement mutations capitalized, silent mutations lower case.
Table 2-1. V186.2 sequences from mice undergoing primary NP-KLH immunization Total number of
seq No. of V186.2
No. of mutated V186.2
Position 33 W L
mutation Affinity matured
V186.2
R/S FR
R/S CDR
Lipogran 35 9 8 0 0.72 6Spleen 35 7 5 0 1.3 7.5
57
CHAPTER 32 B CELL PROLIFERATION, SOMATIC HYPERMUTATION, CLASS SWITCH
RECOMBINATION, AND AUTOANTIBODY PRODUCTION IN ECTOPIC LYMPHOID TISSUE IN MURINE LUPUS
Introduction
Secondary lymphoid tissue, which includes lymph nodes, mucosal-associated lymphoid
tissues, and the spleen, is organized to concentrate foreign antigens, placing the cells responsible
for mounting an antigen-specific immune response to these antigens (T and B lymphocytes and
dendritic cells) in close proximity (105, 140). The tissue is organized into discrete zones
containing T cells and dendritic cells (the periarteriolar lymphoid sheath) and B cells and
follicular dendritic cells (the primary follicles). The chemokines CCL19 (ELC) and CCL21
(SLC), which attract T lymphocytes and dendritic cells, and CXCL13 (BLC), which attracts B
lymphocytes, play an important role in establishing the compartmentalization of secondary
lymphoid tissues into discrete T and B cell zones (141). Antigen-specific B cells appear initially
at the periphery of the periarteriolar lymphoid sheath forming primary foci, which are sites of
interclonal competition for antigen among unmutated B cells (128). Subsequently, these give
rise to a second responding population in the follicle, germinal center B cells. Germinal centers
are sites of intraclonal competition for antigen and survival signals between mutated sister
lymphocytes (128). The germinal center reaction regulates antigen-specific clonal evolution
during the development of B cell memory (142). It is characterized by somatic hypermutation
(SHM) of immunoglobulin complementarity determining regions (CDRs), class switch
recombination (CSR), clonal expansion (proliferation), and antigen-driven affinity maturation of
2 Reprinted with permission from The Association of American Immunologists, Inc. Copyright 2009 Nacionales DC and Weinstein JS et. al B Cell Proliferation, Somatic Hypermutation, Class Switch Recombination, And Autoantibody Production In Ectopic Lymphoid Tissue In Murine Lupus.. J Immunol. 2009 Apr 1;182(7):4226-36.
58
B cells, expression of activation induced cytidine deaminase (AID), and a requirement for
CD40L+ T cells (142). B cells in newly formed germinal centers generally are often oligoclonal,
consisting of 1-3 clones (127).
The formation of ectopic (tertiary) lymphoid tissue in response to inflammation has been
termed “lymphoid neogenesis” because it recapitulates many aspects of secondary lymphoid
tissue development (95, 105). Like secondary lymphoid tissue, the organization of ectopic
lymphoid tissue is dependent on CCL19 (ELC), CCL21 (SLC), and CXCL13 (BLC) (1).
Interestingly, lymphoid neogenesis is strongly associated with autoimmunity and the formation
of autoantibodies (96). Autoimmune disorders associated with the formation of ectopic
lymphoid tissue include Hashimoto’s thyroiditis, Sjogren’s syndrome, rheumatoid arthritis, and
myasthenia gravis (105). We have shown that the intraperitoneal injection of the hydrocarbon
pristane (2, 6, 10, 14 tetramethylpentadecane, TMPD) gives rise to the formation of ectopic
lymphoid tissue and a chronic immune reaction culminating in the development of lupus (63). In
contrast, other hydrocarbon oils, such as medicinal mineral oil, induce the formation of ectopic
lymphoid tissue but not lupus (32). Inflammatory tissue generated in response to TMPD consists
of dendritic cells, monocytes, T cells, and B cells, often organized into discrete zones
reminiscent of lymph node architecture, which is vascularized by MECA-79+ high endothelial
venules (63) . The ectopic lymphoid tissue is organized into discrete nodular “lipogranulomas”
(118). CCL19, CCL21, and CXCL13 all are expressed in the lipogranulomas and likely play a
role in recruiting immune cells into them (63).
In this study we show that the lipogranulomas not only morphologically resemble
lymphoid organs but also display some of the characteristics of germinal center reactions,
namely proliferation of T and B lymphocytes, T cell dependent SHM of immunoglobulin
59
variable regions, expression of AID, and CSR. IgG1 and IgG2a hypergammaglobulinemia
induced by TMPD as well as the production of isotype-switched autoantibodies required the
presence of T cells. Moreover, autoantibody secreting cells were present in the lipogranulomas,
consistent with the possibility that they can be generated within the ectopic (tertiary) lymphoid
tissue.
Materials and Methods
Mice
Four-week-old female BALB/cJ mice were purchased from Jackson Laboratory (Bar
Harbor, ME) and housed in barrier cages. At 3 months of age, they received a single
intraperitoneal (i.p.) injection (0.5 ml) of either TMPD (Sigma-Aldrich, St. Louis, MO) or
medicinal mineral oil (Harris Teeter, Mathews, NC). Peritoneal cells, lipogranulomas, and blood
were harvested 12-20 weeks later. In some experiments female T cell receptor deficient
(B6.129P2-Tcrbtm1MomTcrdTm1Mom, backcross generation N12) and C57BL/6J mice
(Jackson) were used. These studies were approved by the Institutional Animal Care and Use
Committee.
Immunohistochemistry and Immunofluorescence
Lipogranulomas were excised from the peritoneal wall after peritoneal lavage, fixed with
4% paraformaldehyde, and embedded in paraffin. Immunohistochemistry was carried out by the
Molecular Pathology and Immunology Core at University of Florida using the DAKO
Autostainer protocol. Briefly, 4 μm serial sections were deparaffinized and then blocked with
Sniper (Biocare Medical, Walnut Creek, CA). Sections were incubated with rat anti-mouse
CD45R (B220) (BD Biosciences, San Jose, CA), CD3 (Serotec, Raleigh, NC), or Ki-67 (Dako
Cytomation, Carpinteria, CA) for 1 hour followed by incubation with non-biotinylated rabbit
anti-rat immunoglobulin antibodies (Vector, Burlingame, CA) for 30 minutes. Staining was
60
visualized using Mach Gt x Rb HRP polymer (Biocare Medical, Walnut Creek, CA), the
chromagen Cardassian DAB (Biocare Medical, Walnut Creek, CA) and Mayer’s hematoxylin
counterstain. Tissue sections also were stained with antibodies against follicular dendritic cells
(FDC-M1, BD Biosciences) and processed for immunohistochemistry as above.
To detect IgM and IgG in the lipogranulomas, de-paraffinized sections were stained with
either FITC-conjugated goat anti-mouse IgG or IgM (Southern Biotechnology, Birmingham,
AL), mounted using Vectashield mounting medium with DAPI (Vector) and examined by
fluorescence microscopy.
Bromodeoxyuridine (BrdU) Labeling of B and T Cells
BrdU was administered to BALB/cJ mice (0.2 mg BrdU i.p. every 4 hours for 3 doses)
and again one day before euthanasia. Peritoneal lipogranulomas from each mouse were excised
and pooled. Single cell suspensions were made by collagenase treatment (63). Spleen cells were
also prepared using collagenase treatment. The isolated cells were incubated with APC-
conjugated anti-BrdU antibodies, plus anti-CD3-FITC and anti-CD19-PE antibodies (BD
Biosciences) and analyzed by flow cytometry. Appropriate isotype controls were used to
evaluate background fluorescence. Isolated lipogranuloma cells were washed in staining buffer
(PBS supplemented with 0.1% NaN3 and 1% bovine serum albumin) and pre-incubated for 20
minutes with 1 µg of anti-CD16 (BD Biosciences) and 0.5 µl rat serum (Sigma Aldrich) at 4°C
in 20 µl of staining buffer to block Fc binding. Primary antibodies were then added at pre-
titrated amounts and incubated for 20 minutes at 4°C, followed by washing in staining buffer.
Intracellular BrdU labeling was performed after permeabilization with BD Cytoperm plus using
the APC BrdU flow kit following the manufacturer’s instructions (BD Biosciences). After
gating on B220+ or CD4+ lymphocytes, the percentage of BrdU+ cells was determined by flow
61
cytometry as above. Data were acquired on a CyAn ADP flow cytometer (Dako, Fort Collins,
Colorado) and analyzed with FCS Express Version 3 (DeNovo Software, Thornhill, Ontario,
Canada). At least 50,000 events per sample were acquired and analyzed using size gating to
exclude dead cells.
Ki-67 Staining of B and T Cells
Single-cell suspensions were made from lipogranulomas and spleen, and proliferating
cells were surface-stained with anti-B220 and anti-CD4, followed by permeabilization with cold
70% ethanol at -20° for 3 hours. Cells were then analyzed for intracellular staining with anti-Ki-
67 antibodies (BD Biosciences) using the manufacturer’s protocol. After gating on B220+ or
CD4+ lymphocytes, the percentage of Ki-67+ cells was determined by flow cytometry as above.
Real Time-PCR Analysis of Aid and Class Switched H-Chain Transcripts
Total RNA from individual lipogranulomas excised from TMPD- or mineral oil-treated
mice was isolated using Trizol (Invitrogen Life Technologies, Carlsbad, California) and
precipitated with isopropanol. The pellets were washed with cold 75% (v/v) ethanol and
resuspended in diethyl pyrocarbonate (DEPC)-treated water. One μg of RNA was treated with
DNase I (Invitrogen) to remove genomic DNA and reverse transcribed to cDNA using
Superscript First-Strand Synthesis System for RT-PCR (Invitrogen). Conventional PCR
amplification was carried out in a PTC-100 Programmable Thermal Controller (MJ Research,
Inc., Waltham, MA) using primers for AID (forward- GAG GGA GTC AAG AAA GTC ACG
CTG GA ; reverse- GGC TGA GGT TAG GGT TCC ATC TCA ) and β-actin (143). Real-time
PCR was performed using SYBR Green core reagents (Applied Biosystems, Foster City, CA)
and a DNA Engine Opticon 2 continuous fluorescence detector (MJ Research). PCR primers
were as follows: AID forward-CCT CCT GCT CAC TGG ACT CC; AID reverse-AGG CTG
AGG TTA GGG TTC CA; 18S forward-AGG CTA CCA CAT CCA AGG AA; 18S reverse-
62
GCT GGA ATT ACC GCG GCT. AID expression was normalized to the expression of an
endogenous control (18s RNA) using the comparative (2 –ΔΔCt) method (144). Data are
expressed relative to the sample with the lowest expression level. For detecting IgM and IgG1
transcripts, a mixture of 8 consensus forward primers (VHF1-8) and isotype specific Cμ and Cγ1
reverse primers were used (130). Primers were synthesized by Invitrogen. PCR products were
analyzed on 1% agarose gels and stained with ethidium bromide.
Class Switch Recombination Assay
The occurrence of active CSR in ectopic lymphoid tissue (TMPD or mineral oil induced
“lipogranulomas”) was evaluated by detecting looped out circular DNAs as described (145).
Briefly, total RNA was isolated from individual lipogranulomas, treated with DNase I and
reverse transcribed to cDNA as above. “Circle transcripts” were amplified as follows: initial
denaturation 95°C for 9 min followed by 35 cycles of PCR (94°C for 30 sec, 58°C for 60 sec)
using 0.025 U of Taq DNA polymerase (Invitrogen), 2.0 mM MgCl2, and 1 μM each of isotype-
specific I-region primers (Iγ1F or Iγ2aF) and a Cμ reverse primer (15). PCR products were
separated on a 1% agarose gel and stained with ethidium bromide.
Immunoglobulin V-D-J Sequence Analysis
To determine VDJ gene usage, 1 μl cDNA was amplified using pooled forward (VHF1-8)
and reverse (VHR2) primers (Fig. 3A) (130). The reaction was carried out in a 20 µl volume
using 1.25 nM pooled VHF and 2.5 nM VHR2 primers containing 1X PCR buffer, 1.5 mM
MgCl2, 200 μM dNTPs, and 0.05 U of Taq DNA polymerase (Invitrogen), in a PTC-100
Programmable Thermal Controller (MJ Research) as follows: denaturation at 94°C for 30 sec,
annealing at 52°C for 30 sec, and extension at 72°C for 1 min. After 30 cycles, extension was
continued at 72°C for an additional 10 min. The PCR product was cloned into a TA vector
(pCR4, Invitrogen) and sequenced using an Applied Biosystems Model 373 Stretch DNA
63
Sequencer, 377 DNA Sequencer, or 3100 Genetic Analyzer using a T7 sequencing primer. The
determined sequences were verified by sequencing in the reverse direction using a T3
sequencing primer. VH, D, and JH sequences were identified by searching the Ig-BLAST and
IMGT/V-Quest databases using MacVector software (Accelrys Inc., San Diego, CA).
Enzyme Linked Immunosorbent Assay
Anti-nRNP/Sm antigen-capture ELISAs were performed as described (94). Antigen-
coated wells were incubated with 100 µl mouse sera diluted 1:500 in blocking buffer for 1 hr at
22°C, washed three times with TBS/Tween 20, and incubated with 100 µl alkaline phosphatase-
labeled goat anti-mouse IgG or IgM (1:1000 dilution) for 1 hr at 22°C. After washing, the plates
were developed with p-nitrophenyl phosphate substrate (Sigma). Optical density at 405 nm
(OD405) was read using a VERSAmax microplate reader (Molecular Devices Corporation,
Sunnyvale, CA). ). Standard curves were generated using serial dilutions of a murine anti-U1-
70K monoclonal antibody (2.73). Concentrations of anti-Sm/RNP autoantibodies were
calculated using a four-parameter logistic equation as part of the Softmax Pro 3.0 ELISA plate
reader software. Total levels of IgG1, IgG2a, IgG3, and IgM were measured by ELISA as
described (27).
Quantification of Plasmablasts
Single-cell suspensions were made using spleen and lipogranuloma tissue from five
TMPD-treated BALB/c mice. Cells were stained with APC-conjugated anti-B220 and PE-
conjugated anti-CD138 antibodies (BD Pharmingen) and analyzed by flow cytometry as above.
ELISPOT Assay for Total Immunoglobulin
Lipogranulomas and splenocytes from TMPD treated mice were harvested, analyzed by
flow cytometry to determine B cell numbers (anti-CD19), and plated (3 X 105 cells/well) in
quadruplicate on Multiscreen HTS plates (Millipore, Billerica, MA) coated with rat IgG anti-
64
mouse light chain antibodies (κ and λ chain specific, 3 µg/ml each, from BD Pharmingen). The
cells were incubated overnight before adding a combination of alkaline phosphatase-conjugated
rat anti-mouse IgG1, IgG2a, IgG2b antibodies (1:1000 dilution). Spots were developed
overnight with BCIP/NBT (Pierce Chemical Co., Rockford, IL). The number of antibody
secreting lipogranuloma cells and splenocytes per 100,000 B cells was determined by counting
the spots using a dissecting microscope.
ELISPOT Assay for Anti-RNP Autoantibodies
The production of anti-U1A (a subset of anti-RNP) autoantibodies in the ectopic
lymphoid tissue also was examined by ELISPOT assay. A human full-length U1A cDNA was
obtained by RT-PCR (PTC-100 Programmable Thermal Controller (MJ Research, Inc.,
Waltham, MA) from normal human PBMC cDNA. The forward primer was GCG GAT CCG
CAG TTC CCG AGA CCC GCC CTA ACC AC Bam HI and reverse primer was GCA AGC
TTC TAC TTC TTG GCA AAG GAG ATG TTC Hind III. The amplified fragment was
inserted between the BamHI and HindIII sites of pET28A (Invitrogen) in-frame with the 6His
sequence. The vector was used to transform E. coli BL21 DE3 and recombinant protein was
expressed by growing in LB medium containing 10 μg/ml kanamycin and 2 mM IPTG. Four
hours later, the bacteria were lysed using 6 M guanidine HCl + 0.5 mM phenylmethylsulfonyl
fluoride and 0.3 TIU/ml aprotinin. Recombinant protein was purified using Ni-NTA resin
columns (Sigma). The protein was eluted with 6 M urea.
Reactivity with serum anti-RNP autoantibodies from TMPD-treated mice was verified by
ELISA. The microtiter plate wells (Immobolizer Amino; Nunc, Napeville, IL) were coated with
1 μg/ml purified recombinant antigen in BBS overnight at 4° C. The remainder of the ELISA
was carried out as described above. Sera from 20 anti-Sm/RNP positive TMPD-treated mice and
20 untreated controls were tested at a 1:500 dilution followed by 1:1000 alkaline phosphatase-
65
conjugated goat anti-mouse IgG antibodies (Southern Biotechnology). Using the SoftMax Pro
3.0 software, OD405 values were converted to units with a standard curve based on a serially
diluted prototype serum.
For the ELISPOT assays, lipogranuloma cells from TMPD treated BALB/cJ mice were
harvested and plated on Multiscreen HTS plates (Millipore) coated overnight at 4°C with either
recombinant U1A protein (5 μg/ml) or BSA followed by alkaline phosphatase-conjugated goat
anti-mouse IgG or IgM antibodies (1:1000 dilution, Southern Biotechnology). Spots were
developed overnight with BCIP/NBT (Pierce) and counted as above.
Results
Lipogranulomas developing in the peritoneum of TMPD- or mineral oil-treated mice are a
form of ectopic lymphoid tissue (63). We investigated whether these structures also exhibit
functional characteristics consistent with germinal center reactions, such as SHM, CSR, and
antigen-driven, T cell-dependent proliferation of B lymphocytes.
