Date post: | 26-Mar-2016 |
Category: |
Documents |
Upload: | matthew-pellegrin |
View: | 250 times |
Download: | 3 times |
11
General InformationMedia Information ..................................................................................................................2Primary Media Outlets ..........................................................................................................3
Season PreviewOutlook ................................................................................................................................. 4-5
PlayersRoster ..................................................................................................................................... 6-7Carolyn O’Brien .......................................................................................................................8Francis Staelin ...........................................................................................................................9Leilani Halkiotis ......................................................................................................................10Mary Beale ...............................................................................................................................11Mary Kate Tucker ...................................................................................................................12Hannah Jeske ...........................................................................................................................13Elizabeth Keil ...........................................................................................................................14Ferriss Roberts .......................................................................................................................15Tarrah Tate ...............................................................................................................................16Amanda Knapp .......................................................................................................................17Erin Ryan ..................................................................................................................................18Emma Sell Goodhand ............................................................................................................19Gina Beer .................................................................................................................................20Kristen Lawson .......................................................................................................................21Newcomers ......................................................................................................................22-24
Coaching StaffHead Coach Michelle Demko ......................................................................................25-26Assistant Coach Mary Casey .............................................................................................27
Records Section2010 Season Stats .................................................................................................................302010 Big South Final Standings ..........................................................................................31 Big South Tournament History ....................................................................................32-33The Big South Conference .............................................................................................34-35Game Records ..................................................................................................................36-37Year-by-Year Leaders .............................................................................................................38All-Time Letterwinners ........................................................................................................39All-Time Results ...............................................................................................................40-42The Big South Network .......................................................................................................43
UNC AshevilleThe University of North Carolina Asheville .............................................................44-47Dr. Anne Ponder, Chancellor ...............................................................................................48Janet R. ConeDirector of Athletics/Senior Administrator for University Enterprises .............49-50Support Staff ....................................................................................................................51-52Head Coaches .......................................................................................................................53Rocky .......................................................................................................................................54NCAA .....................................................................................................................................55The Bulldog Athletics Association .....................................................................................56
Bulldog Coaching StaffHead Coach...................................................... Michelle Demko
............................................................................. (Maryland 1996)
Overall/years ..................................................................First Year
at Asheville ......................................................................First Year
Conference .....................................................................First Year
Assistant Coach ........................................................Mary Casey
............................................................................. (Maryland 2008)
2010 Team Information2010 Record ....................................................................... 1-16-0
2009 Big South Record/Finish ................................. 0-9-0/10th
Home Record .......................................................................1-7-0
Away Record .........................................................................0-9-0
Neutral Record ....................................................................0-0-0
Starters Returning/Lost ........................................................ 9/2
Letterwinners Returning/Lost ............................................ 13-5
Soccer Support StaffAthletic Trainer ..........................................................Jim Wallace
Athletics Communication ........................................Mike Gore
Greenwood FieldCapacity ................................................................................. 1,000
Press Box Phone ............................................... (828) 545-1121
Message To MediaThis edition of the 2011 UNC Asheville Soccer media
guide has been prepared for you as you cover the Bulldogs
during the season. For additional information, photographs,
interviews with players and coaches, please contact Matt
Pellegrin or Mike Gore in the Athletics Communication
Offi ce.
CreditsEditorMike Gore
Designer:Matt Pellegrin
Contributors:Everett Hutto, Nic Bowman
Photographers:Brett Whitsell, Rebecca Nelms Keil, Matt Pellegrin and Blake
Madden
UNC Asheville is a selective, public liberal arts institution. UNC Asheville’s Intercollegiate Athletics Program refl ects the attitudes and values underlying the University’s overall mission: academic excellence, diversity, equity, integrity, service, and accomplishment. The UNC Asheville athletics program contributes to this liberal arts culture in two ways. First, athletics programs foster a sense of community and pride by fi elding NCAA Division I teams and developing talented student-athletes who successfully represent UNC Asheville in competition and refl ect the University’s commitment to overall excellence. Accordingly, the athletics program encourages an atmosphere of respect for self and others through the development of ethical conduct, sportsmanship, leadership, and citizenship and provides equitable opportunities for all students and staff, including women, minorities and indivduals of all sexual identities. Second, the program provides an additional campus experience for capable students to grow and develop academically, personally, socially, and athletically. This experience promotes institutional commitment and pride on the part of students, faculty, staff, and alumni.
UNC ASHEVILLE MISSION STATEMENT
22
Athletics Media Communications
Mike Gore Associate Athletics Director for
External Affairs / Soccer ContactOffi ce Phone: (828) 251-6923Cell Phone: (828) 215-6387
Email: [email protected]
Matt PellegrinDirector of Athletics Media Communication
Offi ce Phone: (828) 251-6931Cell Phone: (828) 545-1121Email: [email protected]
Offi ce Fax: (828) 251-6386Web Site: www.uncabulldogs.com
Mailing Address:One University Heights
Justice Center, CPO #2600Asheville, N.C. 28804
COVERING THE BULLDOGSThe Offi ce of Athletics Communication produces stories, pertinent notes about upcoming games, and cumulative statistics, all of which are available at www.uncabulldogs.com, the on-line home of Bulldog athletics.
Press Passes: Please contact the UNC Asheville Athletics Communication Offi ce as early as possible for press passes. Passes will be mailed if time permits.
Broadcasts: There are no phone lines at the Greenwood Field for radio and internet broadcasts. If you would like to broadcast a game please call well in advance to see what arrangements can be made.
Photographers: Photo passes are limited to working press photographers. All photo requests should be made as early as possible to the Offi ce of Athletics Communication.
Services: The UNC Asheville Offi ce of Athletics Communication will provide programs, notes and updated statistics at every home soccer match. After the match, each media member will receive a box score of the match. Phone lines are available upon request.
Interview Policy: The UNC Asheville Offi ce of Athletics Communication and the women’s soccer coaching staff are eager to assist the media with player and coach interview requests. Please contact the Offi ce of Athletics Communication for all player interviews. On the road, please make coach interview arrangements through the Athletics Commincation representative for that sport. Players will not be available for interviews on days of games until the completion of the contest. Your cooperation is appreciated.
Media Guides: UNC Asheville will not print media guides to assist in the department’s cost-containment efforts. The Athletics Communications Offi ce will provide the same material it has in the past through on-line supplements and enhanced notes packages.
Video Streaming: UNC Asheville will once again video stream all of its home soccer matches live on www.bigsouthsports.com. This is a pay per view service. Archives of each broadcast will be available the day after each match. For match highlights or more information video of matches please contact Matt Pellegrin
MEDIA INFORMATION
33
NEWSPAPERS
Asheville Citizen-TimesPO Box 2090Asheville, NC 28802828/232-5867800/800-4204Fax: 828/251-0585
Hendersonville Times-NewsPO Box 490Hendersonville, NC 28739828/692-0505Fax: 828/692-2319
The MountaineerPO Box 129Waynesville, NC 28786828/452-0661Fax: 828/452-0665
The Charlotte ObserverPO Box 32188Charlotte, NC 28232704/379-6448Fax: 704/379-6506
WIRE SERVICEAssociated Press219 South McDowell St.Raleigh, NC 27602800/662-7075Fax: 919/834-1078
TELEVISION
WLOS-TV110 Technology DriveAsheville, NC 28803828/651-4563Fax: 828/651-4618
WSPA-TVPO Box 1717Spartanburg, SC 29304864/576-7777Fax: 864/587-5430
WYFF-TV505 Rutherford Rd.Greenville, SC 29602864/242-4404Fax: 864/240-5305
RADIO STATIONS1310 WISE Radio1190 Patton Ave.Asheville, NC 28804828/253-1310
WWNC RadioPO Box 6447Asheville, NC 28816828/253-3835
WCQS Radio70 Broadway St.Asheville, NC 28801828/253-6875
Location: Asheville, North CarolinaEnrollment: 3,700Founded: 1927Nickname: BulldogsAffi liation: NCAA Division IConference: Big SouthColors: Royal Blue and WhiteArena (Capacity): Greenwood Field (300)Chancellor: Dr. Anne PonderFaculty Representative: Dr. Herman HoltDirector of Athletics: Janet R. ConeAssociate Athletics Director of Internal Affairs and Compliance: Terri BrneDirector of Development and Alumni Relations: Ken Hogue Athletics Business Manager: Judith BohanDirector of Marketing: Erin Punter SpenceTicket Manager: Harmon TurnerTicket Offi ce Phone: (828) 251-6904
PRIMARY ATHLETICS LOGO
SECONDARY ATHLETICS LOGOS
44
The 2010 UNC Asheville women’s soccer season was not one for the record book as the Bulldogs fi nished with a 1-16 record and a last-place fi nish in the Big South Conference.
However, for fi rst-year coach Michelle Demko, last year’s tough campaign was the beginning of a new era for Asheville soccer.Demko installed a whole new attacking style of soccer and dealt with a rash of injuries that saw the Bulldogs limited to one or two substitutes in many matches. Asheville added players throughout the season just to make sure the squad had enough to fi nish the campaign.