Lymphocyte Proliferation in TMPD-Induced Ectopic Lymphoid Tissue
As shown previously (63), serial sections of lipogranulomas from TMPD-treated mice
revealed contiguous aggregates of B220+ and CD3+ cells (Fig. 3-1A). Ki-67+ cells were found
in the same region, consistent with the presence of proliferating lymphocytes (Fig. 3-1A).
However, it was difficult to determine from these sections whether T cells, B cells, or both were
proliferating. To address this question, pooled lipogranulomas were analyzed by flow cytometry
using anti-B220, CD4, and Ki-67 antibodies. A small percentage of B220+ (4.91%) and CD4+
lymphocytes (3.85%) was Ki-67+ (Fig. 3-1B). To confirm the presence of proliferating B and T
lymphocytes in the ectopic lymphoid tissue, TMPD-treated mice were injected with BrdU (0.2
mg every 4 hours for 3 doses) and euthanized the following day. Incorporation of BrdU by B
and T cells in the lipogranulomas and spleen was determined by flow cytometry using anti-BrdU
66
antibodies. BrdU+ B (B220+) and T (CD3+) cells were present in both the lipogranulomas and
the spleen (Fig. 3-1C). There was a significantly higher percentage of BrdU+ B and T cells in
the lipogranulomas compared with spleen (p = 0.028), indicating that B and T cell proliferation
was greater in the ectopic lymphoid tissue than in secondary lymphoid tissue (spleen). Follicular
dendritic cells could not be identified in the ectopic lymphoid tissue after staining with FDC-M1
antibodies (Fig. 3-1A), whereas strong staining of follicular dendritic cells could be
demonstrated in the spleen (not shown).
Expression of AID and CSR in TMPD-Induced Ectopic Lymphoid Tissue
As B cell proliferation in lymphoid follicles is linked to SHM and Ig repertoire
diversification (99), we examined the expression of AID, a marker of CSR and SHM, in TMPD
and mineral oil lipogranulomas. By RT-PCR, expression of AID was demonstrated in both
TMPD and mineral oil induced lipogranulomas but not in peritoneal exudate cells (Fig. 3-2A).
However, the expression appeared lower than in the spleen. Quantitative PCR confirmed that
AID expression was lower in lipogranulomas than spleen from TMPD-treated mice, whereas the
levels were comparable in lipogranulomas vs. spleen of mineral oil treated mice (Fig. 3-2A,
right). The expression of AID was higher in TMPD or mineral oil lipogranulomas than in
peritoneal exudate cells.
Since AID expression is required for immunoglobulin class switching, we examined
whether IgG-producing B cells were present in the ectopic lymphoid tissue. Class switching to
IgG1 and IgG2a, which requires T cells and is characteristic of germinal center reactions, was
detected using conventional RT-PCR. Variable levels of µ H-chain mRNA could be detected in
nearly all lipogranulomas from either TMPD- or mineral oil-treated mice and high levels were
also found in the spleen (Fig. 3-2B). In contrast, γ1 H-chain mRNA was more abundant in the
ectopic lymphoid tissue from TMPD-treated mice in comparison with mineral oil treated mice.
67
At least low levels of γ1 H-chain were detectable by RT-PCR in 11/12 TMPD lipogranulomas
vs. 1/12 mineral oil lipogranulomas (Fig. 3-2B, right).
CSR is accompanied by the looping out of a DNA segment containing Cμ and other CH
genes generating closed circular DNAs with isotype-specific I-Cμ transcripts. In vitro, these
“circle transcripts” are completely removed within 48 hours and detection of circle transcripts by
PCR is indicative of active CSR (145). We used the presence of circle transcripts to evaluate
whether the lipogranulomas were a site of active CSR. Consistent with the data shown in Fig. 3-
2B, γ2a or γ1 (not shown) circle transcripts were detected in some of the TMPD-induced
lipogranulomas (5 out of 31 total), but were rarely detected in mineral oil lipogranulomas (1 out
of 17) (Fig. 3-2C). As a further confirmation, lipogranulomas from mineral oil or TMPD-treated
mice were stained with FITC-conjugated anti-immunoglobulin antibodies (μ or γ chain specific)
and examined by fluorescence microscopy (Fig. 3-2D). Mineral oil and TMPD lipogranulomas
both contained cells expressing μ H-chain, whereas γ H-chain was detected only in TMPD
lipogranulomas.
Individual Lipogranulomas from a Single Mouse Contain Different Populations of B Cells
Germinal center reactions are characterized by oligoclonal expansions of antigen-specific
B cells with somatically mutated immunoglobulin H and L chains. We therefore examined the B
cell repertoire in single lipogranulomas (ectopic lymphoid tissue) induced by TMPD or mineral
oil treatment. Figure 3-3A shows the primers used to analyze immunoglobulin VH gene
expression in the ectopic lymphoid tissue. A total of 78 sequences isolated from 7 individual
lipogranulomas from three TMPD-treated mice and 22 sequences isolated from 4 individual
lipogranulomas from two mineral oil treated mice were analyzed. Figure 3-3B depicts the
distribution of V-D-J segment usage in individual lipogranulomas from three representative
mice. Lipogranulomas #137, 139, and 140 were isolated from a single TMPD-treated mouse,
68
lipogranulomas #190 and 193 from another mouse, and lipogranulomas #201 and 204 from a
third mouse. Diverse H-chain sequences were obtained from each individual lipogranuloma. In
some cases, several identical or closely related sequences were obtained from the same
lipogranuloma. For example, six identical, somatically mutated rearrangements comprised of
VH36-60-DFL16.1-JH4 were obtained from lipogranuloma #137 and 4 of 7 clones obtained
from lipogranuloma #139 used J558.45-DFL16.1-JH1 segments (Figs. 3-3B and 3-4A). One
sequence from lipogranuloma #139 and six from lipogranuloma #137 bore a VH36-60-DFL16.1-
JH4 rearrangement (Fig. 3-3B, indicated by *). However, sequence analysis showed that the
somatic mutations found in the sequence from lipogranuloma #139 differed substantially from
those in lipogranuloma #137, indicating that these sequences were clonally unrelated (Fig. 3-
4A). Four sequences from granuloma #139 and two from #140 did have identical germline
J558.45-DFL16.1-JH1 sequences (indicated by †). However, as all sequences were in a germline
configuration, it could not be determined whether they were clonally related or derived from two
clones that independently rearranged the same V-D-J segments. Sequences from the remaining
five granulomas from TMPD-treated mice contained no shared sequences. VH36-60 sequences
were isolated frequently from TMPD-, but not mineral oil-induced lipogranulomas (9 out of 78
vs. 0 out of 22 sequences).
The sequences recovered from mineral oil lipogranulomas were also diverse (Fig. 3-3C).
As in the TMPD lipogranulomas, there were occasional examples of the same V-D-J
combination being found in more than one lipogranuloma (Fig. 3-3C, indicated by **). In this
case, the sequences were identical (Fig. 3-4B). However, as was true of the shared sequences in
granulomas #139 and 140 (above), the sequences were germline, making it difficult to evaluate
69
whether they were derived from a single clone or two independent clones with the same V-D-J
segments.
As suggested by the representative sequences shown in Fig. 3-4B, the H-chain sequences
from ectopic lymphoid tissue in mineral oil treated mice contained fewer somatic mutations than
those from TMPD-treated mice. The total somatic mutation frequency in the heavy chain of
mice treated with TMPD was 4.9% (607 mutations/12466 bases) in contrast to 0.8% (37
mutations/4336 bases) in mineral oil treated mice. As shown in Table 3-1, the somatic mutations
were found predominantly in the CDR regions of sequences obtained from both TMPD- and
mineral oil- induced ectopic lymphoid tissue (replacement/silent mutation ratios of 7.2 and 8,
respectively, for the CDR regions of TMPD and mineral oil-treated mice vs. 1.7 and 2.0 for the
framework regions), suggesting that in both cases, somatic mutations were generated through a
process of antigen-selected affinity maturation.
Taken together, these data indicate that the B cells from ectopic lymphoid tissue induced
by TMPD or mineral oil in non-immunized mice were clonally diverse, although there was a
suggestion that certain clones may predominate within individual lipogranulomas and that
VH36-60, an H-chain that is utilized preferentially by B cells with rheumatoid factor or
rheumatoid factor-anti-DNA dual reactivity (146, 147), is used considerably more frequently in
TMPD- vs. mineral oil-induced ectopic lymphoid tissue. We found little evidence for sharing of
B cell clones between individual lipogranulomas, as might be expected if the ectopic lymphoid
tissue was populated by B cells arising from another location, such as the spleen or lymph nodes.
Somatic Hyper Mutation in TMPD-Treated Mice is T Cell-Dependent.
SHM of immunoglobulin genes occurring during the germinal center reaction usually
requires CD40L+ T cells (148). However, both inside and outside of germinal centers, SHM
sometimes may be T cell-independent (113, 149, 150). To investigate the role of T cells in
70
generating the somatic mutations in H-chain sequences from B cells in TMPD-induced ectopic
lymphoid tissue, we treated B6.129P2-Tcrbtm1MomTcrdTm1Mom (T cell receptor β-chain and
δ-chain deficient) and wild type C57BL/6J mice with TMPD and analyzed H-chain sequences
from the lipogranulomas 3 months later. V-D-J sequences from TcR deficient mice had a very
low rate of SHM (1 mutation/3252 total bases, 0.03%), whereas sequences from C57BL/6J mice
had a more than 20-fold higher rate (12 mutations/1626 bases, 0.7%). Significantly, these
mutations were found mainly in the CDR regions (Table 3-2). The greatly increased number of
somatic mutations in wild type vs. TcR deficient mice, clustering of mutations in the CDRs, and
the relatively low error rate reported for Taq polymerase (~ 1 error per 10,000 bases) argue that
the observed base changes represent true somatic hypermutation and not merely polymerase
errors. These data provide further evidence that the SHM seen in ectopic lymphoid tissue from
TMPD-treated mice was generated through a germinal center-like reaction.
Pristane-Induced Hypergammaglobulinemia and Autoantibody Production are also T Cell Dependent
Two of the characteristic immune abnormalities induced by TMPD treatment are induction
of polyclonal hypergammaglobulinemia and the development of IgM and IgG autoantibodies,
such as anti-RNP/Sm, associated with SLE. Since CSR to γ1 and γ2a H-chain occurs in TMPD-
induced ectopic lymphoid tissue (Fig. 3-2C), we investigated whether the increased production
of polyclonal serum IgG and IgG autoantibodies requires the presence of T cells. Total
immunoglobulin levels were determined (ELISA) in sera from TcR deficient and wild type mice
treated with TMPD 3 months earlier. Levels of IgM and IgG3 were comparable in wild type vs.
knockout mice (Fig. 3-5A) consistent with the fact that IgM and IgG3 antibody production is
largely T cell independent. However, IgG1 and IgG2a levels were significantly higher in the
71
wild type mice (Mann Whitney p = 0.008 and p = 0.03, respectively), indicating that the TMPD-
induced polyclonal increase in these isotypes was T cell mediated.
To determine whether some of the T cell-dependent immunoglobulin production was
derived from B cells present in the lipogranulomas, ELISPOT assays were performed using
isolated lipogranuloma cells and splenocytes. As shown in Figure 3-5B, pooled lipogranuloma B
cells from TMPD-treated mice secreted immunoglobulin of T cell dependent isotypes (IgG1,
IgG2a, IgG2b) at a frequency similar to that in the spleen. Although the percentage of
B220+CD138+ plasmablasts was lower in the lipogranulomas compared to spleen (Fig. 3-5C),
the frequency and size of the spots produced by lipogranuloma and splenic B cells was similar
suggesting that individual cells from the two locations secreted comparable amounts of
polyclonal immunoglobulin. We previously showed that after immunization with exogenous
antigen, T cells from the lipogranulomas secrete IL-21, which has been shown to play a role in
plasma cell differentiation (120). These data indicate that lipogranuloma cells actively secrete
antibodies of T-cell dependent isotypes.
Finally, we examined the role of ectopic lymphoid tissue induced by TMPD in the
pathogenesis of lupus-associated autoantibodies against the U1 small ribonucleoprotein (anti-Sm
and anti-RNP antibodies). IgM anti-RNP/Sm autoantibodies (ELISA) were detected at low, but
comparable, levels in the sera of wild type and TcR knockout mice (Fig. 3-6A). In contrast, IgG
anti-nRNP/Sm autoantibodies were produced by wild type animals but the levels in TcR
deficient mice were not statistically different than those in untreated controls (Fig. 3-6B). These
experiments suggested that not only was the induction of polyclonal IgG1 and IgG2a by TMPD
T cell dependent (Fig. 3-5), but also the appearance of class-switched serum autoantibodies
required T cells, a characteristic of autoantibodies generated during germinal center reactions.
72
The presence in ectopic lymphoid tissue of B cells producing class-switched
autoantibodies against the U1 small ribonucleoprotein was investigated using an ELISPOT for
anti-U1A (anti-RNP) autoantibodies. The purified recombinant U1A antigen used for ELISPOT
assays was reactive with sera from 19/20 anti-RNP and/or anti-Sm positive TMPD-treated
BALB/c mice, but not with 20 normal mouse sera (Fig. 3-6C). As shown in Fig. 3-6D, left
panel, large numbers of IgM anti-U1A autoantibody secreting cells were detected in cells
obtained from TMPD-induced ectopic lymphoid tissue, but not in ectopic lymphoid tissue
induced by medicinal mineral oil, which does not induce serum anti-RNP or anti-Sm
autoantibodies. Similarly, IgG anti-U1A autoantibody secreting cells were detected in TMPD-
induced ectopic lymphoid tissue, but not in mineral oil-induced ectopic lymphoid tissue (Fig. 3-
6D, right panel). We next compared the frequencies of anti-U1A secreting B cells in the
lipogranulomas vs. spleen of mice that were positive for serum anti-RNP autoantibodies (Fig. 3-
6E). A substantial difference in the frequency of anti-U1A secreting B cells in the
lipogranulomas vs. the spleen was observed (p = 0.01, Mann Whitney test). There also was a
significant difference in the frequencies of cells in the lipogranulomas secreting anti-U1A
autoantibodies vs. antibodies against a control foreign antigen, bovine serum albumin (BSA) (p =
0.03), suggesting that autoantibody producing cells may preferentially localize to or develop
within the ectopic lymphoid tissue.
These experiments indicate that class-switched autoantibody producing cells were present
within the ectopic lymphoid tissue and were secreting autoantibodies. Taken together, the data
in Figures 3-5 and 3-6 suggest that the increased polyclonal IgG as well as the IgG anti-RNP
autoantibodies in the sera of TMPD-treated mice are likely to be at least partially derived from B
cells/plasma cells in the ectopic lymphoid tissue.
73
Discussion
Structures morphologically and developmentally resembling secondary lymphoid organs
(ectopic lymphoid tissue) form at the sites of chronic inflammation, a process known as
lymphoid neogenesis (95, 98, 103). There is a strong association of lymphoid neogenesis with
humoral autoimmunity (98). However, the role of ectopic lymphoid tissue in initiating
immune/autoimmune responses, as opposed to serving as a reservoir for B lymphocytes
previously activated elsewhere, has not been fully defined. In NZB/W lupus mice, plasma cells
are activated in the spleen and secondarily migrate to inflamed tissues, such as the kidney (117,
124), whereas in patients with rheumatoid arthritis or Sjogren’s syndrome ectopic lymphoid
tissue may represent a site of antigen-dependent B cell differentiation consistent with a true
germinal center reaction (110, 111, 138).
Intraperitoneal exposure to TMPD induces lupus in mice (18, 26) with formation of
ectopic lymphoid tissue (63), consisting of “lipogranulomas”, discrete nodules attached to the
mesothelial lining of the peritoneal cavity (118). In certain strains of mice, notably
BALB/cAnPt, plasma cell neoplasms develop in the lipogranulomas after several months (151).
Closer examination shows that the lipogranulomas morphologically resemble secondary
lymphoid tissue, with discrete B cell and T cell-dendritic cell rich zones, MECA-79+ high
endothelial venules, and the expression of an array of lymphoid chemokines characteristic of
developing lymphoid tissue (63). Following immunization, T cells and B cells specific for
exogenous test antigens (NP-KLH and NP-OVA) are enriched in TMPD-lipogranulomas and
individual lipogranulomas frequently contain monoclonal populations of proliferating NP-
specific B cells along with proliferating carrier specific T cells (120).
The objective of the current study was to see if autoimmune responses can develop within
foci of chronic inflammation in lupus. T and B cell proliferation and AID expression as well as
74
SHM and CSR of immunoglobulin genes were found in TMPD-induced lipogranulomas. In
addition, we report that B cells actively secreting a prototypical lupus autoantibody, anti-U1A,
are enriched in the ectopic lymphoid tissue (Fig. 3-6E). A key question is whether the local
production of these autoantibodies is stimulated by cognate T-B interactions within the ectopic
lymphoid tissue (consistent with a germinal center reaction) or by antigen-independent
mechanisms, such as TLR signaling. Although unlike germinal centers, TMPD-induced ectopic
lymphoid tissue did not contain FDC-M1+ follicular dendritic cells (FDCs) (Fig. 3-1A), FDC-
M1- FDCs have been described (152).
In humans, FDCs have been reported in lymphoid neogenesis arising in the stomach,
rheumatoid synovium, salivary glands, and other locations (100, 107, 153), raising the possibility
that the germinal center-like structures found in these sites are sites of cognate T-B interaction
involved in autoantibody production. Conversely, autoantibodies can be produced
extrafollicularly by B cells located at the border between the T cell zone and the red pulp of the
spleen (113, 154, 155). This is a site where T cell-independent responses to foreign antigens
occur and it has been shown that in AM14 rheumatoid factor transgenic mice, the activation of
autoantibody production requires TLR signaling but not T cells (156).