Yet Demko’s club battled through all the adversity. It played hard in every match and showed improvement throughout the season. In the fi nal match of the year, the Bulldogs played at eventual Big South champi-on High Point. It was a match the Panthers had to win to move up in the league standings. Asheville, with nothing to play for, played High Point to a standstill for most of the match before falling 2-1 in overtime.
“I was really proud of our team last year,” stated Demko. “We in-stalled a whole new style of play and training and our players never wavered. They fought hard through every match and set a foundation for the future of our program.
“I think the disappointing part of the High Point match was that it was the last match for us,” added Demko. “Our players were wishing for six or seven more matches after playing High Point. “
“And that momentum carried over to the spring,” Demko said. “We worked hard and really accomplished a great deal. We have a lot more work to do, but the foundation is set in what we’re trying to ac-complish with our program.”
GOALKEEPER
UNC Asheville will go with a freshman in goal this season in Heath-er Muller. She comes to the mountains from Cary where she excelled at Apex HS and in club soccer.
“We have high expectations for Heather as she’s coming into to be our starting goalkeeper as a freshman,” declared Demko. “She’s an excel-lent athlete who has good height and has all the attributes to be a good goalkeeper. I know that Mary Casey (Demko’s assistant coach) can’t wait to work with her.”
Sophomore Kristen Lawson, who will play in the fi eld most of the time, will serve as Muller’s back-up. She played some in goal as a fresh-man in 2010.
DEFENSE
Asheville’s defense will be led by its upper-classmen. Senior Carolyn O’Brien and Mary Kate Tucker will headline the backline for the Bull-dogs.
O’Brien has been a three-year starter for Asheville, while Tucker is coming off a knee injury. Both will be key players for the Bulldogs this season.
“Carolyn has turned into a versatile player who can play anywhere on the fi eld,” explained Demko. “She’s hungry to have a winning senior season. Carolyn will be one of our leaders this year both on and off the fi eld.”
Tucker was injured in the fi nal match of the 2009 season and didn’t play last season. She was a second team All-Conference selection that year and earned Big South All-Rookie honors the previous season. Dem-ko is glad to have her back.
Carolyn O’Brien
“Mary Kate is a fantastic example of what we want this program to be,” stated Demko. “She is such a hard worker and will sacrifi ce and do anything to turn the program around. We’re glad we will have Mary Kate on the fi eld in 2011.”
Senior Frances Staelin walked on to the Bulldog team right before practice started and ended up being an important player for Asheville.
“Frances joined our program and then caught on quite quickly on what we were trying to accomplish,” admitted Demko. “She’s a good tackler and is vocal, which you need in the back.”
Sophomore Erin Ryan stepped in as a freshman and had a lot of positive moments for the Bulldogs.
“Erin did a tremendous job for us last year. She played just about every minute of every match,” stated Demko. “She will be a real anchor for our defense. Erin is strong and quite confi dent going forward.”
Gina Beer was another walk-on who ended up playing a great deal in 2010 in the back.
“Gina really played hard for us last year and gave us some good minutes,” commented Demko. “She’ll give us more of the same this year and provide depth in the both the back and midfi eld.”
Freshman Margo Flewelling joins the Asheville program after a successful prep and club career in Chapel Hill. She played in the East-West All-Star Game this past summer and scored a goal in the match.
“Margo comes from a great club program, so I know she knows the game very well,” explained Demko. “I know she’ll be a quick study and compete for playing time.”
2011 ASHEVILLE WOMEN’S SOCCER:
55
Leilani Halkiotis
MIDFIELD
Senior Leilani Halkiotis has been starter at midfi eld for the Bulldogs her entire career. She was Asheville’s leading scorer last season with four goals and 11 points.
“Leilani will be a huge part of our attack this year,” said Demko. “She’s very determined to make her senior season a successful one. Lei-lani has been a leader by example and has been extremely coachable.”
Junior Hannah Jeske is one of Asheville’s most versatile players.
“We can put Hannah anywhere on the fi eld and know we’re in good shape,” stated Demko. “She has a tremendous competitive spirit and will make sacrifi ces in order for us to win.”
Junior Ferris Roberts played as an outside midfi elder last season and made some solid contributions as she scored two goals during the year.
“Ferris has a nice pace and is a good server into the box,” said Demko. “She has an enormous fi tness rate and is always ready when called upon.”
Tarrah Tate, a sophomore, from Castle Rock, Colo., started in the last seven matches of the year and showed a great deal of promise.
“Tarrah likes to get forward and is deceptive with the ball,” stated Demko. “She is quite gifted technically and is strong one-on-one play-er.”
Kristen Lawson played both in goal and was a fi eld player in 2010. She’ll mostly be a midfi elder this year but will serve as a back-up goal-keeper to Heather Muller.
“Kristen does a good job serving long balls and is a solid player with her 1-2 touch,” admitted Demko. “She knows how to keep the game simple. We plan to use her in the fi eld this season but she’ll be ready to be in goal if we need her to be.”
Freshman Megan Foster joins the Asheville program from Gaines-ville, Fla. She is a versatile player who Demko is very high on.
“We believe Megan is a big piece of the puzzle to turning our pro-gram around,” explained Demko. “She can play anywhere, and we will use her wherever we need her. Megan is a player who does a great job when she possesses the ball. “
FORWARD
The Bulldogs have an interesting mixture up front of veterans and extremely talented newcomers.
The returnees include junior Mary Beale. She had not played much in her career but turned into a valuable contributor up front for Asheville in 2010. Beale scored two goals and gave the Bulldogs some toughness and energy.
“Mary is a player who strives to be better. She has an enormously positive attitude and is a real hard worker,” declared Demko. “Mary was such a pleasant surprise for us last season, and she’ll only be better this year with the experience she gained last season.”
Sophomore Amanda Knapp was Asheville’s second leading scorer in 2010 with three goals, two assists for eight points. She is just begin-ning to realize her potential.
“I have big expectations for Amanda,” stated Demko. “I think Aman-da is ready to prove to people that she can be a very dangerous striker and help us win games by scoring goals.”
Sophomore Emma Sell-Goodhand joined the Asheville program in the middle of the season. She jumped and really gave the Bulldogs a spark when she was playing.
“Emma did a nice job of buzzing around the top and giving us some energy,” commented Demko. “She’s a good combination player and has excellent speed.”
Freshman Amanda Dailor and Kaitlyn Eckert are highly touted rookies who could make an immediate impact on this year’s Bulldog squad.
Eckert has actually been at UNC Asheville since January. She gradu-ated early from Knightdale (N.C.) HS and enrolled last winter. Eckert got to play in the spring for the Bulldogs. She had an amazing prep career with 105 goals at Knightdale, including 63 in her junior year in 2010.
“Kaitlyn is one of the most powerful strikers I’ve ever seen,” ex-plained Demko. “She can score from a lot of different places on the fi eld. It was great to have her in the spring as she earned her teammates re-spect with her play. Kaitlyn has a great understanding of the game. We’re looking for big things from her.”
Dailor comes to Asheville from Castiac, Calif., where she had a solid prep and club career.
“Amanda will give us good energy and a fantastic technical pres-ence right away,” stated Demko. “She adds another dimension of being dangerous in front of the goal. There is so much potential to Amanda, I look forward to watching this program grow with her immediate im-pact.”