The presence of AID and circle intermediates in TMPD-induced ectopic lymphoid tissue
(Fig. 3-2) strongly suggests that B cell activation occurs locally. AID, an enzyme required for
CSR and SHM (157, 158), is expressed in germinal centers (159). In addition, the presence of
circle transcripts (Fig. 3-2C), transient intermediates of CSR, that at least in vitro disappear
within 48 hours of being generated (145) strongly suggests that the ectopic lymphoid tissue is a
site of CSR, arguing against the possibility that isotype switched B cells secondarily migrate
there. However, although the presence of circle transcripts is suggestive of local CSR, we cannot
75
at present exclude the possibility that circle transcripts are degraded more slowly under in vivo
conditions.
In addition, although characteristic of germinal center reactions, AID expression and CSR
can be induced in B cells by TLR signaling (160-162). Thus, even though B cell activation
occurs locally, since the U1 small ribonucleoprotein carries an endogenous TLR7 ligand (163),
we cannot completely exclude the possibility that anti-Sm/RNP autoantibody production in the
ectopic lymphoid tissue is antigen-independent and driven by TLR7 signaling, as has been
reported for other autoantibodies. For instance, when injected with an IgG2a anti-chromatin
antibody, AM14 transgenic mice deficient in T cell receptors generate AM14 (rheumatoid factor)
antibody forming cells at frequencies comparable to those in TcR sufficient controls (156). The
T cell independent activation of these autoantibody producing cells is mediated by dual
engagement of the B cell receptor and Toll-like receptors. However, TLR signaling in TMPD-
induced ectopic lymphoid tissue was insufficient to drive significant IgM or class-switched
(IgG1, IgG2a) anti-Sm/RNP autoantibody production or SHM in TcR deficient mice (Fig. 3-6,
Table 3-2), consistent with the possibility that cognate interactions between anti-Sm/RNP B and
T cells take place in the ectopic lymphoid tissue, as also appears to be the case following
immunization with exogenous antigens (120).
Examination of the immunoglobulin repertoires in individual lipogranulomas provides
further evidence for the local activation of antigen-specific B cells within the ectopic lymphoid
tissue. If B cells activated elsewhere secondarily populate the ectopic lymphoid tissue, different
lipogranulomas might exhibit partially overlapping B cell repertoires, whereas if local expansion
occurs (as suggested by B cell proliferation in the lipogranulomas, Fig. 3-1), the B cell repertoire
should differ from lipogranuloma to lipogranuloma. In most cases, different B cell repertoires
76
were found in the individual lipogranulomas from the same mouse. We did not identify
immunoglobulin VH-D-JH sequences that were unequivocally shared by more than one
lipogranuloma. In two cases (one from a TMPD treated mouse and one from a mineral oil
treated mouse) identical V-D-J sequences were obtained from two different granulomas (Figs. 3-
3-3-4). However, due to the germline configuration of these sequences, it could not be
determined whether they were derived from individual B cell clones or from two B cells that
independently rearranged the same V-D-J. Similarly, the L-chain sequences from individual
lipogranulomas did not overlap (data not shown). Strikingly, the B cell repertoire in individual
lipogranulomas becomes highly oligoclonal following immunization with a foreign antigen (NP-
KLH or NP-OVA) concomitant with the appearance of proliferating carrier-specific T cells in
the same location (120). We conclude that autoantibody-secreting B cells most likely are
activated locally within the ectopic lymphoid tissue. This activation may be dependent on
cognate interactions with local antigen-specific T cells, although the possibility of T cell-
independent, TLR-mediated B cell activation cannot be completely excluded. Further studies of
the relative importance of T cells and TLR7 signaling for activating anti-Sm/RNP B cells in
ectopic lymphoid tissue may help elucidate why ectopic lymphoid tissue is associated with a
wide variety of humoral autoimmune disorders, including Hashimoto’s thyroiditis (99),
myasthenia gravis (135), multiple sclerosis (164), rheumatoid arthritis (110, 111), and Sjogren’s
syndrome(100, 108). Ectopic lymphoid tissue in TMPD lupus is a site of exuberant chronic
Type I interferon production (63), which is required for the development of anti-Sm/RNP
autoantibodies (40). The enrichment of anti-Sm/RNP B cells in the ectopic lymphoid tissue vs.
spleen (Fig. 3-6E) highlights the potential importance of chronic inflammation in the
pathogenesis of lupus autoantibodies, raising the possibility that ectopic lymphoid tissue
77
formation (165, 166) or other forms of chronic inflammation (167) may be involved in the
production of autoantibodies in human SLE as well in TMPD-lupus.
Figure 3-1. B and T cell proliferation in lipogranulomas. A, Immunohistochemistry of a TMPD-induced lipogranuloma (serial sections) demonstrating the presence of contiguous B cell (B220+) and T cell (CD3+) zones as well as cellular proliferation, as demonstrated by Ki-67 staining. Bottom right panel shows the absence of cells staining with the follicular dendritic cell marker FDC-M1 (FDC). B, Flow cytometry of lipogranuloma cells. Gates were set on either the B cells anti-CD45R (B220) or T cells (anti-CD4) and the percentage of cells staining with anti-Ki67 antibodies was determined. C, In vivo BrdU labeling of T and B cells in the lipogranulomas and spleens of TMPD-treated mice. Single cell suspensions were stained with anti-CD45R (B220), anti-CD3, and anti-BrdU antibodies. Data are expressed as the % of BrdU+ B cells or T cells, respectively.
78
Figure 3-2. TMPD lipogranulomas contain class switched B cells. A, Lipogranulomas express AID. Left, cDNA from TMPD or mineral oil lipogranulomas, spleen, or peritoneal cells was amplified using primers specific for AID or β-actin and analyzed by agarose gel electrophoresis. Right, AID mRNA was quantified by real-time PCR normalized to 18S RNA. B, μ and γ H-chain transcripts. Lipogranuloma and spleen cDNA from mineral oil or TMPD treated mice was tested for expression of IgM and IgG1 by PCR using VHF1-8 and Cμ or Cγ1 reverse primers, respectively. Left, agarose gel of amplified PCR products from lipogranulomas or spleen. γ1 transcripts are seen strongly in two TMPD lipogranulomas (TMPD, lanes 1 and 4) and weakly in another (TMPD, lane 3). Right, frequencies of IgM and IgG1 production in TMPD vs. mineral oil lipogranulomas (4 individual lipogranulomas/mouse, 3 mice/group). C, Circle transcripts. Presence of isotype specific I promoter-Cγ2a transcripts in lipogranulomas from TMPD-treated but not in mineral oil treated mice. Circle transcripts were detected using Iγ2aF forward primer and CμR reverse primer. PCR product sizes closely approximated the expected sizes of 458 and 318 bp (15) (arrows). PCR using Β-actin primers was used as a loading control. D, Direct immunofluorescence for IgM (top) and IgG (bottom) producing cells in lipogranulomas from mineral oil or TMPD-treated mice. Both IgM and IgG producing cells were detected in ectopic lymphoid tissue from TMPD-treated mice, but only IgM producing cells in tissue from mineral oil-treated mice.
79
Figure 3-2. Continued
80
Figure 3-3. Individual TMPD-induced lipogranulomas contain distinctive populations of B cells.
A, pooled forward primers (VHF1-8) and consensus reverse primer (VHR2) used for amplifying cDNA from lipogranulomas. B, H-chains recovered from lipogranulomas obtained from TMPD-treated BALB/c mice. Lipogranulomas #137, 139, and 140 were isolated from the same mouse. Lipogranulomas #190 and 193 were from a second mouse and lipogranulomas #201 and 204 from a third mouse. C, H-chains recovered from two lipogranulomas (#149 and 150) obtained from a mineral oil-treated BALB/c mouse.
81
Figure 3-4. VH sequences from TMPD-induced lipogranulomas. A, Sequence alignments of VH36-60-DFL16.1-JH4 H-chains isolated from lipogranulomas #137 and 139 (two individual lipogranulomas from a single TMPD-treated mouse). Sequences obtained from the two different granulomas were unrelated, whereas the 6 sequences in granuloma #137 were identical. B, Sequence alignments of J558.f-DSP2.9-JH2 H-chains isolated from two different lipogranulomas (#149 and 150) from a mineral oil-treated mouse.
82
Figure 3-5. IgG1 and IgG2a induced hypergammaglobulinemia in TMPD-treated mice is T cell
dependent. A, Serum samples were obtained from wild type C57BL/6J (WT, n = 5) or B6.129P2-Tcrbtm1MomTcrdTm1Mom (n = 6) mice treated 3 months earlier with TMPD. IgG1, IgG2a, IgG3, and IgM levels were measured by ELISA and means were compared by the Mann-Whitney test. B, IgG production in lipogranulomas. Lipogranuloma cells and splenocytes from two mice were tested in quadruplicate for T cell dependent immunoglobulin secretion (IgG1+ IgG2a+IgG2b) by ELISPOT assay. C, Quantification of plasmablasts in spleen and lipogranulomas. Pooled lipogranuloma and spleen cells from four TMPD-treated BALBc/J mice were stained with anti-B220 and anti-CD138 antibodies and analyzed by flow cytometry.
83
Figure 3-6. Ig G anti-nRNP/Sm autoantibody production in TMPD-treated mice is T cell dependent. A and B, Serum samples were obtained from wild type C57BL/6J (WT, n = 5) or B6.129P2-Tcrbtm1MomTcrdTm1Mom (n = 6) mice treated 3 months earlier with TMPD. IgM (A) and IgG (B) anti-nRNP/Sm antibody levels were measured by ELISA at a 1:500 serum dilution. Means were compared by the Mann-Whitney test. C, Reactivity of sera with recombinant U1-A protein (ELISA). Recombinant 6His-tagged U1-A protein was expressed in E. coli and purified on a Ni-NTA affinity column. Sera from 20 TMPD-treated BALB/c mice positive for anti-Sm/RNP autoantibodies and 20 normal BALB/c mouse sera were tested for reactivity with the recombinant antigen at a 1:100 dilution (ELISA). D, IgM and IgG ELISPOT assay with purified U1-A antigen using cells isolated from collagenase treated ectopic lymphoid tissue from an anti-RNP positive TMPD-treated mouse or an anti-RNP negative mouse treated with medicinal mineral oil. Representative of 3 experiments. E, IgG ELISPOT assay with purified U1-A or bovine serum albumin (BSA) antigens, using cells isolated from lipogranulomas (Lipogran) or spleens of anti-U1-A positive mice (n = 5). The frequencies of antigen-specific spots are expressed per 50,000 B cells. The frequency of anti-U1-A spots was higher in lipogranulomas than in spleen (P = 0.01, Mann-Whitney test) and the frequency of anti-U1-A spots was higher than the frequency of anti-BSA spots (P = 0.03, Mann-Whitney test).
84
Figure 3-6. Continued.
85
Table 3-1. Somatic hypermutation of H-chains from ectopic lymphoid tissue Treatment # of sequences # of mice # of lipogranulomas FR R FR S CDR R CDR
S R/S FR R/S CDR
TMPD 20 2 4 66 39 72 10 1.7 7.2 Mineral oil
20 2 4 23 11 16 2 2 8
86
Table 3-2. Somatic hypermutation in ectopic lymphoid tissue from TcR deficient mice Framework CDRs R/S ratio Strain # of
lipogranulomas # of sequences
R (%) S (%) R (%) S (%) FR CDR
WT* 2 6 0.08 0.32 1.30 0.50 0.25 2.5 TcR KO 4 12 0 0 0.13 0 0 ***
87
CHAPTER 4 MAINTENANCE OF ANTI-SM/RNP AUTOANTIBODY PRODUCTION IN
EXPERIMENTAL LUPUS BY PLASMA CELLS RESIDING IN ECTOPIC LYMPHOID TISSUE AND MEMORY B CELLS RESIDING IN THE BONE MARROW
Introduction
Lymphoid neogenesis, the formation of ectopic (tertiary) lymphoid tissue in response to
inflammation (103), is associated with the production of autoantibodies in several diseases
including Sjogren’s syndrome, rheumatoid arthritis, and myasthenia gravis (112, 135, 168). It
remains unclear whether ectopic lymphoid tissue participates directly in generating autoreactive
B cells or indirectly as a reservoir for antibody-secreting cells. Lymphoid neogenesis
recapitulates many aspects of secondary lymphoid tissue development (95). Approximately 3
months after intraperitoneal exposure of non-lupus prone mice to 2, 6, 10, 14
tetramethylpentadecane (TMPD), ectopic lymphoid tissue (“lipogranulomas”) form and the mice
develop lupus (63). Autoantibodies are produced against the U1, U2, U4-U6, and U5 small
nuclear ribonucleoproteins (snRNPs) (anti-Sm and anti-RNP) as well as proteins associated with
micro RNAs (anti-Su) and dsDNA (18). Ectopic lymphoid tissue induced by TMPD is
organized in to T and B cell zones, is vascularized by high endothelial venules, and expresses
high levels of chemokines that attract T cells and dendritic cells (CCL19, CCL21), as well as B
cells (CXCL13) (18).
B cells in this ectopic lymphoid tissue exhibit many of features reminiscent of a germinal
center response, including class switch recombination and expression of activation-induced
cytidine deaminase(37). After primary immunization with exogenous antigen, antigen-specific B
and T lymphocytes home to the ectopic lymphoid tissue and there actively secretes of class-
switched, antigen-specific immunoglobulin (120). Interestingly, IgG anti-RNP (U1-A)
autoantibody-secreting cells also are enriched in the ectopic lymphoid tissue (37). The
88
relationship between these cells and the persistent anti-U1A autoantibody levels in the serum is
at present unknown.
Long-term serological memory can be maintained by several mechanisms: 1) long-lived
plasma cells, normally found in the bone marrow, may continue to secrete antibodies for many
years (169); 2) memory B cells may be continuously stimulated by antigen-specific T cells to
undergo differentiation into short-lived plasma cells, which secrete antibodies and then undergo
apoptosis after ~ 1-2 weeks (126, 170); or 3) memory B cells may be driven polyclonally
through Toll-like receptor stimulation to develop into short-lived plasma cells (171, 172). The
objective of this study was to examine how autoantibody responses to the Sm/RNP autoantigen
(anti-U1A autoantibodies) are maintained in TMPD-induced lupus and to evaluate the role
played by chronic inflammation and ectopic lymphoid tissue in the persistence of autoantibody
formation. The data suggest that ectopic lymphoid tissue is enriched in both long- and short-
lived plasma cells producing anti-U1A autoantibodies, but nearly devoid of anti-U1A memory B
cells. Unexpectedly, the bone marrow of TMPD-treated mice proved to be a major reservoir of
anti-U1A memory B cells and contained very few anti-U1A plasma cells.
Methods and Materials
Mice
Six-week-old female C57BL/6, BALBC/J, CB.17, and T cell transgenic C.Cg-Tg
(DO11.10)10Dlo/J (DO11.10) mice were purchased from Jackson Laboratory (Bar Harbor, ME)
and housed in barrier cages. At 2 months of age, C57BL/6, BALBC/J, CB.17, and DO11.10
mice received 0.5 ml of TMPD (Sigma-Aldrich, St. Louis, MO) or mineral oil (Harris Teeter)
i.p. or left untreated. Three months later, lipogranulomas were harvested for transplantation.
These studies were approved by the Institutional Animal Care and Use Committee.
89
Lipogranuloma Transplantation
For transplantation, TMPD-induced lipogranulomas were harvested from mice confirmed
by ELISA to be producing anti-U1A antibodies. Recipient mice underwent an upper midline
laparotomy beginning at the mid-abdominal region and terminating superiorly at the xiphoid
process. The harvested donor lipogranulomas were then transplanted onto the lateral aspect of
the peritoneal surface of the right and left costo-diaphramatic junctions using a 6-0
polypropylene monofilament suture. The midline laparotomy was re-approximated with
interrupted subcutaneous monofilament sutures and the overlying skin secured with surgical
wound clips. Mice received 1 mL of physiological saline for resuscitation at transplant
completion. When indicated, mice also received lipogranuloma tissue subcutaneously or
intraperitoneally without any suture to hold it in place. Sham procedures were carried out with a
midline laparotomy and placement of a 6-0 polypropylene monofilament suture on the lateral
aspect of the peritoneal surface of the right and left costo-diaphramatic junctions. Sham-
transplanted mice also received at the termination of the procedure.
Flow Cytometry
Cell suspensions from transplanted lipogranuloma or recipients spleens were analyzed
using annexin 5-7AAD staining (apoptotic cell kit, BD). T cells were analyzed with anti-CD3,
anti-CD4, anti-B220, anti-CD11b, anti-CD25, anti-IgMa , and anti-IgMb antibodies (BD
Biosciences, San Jose, CA) and anti-Foxp3 antibodies (eBioscience, San Diego, CA). DO11.10
T cells were identified using anti-DO11.10 (KJI-26)-APC antibodies (Invitrogen, Caltag
Laboratories, Carlsbad, CA). Data were acquired on a CyAn ADP flow cytometer (Dako, Fort
Collins, Colorado) and analyzed with FCS Express Version 3 (DeNovo Software, Thornhill,
Ontario, Canada). At least 50,000 events per sample were acquired and analyzed using size
gating and Sytox blue (Invitrogen ) to exclude dead cells.
90
Anti-U1A (RNP) ELISA
The ELISA was carried out as described previously, using 6-His tagged recombinant U1A
protein expressed in E. coli (5 μg/ml) as antigen(37). Serum samples were tested at a 1:250
dilution followed by incubation with alkaline phosphatase-labeled goat anti-mouse IgG (1:1000
dilution) or biotinylated IgG2aa, IgG2ab, IgMa, or IgMb (BD Biosciences, 1 hr at 22°C), a 45
minute incubation with neutralite-avidin (Southern Biotechnology, Birmingham, AL), and
development with p-nitrophenyl phosphate substrate (Sigma-Aldrich). Optical density at 405 nm
(OD405) was read using a VERSAmax microplate reader (Molecular Devices Corporation,
Sunnyvale, CA).