YEAR TWO OF THE DEMKO ERA
66
22222222222200111 WWWWWWWWWWWWWOOMMMMMMMMMMMMEEEEEENNNNNNNNNNNNNNNNNNNNN’’’’SSSS SSSSSSSSSSSSSSSOOOOOOOOOOOOOCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCEEEERRRRRRRRRRRR RRRRRRRRRRRRRRRRRRRROOOOOOOOOOOOOOOSSSSSSSSSSSSSSTTTTTTTTTTTTTTTTTTTTTTTTEEEEEEEEEEEEEERRRRRRRRR NNN o.o. N Namammmme ee e ee eeee PoPos.s.s.ss..s.s.s Y Y YYY rrrrrrr.r.r.rrrr HHHHHHHHHHHt.tt.t.t.ttttt HHHHHHHHHHHHHomoomommmommmetetoowwwwwowwwwwwwnnnnnn nnnnnnnn ///////////// / PPrPPrPrPrPrPrPrPrPPPPPPPPreeeevevevevevvvvvvvviiioiiioiousss SSSccccchchchchhchchcccchooooooooooooooooooooooool ll 00 H HHHHHHHHHeaae thht ererererrrrr MMMMMMMMMululuuuu leleer r rr GKGKK F Fr.r. 555555555555555-1-1-1-1-111--11- 00 000 00 0 00 CaCaryryrryryryyyryyyyyryyy, , ,, N.N.N CCC.C.CCCCCCC..C //////// / // /////// A A AA AA AAppepepepepepepepepeepeexxxxx xxxxx HSHH 2 2 AAAAAAAAAAAAAAAmandndddddddddddaaaaaaaaaa a DDaDDaDDaDaDDaDaDDaDaaililllllillilililiilorooo FFF F FFFFFr.r 55555555 5 4-4-4 CCC assssssstataaaaaaataiciiciiciccccccccc,,, , CaCaCaaCaaCaaCaCCCCCCC lllllilllllliiillllilliffffffffff.f //////// / WW W WW WWWWW Wessesttt t RaRaaancncnncnccnchh hhh hhhh hhhh h HSHSHSHSHSHHSHSHSSHSHHHH
44 KKKKKKKKKKaia tltlynynnnnnn E E EE Eckckckckkkckkereerrrererreree t tt FF FFr. 555-5-5 5 KnKnKnK igigggggghhhhthtthtttttdadaddaddadddadaddadaleeeeleleeeleleeee, NNN.N.CCC.C.CC.C.C.C.. ////// / / / K K Kninighghghg ttdtdtdtdtdddaaalalaallallalaalaaalla eeeeeeeeeee e e HHSHSSHSSHSHSHHH 5555 T T TTTTTTTTTaararaaaaa raraaaahhhh h hhhh h TaTaTaTatetetete FF SSoo. 55-5-5 C Casasssstttltltllt eeeeee eee RoRoRoRoRRoRooccckkccccccc , , Cooooooolololooolooll . / RoR ckckckkck CCCCCCCCCC CCCCaaaanyoonn nn HHHHHHSSHHHHHH 6 6666666 A A AAmamamaamamamaamam ndndndn a a KnKnapappppappp ppp FF F Sooooo... .. 5-55 4 4 YoYounuuungggggvgvgvgvgvgvg ililili lelelell ,, ,, ,,,,,, NN.N.N CCCC.C.C.CC.C.CCCCCCC /////// / /// FF F Frarararankkknkliliilintnnttttttttnttoonnnnnnnnonnononnnon HSSS 777777777 MMM M MMM MM MMaraaarary yy y BeBeBeBeBealalallala e ee e MFMFMFMFMFFFFFFFFMFMFMMMMFMFMFFFMF J JJJJJJ JJ JJJ J J J JJJJJJrrrrrr.r.rr. 555555 5 555-5- AAAAArdrdrdrrdrdrrr eeennnnnenenee ,,, , N.N.N.NN CCCCCC..CCCCCCCC /// HHHHHHHHHHHHHHHHaalalaaallalallliiifiiiifi axax C CCCCCCCCCCCCCooououoo nnnnntntnttntntnnttyyyyyyyyyyy yyyy y y HSHSSSSS ( (((( ( ((VaVVaVaVaVaVVaVVVaVaVaaV .)) 8888888 8 CC CCCCCC CCarararararrr lollololololoololynyyyynynynyynyny OOO OOOOOOO’B’B’B’B’B’B’Bririrrrriririririrr eneneenenenenenenenennn DD DDD DDDDDDDDDD S SS SSSSSSrrrrrrrrrr.r. 5 5555 555555 1111111-1-1-1-1-1-11 A A AAAA AAA shshhhhshshhshshshshshs eeeeeevveveveveveveveve ililililiili leleleelelelee,, , NNNNN.NN.NN.N.N.NNNN CCCCC.C.C.CCC.CCCCCCC.CCC.CC. /// //// / // RRRRRoRoRRRRRobeeebeebeeeerrrsrsrrsrsrrrrrr onoononnnnonnn H HHH HHHHHHHHHHHHHH HHH H HHHHSSSSSSSSSSSSSSSSSSSSS 9 999 F Frarar ncnccncceseseses S S SSStatataatt eleleleeelinnin DDDDD S SSSSr.rrr. 55 5555555-7-7-77-7-7-77 C CCCCC CCC CCCCChahahahahhahahahahahaapepepeppepepep ll l HiHHiHHiHiiiHHiH lllllllllllll , NNNNNNNNNNNNNNNN.N.NNN CCC.C.CC //// // CCCCCC C Chhahahahapepepep ll l HHiHiHH llllllll HHHHHHHH HH HSSSSSSSS 110 00 HaHHH nnnnahhh JJesesskekek M MF FF JrJJrJrJrJ . 5-5555 7 777 CeCeeCCedadadaaarbrrbbururrrg,g,g,g WWWWWiss. / /// CeCeCCedaddadaarbrbr ururrrg g HSHSH 12 Leilani Halkiotis MFM Sr. 5-3 Brookeville, Md. / Sherwood HHS 14 Elizabeth KeKKeil D Jr. 5-777 AAshhevilleee, N.C. / AsA heville HSHH 115 5 5 MeMeMegagagag n nnn FoFoF sterrer F Fr. 5-5 Gainen svillel , FlFFla.a / Gainesville HSH 16 66 MaM rgo Flewelllingnn MMMF F FrFr. 5-7 ChChChapapapel HHilii l, NNN.CC. / //// ChChapapapele HHHHill HSHSHS 17 7 MaMaaryyy KKatatte e TuTuckc ere DDDD JJr.r 55-8-8-8 WWWWinnststononono -SSSSalallemmm, N.N C.C / RRono alla d dd ReReReagagaganaanan 118 888 ErErrrErErinnn RRRRyayayan n n nn D DD Soo. 5-8 RaR leeigh,hh N.CC. / / Sandnderrsoson n HSHSHSHS 2220 Emmmmam SSSelelele l-GoGoGooododdhaaaandn DD So.oo 5-6-- DDururu hahh m, NNN.CC. / / Duuurhrhrhhama S Schchhoooool l ofofof AAArtrtrtsss 2 221 11 GiGiGiGGG nananaa BBBBBeeeeeeerrr D DDD SoSSSooo. . . 5-5-5 8 88 ChChChhapapapaa elelel HHHililill,l,l N N NN.C.C.C.. / // ChChCC apapapelelel HHHHilililll lll HSHSHSHSS 22222 2 FeF rrrrisss RoRobertrrtr s MFMFMF JJr. 555-5-5 LLLeaeaeawoww odoo , KaKaK n. /// B BBluuue e VaVaVV lleyeyey NNNoroorthth HHHSS 224 44 KrKKrissteeen nn LaLaawswswsononn GGGK K SoSo. 5-5-5 8 888 ChChC ararlolol tttt e,e,, NNN.C.CC. / / PrPrrovovoo idddideneee cecec HH HHSSSS
HeHeeaddadad CCoaoachhchch: MMicheheheeellll e eee DeDeD mkmkmkko oo (M(MMaraarrylylannand,dd 1199999996))6)))6))6)AsAssis ststtananannnt tt CoCoC acach:h:: M MMaary yyyyyyy CaCaCasesseseey yyyyyyyy (M((M((((((( araryllylyylyyyy anand,dd,, 22220000009)9)9)9)))))
77
BBBBBBBBBBBBBBBBBBBBBBBBBBuuuuuuuuuuuuuuuuuullllllllllllllllllllllllllllldddddddddddddddddoooooooooooooooogggggggggggggggggggsssssssssssss bbbbbyyyyy YYYYYYYYYYeeeeeaaaaarrrr SSSSSSSSSSSSeeneneneenennneneeenenennee ioioioooooorrsrsrsr ((( (( 3)3)))))3)) JuJuJuJuJJJJJJJJJJJJJJJJJJJ niiiniiororororororoooorors s s s sss sssss ((5(5(5(5(5(5(5(5(5(5((5(5))))) ))) ) ) SSSSSSS SSSopopopopppopppppophohohohohohohohohohohoohohooooommmmmmmmomomomommmmmooorrrerereresssss ssss s s (6(6(6(66)) )) ) FrFrFrFrFreseeeeseseseseeeeeesssseshhmhmmhmhmhmmhmhmhmhmmmmmh ananananananann ((( ( ((((555)5)5)5)5) CCCCCCCCCaaaaaararaaararrrararrroolollololoooo ynynn OO OO’’B’B’Bririenene EEEElililililil zazazazazzazazzaz bebebbebebebeebeebeeeeeebeethhththtthhthhthhthhthttt KKKK KKKeeieiee l ll l l l TaTaTaTaTTarrrrrrrrrrrrrrrrrrrrrrrrrrraahhahhaaaahhhahahaahaaaa TTTTT TTTTattatatata e e HHHHHHHHHH eeaeaeaeaaeaeaeaeaee ththththhtthhthhthththeeerererereeerer M Mulullelerr FFFF rarararaancncncncn esses S Statatataaaataaaataaaeelinin MMMMarararrrararrrrrrrryyy y BeBBealaleee e eee AmAmAmAmAmmmmmAmAmmmmmmaanananannnndadadadadadd K KKnananappppppppp AAAAAAAAmamamammmmmamamamammmam nnnnndndnnn a aa DaDaDD ili orororrrrrr
LL eieieieilalanini H HHHalalkkkkkikkkikikikikkikikik otototttttototototo isi HHHHHHHHanannnnnnnnanah h JeJeskskkkkkkkkkeeeeee eee EEE EE rrrin n n RyRRyanan KKKKaKKK ittlylylyyyynnn nnn EccE kekeertrtrtrt MMMaMarryryryry KKatata ee TTTTTTTTuTuTTTuuckckckckerererrrrrrerrrrre EEE Emmmmmmmmmmmmmmmmmmmmmmmmaa a SeSellll-G-GGGGGGGGGGoooooooooo dhhhhhhaanananannnddddd d ddddd MMMeMegaaaagaaaaaan nn n nnnnn FFFoFooststerer FeFerrrriisss RoRooobbbbebeeeeeeeeeerttrtrtrtrttrrtrtsssssss GiGiiiiiiiiinanaaaaaaaaanaa BBeeeer r MMararggggogogogooooggog FFFleewewellinnnngg K KKKKKKKKKriririririsssttttststtenenenenennn L L L LL Lawawawawwwwwwwwwsosooooooss n
BBBBBBBBBBBBBBBBBBBBBBBBBuuuuuuuuuuuuuuuuuuuuuuullllllllllllllllllllllllllllllllllllllllldddddddddddddddddddddoooogggggggggsssssssssssssssss bbbbbbbbbbbyyyyyyyyyyyyyyyyyyyy SSSSSSSSSSSSSSSSSSSSSSSSSStttttttttttttttttaaaaaaaaaaaaaaaaaaaaaaattttttttttteeeeeeeeeeeeeeeeeeeee NNNNNNNNN N Norororororororthththththththth CCCC CCCCCCarararrarollolooo iinninna aa a a ((1(1(1( 3)3)3)) CCCCCCCCCCaaaalalallifififififororoororro iiininininniaaa aaa (((((1(1(1(1(1(1) ))) )))) ) C C CCCCCCCC CCCColololloloorororor dddadadadada ooo ooo (1(1(1(1(11( ) ) ) ) WW WWWWWW WW isisisisisissssscccococococconsnsnsnsiiininininin (( ((( ( (1)11)))1)1))1)1)1 H H HH Heae thhhhtt ererrrr MMMMMMMuluuu leler rrrr AmAmAAAmanannnndaadadaadada D D D DDDaiaiaiaaaiaiailollololooor rr rr TaTT rrrahhhahah T TT TTTata e ee e HH ananannnan h hh JeJJeJ skskkeee Kaitlyn Eckert Elizabeethh Keiil Marryland (1) Florida (1) KaK nsn as (1) Mara y Beeale Leilani Halkiotis Megan Foster Ferrir ss RRRoberts CCCararolynynn OOOO’B’Brien FFrancn ese SStat ele ini AAmanda KnKnKK apaapp pp Mararara gogogo Flelewewew lll iningg M M MMMararara y yy KaKaKaKK tetetetee TTTucucuckekekeer rrr EEriin RyRyyanan EEmmmmma a SeSellll-G-Gooodhdhd and dd GGGGGGGGininnnii a a BeBeBeBeerr KKKKriririiststttennn L LLawawwa soson n
88
CAROLYN O’BRIEND • 5-1 • SR • ASHEVILLE, N.C.