Detection of Autoantibodies by Immunoprecipitation
The presence of anti-Sm/RNP autoantibodies was confirmed by immunoprecipitation of
[35S]-labeled cellular proteins and analyzed on a 12.5% SDS-polyacrylamide gel as described
(18).
Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR)
Total RNA was precipitated with isopropanol and the pellet washed with cold 75% (v/v)
ethanol and resuspended in diethyl pyrocarbonate-treated water. One µg of RNA was reverse
transcribed to cDNA using Superscript First-Strand Synthesis System for RT-PCR (Invitrogen).
One µl of cDNA was added to the PCR mixture containing PCR buffer, 2.5 mmol/L MgCl2, 400
µmol/L dNTPs, 0.025 U of TaqDNA polymerase (Invitrogen), and 1 µmol/L each of forward
and reverse primers in a 20-µl volume. Primers were as follows: CXCL21 forward 5'-ATG ATG
ACT CTG AGC CTC C-3' and reverse 5'-GAG CCC TTT CCT TTC TTT CC-3'; CXCL13
forward 5'-ATG AGG CTC AGC ACA GCA AC-3' and reverse 5'-CCA TTT GGC ACG AGG
ATT CAC-3'. 18s forward 5'-CGGCTACCACATCCAAGGAA-3' and reverse 5'-
GCTGGAATTACCGCGGCT-3'. Amplification was for 5 min at 94°C, followed by 35 cycles
91
of denaturation at 94°C for 1 min, annealing at 60°C for 1 min, extension at 72°C for 1 min, and
a final extension of 72°C for 10 min in a PTC-100 programmable thermal controller (MJ
Research, Inc., Waltham, MA). PCR primers were synthesized by Invitrogen.
Quantitative PCR
Gene expression was quantified by real-time PCR. One µl of cDNA was added to a
mixture containing 3.75 mmol/L MgCl2, 1.25 mmol/L dNTP mixture, 0.025 U of Amplitaq
Gold, SYBR Green dye (Applied Biosystems, Foster City, CA), and optimized concentrations of
specific forward and reverse primers an a final volume of 20 µl. CXCL12 primers were as
follows: forward 5'-TGC TCT CTG CTT GCC TCC A-3' and reverse 5'-GGT CCG TCA GGC
TAC AGA GGT-3' and 18s (see above). Amplification conditions were 95°C (10 min), followed
by 45 cycles of 94°C (15 sec), 60°C (25 sec), 72°C (25 sec), and a final extension at 72°C for 8
minutes using a DNA Engine Opticon 2 continuous fluorescence detector (MJ Research).
Transcripts were quantified using the comparative (2– Ct) method.
ELISPOT Assay for Anti-RNP Autoantibody Secreting Cells
The production of anti-U1A (a subset of anti-RNP) autoantibodies in the ectopic lymphoid
tissue was examined by ELISPOT assay as previously described (37).
Statistical Analysis.
For quantitative variables, differences between groups were analyzed by the unpaired
Student's t test. Survival curves were analyzed using the log-rank test. ANA titers and
autoantibody levels were compared using the Mann-Whitney U test. Data are presented as means
± SD. All tests were two-sided, and P < 0.05 was considered significant. Statistical analyses were
performed using Prism 4.0 software (GraphPad Software, Inc.).
92
Results
Antigen-specific B and T lymphocytes, including autoantibody-producing cells, home to
TMPD-induced lipogranulomas (120). We asked whether this ectopic lymphoid tissue continues
to be functional outside of a chronically inflamed milieu by transplanting lipogranulomas into
non-TMPD treated mice. Lipogranulomas were excised from TMPD-treated mice that were
seropositive for anti-U1-A autoantibodies (ELISA) and transplanted into non-TMPD-treated
(anti-U1-A negative) recipients. After 35 days, the transplanted lipogranulomas had a similar
appearance to that of pre-transplant ectopic lymphoid tissue when stained with hematoxylin &
eosin (Fig. 4-1A). The transplanted ectopic lymphoid tissue was tightly adherent to the
mesothelial surface of the peritoneum overlying the abdominal musculature. The transplants
were vascularized, as determined by the distribution of intravenously injected Evans Blue dye
(EBD), an intravascular marker, in the lipogranulomas (Fig. 4-1B). Blue staining of the
transplanted lipogranulomas confirmed that the high endothelial venules in the transplanted
ectopic lymphoid tissue (reference) became connected to the host’s circulation. To verify that
the cells in the transplanted lipogranuloma remained viable, a single cell suspension was stained
with markers of apoptosis and necrosis (annexin 5 and 7AAD, respectively) and the total cell
population was analyzed by flow cytometry (Fig. 4-1C). Although only 50% of the total cells
isolated from transplanted lipogranulomas were annexin 5- 7AAD-, this was similar to the
percentage of live cells found in pre-transplant lipogranulomas (57% annexin 5- 7AAD-). The
percentage of living cells is also comparable to mineral oil-induced lipogranulomas (54%
annexin 5- 7AAD-). Thus, not only were the lipogranulomas re-vascularized after
transplantation, but they also contained similar numbers of viable cells to those found in pre-
transplant lipogranulomas.
93
By flow cytometry, the cellular composition of transplanted lipogranulomas was similar to
that of pre-transplant lipogranulomas. Lymphocytes in the transplanted lipogranulomas (35 days
post-transplant) consisted of 28% CD4+ T cells and 46% B cells, vs. 24% and 51%, respectively
in non-transplanted lipogranulomas (Fig. 4-1D). The percentages in lipogranulomas and spleen
were similar. Similarly, the percentages of CD11b+B220- cells (monocytes) in the transplanted
and pre-transplant lipogranulomas were similar (11% and 10%, respectively), but less than the
percentage in the spleen (3.4%). These data suggest that the composition of pre- and post-
transplant ectopic lymphoid tissue is similar.
Lipogranulomas contain autoantibody-secreting cells that can be detected using ELISPOT
assays (37). To evaluate the functionality and ultimate fate of these cells following
transplantation of lipogranulomas from anti-U1A positive TMPD-treated mice, sera were
collected from transplant recipients at days 0, 7, 14, and 28 days and the secretion of IgG anti-
U1A was analyzed by ELISA. Serum anti-U1A activity was detectable by ELISA and
immunoprecipitation in mice receiving TMPD lipogranulomas starting at day 7-14 post-
transplant and increased up to 28 days post-transplant (Fig. 4-2A). These autoantibodies also
could be detected by immunoprecipitation (Fig. 4-2B). In contrast, mice transplanted with
mineral oil (anti-U1A negative) lipogranulomas or mice transplanted subcutaneously with
TMPD lipogranulomas did not develop detectable levels of anti-U1A by 28 days (Fig. 4-2A).
Likewise, sham transplanted mice did not develop anti-U1A autoantibodies.
To determine if autoantibody production by the transplanted ectopic lymphoid tissue is
affected by the chronic inflammatory response, mice were pre-treated with TMPD or mineral oil
2 weeks prior to transplantation with lipogranulomas from anti-U1-A positive donors (Fig. 4-
2C). In comparison with untreated controls, the strong inflammatory response induced 2 weeks
94
after TMPD treatment (69) did not increase serum autoantibody levels in the recipient mice, nor
did mineral oil pre-treatment. To verify that pre-treatment with TMPD or mineral oil did not
induce anti-U1-A autoantibody production independently of the transplanted ectopic lymphoid
tissue sham-transplanted mice also were pre-treated with TMPD or mineral oil. These control
mice did not produce anti-U1-A autoantibodies. Anti-U1-A remained detectable in the serum of
the mice transplanted with lipogranulomas from TMPD-treated donors up to 60 days afterward
(Fig. 4-2C). In contrast, the TMPD pre-treated sham mice began to produce anti-U1A by day 60
post-transplant (80 days after TMPD pre-treatment), consistent with previous observations that
TMPD treated mice develop an anti-Sm/RNP response at ~ 3 months post-treatment (18).
Despite the production of Sm/RNP autoantibodies, recipient mice failed to develop kidney
disease, as indicated by measurement of proteinuria (Fig 4-2D). These data suggest that the
transplanted ectopic lymphoid tissue contains long-lived plasma cells producing anti-U1A
autoantibodies or else that it is capable of generating new short-lived plasma cells capable of
secreting anti-U1A autoantibodies.
To examine the role of T cells in the production of autoantibodies in the transplanted mice,
we transplanted U1A+ lipogranulomas from BALB/c mice into BALB/c CD4 T cell transgenic
DO11.10 mice. Surprisingly, serum anti-U1A autoantibody levels were higher in DO11.10
recipients than in wild type controls (P = 0.02, Mann-Whitney; Fig. 4-3A). Using an antibody
against the transgenic T cells (KJI-26), we found that by 35 days after transplantation, donor
lipogranulomas were repopulated with large numbers of recipient T cells (Fig. 4-3B, C).
Approximately 75-80% of the CD4+ T cells in the transplanted lipogranulomas were of donor
(transgenic) origin, a percentage similar to that seen in the spleen. The transplanted
lipogranulomas expressed the T cell attractive chemokine CXCL21 (Fig. 4-3D), which may
95
mediate the influx of recipient T cells into the transplant. These data suggest that naïve T cells
may transit through the transplanted ectopic lymphoid tissue in a manner analogous to that in
authentic secondary lymphoid tissue.
The increased levels of serum anti-U1A autoantibodies in OVA-specific TcR transgenic
DO11.10 recipients raised the possibility that recipient regulatory T cells might down-modulate
anti-U1A autoantibody production. CD4+CD25+FoxP3+ regulatory T cells are thought to
down-regulate autoantibody production in some circumstances (173), and the numbers of these
cells in the lipogranulomas increased following transplantation (Fig. 4-3E). The percentage of
CD4+CD25+FoxP3+ T cells in the lipogranulomas, presumably of recipient origin (Fig. 4-3E),
increased in 4 out of 4 mice tested before transplantation and again 28 days later (mean 11.12%
pre-transplant vs. 21.4% post-transplant, P = 0.02, Mann Whitney). However, at least at 28 days
post-transplantation, the presence of these cells did not turn off autoantibody production (Fig. 4-
2A). We next examined whether the recipient’s B lymphocytes also could enter the transplanted
ectopic lymphoid tissue.
To examine the B cell populations in the transplanted lipogranulomas, anti-U1A+
lipogranulomas were transplanted from the allotype congenic CB.17 (Ighb) donors into BALB/c
(Igha) recipients. We took advantage of the fact that anti-U1A autoantibodies induced by TMPD
are predominantly IgG2a in BALB/c mice (29). Instead of IgG2aa, the CB.17 strain expresses
IgG2ab (also termed IgG2c). An IgG2a allotype-specific anti-U1A ELISA, we found that all of
the serum anti-U1A autoantibodies in BALB/c mice transplanted with CB.17 lipogranulomas
were of donor (CB.17) origin (Fig. 4-4A). The level of serum IgG2aa (BALB/c origin) anti-U1-
A autoantibodies was no different from that of sham transplanted mice. In contrast, IgG2ab
96
(CB.17 origin) anti-U1A autoantibody levels increased significantly following transplantation,
indicating that the anti-U1A autoantibodies were derived exclusively from the donor B cells.
The presence of donor and recipient surface IgM+ B cells in the transplanted
lipogranulomas was examined 35 days post-transplant (Fig. 4-4B). Pre-transplantation, the
lipogranulomas contained exclusively IgMb (CB.17 donor) B cells. In contrast, by 28 days post-
transplantation, these cells were entirely replaced by B cells of recipient origin (BALB/c, IgMa).
Post-transplantation, the lipogranulomas contained significantly more recipient (IgMb) than
donor (IgMb) B cells (Fig 4C, P=0.002 Mann-Whitney). Similar to the expression of the T cell
attractive chemokine CXCL21 (Fig. 4-3D), the B cell chemokine CXCL13 was expressed in the
transplanted lipogranulomas (Fig. 4-4D). These data suggest that within 1 month of
transplantation, the donor B and T lymphocytes in the lipogranulomas were largely replaced by
lymphocytes of recipient origin. Nevertheless, the serum anti-U1A autoantibody levels
continued to increase over that time and are exclusively of donor origin. The simplest
interpretation of these data is that the anti-U1A autoantibodies were produced by long-lived
plasma cells or perhaps memory B cells from the transplanted lipogranulomas.
To examine the importance of long-lived plasma cells vs. memory cells in the production
of anti-U1A autoantibodies, CD4+ T cells were depleted in the donors as well as the recipient
mice using the CD4-depleting monoclonal antibody GK1.5. By treating the anti-U1A+ donor
mice with GK1.5 four days prior to surgery nearly all CD4 T cells could be eliminated from the
donor lipogranulomas (Fig. 4-5A). Recipient mice were treated with GK1.5 or an irrelevant
control antibody at the time of surgery and continued to receive treatments up to 35 days post
surgery. CD4+ T cells remained depleted in the peripheral blood of the recipient mice
throughout the 35-day duration of this study, whereas the control antibody had no effect (Fig. 4-
97
5B). After 35 days, lipogranulomas and spleens were excised from mice that received GK1.5 or
control antibody and the numbers of viable (CD4+, Sytox blue-) cells were determined by flow
cytometry. As shown in Fig. 4-5C, CD4+ T cells were undetectable in the GK1.5 treated mice.
Interestingly, there was a significant decrease in the numbers of CD138+CD44+ plasma cells in
the spleen and lipogranulomas of the GK1.5 treated mice (Fig. 4-5D, P = 0.016, Mann Whitney
test, for both spleen and lipogranulomas), consistent with the presence of short-lived plasma cells
in both locations. In contrast, depletion of CD4+ cells had little effect on the levels of serum IgG
anti-U1A autoantibodies in transplanted mice (Fig. 4-5E), suggesting that the serum anti-U1A
autoantibodies in the transplanted mice were derived from a population of long-lived plasma
cells. It has been demonstrated that the half-life of IgG antibodies in an adult mouse is 3
weeks(174). Thus, if the antibody was generated by a plasma cell prior to transplantation,
antibody levels would be reduced by at least half 35 days post transplant.
We next examined whether depleting CD4+ T cells had any effect on anti-Sm/RNP
autoantibody production in non-transplanted TMPD-treated mice. Induction of anti-Sm/RNP
and anti-U1A autoantibodies by TMPD is abolished in nude mice and in T cell receptor deficient
mice (37, 123). However, the role of T cells in maintaining autoantibody production once it has
been established has not been examined. We therefore administered GK1.5 monoclonal
antibodies weekly to U1A+ TMPD treated mice. Peripheral blood CD4 counts were monitored
every 7 days to verify depletion of all CD4+ cells (data not shown). After 35 days of GK1.5
treatment, lipogranuloma and spleen were harvested and the presence of live CD4 T cells was
determined by flow cytometry. As shown in Fig. 4-6A, the lipogranulomas and spleen did not
contain any CD4 T cells. Following GK1.5 treatment there was a reduction in the percentage of
CD44+CD138+ plasma cells in the spleen, but in contrast to the transplanted lipogranulomas,
98
this was not seen in non-transplanted lipogranulomas (Fig. 4-6B). Depletion of CD4+ T cells
resulted in a substantial decrease in the levels of serum IgG anti-U1A autoantibodies at 35 days
(Fig. 4-6C). Serum levels of IgG anti-U1A were compared between day 0 and day 35 from
individual mice treated with GK1.5 or control antibody. Despite the significant decrease after T
cell depletion, serum IgG anti-U1A was still detectable (Fig. 4-6C). Anti-U1A activity
remained significantly higher than background levels in non-TMPD-treated mice. This may be
partly because the half-life of murine IgG in adult mice is 3 weeks (174). Since it remained
unclear how much anti-U1A autoantibody could be produced de novo in the absence of CD4+ T
cells, we examined the numbers of anti-U1A autoantibody producing cells in TMPD-treated
mice receiving GK1.5 antibodies. Memory B cells, but not plasma cells, can be stimulated to
secrete antibody in vitro in the presence of LPS (171, 172). Therefore, B cells from the
lipogranulomas, spleen, or bone marrow of TMPD-treated, anti-U1A+, mice cultured in the
presence or absence of LPS (5 μg/mL) followed by assessment of the numbers of anti-U1A
secreting cells by ELISPOT (Fig. 4-6E). In both the spleen and bone marrow, the number of IgG
anti-U1A spots increased significantly in the presence of LPS, consistent with the presence of a
memory B cell population. In contrast, the number of spots in the lipogranulomas was
unaffected by LPS, suggesting that memory B cells in the ectopic lymphoid tissue could not be
activated by TLR4 ligand to become AFCs. However, when T cells were depleted using GK1.5
antibodies, the number of anti-U1A spots in lipogranulomas was decreased (P = 0.007 vs.
treatment with control antibody, Mann Whitney test Fig 4-6D). These data suggest that the anti-
U1A autoantibody response in the ectopic lymphoid tissue was partly T cell dependent and partly
T cell independent. The T cell dependent fraction apparently was not derived from a population
of B cells/plasma cells capable of being stimulated by LPS. In contrast, the T cell independent
99
production of anti-U1A autoantibodies could be enhanced by TLR stimulation. The situation
was similar in the spleen, there was an increase in the number of anti-U1A spots following LPS
treatment. In contrast to the lipogranulomas and spleen, very few spontaneous anti-U1A
secreting cells were detected in the bone marrow. However, following stimulation with LPS,
large numbers of anti-U1A secreting B cells were found. Their numbers were unaffected by
GK1.5 antibody treatment (Fig. 4-6D).
A striking and unexpected observation of the ELISPOT experiment (Fig. 4-6D) was the
absence of anti-U1A secreting cells in the bone marrow, a major site for the accumulation of
long-lived plasma cells (175). To examine whether the absence of plasma cells was unique to
autoantibody producing cells or a more general phenomenon, we determined the number of
CD138+sIgM- plasma cells in the bone marrow of TMPD-treated vs. untreated mice or TMPD-
treated IFNAR -/- mice which do not develop autoantibodies. As shown in Fig. 4-7A, the
number of plasma cells was substantially lower in the two TMPD-treated groups. The
expression of CXCL12 (real-time PCR) also was much lower in the bone marrow of TMPD
treated mice vs. untreated controls (Fig. 4-7B). Expression of CXCL12 was seen in the
lipogranulomas from TMPD-treated mice, although it was lower than that seen in untreated bone
marrow. These data suggest that TMPD treatment may lead to the depletion of mature plasma
cells from the bone marrow by reducing the expression of CXCL12. Additionally, expression of
CXCL12 in the ectopic lymphoid tissue may promote the recruitment/retention of long-lived
plasma cells in the lipogranulomas.
Discussion
Ectopic lymphoid tissue (lipogranulomas) induced by i.p. injection of TMPD is a site
where antigen-specific B and T lymphocytes accumulate and autoantibody secreting cells (ASC)
can be detected readily (120). Here, we show that when this ectopic lymphoid tissue was
100
transplanted into a non-TMPD treated recipient, autoantibody production by donor ASC
continued for up to 2 months but there was no generation of autoantibody-producing host B cells.
At the same time, the activated (CD69+) donor B cells within the ectopic lymphoid tissue were
replaced by host B and T lymphocytes exhibiting a resting (CD69-) phenotype (Fig 4-8B).
Using CD4 depletion and LPS stimulation, which respectively decrease or increase plasma
cell differentiation of switched memory B cells while having little effect on mature plasma cells
(170), we found that plasma cells were the main ACSs in the ectopic lymphoid tissue (Figs. 4-5E
and 4-6E-4-6F). T cell depletion had little effect on serum anti-U1A antibody levels (Fig. 4-5D),
but reduced the numbers of CD138+CD44+ plasma cells (Fig. 4-5D), consistent with the
presence of both long-lived plasma cells (unaffected by GK1.5 mAb treatment) and short-lived
plasma cells, which require T cell help to be generated from precursor memory cells (170).
TMPD treatment induced remarkable changes in the distribution of autoantibody-
producing plasma cells and memory B cells, some of which (activated CD69+ B cells in the
ectopic lymphoid tissue) were IFN-I dependent and some (redistribution of long-lived plasma
cells) IFN-I independent. In addition, we identified the bone marrow of TMPD-treated mice as
an important reservoir of autoreactive memory B cells. TMPD-stimulated ectopic lymphoid
tissue formation may promote autoantibody production through the persistent recruitment of
IFN-I secreting monocytes promoting lymphocyte activation and by providing survival niches
for autoantibody-secreting plasma cells. However, the data also raise the possibility that
activated B cells from the ectopic lymphoid tissue may generate memory B cells that either home
to, or persist in, the bone marrow. Unlike the bone marrow plasma cells, which are substantially
depleted following TMPD treatment, autoreactive memory cells persist in the bone marrow and
101
may be a renewable pool of switched-memory cells capable of developing into autoantibody
secreting cells that are attracted/retained in the ectopic lymphoid tissue by CXCL12.
Ectopic Lymphoid Tissue is a Major Site of Autoantibody Production in TMPD-Lupus
Ectopic lymphoid tissue is associated with autoantibody production in several autoimmune
disorders (105). Using the transplant model, ectopic lymphoid tissue can be studied outside of a
chronic inflammatory environment, although with the caveat that the immunoglobulin repertoire
may vary from lipogranuloma to lipogranuloma (120), leading to variability in the anti-U1A
levels of different recipient mice.
The ectopic lymphoid tissue of TMPD-treated mice was a significant reservoir for plasma
cells secreting IgG anti-U1A (anti-RNP) autoantibodies, with nearly double the number of U1A
specific ASC per 100,000 B cells as the spleen (Fig. 4-6). Most of these cells apparently were
short-lived plasmablasts/plasma cells derived from the T cell-mediated activation of memory B
cells, since they could be depleted with GK1.5 mAb. Consistent with previous reports that long-
lived plasma cells home to the inflamed kidneys and spleen of NZB/W mice (117), the chronic
inflammatory process in TMPD-induced lipogranulomas also attracted substantial numbers of
presumptive long lived plasma cells (unaffected by 28 days of GK1.5 mAb treatment).
However, they were less numerous than short-lived plasma cells/plasmablasts (Fig. 4-6).
Increased numbers of autoantibody producing plasma cells also have been reported in ectopic
lymphoid tissue in Sjogren’s syndrome, rheumatoid arthritis, and myasthenia gravis (108, 135,
176) .
Regulation of Autoantibody Production in Transplanted Ectopic Lymphoid Tissue
Transplantation of lipogranulomas from anti-U1A+ mice allowed us to examine the
regulation of autoantibody production from ectopic lymphoid tissue in a non-inflammatory/non-
autoimmune milieu. The ASCs continued to secrete autoantibodies exclusively of donor origin
102
that were detectable in the serum for up to 2 months after transplantation. Serum autoantibody
(anti-Sm/RNP) levels peaked ~1 month after transplantation, and were then maintained for an
additional month (Fig. 4-2C). Since the half-life of murine IgG is less than 3 weeks (174), the
data suggest but do not prove that they were produced by long-lived plasma cells.
To further address the origin of anti-U1A autoantibodies we treated TMPD-treated U1A+
mice with GK1.5 and found that serum anti-U1A antibodies decreased ~60-70%. Nevertheless,
some serum autoantibodies remained detectable (Fig. 4-6C-D), suggesting a portion of the IgG
anti-U1A activity was maintained by mechanisms that were independent of T cells. These
autoantibodies may be derived from long-lived plasma cells or memory B cells driven to undergo
terminal differentiation by TLR ligands (156). In the absence of T cells memory B cells, and not
plasma cells, can be stimulated with LPS in vitro (171). LPS treatment revealed the presence of
anti-U1A B cells in the spleen and, unexpectedly, the bone marrow (Fig. 4-6E). However, the
number of ASCs in lipogranulomas did not change with LPS stimulation, suggesting that the
ectopic lymphoid tissue contained few memory cells. Thus, T cell dependent autoantibody
responses in the lipogranulomas resemble extrafollicular germinal center-like responses
developing in the spleen of mice with spontaneous lupus (137, 177).
Transplanted lipogranulomas maintained populations of T and B lymphocytes strongly
resembling those in the spleen and pre-transplant lipogranulomas (Fig. 4-1D). In contrast, the
numbers of monocytes in pre- and post- transplant lipogranulomas was approximately 3-fold
higher than in the spleen. Before transplantation, many of these monocytes are immature
(Ly6Chi) cells producing Type I interferon (IFN-I)(69). The activation marker CD69 is IFN-I
inducible, suggesting that the IFN-I producing Ly6Chi monocytes in lipogranulomas may
promote B and T cell activation in the ectopic lymphoid tissue (Fig. 4-8A). This is likely to
103
represent local, rather than systemic, IFN-I production, since the splenic B cells of TMPD-
treated mice were CD69- (Fig. 4-8A). As Ly6Chi monocytes in TMPD-treated mice have a
lifespan of ~3 days and are continuously replaced by Ly6Chi monocytes exiting the bone
marrow (69), the loss of CD69+ B cells in the transplanted lipogranulomas (Fig. 4-8B) may
reflect diminished recruitment of Ly6Chi IFN-I producing cells from bone marrow precursors
due to the absence of peritoneal inflammation in the recipient mice. Production of anti-Sm/RNP
autoantibodies in TMPD-lupus is strictly dependent on IFN-I production that is stimulated by a
TLR7 and MyD88-dependent pathway (70). The generation of new (recipient-derived)
autoreactive B cells in the transplanted ectopic lymphoid tissue may cease because they are
“starved” of IFN-I (Fig 4-8C).
Altered Bone Marrow Plasma Cell Homeostasis in TMPD-Treated Mice
Chronic inflammation causes profound alterations in the bone marrow, with a marked
decrease in lymphopoiesis and a corresponding increase in myeloid precursors (178). The
present data suggest that besides altering lymphopoiesis/myelopoiesis, TMPD treatment also
substantially alters the plasma cell compartment. The bone marrow is the major site of “survival
niches” for long-lived plasma cells (179). However, in contrast to the large number of anti-U1A
ASCs inhabiting ectopic lymphoid tissue, they were nearly quantitatively absent in the bone
marrow (Fig. 4-6). There was a similar, but less profound, depletion of total class-switched
(IgM-CD138+) plasma cells in the bone marrow.
Remarkably, although plasma cells were absent, the bone marrow contained presumptive
switched memory B cells that did not secrete IgG anti-U1A autoantibodies spontaneously but
could be stimulated to become ASCs by TLR4 ligand (Fig. 4-6). This population is reminiscent
of the “bone marrow memory” subset identified previously by Cooper, et al. (180). The
functional significance of this subset is at present unknown. Retention of this population of
104
autoreactive B cells in the bone marrow is unlikely to involve CXCL12 (181), which is greatly
decreased in the bone marrow of TMPD-treated mice (Fig. 4-7B). Consistent with that
possibility, we failed to detect these cells in the ectopic lymphoid tissue of TMPD-treated mice
(Fig. 4-6D), which expresses large amounts of CXCL12 (Fig. 4-7B).
We hypothesize that in the presence of T cells, memory B cells may migrate into the
lipogranuloma from either spleen or the bone marrow and develop extrafollicularly into
plasmablasts/plasma cells. After transplantation a reservoir of bone marrow/splenic memory
cells is no longer present and serum anti-U1A antibodies in the recipients are derived entirely
from plasma cells (both long- and short-lived) transplanted along with the ectopic lymphoid
tissue. The possibility that ectopic lymphoid tissue is populated by plasma cells derived from a
novel subset of autoreactive bone marrow memory B cells warrants further investigation.
105
Figure 4-1. Transplanted lipogranuloma become vascularized. (A) Endogenous TMPD-induced
or surgically implanted lipogranulomas were removed from BALB/c mice, and 5μm paraffin embedded sections were stained with hematoxylin & eosin. (B) Transplanted recipient mice were injected i.v. with 0.5% Evans blue dye (EBD, n = 5) or left uninjected (n = 3). (C) Transplanted lipogranulomas (n = 6) were removed from recipient mice and analyzed by flow cytometry for dead/dying cells using annexin-5 and 7-AAD staining. (D) Cellular composition of spleen and lipogranulomas was evaluated by gating on living cells (annexin-5 and 7-AAD staining). Upper panel, percentages of B cells (B220), T cells (CD4) in the transplanted lipogranulomas compared to pre-transplanted lipogranulomas and spleen. Lower panel, percentages of monocytes (CD11b+, B220-).
106
Figure 4-2. Serum levels of anti-U1A antibodies in recipient mice. Serum samples were
collected at 7, 14, 28, and 35 days from mice either transplanted i.p with U1A+ TMPD-induced lipogranulomas (n = 7), U1A – mineral oil-induced lipogranulomas (n = 5), s.c. with U1A+ TMPD-induced lipogranulomas (n = 4), or sham transplanted (n = 4). (A) Sera were tested for IgG anti-U1A antibodies by ELISA. (B) Anti-U1A antibodies in the sera of mice transplanted i.p with U1A+ TMPD-induced lipogranulomas were detected by immunoprecipitation of [S35]- labeled cell extract. (C) Mice were injected i.p. two weeks prior to surgery with either TMPD (n = 7) mineral oil (n = 7) or left un-injected (n = 7). Sera collected at days 0, 7, 14, 28, and 60 were tested for IgG anti-U1A antibodies as in (A). (D) Urine was collected from mice and tested by dipstick on days 0, 7, 14, 28, and 55 following surgery. Data are representative of two experiments.
107
Figure 4-3. Recipient T cells repopulate transplanted lipogranulomas. (A) D011.10 mice
received U1A+ lipogranulomas from TMPD treated BALB/c (n = 6). Sera were collected at days 0, 7, 14, 28, 35 following surgery and IgG anti-U1A was assessed by ELISA. (B) Lipogranulomas and spleen were harvested from DO11.10 mice 35 days after transplant and the percentage of recipient transgenic (CD4+KJI-26+) T cells was detected in each tissue by flow cytometry (gated on lymphocytes and CD4+ cells). (C) Percentages of recipient transgenic T cells (KJI-26+) found in lipogranulomas 35 days after transplant compared with pre-transplant lipogranulomas (P = 0.007, Mann-Whitney test). (D) cDNA from transplanted lipogranulomas (Lipogran) and the spleen or recipient BALB/c mice was tested for CXCL21 expression by RT-PCR and normalized to 18S rRNA expression (representative of four experiments). (E) Regulatory T cells were analyzed from harvested lipogranulomas pre-transplant and 35 days post-transplant by staining for surface markers CD4+ CD25+ and the intracellular marker FoxP3+ (flow cytometry, n = 4).
108
Figure 4-4. Anti-U1A antibodies are made exclusively from donor lipogranulomas. (A) U1A+
lipogranulomas from CB.17 (Ighb) mice were transplanted into BALB/c (Igha) recipients (n = 6). Sera were collected at days 0, 7, 14, 28, 35 and IgG2ab (IgG2c) or IgG2aa anti-U1A antibodies were assessed by ELISA. (B and C) Transplanted lipogranulomas or un-transplanted lipogranulomas from CB.17 mice was harvested at day 35 and the B cells (B220+) were stained for recipient (IgMa) or donor (IgMb) allotypes (flow cytometry). A representative plot shows the percentage of allotype-specific B cells in transplanted lipogranuloma. Data are representative of two experiments (P = 0.02, Mann-Whitney test). (D) cDNA from a BALB/c transplanted lipogranuloma (Lipogran) or spleen from a recipient mouse was tested for CXCL13 expression (RT-PCR) normalized to 18S rRNA (representative of four experiments).
109
Figure 4-5. Serum anti-U1A antibodies in transplanted mice persist after T cell depletion. (A)
U1A+ lipogranuloma from TMPD treated mice were treated with T cell depleting mAb GK1.5 (n = 5, left) or control (Ctl, n = 4, right) antibody. (B) Recipient mice were bled every 7 days and CD4+ T cell depletion was analyzed by flow cytometry. (C) Lipogranuloma and spleen were excised from recipient mice 35 days after transplant and CD4 T cells were examined by flow cytometry GK1.5mAb (shaded) control mAb (open). (D) Plasma cells (CD44+ CD138+) from recipient spleen and transplanted lipogranulomas were analyzed after treatment with GK1.5 or control antibody (p = 0.01, Mann-Whitney test). (E) Sera were collected from either GK1.5 or control antibody treated mice at day 0, 7, 14, 28 and 35 post-transplant. Serum IgG anti-U1A levels were assessed by ELISA (data representative of two experiments).
110
Figure 4-6. IgG anti-U1A antibody levels are decreased but not abolished after T cell depletion.
TMPD treated mice were administered GK1.5 or control antibody for 35 days. (A) Spleen and lipogranulomas were devoid of CD4+ T cells after GK1.5 treatment (shaded) whereas CD4+ T cells were still present after treating with control antibody (open). (B) Plasma cells (CD44+ CD138+) from GK1.5 and control antibody-treated lipogranulomas and spleen were analyzed by flow cytometry. (C) Serum IgG anti-U1A antibodies from TMPD-treated mice pre-GK1.5 or control antibody treatment vs. 35 days post-treatment. The % decrease of IgG anti-U1A post-treatment is shown (p = 0.03, Mann-Whitney test). (D) IgG anti-U1A serum levels from TMPD mice treated with GK1.5 vs. control antibody (p = 0.06, Mann-Whitney test) or from non-TMPD-treated BALB/c mice (NSC) (p = 0.02, Mann-Whitney test). (E) Lipogranuloma, spleen, and bone marrow were harvested from TMPD treated mice treated with either GK1.5 or control antibody. B cells were negatively selected and cultured in the presence or absence of LPS (5 μg/ml) for 5 days. IgG anti-U1A antibody production from cultured B cells was measured by ELISPOT (* P ≤ 0.02; ** P ≤ 0.04 Mann-Whitney test).
111
Figure 4-7. TMPD treatment depletes plasma cells from the bone marrow. (A) Bone marrow
from TMPD treated BALB/c, IFNAR-/- or untreated BALB/c was harvested. The presence of CD138+IgM- plasma cells was detected by flow cytmotery (left panel). The percentages of bone marrow plasma cells is compared between each group of mice (right panel) ( P ≤ 0.02 Mann-Whitney test). (B) Using real-time PCR the amount of CXCL12 was quantified from bone marrow cDNA of each group (P = 0.02; P = 0.03 Mann-Whitney test)
112
Figure 4-8. The effect of IFN-I on lymphocyte activation. (A) Lipogranuloma and spleen from TMPD-treated were harvested and the activated B cells (CD19+CD69+) and T cells (CD4+CD69+) were stained by flow cytometry. (B) Activated B cells (CD19+CD69+) from lipogranuloma pre and post transplant as well as spleen from TMPD-treated or recipient mice was analyzed by flow cytometry. (C) To determine the effect IFN-I has on the production of autoantibodies post transplant, U1A+ lipogranulomas were transplanted into IFNAR-/- mice. Sera were collected from at day 0, 7, 14, and 35 post-transplant. Serum IgG anti-U1A levels were assessed by ELISA (data representative of two experiments).