Overview: Key contributor for the Bulldogs for the past three years...versatile player who can play anywhere on the fi eld...will be one of fi ve seniors on this year’s roster...local product who played at Roberson HS in Asheville.
2010: Appeared and started in 13 matches for the Bulldogs...fi red two shots on the season.
2009: Started and played in all 16 matches for Asheville...was part of a stingy defense that allowed just 16 goals in 16 matches...helped Bulldogs record fi ve shutouts on the year and never al-low an opponent to score more than two goals...took fi ve shots during the season.
2008: Played in 18 matches and started fi ve times...had four shots in four different matches...earned a start at Murray State (9-5), UT-Martin (9-7), at Furman (9-10), at Coastal Carolina (10-7) and Radford (11-1).
Before UNC Asheville: Helped lead Roberson to 28-1 overall record and berth in 3-A state championship game in 2008...Rob-erson was ranked #1 in nation for part of the year...tallied four goals and had nine assists...earned All-Conference honors and Sportsmanship Award.
8
99
FRANCES STAELIND • 5-7 • SR • CHAPEL HILL, N.C.
Overview: Walk-on who joined the Bulldog team right before the 2010 season started and turned into a key performer for Asheville...one of fi ve seniors on this year’s club.
2010: Played in 14 matches and started nine times...delivered an assist at Coastal Carolina (10-18)...started the fi nal seven games of the season...took one shot on the year vs. Western Carolina (8-26).
Before UNC Asheville: Attended Chapel Hill HS in Chapel Hill where she enjoyed an excellent prep career...was an all-con-ference performer for three straight year and earned all-region honors her junior and senior year...MVP of Chapel Hill team as a sophomore, junior and senior...played club soccer for 89’ Triangle where she served as captain of that team and helped lead team to Club State runner-up fi nish for U18.
9
1010
LEILANI HALKIOTISMF • 5-3 • SR • BROOKSVILLE, MD
Overview: First name is pronounced Lay-lahn-nee...last name is pronounced Hall-kee-otis...has been a starter for the Bulldogs from the start of her freshman year...will be a key player for Asheville in 2011 and should compete for All-Conference hon-ors.
2010: Started and played in all 17 matches for the Bulldogs...led Asheville in scoring with four goals, three assists and 11 points...led team in shots with 43...tallied career-best two goals at Liberty (10-27)...scored Bulldogs fi rst goal of the season in opening game vs. ETSU (8-20)...tallied a goal and assist in close 3-2 loss to Wof-ford (9-10)...had an assist in game-winning goal against Francis Marion (9-19)...also had assist vs. VMI (10-3)...fi red fi ve shots in two different matches.
2009: Started in 15 matches and played in 16 games at midfi eld...fi red 22 shots during the year, fourth most on the team...had four shots vs. VMI (10-4) and Coastal Carolina (10-18).
2008: Started in 18 of 19 matches...was UNC Asheville’s fi fth leading scorer with two goals and fi ve points...took 11 shots on the year...scored fi rst career goal at Furman (9-10)...tallied game-tying goal at Tennessee Tech (9-21)...had assist in victory over Presbyterian (9-17).
Before UNC Asheville: Graduated from Sherwood HS in San-dy Spring, Md....second team All-Conference as a senior...scored fi ve goals and added seven assists senior season...enjoyed a great club career for the Bethesda Rapids as she helped the Rapids to the 2007 Maryland State Cup championship and Jefferson Cup fi nals.
12
1111
MARY BEALEF • 5-5 • R-JR • ARDEN, N.C.
Overview: Red-shirt junior who played very well for the Bull-dogs in 2010...gave Asheville offense a real lift...has also played as a goalkeeper during her career...grew up and played high school soccer in Virginia before her family moved to Asheville area prior to her freshman year.
2010: Emerged as a key player for the Bulldogs...scored fi rst career goal vs. Francis Marion (9-19) that tied the match as Asheville would go on to record a 2-1 victory...also tallied goal vs. VMI (10-3)...took 11 shots on the season with three coming vs. VMI (10-3)
2009: Played in one match and played the fi nal three minutes as a goalkeeper in 3-0 victory over Presbyterian College (10-10).
2008: Red-shirted.
Before UNC Asheville: Enjoyed a standout career at Halifax County HS in South Boston, Va....earned fi rst team All-District honors as a junior and second team All-District honors as a sophomore and senior...was captain of team senior year...four-year starter at Halifax for head coach Sid Young...also lettered in cross country and basketball...played for Danville Blasts Club team.
7
1212
MARY KATE TUCKERD • 5-8 • R-JR • WINSTON-SALEM, N.C.
Overview: One of the top defenders in the Big South Confer-ence...missed last season due to a knee injury...should be ready to play in 2011...earned second team All-Conference honors as a sophomore in 2009...made the league’s All-Rookie team as a freshman in 2008.
2010: Did not play due to a knee injury
2009: Started and played all 16 matches for Asheville...picked up assist on game-winning goal vs. Tennessee Tech (9-13)...fi red 10 shots during the season...took three shots at Western Carolina (9-20)...also had two shots vs. Coastal Carolina (10-18).
2008: Started in 16 games for the Bulldogs in the back and quickly became a key player for the Bulldogs...picked up a goal at Liberty (10-11) and had 15 shots on the year...took three shots at Tennessee Tech (9-21)...had two shots in four different matches.
Before UNC Asheville: Attended Ronald Reagan HS where she was a four-year starter as a defender...senior season was named to all-conference, all-county and all-region teams...earned Marine Corps Athletic Achievement Award...made All-Confer-ence and All-Region team as a junior...freshman year was named Most Valuable Defender by Reagan coaching staff...attended North Carolina ODP all-region camp...good athlete who let-tered in cross country and basketball in high school...earned All-Conference honors in cross country as a sophomore.
17
1313
HANNAH JESKED • 5-7 • JR • CEDARBURG, WI
Overview: Has been a starter for the Bulldogs for the past two years and should be one of the best in the Big South in 2011...earned Big South All-Rookie honors in 2009...went with Gina Beer in January of 2011 to Nicarauga to teach soccer in Soccer Without Borders Program.
2010: Played and started in all 17 matches for the Bulldogs...fi nished the year with three points...scored goal at South Caro-lina State (9-27)...picked up an assist vs. Wofford (9-10)...took six shots on the year.
2009: Started and played in all 16 matches for Asheville and did a great job for the Bulldogs in the midfi eld...has 12 shots on the year, including two at Presbyterian College (10-10) and two at Winthrop (10-23).
Before UNC Asheville: Played one year of high school soccer at Cedarburg HS in Wisconsin...played as a freshman and earned second team All-Conference honors...played club soccer for FC Milwaukee and helped team get to regional fi nals.
10
1414
ELIZABETH KEILD • 5-7 • JR • ASHEVILLE, N.C.
Overview: Local product from Asheville HS who earned her way into the starting line-up in the back last year...two-sport ath-lete at Asheville HS and excelled in fi eld hockey...mother Rebecca Keil works in the Athletic Deparment’s as Director of Student-Athlete Affairs.