113
CHAPTER 5 FUTURE DIRECTIONS
B Cells in the TMPD Model
Although I have been able to demonstrate that autoantibodies are secreted from long lived
plasma cells in the lipogranuloma, the generation of these autoantibodies still remains
unanswered. It is still unclear how tolerance is broken in many autoimmune diseases and
specifically in the TMPD model. I have identified a subset of B cells (IgM-IgD+) in the TMPD-
induced lipogranulomas that differs from both spleen and mineral oil lipogranulomas (Fig 5-1).
Despite having similar number of antibody secreting B cells (Fig 3-5), the lipogranulomas tend
to secrete a smaller amount of antibody (Fig 2-3D) on a per B cell basis compared to spleen.
Taken together with the finding of fewer CD138+ plasma cells, this IgM-IgD+ B cell subset may
have a role in the class switched antibody production in the lipogranuloma. A study showed that
in the absence of IgM, there is a population (IgM-IgD+) that is able to secrete class switched
antibodies (182). The role and development of this B cell subset needs to be investigated further.
I have data showing that only TMPD-induced lipogranulomas and not mineral oil
lipogranulomas contains activated (CD69+) B cells. In addition I demonstrated that after
transplant the B cell that repopulate the lipogranuloma express the activation marker CD69 (Fig
4-8B ). Follicular dendritic cells (FDC), involved in germinal center censoring of B cells is not
found in the lipogranuloma(183). Potentially, the activated B cells in the lipogranulomas are
able to expand in the absence of a proper censoring mechanism and may be the cause of the
break in tolerance leading to autoimmunity in this model.
T Cells in the TMPD Model
I have shown that the initial generation and persistence of autoantibody production is T
cell dependent (chapter 3 and 4). Previous work has shown that in the absence of Th1 cytokines,
114
the autoantibody response is diminished but not abolished (29). In contrast, deletion of Th2
cytokines resulted in a slight increase in the Th1 dominated autoantibody response (43). I have
some preliminary evidence that TMPD actually drives a Th1 response in the lipogranulomas and
not in the spleen, suggesting that the dominant autoreactive IgG2a response is possibly generated
in the lipogranuloma. Similar to lipogranuloma B cells, there is evidence that T cells in
lipogranulomas express higher levels of the activation marker CD69 compared to spleen(Fig 4-
8A). In combination with the activated B cells this may account for the break in tolerance
leading to the generation of autoantibodies. Despite that the autoantibody response is T cell
dependent, it still remains uncertain if a T cell breaks tolerance first then activates a B cell or
vice versa.
Bone Marrow in the TMPD Model
It has been demonstrated that in acute inflammatory responses, the bone marrow undergoes
extensive myelopoiesis and lymphpoiesis(178). Bone marrow of TMPD treated mice behave
similarly to the bone marrow of mice undergoing this acute response. Four months after TMPD
injection, the bone marrow still exhibits an increase in the number of CD11b monocytes in an
IFN-I independent manner(Fig 5-2A-5-2B). TMPD increases the inflammatory cytokine IL-1β,
which expands the bone marrow granulocyte (CD11b) compartment (184, 185). Conversely, the
number of IgM+ B cells and CD138 plasma cells in the bone marrow is decreased compared to
control bone marrow. It remains to be investigated if this disruption of bone marrow architecture
is contributing to the pathogenesis of TMPD-induced autoimmunity.
Conclusion
The work presented revealed a potential role for ectopic lymphoid tissue in the
development of autoimmunity. The B and T lymphocytes present in this tissue are not only
antigen-specific but capable of generating a de novo immune response leading to the production
115
of class switched antibodies. In addition, we have developed a novel transplant model that
allows ectopic lymphoid tissue to be studied further in various immunological environments.
These studies greatly enhance the understanding of the pathogenesis of the TMPD-induced lupus
mouse model. Although ectopic lymphoid tissue has not been documented in human SLE, the
TMPD-induced ectopic lymphoid tissue is a useful model to examine the mechanism of
production of autoantibodies in many other autoimmune diseases.
Figure 5-1. Lipogranulomas contain an increased IgM-IgD+ B cell population. Spleen and lipogranuloma from either TMPD treated or mineral oil were harvested and made into single cell suspensions. Cells were gated on lymphocytes and the staining for IgM and IgD was analyzed by flow cytometry.
116
Figure 5-2. TMPD drives an increase in CD11b+ cells in the bone marrow. (A) Bone marrow
was harvested from untreated Sv129, TMPD treated Sv129 or IFNRA-/- mice. The percentage of CD11b+ myeloid cells in the bone marrow was analyzed by flow cytometry. (B) The total myeloid cell count from bone marrow of treated mice.
117
REFERENCES
1. Heimbach, J. T., A. R. Bodor, J. S. Douglass, L. M. Barraj, S. C. Cohen, R. W. Biles, and H. R. Faust. 2002. Dietary exposures to mineral hydrocarbons from food-use applications in the United States. Food Chem Toxicol 40:555-571.
2. Stryker, W. A. 1941. bsorbtion of liquid petrolatum ("mineral oil") from the intestine. .
Arch. Pathol. 31:670-692. 3. Wanless, I. R., and W. R. Geddie. 1985. Mineral oil lipogranulomata in liver and spleen.
A study of 465 autopsies. Arch Pathol Lab Med 109:283-286. 4. Potter, M., and C. R. Boyce. 1962. Induction of plasma-cell neoplasms in 5. Anderson, P. N., and M. Potter. 1969. Induction of plasma cell tumours in BALB-c mice
with 2,6,10,14-tetramethylpentadecane (pristane). Nature 222:994-995. 6. Nordan, R. P., and M. Potter. 1986. A macrophage-derived factor required by
plasmacytomas for survival and proliferation in vitro. Science 233:566-569. 7. Potter, M., and F. Wiener. 1992. Plasmacytomagenesis in mice: model of neoplastic
development dependent upon chromosomal translocations. Carcinogenesis 13:1681-1697.
8. Fattori, E., M. Cappelletti, P. Costa, C. Sellitto, L. Cantoni, M. Carelli, R. Faggioni, G.
Fantuzzi, P. Ghezzi, and V. Poli. 1994. Def 9. Shaw, C. M., E. C. Alvord, Jr., and M. W. Kies. 1964. Straight Chain Hydrocarbons as
Substitutes for the Oil in Freund's Adjuvants in the Production of Experimental "Allergic" Encephalomyelitis in the Guinea Pig. J Immunol 92:24-27.
10. Crowle, A. J., and C. C. Hu. 1966. A comparison of n-hexadecane and mineral oil 11. Whitehouse, M. W., K. J. Orr, F. W. Beck, and C. M. Pearson. 1974. Freund's adjuvants:
relationship of arthritogenicity and adjuvanticity in rats to vehicle composition. Immunology 27:311-330.
12. Dupuis, M., K. Denis-Mize, A. LaBarbara, W. Peters, I. F. Charo, D. M. McDonald, and
G. Ott. 2001. Immunization with the adju 13. Dupuis, M., T. J. Murphy, D. Higgins, M. Ugozzoli, G. van Nest, G. Ott, and D. M.
McDonald. 1998. Dendritic cells in 14. Valentino, M., V. Rapisarda, and C. Fenga. 2003. Hand injuries due to high-pressure
injection devices for painting in shipyards: circumstances, management, and outcome in twelve patients. Am J Ind Med 43:539-542.
118
15. Spickard, A., 3rd, and J. V. Hirschmann. 1994. Exogenous lipoid pneumonia. Arch Intern Med 154:686-692.
16. Sharif, F., E. Crushell, K. O'Driscoll, and B. Bourke. 2001. Liquid paraffin: a reappraisal
of its role in the treatment of constipation. Arch Dis Child 85:121-124. 17. Potter, M., and J. S. Wax. 1981. Genetics of susceptibility to pristane-induced
plasmacytomas in BALB/cAn: reduced susceptibility in BALB/cJ with a brief description of pristane-induced arthritis. J Immunol 127:1591-1595.
18. Satoh, M., and W. H. Reeves. 1994. Induction of lupus-associated autoantibodies in
BALB/c mice by intraperitoneal injection of pristane. J Exp Med 180:2341-2346. 19. Satoh, M., H. B. Richards, V. M. Shaheen, H. Yoshida, M. Shaw, J. O. Naim, P. H.
Wooley, and W. H. Reeves. 2000. Widespread susceptibility among inbred mouse strains to the induction of lupus autoantibodies by pristane. Clin Exp Immunol 121:399-405.
20. Hirano, T., T. Taga, K. Yasukawa, K. Nakajima, N. Nakano, F. Takatsuki, M. Shimizu,
A. Murashima, S. Tsunasawa, F. Sakiyama, and et al. 1987. Human B-cell differentiation factor defined by an anti-peptide antibody and its possible role in autoantibody production. Proc Natl Acad Sci U S A 84:228-231.
21. Nagafuchi, H., N. Suzuki, Y. Mizushima, and T. Sakane. 1993. Constitutive expression
of IL-6 receptors and their role in the excessive B cell function in patients with systemic lupus erythematosus. J Immunol 151:6525-6534.
22. Kobayashi, I., T. Matsuda, T. Saito, K. Yasukawa, H. Kikutani, T. Hirano, T. Taga, and
T. Kishimoto. 1992. Abnormal distribution of IL-6 receptor in aged MRL/lpr mice: elevated expression on B cells and absence on CD4+ cells. Int Immunol 4:1407-1412.
23. Tang, B., T. Matsuda, S. Akira, N. Nagata, S. Ikehara, T. Hirano, and T. Kishimoto.
1991. Age-associated increase in interleukin 6 in MRL/lpr mice. Int Immunol 3:273-278. 24. Jourdan, M., R. Bataille, J. Seguin, X. G. Zhang, P. A. Chaptal, and B. Klein. 1990.
Constitutive production of interleukin-6 and immunologic features in cardiac myxomas. Arthritis Rheum 33:398-402.
25. Yoshizaki, K., T. Matsuda, N. Nishimoto, T. Kuritani, L. Taeho, K. Aozasa, T. Nakahata,
H. Kawai, H. Tagoh, T. Komori, and et al. 1989. Pathogenic significance of interleukin-6 (IL-6/BSF-2) in Castleman's disease. Blood 74:1360-1367
. 26. Satoh, M., A. Kumar, Y. S. Kanwar, and W. H. Reeves. 1995. Anti-nuclear antibody
production and immune-complex glomerulonephritis in BALB/c mice treated with pristane. Proc Natl Acad Sci U S A 92:10934-10938.
119
27. Hamilton, K. J., M. Satoh, J. Swartz, H. B. Richards, and W. H. Reeves. 1998. Influence of microbial stimulation on hypergammaglobulinemia and autoantibody production in pristane-induced lupus. Clin Immunol Immunopathol 86:271-279.
28. Richards, H. B., M. Satoh, M. Shaw, C. Libert, V. Poli, and W. H. Reeves. 1998.
Interleukin 6 dependence of anti-DNA antibody production: evidence for two pathways of autoantibody formation in pristane-induced lupus. J Exp Med 188:985-990.
29. Richards, H. B., M. Satoh, J. C. Jennette, B. P. Croker, H. Yoshida, and W. H. Reeves.
2001. Interferon-gamma is required for lupus nephritis in mice treated with the hydrocarbon oil pristane. Kidney Int 60:2173-2180.
30. Satoh, M., K. J. Hamilton, A. K. Ajmani, X. Dong, J. Wang, Y. S. Kanwar, and W. H.
Reeves. 1996. Autoantibodies to ribosomal P antigens with immune complex glomerulonephritis in SJL mice treated with pristane. J Immunol 157:3200-3206.
31. Satoh, M., E. L. Treadwell, and W. H. Reeves. 1995. Pristane induces high titers of anti-
Su and anti-nRNP/Sm autoantibodies in BALB/c mice. Quantitation by antigen capture ELISAs based on monospecific human autoimmune sera. J Immunol Methods 182:51-62.
32. Satoh, M., Y. Kuroda, H. Yoshida, K. M. Behney, A. Mizutani, J. Akaogi, D. C.
Nacionales, T. D. Lorenson, R. J. Rosenbauer, and W. H. 33. Kuroda, Y., J. Akaogi, D. C. Nacionales, S. C. Wasdo, N. J. Szabo, W. H. Reeves, and
M. Satoh. 2004. Distinctive Patterns of Autoimmune Response Induced by Different Types of Mineral Oil. Toxicol Sci. 78(2):222-8
34. Mizutani, A., V. M. Shaheen, H. Yoshida, J. Akaogi, Y. Kuroda, D. C. Nacionales, Y.
Yamasaki, M. Hirakata, N. Ono, W. H. Reeves, and M. Satoh. 2005. Pristane-induced autoimmunity in germ-free mice. Clin Immunol 114:110-118.
35. Jakymiw, A., K. Ikeda, M. J. Fritzler, W. H. Reeves, M. Satoh, and E. K. Chan. 2006.
Autoimmune targeting of key components of RNA interference. Arthritis Res Ther 8:R87.
36. Satoh, M., J. J. Langdon, C. H. Chou, D. P. McCauliffe, E. L. Treadwell, T. Ogasawara,
M. Hirakata, A. Suwa, P. L. Cohen, R. A. Eisenberg, and et al. 1994. Characterization of the Su antigen, a macromolecular complex of 100/102 and 200-kDa proteins recognized by autoantibodies in systemic rheumatic diseases. Clin Immunol Immunopathol 73:132-141.
37. Nacionales, D. C., J. S. Weinstein, X. J. Yan, E. Albesiano, P. Y. Lee, K. M. Kelly-
Scumpia, R. Lyons, M. Satoh, N. Chiorazzi, and W. H. Reeves. 2009. B cell proliferation, somatic hypermutation, class switch recombination, and autoantibody production in ectopic lymphoid tissue in murine lupus. J Immunol 182:4226-4236.
120
38. Wooley, P. H., J. R. Seibold, J. D. Whalen, and J. M. Chapdelaine. 1989. Pristane-induced arthritis. The immunologic and genetic features of an experimental murine model of autoimmune disease. Arthritis Rheum 32:1022-1030.
39. Levitt, N. G., F. Fernandez-Madrid, and P. H. Wooley. 1992. Pristane induced arthritis in
mice. IV. Immunotherapy with monoclonal antibodies directed against lymphocyte subsets. J Rheumatol 19:1342-1347.
40. Nacionales, D. C., K. M. Kelly-Scumpia, P. Y. Lee, J. S. Weinstein, R. Lyons, E. Sobel,
M. Satoh, and W. H. Reeves. 2007. Deficiency of the type I interferon receptor protects mice from experimental lupus. Arthritis Rheum 56:3770-3783.
41. Finkelman, F. D., A. Svetic, I. Gresser, C. Snapper, J. Holmes, P. P. Trotta, I. M. Katona,
and W. C. Gause. 1991. Regulation by interferon alpha of immunoglobulin isotype selection and lymphokine production in mice. J Exp Med 174:1179-1188.
42. Taniguchi, T., and A. Takaoka. 2002. The interferon-alpha/beta system in antiviral
responses: a multimodal machinery of gene regulation by the IRF family of transcription factors. Curr Opin Immunol 14:111-116.
43. Calvani, N., M. Satoh, B. P. Croker, W. H. Reeves, and H. B. Richards. 2003.
Nephritogenic autoantibodies but absence of nephritis in Il-12p35-deficient mice with pristane-induced lupus. Kidney Int 64:897-905
44. Mendiratta, S. K., W. D. Martin, S. Hong, A. Boesteanu, S. Joyce, and L. Van Kaer.
1997. CD1d1 mutant mice are deficient in natural T cells that promptly produce IL-4. Immunity 6:469-477.
45. Asea, A., and J. Stein-Streilein. 1998. Signalling through NK1.1 triggers N 46. Yang, J. Q., A. K. Singh, M. T. Wilson, M. Satoh, A. K. Stanic, J. J. Park, S. Hong, S. D.
Gadola, A. Mizutani, S. R. Kakumanu, W. H. Reeves, V. Cerundolo, S. Joyce, L. Van Kaer, and R. R. Singh. 2003. Immunoregulatory role of CD1d in the hydrocarbon oil-induced model of lupus nephritis. J Immunol 171:2142-2153.
47. Kuroda, Y., D. C. Nacionales, J. Akaogi, W. H. Reeves, and M. Satoh. 2004.
Autoimmunity induced by adjuvant hydrocarbon oil components of vaccine. Biomed Pharmacother 58:325-337.
48. Kuroda, Y., N. Ono, J. Akaogi, D. C. Nacionales, Y. Yamasaki, T. T. Barker, W. H.
Reeves, and M. Satoh. 2006. Induction of lupus-related specific autoantibodies by non-specific inflammation caused by an intraperitoneal injection of n-hexadecane in BALB/c mice. Toxicology 218:186-196.
121
49. Tan, E. M., A. S. Cohen, J. F. Fries, A. T. Masi, D. J. McShane, N. F. Rothfield, J. G. Schaller, N. Talal, and R. J. Winchester. 1982. The 1982 revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum 25:1271-1277.
50. Smith, D. L., X. Dong, S. Du, M. Oh, R. R. Singh, and R. R. Voskuhl. 2007. A female 51. Chowdhary, V. R., J. P. Grande, H. S. Luthra, and C. S. David. 2007. Characterization of
haemorrhagic pulmonary capillaritis: another manifestation of Pristane-induced lupus. Rheumatology (Oxford) 46:1405-1410.
53. Ravetch, J. V., and S. Bolland. 2001. IgG Fc receptors. Annu Rev Immunol 19:275-290. 54. Clynes, R., C. Dumitru, and J. V. Ravetch. 1998. Uncoupling of immune complex
formation and kidney damage in autoimmune glomerulonephritis. Science 279:1052-1054.
55. Kitching, A. R., P. G. Tipping, J. R. Timoshanko, and S. R. Holdsworth. 2000.
Endogenous interleukin-10 regulates Th1 responses that induce crescentic glomerulonephritis. Kidney Int 57:518-525.