2010: Played in 11 matches and started seven times...slowed by injuries in latter part of the season.
2009: Played in one match during the year.
Before UNC Asheville: Three-year starter in the back at Asheville HS...played forward for fi eld hockey team at Asheville and led the state in goals scored junior and senior year...played club soccer for Highlands Football Club and helped them win Savannah Cup and Riverside tournement in 2006-2007 season.
14
1515
FERRISS ROBERTSMF • 5-5 • JR • LEAWOOD, KS
Overview: Junior midfi elder who really came on during her sophomore season...comes to Asheville from Leawood, Kansas.
2010: Started 12 times and played in 15 matches...tied for third on team in scoring with two goals and four points...scored fi rst career goal at Tennessee Tech (9-5) and tallied again at Coastal Carolina (10-18)...had nine shots during the season with season-high two at Charleston Southern (10-15)
2009: Played in nine matches and gave the Bulldogs some real energy off the bench.
Before UNC Asheville: Attended high school at Blue Valley North in Leawood, Kansas...three-year starter at Blue Valley where she led the team in assists throughout her career...helped lead school to 6-A state championship as a sophomore and three straight regional titles...Honorable Mention All-Conference as a junior and senior...played for club team KC Metro Dynamos...led club team to State Cup championships in 2008 and 2009...team earned #15 national ranking...excellent student who made Academic-Principal’s Honor Roll for eight semesters...member of National High School Scholar Hall of Fame...member of Kansas Regional Ballet and American Dance Center for 12 years.
22
1616
TARRAH TATEMF • 5-5 • SO • CASTLE ROCK, CO
Overview: Sophomore forward who worked hard last year and showed tremendous improvement throughout the season...will be a key player for the Bulldogs up front this season.
2010: Played in 15 matches and started 13 times...registered 10 shots...had three shots vs. VMI (10-3) and two shots at Furman (9-15)...started the last seven matches of the year.
Before UNC Asheville: Attended Rock Canyon HS in Castle Rock, Colo....led team in scoring in both her junior and senior seasons...served as team captain as a senior...earned All-Confer-ence honors senior campaign...played for club team Colorado Rush Nike that was ranked fi fth in country at one point...played for Colorado ODP until 2008 and attended Region IV camp.
5
1717
AMANDA KNAPPF • 5-4 • SO • YOUNGSVILLE, N.C.
Overview: Enjoyed a spectacular high school career at Franklin-ton HS in Youngsville and did a solid job for the Bulldogs up front in her rookie year...will be one of the most dangerous strikers in the Big South this season.
2010: Played in 16 matches and earned 11 starts...fi nished the season as Asheville’s second leading scorer with three goals, two assists and 11 points...scored at least one goal in last two games of the season at Liberty (10-27) and near upset of Big South champion High Point (10-29)...tallied fi rst career goal vs. VMI (10-3)...also had an assist against Keydets (10-3) and at Liberty (10-27)...second on team in shots taken with 27...had two matches with four shots and fi ve matches with three shots taken.
Before UNC Asheville: Attended Franklinton HS where she was the team MVP all four years she played...scored an amazing 165 goals in her career...fi rst-team all-conference all four years she played...served as captain as a sophomore, junior and senior...top goal scoring year was junior year when she scored 51 goals...tallied 49 goals as a sophomore...senior year scored 38 goals with 24 assists...all-region performer as a sophomore, junior and se-nior...was named Northern Carolina Conference Player of the Year following senior campaign...earned Wendy’s Heisman Award as junior...member of North squad in North Carolina State games in 2008 & 2009...was named as 2010 U.S. Army National Scholar Athlete...named to All-State team as a senior...led Franklinton to conference championship as a senior and helped team advance to third round of state playoffs...also led school to Brassfi eld Com-mercial Classic Tournament title for four straight years...played club for CASL 91 Spartan Premier...team fi nished fi rst in Premier Division in 2010 and #5 ranking in North Carolina...played in East-West All-Star Game in Greensboro in July of 2010.
6
1818
ERIN RYAND • 5-8 • SO • RALEIGH, N.C.
Overview: Sophomore who played very well for the Bulldogs as a freshman and could compete for All-Conference honors in 2011...versatile player who can play all over the fi eld, including in goal.
2010: Started all 17 matches for the Bulldogs, including one as a goalkeeper at Charleston Southern (10-15)...played most of the season as a defender...took 14 shots during the year with three at Presbyterian College (10-9)...made fi ve saves in the CSU match as she played the fi rst half against the Buccaneers.
Before UNC Asheville: Four-year starter at Sanderson HS...earned All-Conference honors for four straight years...named to All-Regional team sophomore through senior year...team cap-tain as a senior and scored three goals with two assists from central defender spot...was named team MVP following senior year...helped lead Sanderson to 13-5-4 overall record and berth in conference and state tournament...excellent student who was academic all-conference for four years...received the Sports-manship Award at Brittany Tournament...played club soccer for ‘91 Triangle Futbol Club Navy Girls and team compiled 38-12-7 overall record last year...club team advanced to State Cup fi nals and earned a regional berth...helped lead state cup team to state championship in 2008 and went unbeaten in Premier League.
18
1919
EMMA SELL-GOODHANDF • 5-6 • SO • DURHAM, N.C.
Overview: Joined Bulldog program in middle of the season and gave Asheville a lift on offense...hard worker who makes things happen...attended Durham School of the Arts.
2010: Played in nine matches and started one time...took six shots during the year, including career-high of three at Presby-terian College (10-15)...almost scored on her fi rst shot of her collegiate career in her fi rst match vs. Radford (10-1).
20
2020
GINA BEERD • 5-8 • SO • CHAPEL HILL, N.C.
Overview: Did a nice job for the Bulldogs in the back as a freshman...went with teammate Hannah Jeske in January to teach soccer to young girls in Nicarauga for Soccer Without Borders.
2010: Played in 11 matches in the back and started four times...started the fi nal four matches of the year...recorded two shots at Charleston Southern (10-15).
Before UNC Asheville: Played at Chapel Hill HS in Chapel Hill
21
2121
KRISTEN LAWSONMF • 5-8 • SO • CHARLOTTE, N.C.
Overview: Came to UNC Asheville as a goalkeeper but due to injuries ended up playing the majority of the season in the fi eld...member of UNC Asheville Honors Program.
2010: Played in 14 matches with four of them being in goal...picked up an assist at Liberty (10-27) and fi red a shot on goal at South Carolina State (9-27)...started as goalkeeper in two match-es with one being at Coastal Carolina (10-18) and the second against Gardner-Webb (10-24) at home.
Before UNC Asheville: Attended Providence HS in Char-lotte...earned All-Conference and All-Region honors as a senior...was team captain and was given the Panther Pride Award fol-lowing senior campaign...team MVP as a junior and also named to all-conference and all-region teams...helped lead Providence to #8 ranking in state...named Best Team Player as a sophomore and was picked to go to North Carolina State Games...lettered in basketball at Providence and was captain of team as senior...played club soccer for Charlotte United Gold 91G...helped lead team to #3 ranking in state in 2008 and fi nalist in Southern Soc-cer Showcase...selected to play in North Carolina East-West All-Star Game in Greensboro...also selected to play in North Carolina-South Clash of the Carolinas.
24
2222
HEATHER MULLERGK • 5-10 • FR • CARY, N.C.
Overview: Talented freshman goalkeeper who will compete for playing time this season...attended Apex HS in Apex...played in prestigious East-West High School All-Star game in Greensboro in July.
Before UNC Asheville: Enjoyed a standout prep career for head coach Kevin Todd at Apex...senior year posted seven shut-outs and allowed just 14 goals...helped lead Apex to 15-3-1 over-all record...named fi rst team All-Conference following senior season...was team MVP as a junior and senior...junior year had six shutouts...also lettered in basketball at Apex.
0
AMANDA DAILORF • 5-4 • FR • CASTAIC, CA
Overview: Midfi elder from California who could help a great deal as a freshman...enjoyed an excellent club career...fi rst player from California on Bulldog roster since 1999.
Before UNC Asheville: Played prep soccer at West Ranch HS in Stevenson Ranch, Calif....high school coach was Cami Hidding...named Rookie of the Year freshman season...earned top Offensive Player as a freshman, sophomore and junior...team MVP sopho-more year...made fi rst team All-Conference as a sophomore and second team as a junior...U18 club team won Far West Region-als...U17 squad reached San Diego Surf Cups Finals of the Super Group...U15 team won Cal South National Cup...U10-U18 club team ranked top 20 nationally.
2
2323
KAITLYN ECKERTF • 5-5 • FR • KNIGHTDALE, N.C.
Overview: Gifted scorer who only played three years of high school soccer before joining UNC Asheville program last January after graduating from Knightdale HS in Knightdale, N.C....played with the Bulldogs in the spring.
Before UNC Asheville: Completed her three-year career at Knightdale with an amazing 105 goals...junior season compiled 63 goals and 32 assists, the eighth highest scoring total in state his-tory...earned All-State, All-Region and All-Conference honors...averaged three goals per game...helped lead team to third round of state playoffs.