56. Horii, Y., A. Muraguchi, M. Iwano, T. Matsuda, T. Hirayama, H. Yamada, Y. Fujii, K.
Dohi, H. Ishikawa, Y. Ohmoto, and et al. 1989. Involvement of IL-6 in mesangial proliferative glomerulonephritis. J Immunol 143:3949-3955.
57. Ruef, C., K. Budde, J. Lacy, W. Northemann, M. Baumann, R. B. Sterzel, and D. L.
Coleman. 19 58. Naito, T., H. Yokoyama, K. J. Moore, G. Dranoff, R. C. Mulligan, and V. R. Kelley.
1996. Macrophage growth factors introduced into the kidney initiate renal injury. Mol Med 2:297-312.
59. Ioannou, Y., and D. A. Isenberg. 2000. Current evidence for the induction of autoimmune
rheumatic manifestations by cytokine therapy. Arthritis Rheum 43:1431-1442. 60. Kalkner, K. M., L. Ronnblom, A. K. Karlsson Parra, M. Bengtsson, Y. Olsson, and K.
Oberg. 1998. Antibodies against double-stranded DNA and development of polymyositis during treatment with interferon. Qjm 91:393-399.
61. Ronnblom, L. E., G. V. Alm, and K. E. Oberg. 1991. Autoimmunity after alpha-
interferon therapy for malignant carcinoid tumors. Ann Intern Med 115:178-183. 62. Mathian, A., A. Weinberg, M. Gallegos, J. Banchereau, and S. Koutouzov. 2005. IFN-
{alpha} Induces Early Lethal Lupus in Preautoimmune (New Zealand Black x New Zealand White)F1 but Not in BALB/c Mice. J Immunol 174:2499-2506.
122
63. Nacionales, D. C., K. M. Kelly, P. Y. Lee, H. Zhuang, Y. Li, J. S. Weinstein, E. Sobel, Y. Kuroda, J. Akaogi, M. Satoh, and W. H. Reeves. 2006. Type I interferon production by tertiary lymphoid tissue developing in re
64. Santiago-Raber, M. L., R. Baccala, K. M. Haraldsson, D. Choubey, T. A. Stewart, D. H.
Kono, and A. N. Theofilopoulos. 2003. Type-I interferon receptor deficiency reduces lupus-like disease in NZB mice. J Exp Med 197:777-788.
65. Jorgensen, T. N., E. Roper, J. M. Thurman, P. Marrack, and B. L. Kotzin. 2007. Type I
interferon signaling is involved in the spontaneous development of lupus-like disease in B6.Nba2 and (B6.Nba2 x NZW)F(1) mice. Genes Immun.
66. Thibault, D. L., A. D. Chu, K. L. Graham, I. Balboni, L. Y. Lee, C. Kohlmoos, A.
Landrigan, J. P. Higgins, R. Tibshirani, and P. J. Utz. 2008. IRF9 and STAT1 are required for IgG autoantibody production and B cell expression of TLR7 in mice. J Clin Invest 118:1417-1426.
67. Zhuang, H., S. Narain, E. Sobel, P. Y. Lee, D. C. Nacionales, K. M. Kelly, H. B.
Richards, M. Segal, C. Stewart, M. Satoh, and W. H. Reeves. 2005. Association of anti-nucleoprotein autoantibodies with upregulation of Type I interferon-inducible gene transcripts and dendritic cell maturation in systemic lupus erythematosus. Clin Immunol. 117(3):238-50
68. Hasegawa, H., M. Kohno, M. Sasaki, A. Inoue, M. R. Ito, M. Terada, K. Hieshima, H.
Maruyama, J. Miyazaki, O. Yoshie, M. Nose, and S. Fujita. 2003. Antagonist of monocyte chemoattractant protein 1 ameliorates the initiation and progression of lupus nephritis and renal vasculitis in MRL/lpr mice. Arthritis Rheum 48:2555-2566.
69. Lee, P. Y., J. S. Weinstein, D. C. Nacionales, P. O. Scumpia, Y. Li, E. Butfiloski, N. van
Rooijen, L. Moldawer, M. Satoh, and W. H. Reeves. 2008. A novel Type I IFN-producing cell subset in murine lupus. J Immunol 180:5101-5108.
70. Lee, P. Y., Y. Kumagai, Y. Li, O. Takeuchi, H. Yoshida, J. Weinstein, E. S. Kellner, D.
Nacionales, T. Barker, K. Kelly-Scumpia, N. van Rooijen, H. Kumar, T. Kawai, M. Satoh, S. Akira, and W. H. Reeves. 2008. TLR7-dependent and FcgammaR-independent production of type I interferon in experimental mouse lupus. J Exp Med 205:2995-3006.
71. Bave, U., M. Magnusson, M. L. Eloranta, A. Perers, G. V. Alm, and L. Ronnblom. 2003.
Fc gamma RIIa is expressed on natural IFN-alpha-producing cells (plasmacytoid dendritic cells) and is required for the IFN-alpha production induced by apoptotic cells combined with lupus IgG. J Immunol 171:3296-3302.
72. Cella, M., D. Jarrossay, F. Facchetti, O. Alebardi, H. Nakajima, A. Lanzavecchia, and M.
Colonna. 1999. Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon. Nat Med 5:919-923.
123
73. Coccia, E. M., M. Severa, E. Giacomini, D. Monneron, M. E. Remoli, I. Julkunen, M. Cella, R. Lande, and G. Uze. 2004. Viral infection and Toll-like receptor agonists induce a differential expression of type I and lambda interferons in human plasmacytoid and monocyte-derived dendritic cells. Eur J Immunol 34:796-805.
74. Baccala, R., K. Hoebe, D. H. Kono, B. Beutler, and A. N. Theofilopoulos. 2007. TLR-
dependent and TLR-independent pathways of type I interferon induction in systemic autoimmunity. Nat Med 13:543-551
. 75. Kawai, T., and S. Akira. 2006. Innate immune recognition of viral infection. Nat
Immunol 7:131-137. 76. Means, T. K., E. Latz, F. Hayashi, M. R. Murali, D. T. Golenbock, and A. D. Luster.
2005. Human lupus autoantibody-DNA complexes activate DCs through cooperation of CD32 and TLR9. J Clin Invest 115:407-417
77. Savarese, E., O. W. Chae, S. Trowitzsch, G. Weber, B. Kastner, S. Akira, H. Wagner, R.
M. Schmid, S. Bauer, and A. Krug. 2006. U1 small nuclear ribonucleoprotein immune complexes induce type I interferon in plasmacytoid dendritic cells through TLR7. Blood 107:3229-3234.
78. Vollmer, J., S. Tluk, C. Schmitz, S. Hamm, M. Jurk, A. Forsbach, S. Akira, K. M. Kelly,
W. H. Reeves, S. Bauer, and A. M. Krieg. 2005. Immune stimulation mediated by autoantigen binding sites within small nuclear RNAs involves Toll-like receptors 7 and 8. J Exp Med 202:1575-1585.
79. Hemmi, H., T. Kaisho, K. Takeda, and S. Akira. 2003. The roles of Toll-like receptor 9,
MyD88, and DNA-dependent protein kinase catalytic subunit in the effects of two distinct CpG DNAs on dendritic cell subsets. J Immunol 170:3059-3064.
80. Hemmi, H., T. Kaisho, O. Takeuchi, S. Sato, H. Sanjo, K. Hoshino, T. Horiuchi, H.
Tomizawa, K. Takeda, and S. Akira. 2002. Small anti-viral compounds activate immune cells via the TLR7 MyD88-dependent signaling pathway. Nat Immunol 3:196-200.
81. Yamamoto, M., S. Sato, H. Hemmi, K. Hoshino, T. Kaisho, H. Sanjo, O. Takeuchi, M.
Sugiyama, M. Okabe, K. Takeda, and S. Akira. 2003. Role of adaptor TRIF in the MyD88-independent toll-like receptor signaling pathway. Science 301:640-643.
82. Yoneyama, M., M. Kikuchi, T. Natsukawa, N. Shinobu, T. Imaizumi, M. Miyagishi, K.
Taira, S. Akira, and T. Fujita. 2004. The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses. Nat Immunol 5:730-737.
83. Kawai, T., K. Takahashi, S. Sato, C. Coban, H. Kumar, H. Kato, K. J. Ishii, O. Takeuchi,
and S. Akira. 2005. IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction. Nat Immunol 6:981-988.
124
84. Kato, H., O. Takeuchi, S. Sato, M. Yoneyama, M. Yamamoto, K. Matsui, S. Uematsu, A. Jung, T. Kawai, K. J. Ishii, O. Yamaguchi, K. Otsu, T. Tsujimura, C. S. Koh, E. S. C. Reis, Y. Matsuura, T. Fujita, and S. Akira. 2006. Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature. 441(7089):101-5
85. Stockinger, S., B. Reutterer, B. Schaljo, C. Schellack, S. Brunner, T. Materna, M.
Yamamoto, S. Akira, T. Taniguchi, P. J. Murray, M. Muller, and T. Decker. 2004. IFN regulatory factor 3-dependent induction of type I IFNs by intracellular bacteria is mediated by a TLR- and Nod2-independent mechanism. J Immunol 173:7416-7425.
86. Stetson, D. B., and R. Medzhitov. 2006. Recognition of cytosolic DNA activates an
IRF3-dependent innate immune response. Immunity 24:93-103. 87. Savarese, E., C. Steinberg, R. D. Pawar, W. Reindl, S. Akira, H. J. Anders, and A. Krug.
2008. Requirement of Toll-like receptor 7 for pristane-induced production of autoantibodies and development of murine lupus nephritis. Arthritis Rheum 58:1107-1115.
88. Ronnblom, L., M. L. Eloranta, and G. V. Alm. 2006. The type I interferon system in
systemic lupus erythematosus. Arthritis Rheum 54:408-420. 89. Herrmann, M., R. E. Voll, O. M. Zoller, M. Hagenhofer, B. B. Ponner, and J. R. Kalden.
1998. Impaired phagocytosis of apoptotic cell material by monocyte-derived macrophages from patients with systemic lupus erythematosus. Arthritis Rheum 41:1241-1250.
90. Vallin, H., A. Perers, G. V. Alm, and L. Ronnblom. 1999. Anti-double-stranded DNA
antibodies and immunostimulatory plasmid DNA in combination mimic the endogenous IFN-alpha inducer in systemic lupus erythematosus. J Immunol 163:6306-6313.
91. Barrat, F. J., T. Meeker, J. Gregorio, J. H. Chan, S. Uematsu, S. Akira, B. Chang, O.
Duramad, and R. L. Coffman. 2005. Nucleic acids of mammalian origin can act as endogenous ligands for Toll-like receptors
92. Clynes, R., N. Calvani, B. P. Croker, and H. B. Richards. 2005. Modulation of the
immune response in pristane-induced lupus by expression of activation and inhibitory Fc receptors. Clin Exp Immunol 141:230-237.
93. Bly, J. E., L. R. Garrett, and M. A. Cuchens. 1990. Pristane induced changes in rat
lymphocyte membrane fluidity. Cancer Biochem Biophys 11:145-154. 94. Satoh, M., J. P. Weintraub, H. Yoshida, V. M. Shaheen, H. B. Richards, M. Shaw, and
W. H. Reeves. 2000. Fas and Fas ligand mutations i 95. Kratz, A., A. Campos-Neto, M. S. Hanson, and N. H. Ruddle. 1996. Chronic
inflammation caused by lymphotoxin is lymphoid neogenesis. J Exp Med 183:1461-1472.
125
96. Hjelmstrom, P. 2001. Lymphoid neogenesis: de novo formation of lymphoid tissue in chronic inflammation through expression of homing chemokines. J Leukoc Biol 69:331-339.
97. Mebius, R. E. 2003. Organogenesis of lymphoid tissues. Nat Rev Immunol 3:292-303. 98. Drayton, D. L., X. Ying, J. Lee, W. Lesslauer, and N. H. Ruddle. 2003. Ectopic LT alpha
beta directs lymphoid organ neogenesis with concomitant expression of peripheral node addressin and a HEV-restricted sulfotransferase. J Exp Med 197:1153-1163.
99. Armengol, M. P., M. Juan, A. Lucas-Martin, M. T. Fernandez-Figueras, D. Jaraquemada,
T. Gallart, and R. Pujol-Borrell. 2001. Thyroid autoimmune disease: demonstration of thyroid antigen-specific B cells and recombination-activating gene expression in chemokine-containing active intrathyroidal germinal centers. Am J Pathol 159:861-873.
100. Salomonsson, S., M. V. Jonsson, K. Skarstein, K. A. Brokstad, P. Hjelmstrom, M.
Wahren-Herlenius, and R. Jonsson. 2003. Cellular basis of ectopic germinal center formation and autoantibody production in the target organ of patients with Sjogren's syndrome. Arthritis Rheum 48:3187-3201.
101. Luther, S. A., K. M. Ansel, and J. G. Cyster. 2003. Overlapping roles of CXCL13,
interleukin 7 receptor alpha, and CCR7 ligands in lymph node development. J Exp Med 197:1191-1198.
102. Ngo, V. N., H. Korner, M. D. Gunn, K. N. Schmidt, D. S. Riminton, M. D. Cooper, J. L.
Browning, J. D. Sedgwick, and J. G. Cyster. 1999. Lymphotoxin alpha/beta and tumor necrosis factor are required for stromal cell expression of homing chemokines in B and T cell areas of the spleen. J Exp Med 189:403-412.
103. Aloisi, F., and R. Pujol-Borrell. 2006. Lymphoid neogenesis in chronic inflammatory
diseases. Nat Rev Immunol 6:205-217. 104. Aust, G., D. Sittig, L. Becherer, U. Anderegg, A. Schutz, P. Lamesch, and E.
Schmucking. 2004. The role of CXCR5 and its ligand CXCL13 in the compartmentalization of lymphocytes in thyroids affected by autoimmune thyroid diseases. Eur J Endocrinol 150:225-234.
105. Drayton, D. L., S. Liao, R. H. Mounzer, and N. H. Ruddle. 2006. Lymphoid organ
development: from ontogeny to neogenesis. Nat Immunol 7:344-353. 106. Murakami, J., Y. Shimizu, Y. Kashii, T. Kato, M. Minemura, K. Okada, S. Nambu, T.
Takahara, K. Higuchi, Y. Maeda, T. Kumada, and A. Watanabe. 1999. Functional B-cell response in intrahepatic lymphoid follicles in chronic hepatitis C. Hepatology 30:143-150.
126
107. Mazzucchelli, L., A. Blaser, A. Kappeler, P. Scharli, J. A. Laissue, M. Baggiolini, and M. Uguccioni. 1999. BCA-1 is highly expressed in Helicobacter pylori-induced mucosa-associated lymphoid tissue and gastric lymphoma. J Clin Invest 104:R49-54.
108. Stott, D. I., F. Hiepe, M. Hummel, G. Steinhauser, and C. Berek. 1998. Antigen-driven
clonal proliferation of B cells within the target tissue of an autoimmune disease. The salivary glands of patients with Sjogren's syndrome. J Clin Invest 102:938-946.
109. Xanthou, G., M. Polihronis, A. G. Tzioufas, S. Paikos, P. Sideras, and H. M.
Moutsopoulos. 2001. "Lymphoid" chemokine messenger RNA expression by epithelial cells in the chronic inflammatory lesion of the salivary glands of Sjogren's syndrome patients: possible participation in lymphoid structure formation. Arthritis Rheum 44:408-418.
110. Schroder, A. E., A. Greiner, C. Seyfert, and C. Berek. 1996. Differentiation of B cells in
the nonlymphoid tissue of the synovial membrane of patients with rheumatoid arthritis. Proc Natl Acad Sci U S A 93:221-225.
111. Randen, I., O. J. Mellbye, O. Forre, and J. B. Natvig. 1995. The identification of germinal
centres and follicular d 112. Gause, A., K. Gundlach, M. Zdichavsky, G. Jacobs, B. Koch, T. Hopf, and M.
Pfreundschuh. 1995. The B lymphocyte in rheumatoid arthritis: analysis of rearranged V kappa genes from B cells infiltrating the synovial membrane. Eur J Immunol 25:2775-2782.
113. William, J., C. Euler, S. Christensen, and M. J. Shlomchik. 2002. Evolution of
autoantibody responses via somatic hypermutation outside of germinal centers. Science 297:2066-2070.
114. Horsfall, A. C., L. M. Rose, and R. N. Maini. 1989. Autoantibody synthesis in salivary
glands of Sjogren's syndrome patients. J Autoimmun 2:559-568. 115. Jego, G., A. K. Palucka, J. P. Blanck, C. Chalouni, V. Pascual, and J. Banchereau. 2003.
Plasmacytoid dendritic cells induce plasma cell differentiation through type I interferon and interleukin 6. Immunity 19:225-234.
116. Shapiro-Shelef, M., and K. Calame. 2005. Regulation of plasma-cell development. Nat
Rev Immunol 5:230-242. 117. Hoyer, B. F., K. Moser, A. E. Hauser, A. Peddinghaus, C. Voigt, D. Eilat, A. Radbruch,
F. Hiepe, and R. A. Manz. 2004. Short-lived plasmablasts and long-lived plasma cells contribute to chronic humoral autoimmunity in NZB/W mice. J Exp Med 199:1577-1584.
118. Potter, M., and R. C. MacCardle. 1964. Histology of developing plasma cell neoplasia
induced by mineral oil in BALB/c mice. J Natl Cancer Inst 33:497-515.
127
119. Leak, L. V., M. Potter, and W. J. Mayfield. 1985. Response of the peritoneal mesothelium to the mineral oil, pristane. Curr Top Microbiol Immunol 122:221-233.