4
MEGAN FOSTERMF • 5-5 • FR • GAINESVILLE, FL
Overview: Midfi elder from Florida who enjoyed an outstanding senior year in high school and could be able to contribute right away up front for the Bulldogs.
Before UNC Asheville: Attended Gainesville HS and was the region’s leading goal scorer as a senior with 29 goals and eight assists...named to All-Conference and All-Area team.
15
2424
MARGO FLEWELLINGD • 5-7 • FR • CHAPEL HILL, N.C.
Overview: Freshman midfi elder who should battle for playing time as a rookie.
Before UNC Asheville: Attended Chapel Hill HS and enjoyed a standout prep career...earned All-Conference honors as a ju-nior and senior...selected to play in East-West All-Star game in Greensboro in July.
16
2525
MICHELLE DEMKOHEAD COACH • SECOND SEASON • MARYLAND, 1996
Michele Demko is in her second year as head coch of the UNC Asheville women’s soccer program.
Demko, a former standout at the University of Mary-land, came to Asheville after working at the University of Nebraska as an assisant coach.
She replaced Michele Cornish, the Big South’s and UNC Asheville’s all-time winningest coach.
“When we began to look at the applicants for this posi-tion, we were determined to fi nd a Champion in Athletics and a Leader in Life,” declared Director of Athletics Janet R. Cone. “Michelle fi t our vision perfectly. She has been a champion on the fi eld both collegiately and professionally. Michelle has also coached at two outstanding universities. We believe she will do an exemplary job leading our wom-en’s soccer program.”
Demko has been at Nebraska for three years and served as the Huskers recruiting coordinator. Nebraska has posted three straight winning seasons and improved its win total each year.
Before coming to Nebraska, Demko spent four years with North Carolina State, helping to improve the Pack from a record of 9-9-1 in 2003 to a record of 11-9-1 in 2006.
Before her stint at N.C. State, Demko played professionally with the Philadelphia Charge. She was selected in the eighth round (63rd overall) by the Charge and
played two seasons in the WUSA, leading Philadelphia into the WUSA Founders Cup semifi nals twice.
Demko also had a successful professional career over-seas, spending three years in Germany in the competitive Frauen Bundesliga for the SC Klinge Seckah, FSV Frankfurt and Bayern Munich.
She was a starter for all three teams and led Bayern Munich to a league championship. In addition, Demko cap-tured a national title, while playing with the W-League’s Maryland Pride from 1994 to 1996.
Demko, who played soccer at the University of Mary-land under former U.S. National Team Coach April Hein-richs, was named to the Atlantic Coast Conference’s 50th Anniversary Women’s Soccer Team. While playing at Mary-land, she served as a two-year captain and was voted MVP by her team. She also earned fi rst-team All-ACC honors.
Michelle Demko coaching at halftime
2626
Demko played in three Olympic Festivals (1994-96), as well as being called into national team training camps in 1995, 1996 and 1997. Demko also owns a cap with the U.S. Women’s National Team while playing against Germany in 1997.
A native of Largo, Fla., Demko received a bachelor’s de-gree of science-kinesiology from Maryland in 1996. Prior to her arrival at Maryland, she played soccer at Barry Univer-sity in Miami Shores, Fla. She helped lead Barry to the 1992 NCAA Division II national title as she scored in the champi-onship match against Adelphi.
What People Are Saying About Michelle Demko
“Michelle Demko is one of the brightest and best female head coaches I have observed coaching. She is passionate about the game, cares about her players and is a fabulous role model for all. Student-Athletes will push themselves and each other while playing for Michelle at UNC Ashville.”
April Heinrichs, Former Head Coach at Maryland/Former United States National Team Coach
“Michelle will do a terrifi c job at UNC Asheville. She brings incredible experience as a former professional player and during her tenure at Nebraska. She proved herself to be an excellent recruiter, a creative and disciplined coach, and most of all, she brings her outstanding character and passion which will become the foundation of her program at UNC Asheville. We will miss her at Nebraska but we are excited to follow her progress with her new program.”
John Walker, Nebraska Head Women’s Soccer Coach
Michelle Demko at Greenwood Field
2727
MARY CASEYASSISTANT COACH • SECOND SEASON • MARYLAND, 2009
Former Maryland standout Mary Casey is in her second year as an assistant coach with the UNC Asheville women’s soccer program.
Casey was an All Atlantic Coast Conference performer for Maryland and played professionally for the Northern Virginia Majestics of the United Soccer League’s W-League and was drafted by the Los Angeles Sol of Women’s Profes-sional Soccer (WPS).
“I am more than excited to have Mary join the staff,” said Demko. “She was among the best players in the ACC and was a huge reason for Maryland’s success. Her work ethic sets her apart on and off the fi eld and brings immedi-ate credibility with the players having played profession-ally.”
Casey played both defender and goalkeeper during her playing career and was an All-ACC fi rst team selection in 2008. She was named a team captain at Maryland her se-nior season and helped lead the Terrapins to an appearance in the Sweet 16 of the 2009 NCAA Tournament.
That season Casey anchored a defense that posted nine shutouts including fi ve of the Terps’ fi rst seven games. Maryland went 14-6-2 in 2009 as Casey posted 76 saves in goal while only allowing 22 goals over the course of the season.
For her career with the Terrapins she played in 74 con-tests recording 136 saves and 13 shutouts.
She excelled academically as well earning a spot on the 2008 All-ACC Academic team. Casey was named to the National Soccer Coaches Association of America Scholar All-American second team and the NSCAA All-East Schol-ar fi rst team.
Mary Casey at Maryland
2828
2929
CCCCCCCCCCCCCOOOOOOOOOOOOOONNNNNNNNNNNNFFFFFFFFEEEEEEEERRRRRRRRREEEEEEEENNNNNNNNNNCCCCCCCCCCEEEEEEEEEEEEEE /////////// RRRRRRRRRRRRREEEEEEEEEEEEECCCCCCCCCCCCCCCOOOOOOOOOOOOORRRRRRRRRRRRRRRDDDDDDDDDDDDSSSSSSSSSSSS
3030
2010 ASHEVILLE SOCCER SEASON
## Name GP-GS G A Pts Sh Sh% GW PK-ATT 12 HALKIOTIS, Leilani 17-16 4 3 11 43 .093 0 0-0 14 KNAPP, Amanda 16-11 3 2 8 27 .111 0 0-0 7 BEALE, Mary 16-8 2 0 4 11 .182 0 0-0 22 ROBERTS, Ferriss 15-12 2 0 4 9 .222 0 0-0 3 MCCLEARY-SMALL,Chole 8-5 1 2 4 21 .048 0 0-0 20 SROKA, Dana 16-14 1 1 3 15 .067 1 0-0 10 JESKE, Hannah 17-16 1 1 3 6 .167 0 0-0 11 BEELER, Katy 7-6 1 0 2 8 .125 0 0-0 24 LAWSON, Kristen 15-6 0 1 1 1 .000 0 0-0 9 STAELIN, Frances 14-9 0 1 1 1 .000 0 0-0 18 RYAN, Erin 17-16 0 0 0 14 .000 0 0-0 5 TATE, Tarrah 15-13 0 0 0 10 .000 0 0-0 15 SELL-GOODHAND, Emma 9-1 0 0 0 6 .000 0 0-0 21 BEER, Gina 11-4 0 0 0 2 .000 0 0-0 16 TEAGUE, Bethany 9-6 0 0 0 2 .000 0 0-0 8 O’BRIEN, Carolyn 13-12 0 0 0 2 .000 0 0-0 6 KEIL, Elizabeth 11-7 0 0 0 1 .000 0 0-0 0 DENT, Megan 14-13 0 0 0 0 .000 0 0-0 Total 17 15 11 41 179 .084 1 0-0 Opponents 17 60 39 159 294 .204 15 0-0
RECORD: OVERALL BIG SOUTH HOME AWAY NEUTRALALL MATCHES 1-16-0 0-9-0 1-7-0 0-9-0 0-0-0
TEAM STATISTICS UNCA OPP
SHOT STATISTICS Goals-Shot attempts 15-719 60-294 Goals scored average 0.88 3.53 Shot pct .084 .204 Shots/Game 10.5 17.3 Assists 11 39CORNER KICKS 66 75PENALTY KICKS 0-0 0-0PENALTIES Yellow cards 8 4 Red cards 0 0ATTENDANCE Total 1640 1898 Dates/Avg Per Date 8/205 9/211 Neutral Site #/Avg 0/0
2010 RESULTSDATE OPPONENT W/L SCORE ATTAug 20 ETSU L 1-4 259Aug 26 WESTERN CAROLINA L 0-4 276Sep 05 at Tennessee Tech L 1-3 519Sep 09 at Elon L 0-3 156Sep 10 WOFFORD COLLEGE L 2-3 188Sep 15 at Furman L 1-4 135Sep 19 FRANCIS MARION W 2-1 158Sep 27 at SCSU L 1-3 28*Oct 01 RADFORD L 0-2 156*Oct 03 VMI L 2-3 124*Oct 09 at Presbyterian College L 0-3 125*Oct 15 at Charleston Southern L 0-8 146*Oct 18 at Coastal Carolina L 1-4 297*Oct 22 WINTHROP L 0-4 212*Oct 24 GARDNER-WEBB L 0-3 267*Oct 27 at Liberty L 3-6 120*Oct 29 at High Point LOT 1-2 372
|-GOAL AVERAGE-| |-SAVES-|## GOALTENDERS GP Minutes GA Avg Sv Pct W L T Sho 0 DENT, Megan 14-12 1202:50 44 3.29 84 .656 1 12 0 0.0 24 LAWSON, Kristen 4-2 285:09 12 3.79 26 .684 0 2 0 0.0 18 RYAN, Erin 1-1 45:00 4 8.00 5 .556 0 1 0 0.0 Total 17 1532:59 60 3.52 115 .657 1 15 0 0 Opponents 17 1532:59 15 0.88 82 .845 15 1 0 7
GOALS BY PERIOD 1st 2nd OT TotalUNC Asheville 8 7 0 15Opponents 31 28 1 60
SHOTS BY PERIOD 1st 2nd OT TotalUNC Asheville 82 96 1 179Opponents 141 151 2 294
SAVES BY PERIOD 1st 2nd OT TotalUNC Asheville 52 63 0 115Opponents 42 39 1 82
CORNER KICKS BY PRD 1st 2nd OT TotalUNC Asheville 36 30 0 66Opponents 42 32 1 75
FOULS BY PERIOD 1st 2nd OT Total UNC Asheville 54 47 1 102Opponents 70 50 0 120
3131
BIG SOUTH OVERALLTeam W L T Pts Pct W L T Pct Home Road Neu L10 StreakWinthrop 6 2 1 19 .722 7 10 2 .420 4-3-1 2-5-1 1-2-0 6-3-1 L1Radford 6 2 1 19 .722 12 7 1 .625 6-3-1 5-4-0 1-0-0 6-3-1 L1Charleston Southern 6 2 1 19 .722 12 7 1 .625 8-2-0 3-3-1 1-2-0 6-3-1 L1Coastal Carolina 6 2 1 19 .722 10 8 2 .555 3-1-1 6-5-1 1-2-0 6-2-2 L1High Point 6 2 1 19 .722 11 11 1 .500 4-3-1 3-7-0 4-1-0 8-1-1 L1Liberty 4 5 0 12 .444 8 10 3 .452 6-2-0 0-8-1 2-0-2 5-4-1 U4Gardner-Webb 3 4 2 11 .444 7 10 5 .432 2-3-3 4-5-1 1-2-0 4-3-3 L1VMI 2 6 1 7 .278 3 16 1 .175 2-6-0 1-8-1 0-2-0 2-7-1 L2Presbyterian College ** 2 7 0 6 .222 5 13 1 .289 5-4-1 0-8-0 0-1-0 3-7-0 L6UNC Asheville 0 9 0 0 .000 1 16 0 .059 1-8-0 0-9-0 0-0-0 0-10-0 L10
** - Presbyterian is not eligible for the postseason tournament
2010 BIG SOUTH STANDINGS
FIRST TEAM ALL-CONFERENCEMarky Boyce F Sr. Charleston Southern
Courtney Durbin F Jr. WinthropKelli Joline F Fr. High PointJulie Ruh’e F Fr. Radford
Anna Tupy MF Sr. Coastal CarolinaLatrice Lee MF Sr. Radford
Caitlyn Wesnesky MF Sr. Charleston Southern
Allie VandeWater MF So. WinthropJanay Whittaker D So. High Point
Tyler Drake D Fr. RadfordKate Perkinson D Sr. Winthrop
Chloe Urig D Fr. Charleston SouthernChe’ Brown GK Fr. Radford
SECOND-TEAM ALL-CONFERENCEMichelle Dennis F Sr. Charleston Southern
Aimee Luurtsema F Jr. LibertyTricia Vensel F Jr. Winthrop
Kate Wilkinson F Fr. Coastal CarolinaSara Rager MF Sr. High PointMadison Short MF So. Liberty
Sarah Strand MF Jr. VMIEmma Krantz MF Fr. Charleston Southern
Kelly Morrison D Jr. VMISharDavia Bell D Sr. RadfordAriana Espinoza D So. Liberty
Sammy Vercellino D Fr. High PointChelsea Hearne GK Jr. Gardner-Webb
ALL-FRESHMAN TEAMChe’ Brown GK RadfordKelli Joline F High Point
Kate Wilkinson F Coastal CarolinaChloe Urig D Charleston SouthernToni Lashley F Charleston Southern
Anna Sammons D WinthropMeagan Reynolds F Gardner-Webb
Julie Ruh’e F RadfordTyler Drake D Radford
Sammy Vercellino D High PointCasey Norris MF Liberty
ACADEMIC ALL-CONFERENCEStacie Ulichnie Charleston Southern
Colleen Schohl Coastal CarolinaMegan Tremblay Gardner-Webb
Brielle Spencer High PointAimee Luurtsema Liberty
Melanie Martin Presbyterian CollegeKathleen Jarvis Radford
Megan Dent UNC AshevilleSimone Jimenez VMI
Rachel Webster Winthrop
PLAYER OF THE YEARMarky Boyce, F, Charleston Southern
DEFENSIVE PLAYER OF THE YEARChe’ Brown, GK, Radford
FRESHMAN OF THE YEARChe’ Brown, GK, Radford
COACH OF THE YEARSpencer Smith, Winthrop
SCHOLAR-ATHLETE OF THE YEARBrielle Spencer, High Point
BIG SOUTH WOMEN’S SOCCER CHAMPIONSHIP
Thursday, Nov. 4 - Quarterfi nals#5 High Point 1 #4 Charleston Southern 0#1 Winthrop 3 ............................... #8 VMI 1#6 Liberty 3 ............ #3 Coastal Carolina 2#7 Gardner-Webb 1 ........... #2 Radford 0
Friday, Nov. 5 - Semifi nals#5 High Point1 ................... #1 Winthrop 0#7 Gardner-Webb 0 . #6 Liberty 0 (2OT)
(Gardner-Webb advanced 4-2 on PK’s)
Sunday, Nov. 7 - Championship#5 High Point 1 ...... #7 Gardner-Webb 0
(OT)
ALL-TOURNAMENT TEAM
JANAY WHITTAKER (MVP) .... High PointJILLIE JOHNSTON .................... High PointANDREA RITCHIE .................... High PointKELLI JOLINE ............................. High PointCHELSEA HEARNE ...........Gardner-WebbMEGAN TREMBLAY ..........Gardner-WebbMEGAN REIMER ................Gardner-WebbCOURTNEY DURBIN ............... WinthropKATIE PERKINSON ................... WinthropMADISON SHORT ..........................LibertyMAGGIE WOODY ...........................LibertyEMILY DANCHAK .Charleston SouthernAMANDA BERRIOS.............................. VMIHANNAH BROWN ......Coastal CarolinaLATRICE LEE ...................................Radford
3232
BIG SOUTH RECORDS
Big South tournament Record By Round
Win Loss Tie PctQuarterfi nals 5 5 3 .500Semifi nals 6 3 1 .650Finals 1 3 3 .357
Big South Tournament Record By Opponent
Win Loss Tie .PctBirmingham-Southern 1 0 0 1.000Charleston Southern 4 1 1 .750Elon 0 0 2 .500High Point 0 2 1 .200Liberty 0 2 2 .250Radford 0 4 0 .000South Alabama 0 1 0 .000UMBC 2 1 0 .667UNC Greensboro 1 0 1 .750Winthrop 4 0 0 1.000Totals 12 11 7 .517
Big South Tournament Results
Year Opponent Round Score W/L Site1992 UMBC Quarterfi nals 0-7 L Baltimore, Md1994 Radford Quarterfi nals 0-1 L Baltimore, Md.1995 UMBC Semifi nals 3-0 W Greensboro, N.C.1995 UNC Greensboro Finals 1-0 W Greensboro, N.C.1996 UMBC Semifi nals 3-0 W Greensboro, N.C.1996 UNC Greensboro Finals 1-1 (3-4, PK’s) L Greensboro, N.C.1997 Charleston Southern Quarterfi nals 3-0 W Radford, Va.1997 South Alabama Semifi nals 1-2 L Radford, Va.1998 Charleston Southern Semifi nals 2-1 (OT) W Lynchburg, Va.1998 Radford Finals 0-1 L Lynchburg, Va.1999 Elon Quarterfi nals 0-0 (4-5, PK’s) L Lynchburg, Va.2000 Liberty Quarterfi nals 1-3 L Radford, Va.2001 Charleston Southern Quarterfi nals 0-2 L Charleston, S.C.2002 Elon Quarterfi nals 1-1 (4-3, PK’s) W Charleston, S.C.2002 Liberty Semifi nals 1-1 (4-2, PK’s) W Charleston, S.C.2002 Radford Finals 0-2 L Charleston, S.C.2003 Winthrop Quarterfi nals 2-1 W High Point, N.C.2003 Charleston Southern Semifi nals 3-0 W High Point, N.C.2003 High Point Finals 0-0 (2-3, PK’s) L High Point, N.C.2004 Winthrop Quarterfi nals 1-0 W Charleston, S.C.2004 High Point Semifi nals 1-3 L Charleston, S.C.2005 Winthrop Quarterfi nals 1-0 W Rock Hill, S.C.2005 Charleston Southern Semifi nals 3-1 W Rock Hill, S.C.2005 Liberty Finals 0-3 L Rock Hill, S.C.2006 Birmingham-Southern Quarterfi nals 1-0 (2 OT) W Conway, S.C.2006 Winthrop Semifi nals 2-1 W Conway, S.C.2006 Liberty Finals 0-0 (4-2, PK’s) W Conway, S.C.2007 Charleston Southern Quarterfi nals 1-1 (4-2, PK’s) W Charleston, S.C.2007 High Point Semifi nals 0-1 L Charleston, S.C.2008 Radford Quarterfi nals 1-2 (OT) L High Point, N.C.