120. Weinstein, J. S., D. C. Nacionales, P. Y. Lee, K. M. Kelly-Scumpia, X. J. Yan, P. O.
Scumpia, D. S. Vale-Cruz, E. Sobel, M. Satoh, N. Chiorazzi, and W. H. Reeves. 2008. Colocalization of antigen-specific B and T cells within ectopic lymphoid tissue following immunization with exogenous antigen. J Immunol 181:3259-3267.
121. Klein, U., and R. Dalla-Favera. 2008. Germinal centres: role in B-cell physiology and
malignancy. Nat Rev Immunol 8:22-33. 122. Ettinger, R., G. P. Sims, R. Robbins, D. Withers, R. T. Fischer, A. C. Grammer, S.
Kuchen, and P. E. Lipsky. 2007. IL-21 and BAFF/BLyS synergize in stimulating plasma cell differentiation from a unique population of human splenic memory B cells. J Immunol 178:2872-2882.
123. Richards, H. B., M. Satoh, J. C. Jennette, T. Okano, Y. S. Kanwar, and W. H. Reeves.
1999. Disparate T cell requirements of two subsets of lupus-specific autoantibodies in pristane-treated mice. Clin Exp Immunol 115:547-553.
124. Cassese, G., S. Lindenau, B. de Boer, S. Arce, A. Hauser, G. Riemekasten, C. Berek, F.
Hiepe, V. Krenn, A. Radbruch, and R. A. Manz. 2001. Inflamed kidneys of NZB / W mice are a major site for the homeostasis of plasma cells. Eur J Immunol 31:2726-2732.
125. Okada, T., V. N. Ngo, E. H. Ekland, R. Forster, M. Lipp, D. R. Littman, and J. G. Cyster.
2002. Chemokine requirements for B cell entry to lymph nodes and Peyer's patches. J Exp Med 196:65-75.
126. McHeyzer-Williams, L. J., and M. G. McHeyzer-Williams. 2005. Antigen-specific
memory B cell development. Annu Rev Immunol 23:487-513. 127. Jacob, J., and G. Kelsoe. 1992. In situ studies of the primary immune response to (4-
hydroxy-3-nitrophenyl)acetyl. II. A common clonal origin for periarteriolar lymphoid sheath-associated foci and germinal centers. J Exp Med 176:679-687.
128. Jacob, J., R. Kassir, and G. Kelsoe. 1991. In situ studies of the primary immune response
to (4-hydroxy-3-nitrophenyl)acetyl. I. The architecture and dynamics of responding cell populations. J Exp Med 173:1165-1175.
129. Schwickert, T. A., R. L. Lindquist, G. Shakhar, G. Livshits, D. Skokos, M. H. Kosco-
Vilbois, M. L. Dustin, and M. C. Nussenzweig. 2007. In vivo imaging of germinal centres reveals a dynamic open structure. Nature 446:83-87.
130. White, H. N. 1998. Restriction-PCR fingerprinting of the immunoglobulin VH repertoire:
direct detection of an immune response and global analysis of B cell clonality. Eur J Immunol 28:3268-3279.
128
131. Han, S., B. Zheng, J. Dal Porto, and G. Kelsoe. 1995. In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl. IV. Affinity-dependent, antigen-driven B cell apoptosis in germinal centers as a mechanism for maintaining self-tolerance. J Exp Med 182:1635-1644.
132. Barnden, M. J., J. Allison, W. R. Heath, and F. R. Carbone. 1998. Defective TCR
expression in transgenic mice constructed using cDNA-based alpha- and beta-chain genes under the control of heterologous regulatory elements. Immunol Cell Biol 76:34-40.
133. Siekevitz, M., C. Kocks, K. Rajewsky, and R. Dildrop. 1987. Analysis of somatic
mutation and class switching in naive and memory B cells generating adoptive primary and secondary responses. Cell 48:757-770.
134. Allen, D., T. Simon, F. Sablitzky, K. Rajewsky, and A. Cumano. 1988. Antibody
engineering for the analysis of affinity maturation of an anti-hapten response. Embo J 7:1995-2001.
135. Sims, G. P., H. Shiono, N. Willcox, and D. I. Stott. 2001. Somatic hypermutation and
selection of B cells in thymic germinal centers responding to acetylcholine receptor in myasthenia gravis. J Immunol 167:1935-1944.
136. Shlomchik, M. J., A. H. Aucoin, D. S. Pisetsky, and M. G. Weigert. 1987. Structure and
function of anti-DNA autoantibodies derived from a single autoimmune mouse. Proc Natl Acad Sci U S A 84:9150-9154.
137. Herlands, R. A., J. William, U. Hershberg, and M. J. Shlomchik. 2007. Anti-chromatin
antibodies drive in vivo antigen-specific activation and somatic hypermutation of rheumatoid factor B cells at extrafollicular sites. Eur J Immunol 37:3339-3351.
138. Bombardieri, M., F. Barone, F. Humby, S. Kelly, M. McGurk, P. Morgan, S.
Challacombe, S. De Vita, G. Valesini, J. Spencer, and C. Pitzalis. 2007. Activation-induced cytidine deaminase expression in follicular dendritic cell networks and interfollicular large B cells supports functionality of ectopic lymphoid neogenesis in autoimmune sialoadenitis and MALT lymphoma in Sjogren's syndrome. J Immunol 179:4929-4938.
139. Natvig, J. B., I. Randen, K. Thompson, O. Forre, R. A. Mageed, R. Jefferis, D. A.
Carson, H. Tighe, V. Pascual, K. D. Victor, and et al. 1990. Probing of the rheumatoid factor (RF) V gene repertoire in rheumatoid arthritis (RA) by hybridoma clones. Clin Exp Rheumatol 8 Suppl 5:75-80.
140. von Andrian, U. H., and T. R. Mempel. 2003. Homing and cellular traffic in lymph
nodes. Nat Rev Immunol 3:867-878. 141. Cyster, J. G. 1999. Chemokines and cell migration in secondary lymphoid organs.
Science 286:2098-2102.
129
142. McHeyzer-Williams, L. J., M. Cool, and M. G. McHeyzer-Williams. 2000. Antigen-specific B cell memory: expression and replenishment of a novel b220(-) memory b cell compartment. J Exp Med 191:1149-1166.
143. Ulett, G. C., N. Ketheesan, and R. G. Hirst. 2000. Cytokine gene expression in innately
susceptible BALB/c mice and relatively resistant C57BL/6 mice during infection with virulent Burkholderia pseudomallei. Infect Immun 68:2034-2042.
144. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-408. 145. Kinoshita, K., M. Harigai, S. Fagarasan, M. Muramatsu, and T. Honjo. 2001. A hallmark
of active class switch recombination: transcripts directed by I promoters on looped-out circular DNAs. Proc Natl Acad Sci U S A 98:12620-12623.
146. Arant, S. E., J. A. Griffin, and W. J. Koopman. 1986. VH gene expression is restricted in
anti-IgG antibodies from MRL autoimmune mice. J Exp Med 164:1284-1300. 147. Barnes, J. L., F. Goni, H. Heyermann, B. Frangione, and V. Agnello. 1990. Human
rheumatoid factor cross-idiotypes. III. Bla monoclonal rheumatoid factor, prototype of the BLA cross-idiotype group, has distinct kappa chains related to the V kappa III subgroup and VH4 heavy chains. Arthritis Rheum 33:1710-1715.
148. Liu, Y. J., G. D. Johnson, J. Gordon, and I. C. MacLennan. 1992. Germinal centres in T-
cell-dependent antibody responses. Immunol Today 13:17-21. 149. Wang, D., S. M. Wells, A. M. Stall, and E. A. Kabat. 1994. Reaction of germinal centers
in the T-cell-independent response to the bacterial polysaccharide alpha(1-->6)dextran. Proc Natl Acad Sci U S A 91:2502-2506.
150. Mao, C., L. Jiang, M. Melo-Jorge, M. Puthenveetil, X. Zhang, M. C. Carroll, and T.
Imanishi-Kari. 2004. T cell-independent somatic hypermutation in murine B cells with an immature phenotype. Immunity 20:133-144.
151. Potter, M., J. S. Wax, and E. Blankenhorn. 1985. BALB/c subline differences in
susceptibility to plasmacytoma induction. Curr Top Microbiol Immunol 122:234-241. 152. Allen, C. D., and J. G. Cyster. 2008. Follicular dendritic cell networks of primary
follicles and germinal centers: phenotype and function. Semin Immunol 20:14-25. 153. Takemura, S., A. Braun, C. Crowson, P. J. Kurtin, R. H. Cofield, W. M. O'Fallon, J. J.
Goronzy, and C. M. Weyand. 2001. Lymphoid neogenesis in rheumatoid synovitis. J Immunol 167:1072-1080.
154. Shlomchik, M. J. 2008. Sites and stages of autoreactive B cell activation and regulation.
Immunity 28:18-28.
130
155. Jacobson, B. A., D. J. Panka, K. A. Nguyen, J. Erikson, A. K. Abbas, and A. Marshak-Rothstein. 1995. Anatomy of autoantibody production: dominant localization of antibody-producing cells to T cell zones in Fas-deficient mice. Immunity 3:509-519.
156. Herlands, R. A., S. R. Christensen, R. A. Sweet, U. Hershberg, and M. J. Shlomchik.
2008. T Cell-Independent and Toll-like Receptor-Dependent Antigen-Driven Activation of Autoreactive B Cells. Immunity 29:249-260.
157. Muramatsu, M., K. Kinoshita, S. Fagarasan, S. Yamada, Y. Shinkai, and T. Honjo. 2000.
Class switch recombination and hypermutation require activation-induced cytidine deaminase (AID), a potential RNA editing enzyme. Cell 102:553-563.
158. Honjo, T., K. Kinoshita, and M. Muramatsu. 2002. Molecular mechanism of class switch
recombination: linkage with somatic hypermutation. Annu Rev Immunol 20:165-196. 159. Muramatsu, M., V. S. Sankaranand, S. Anant, M. Sugai, K. Kinoshita, N. O. Davidson,
and T. Honjo. 1999. Specific expression of activation-induced cytidine deaminase (AID), a novel member of the RNA-editing deaminase family in germinal center B cells. J Biol Chem 274:18470-18476.
160. He, B., X. Qiao, and A. Cerutti. 2004. CpG DNA induces IgG class switch DNA
recombination by activating human B cells through an innate pathway that requires TLR9 and cooperates with IL-10. J Immunol 173:4479-4491.
161. Capolunghi, F., S. Cascioli, E. Giorda, M. M. Rosado, A. Plebani, C. Auriti, G. Seganti,
R. Zuntini, S. Ferrari, M. Cagliuso, I. Quinti, and R. Carsetti. 2008. CpG drives human transitional B cells to terminal differentiation and production of natural antibodies. J Immunol 180:800-808.
162. Jegerlehner, A., P. Maurer, J. Bessa, H. J. Hinton, M. Kopf, and M. F. Bachmann. 2007.
TLR9 signaling in B cells determines class switch recombination to IgG2a. J Immunol 178:2415-2420.
163. Kelly, K. M., H. Zhuang, D. C. Nacionales, P. O. Scumpia, R. Lyons, J. Akaogi, P. Lee,
B. Williams, M. Yamamoto, S. Akira, M. Satoh, and W. H. Reeves. 2006. "Endogenous adjuvant" activity of the RNA components of lupus autoantigens Sm/RNP and Ro 60. Arthritis Rheum 54:1557-1567.
164. Corcione, A., S. Casazza, E. Ferretti, D. Giunti, E. Zappia, A. Pistorio, C. Gambini, G. L.
Mancardi, A. Uccelli, and V. Pistoia. 2004. Recapitulation of B cell differentiation in the central nervous system of patients with multiple sclerosis. Proc Natl Acad Sci U S A 101:11064-11069.
165. Massone, C., K. Kodama, W. Salmhofer, R. Abe, H. Shimizu, A. Parodi, H. Kerl, and L.
Cerroni. 2005. Lupus erythematosus panniculitis (lupus profundus): clinical, histopathological, and molecular analysis of nine cases. J Cutan Pathol 32:396-404.
131
166. Omokawa, A., H. Wakui, S. Okuyama, M. Togashi, H. Ohtani, A. Komatsuda, R. Ichinohasama, and K. Sawada. 2008. Predominant tubulointerstitial nephritis in a patient with systemic lupus erythematosus: phenotype of infiltrating cells. Clin Nephrol 69:436-444.
167. Alarcon-Riquelme, M. E. 2006. Nucleic acid by-products and chronic inflammation. Nat
Genet 38:866-867. 168. Barone, F., M. Bombardieri, A. Manzo, M. C. Blades, P. R. Morgan, S. J. Challacombe,
G. Valesini, and C. Pitzalis. 2005. Association of CXCL13 and CCL21 expression with the progressive organization of lymphoid-like structures in Sjogren's syndrome. Arthritis Rheum 52:1773-1784.
169. Slifka, M. K., R. Antia, J. K. Whitmire, and R. Ahmed. 1998. Humoral immunity due to
long-lived plasma cells. Immunity 8:363-372. 170. Ochsenbein, A. F., D. D. Pinschewer, S. Sierro, E. Horvath, H. Hengartner, and R. M.
Zinkernagel. 2000. Protective long-term antibody memory by antigen-driven and T help-dependent differentiation of long-lived memory B cells to short-lived plasma cells independent of secondary lymphoid organs. Proc Natl Acad Sci U S A 97:13263-13268.
171. Richard, K., S. K. Pierce, and W. Song. 2008. The agonists of TLR4 and 9 are sufficient
to activate memory B cells to differentiate into plasma cells in vitro but not in vivo. J Immunol 181:1746-1752.
172. Bernasconi, N. L., N. Onai, and A. Lanzavecchia. 2003. A role for Toll-like receptors in
acquired immunity: up-regulation of TLR9 by BCR triggering in naive B cells and constitutive expression in memory B cells. Blood 101:4500-4504.
173. O'Garra, A., and P. Vieira. 2004. Regulatory T cells and mechanisms of immune system
control. Nat Med 10:801-805. 174. Vieira, P., and K. Rajewsky. 1988. The half-lives of serum immunoglobulins in adult
mice. Eur J Immunol 18:313-316. 175. Manz, R. A., A. Thiel, and A. Radbruch. 1997. Lifetime of plasma cells in the bone
marrow. Nature 388:133-134. 176. Humby, F., M. Bombardieri, A. Manzo, S. Kelly, M. C. Blades, B. Kirkham, J. Spencer,
and C. Pitzalis. 2009. Ectopic lymphoid structures support ongoing production of class-switched autoantibodies in rheumatoid synovium. PLoS Med 6:e1.
177. Odegard, J. M., B. R. Marks, L. D. DiPlacido, A. C. Poholek, D. H. Kono, C. Dong, R.
A. Flavell, and J. Craft. 2008. ICOS-dependent extrafollicular helper T cells elicit IgG production via IL-21 in systemic autoimmunity. J Exp Med 205:2873-2886.
132
178. Ueda, Y., M. Kondo, and G. Kelsoe. 2005. Inflammation and the reciprocal production of granulocytes and lymphocytes in bone marrow. J Exp Med 201:1771-1780.
179. Moser, K., K. Tokoyoda, A. Radbruch, I. MacLennan, and R. A. Manz. 2006. Stromal
niches, plasma cell differentiation and survival. Curr Opin Immunol 18:265-270. 180. Paramithiotis, E., and M. D. Cooper. 1997. Memory B lymphocytes migrate to bone
marrow in humans. Proc Natl Acad Sci U S A 94:208-212. 181. Muehlinghaus, G., L. Cigliano, S. Huehn, A. Peddinghaus, H. Leyendeckers, A. E.
Hauser, F. Hiepe, A. Radbruch, S. Arce, and R. A. Manz. 2005. Regulation of CXCR3 and CXCR4 expression during terminal differentiation of memory B cells into plasma cells. Blood 105:3965-3971.
182. Lutz, C., B. Ledermann, M. H. Kosco-Vilbois, A. F. Ochsenbein, R. M. Zinkernagel, G.
Kohler, and F. Brombacher. 1998. IgD can largely substitute for loss of IgM function in B cells. Nature 393:797-801.
183. Fearon, D. T., and M. C. Carroll. 2000. Regulation of B lymphocyte responses to foreign
and self-antigens by the CD19/CD21 complex. Annu Rev Immunol 18:393-422. 184. Patten, C., K. Bush, I. Rioja, R. Morgan, P. Wooley, J. Trill, and P. Life. 2004.
Characterization of pristane-induced arthritis, a murine model of chronic disease: response to antirheumatic agents, expression of joint cytokines, and immunopathology. Arthritis Rheum 50:3334-3345.
185. Ueda, Y., K. Yang, S. J. Foster, M. Kondo, and G. Kelsoe. 2004. Inflammation Controls
B Lymphopoiesis by Regulating Chemokine CXCL12 Expression. J Exp Med 199:47-58.
133
BIOGRAPHICAL SKECTH
Jason Scott Weinstein was born in 1979 in Natick, Massachusetts. He attended
Northeastern University in Boston, Massachusetts, where he graduated with a B.S. in biology in
2003. In the fall of 2003, he started graduate school in the Interdisciplinary Program in
Biomedical Sciences at the University of Florida.
Jason began his research career in 2000 at Millennium Pharmaceuticals as a CO-OP
student in the Antibody Engineering group under the guidance of Dr. Theresa O’Keefe. In 2002
he joined Dr. O’Keefe in a start-up company, Critical Therapeutics, where he worked in the
Molecular Immunology group. In 2004 he joined the Reeves’s laboratory to begin is Ph.D work
studying the role of lymphocytes in pristane-induced ectopic lymphoid tissue. Upon completion
of his Ph.D in 2009, he plans to continue his career in scientific research as a postdoctoral
research associate in the laboratory of Dr. Joseph Craft at Yale University.