Regular Season Championships
2004, 2005Tournament Championships
1995, 2006Tournament Runners-Up
1996, 1998, 2002, 2003, 2005
The 1995 UNC Asheville team won the Big South Conference championship and set a school record for wins with 16. The Bulldogs won the title by upsetting nationally-ranked UNC Greensboro, 1-0 in the championship match.
3333
When the 2006 season started for the UNC Asheville women’s soccer team, Michele Cornish’s club would not carry the role of favorite for the fi rst time in two seasons.
The Bulldogs were coming off back-to-back regular season championships in 2006. The 2004 and 2005 teams had been expected to be good and accomplished a great deal with their titles. Only one thing was missing from those teams and that was a Big South Conference tournament championship and a trip to the NCAA Tournament.
There wasn’t much hope that the Bulldogs would be able to get that tournament title and trip to the NCAA Tournament in 2006. UNC Asheville was a preseason pick to fi nish in fi fth place and had graduated the core of its championship teams. There were some key players returning but a lot of younger players were going to have to step up for the Bulldogs to have a winning season.
Asheville entered the Big South Conference Tournament as the fi fth seed and without the pressure of being the top seed from the previous two seasons. The Bulldogs were 8-6-2 and had a nice year considering they lost their starting goalkeeper early in the season and at times were struggling to score goals.
The fi rst game in the tournament would be a tough one as fourth-seeded Birmingham-Southern would be the opponent. The Panthers were in their fi nal year of Division I and wanted to go out a winner. They had beaten the Bulldogs, 1-0 early in the season at Greenwood Field.
A strong Asheville defense led by senior Sara Pahl and junior Kate Barrow kept the Panthers at bay. But the Panthers’ defense was tough as well and kept the Bulldogs off the scoreboard. The match moved into a second overtime period and it looked like penalty kicks would decide the match. However, Robyn Busha had other ideas. She took a pass from Juliana Duncan and headed the ball into the back of the goal in the 107th minute to send the Bulldogs to the semifi nals for the fi fth straight year.
The semifi nals would be a match with top-seeded Winthrop. The Lady Eagles were gunning for revenge against Asheville. The Bulldogs had ended Winthrop’s season the past three years and it had never beaten UNC Asheville. The regular-season champs scored early and began to dominate the match in the fi rst half before settling for a 1-0 lead.
But again Asheville’s defense would tighten up and keep Winthrop off the scoreboard. The Bulldogs began to play better and then got a big break to tie the game early in the second half. On a corner kick, the ball was knocked into the goal by an Eagle player to knot the match at 1-1.
The Bulldogs were then able to strike again late. Busha sent a perfect pass to Joy Haynes. The junior forward used her speed to get loose for a breakaway. She was able to push the ball into the back of the net and suddenly the Bulldogs led 2-1 with four minutes left. Asheville was able to hold off one more Winthrop charge and the Bulldogs were in the title game for the second straight year and fourth time in the last fi ve seasons.
The Big South Championship match had been a real source of frustration for Cornish and the Bulldog program. This was the sixth time Asheville had advanced to the title game and only had one victory to show. The Bulldogs would face Liberty once again for the title and once again Asheville’s defense was up to the task. The Flames would control play but could not get a shot past Lazar. The match would go through regulation tied at 0-0 before heading to overtime.
It would stay scoreless as each team’s defense would not allow a goal. The Bulldogs’ dream of a trip to the NCAA Tournament would come down to Penalty Kicks.
Lazar stopped two of the Flames tries, while Duncan, Carter and Busha gave Asheville a 3-2 lead. The freshman goalkeeper stopped one more Liberty attempt and now the Bulldogs were one made PK away from a championship. Freshman Meagan Bradham would be the Asheville player to take the kick. She buried it into the back of the goal for a 4-2 PK win and a trip to the NCAA Tournament.
The MVP of the tournament was midfi elder Ashleigh Carter. She was the heart and soul of the Bulldogs. Carter had a solid freshman year but had been sidelined for much of the next two years with injuries. She was never close to 100 percent during her senior season but played on and helped get the Bulldogs a championship.
Also making the all-tournament team were defenders Sara Pahl and Kate Barrow plus midfi elder Juliana Duncan. The Bulldogs’ defense allowed just one goal in 307 minutes of play in the tournament.
Asheville then wondered who it would play in its fi rst NCAA Tournament appearance. The Bulldogs found out the next day that they would take on eventual national champion and national power UNC Chapel Hill later in the week.
2006 BIG SOUTH CHAMPIONS
The 2006 Big South Conference Champions
3434
Since its founding in 1983, the Big South Conference has matured into a competitive leader in college athletics, actively pursuing excellence on the fi eld of play and in the classroom. The League’s growing presence as an NCAA Division I athletic conference is evident by athletic accomplishments on the national stage, innovative marketing and media partnerships, increased television packages, and quality athletic competition while intentionally fostering the academic, personal, social, athletic and leadership development of each student-athlete. This has evolved into the Conference’s mission of “Developing Leaders Through Athletics.”
The Big South Conference was formed on August 21, 1983, when Charleston Southern (then Baptist College) Athletic Director Howard Bagwell and Augusta President George Christenberry began recruiting members into the Big South, receiving initial commitments from Augusta, Charleston Southern, Campbell, Coastal Carolina and Winthrop. One month later, Dr. Edward M. Singleton was selected as the League’s fi rst Commissioner and continued to solicit new members. His efforts led to the additions of Armstrong State, Radford and UNC Asheville, giving the Big South more than the required six members to constitute an offi cial conference. The Big South’s fi rst year of competition was in the Fall of 1984, and in September 1986, the Big South Conference was granted full-fl edged NCAA Division I status.
During its infancy and prior to securing automatic bids to NCAA Championships, the Big South made early strides in earning at-large berths in several national postseason events, including volleyball, women’s basketball and women’s golf. In 1989, George F. “Buddy” Sasser replaced the retiring Dr. Singleton as Commissioner, and in 1990, the League received its fi rst automatic bid -- receiving an automatic qualifi er to the NCAA Baseball Championship. Under Sasser’s seven years of leadership, the Conference implemented its public relations and compliance programs, and introduced its fi rst-ever men’s basketball television package, featuring the Big South competing among some of the fi nest teams in the nation.
In August 1996, Kyle B. Kallander replaced Sasser as the League’s third Commissioner, and in his 15 years at the helm of the Big South, Kallander has been instrumental in aggressively promoting the Conference to new heights. The Conference has enjoyed record levels in marketing revenue during the past several years, he has brought television coverage to Big South women’s basketball, baseball and softball for the fi rst time in Conference history, as well as increased national television exposure to the League as a whole through aggressive and unique television packages.
Under Kallander’s leadership, the Big South developed and initiated its fi rst long-range strategic plan, re-affi rming the League’s vision as a distinctive athletic Conference committed to the quality of institutional life through athletic competition. He also spearheaded the efforts to add football as a championship sport, which came to fruition in 2002, and oversaw the additions of men’s and women’s indoor track & fi eld in 1997. The Conference’s 19th championship sport -- women’s lacrosse, will begin play in 2012-13 with seven members. At the same time, Kallander has solidifi ed Conference membership, as an all-time high 11 member institutions comprise the 28-year League in 2011-12. Recent additions include High Point, Gardner-Webb and Presbyterian College, plus the return of charter member Campbell University this year. Kallander’s long range vision has also included technological advancements, as the Conference introduced its fi rst live event video streaming in 2005 and has since expanded its video offerings to more than 700 events annually through a partnership with the member institutions, as well as the creation of several online and social media platforms.
In the last 15 years alone, the Big South Conference has experienced monumental growth and success in nearly every sport. During this time, the Conference has had an individual National Champion six times, more than 240 All-Americans, has reached the “Sweet 16” in men’s soccer, women’s basketball and baseball, has received national Top 25 rankings in football, men’s soccer, men’s basketball, women’s basketball, baseball, men’s outdoor track & fi eld, and men’s golf, had an individual selected to play in the NCAA Singles Championship six times in addition to the fi rst men’s tennis doubles at-large selection, had the fi rst women’s golf program advance to the national fi nals, had the No. 1 ranked men’s golfer in the country, has had the nation’s top scoring men’s basketball team fi ve consecutive years as well as the national men’s basketball scoring leader twice, received an at-large playoff berth in the Football Championship Subdivision in 2006, has had four NFL Draft picks, and had an institution fi nish fi fth in the NCAA Men’s Golf Championships - the Conference’s highest-ever team fi nish in an NCAA event.
In 2006-07, the Big South was the only Conference nationwide to have an at-large participant in the football playoffs (Coastal Carolina), a team in the Second Round of the NCAA Men’s Basketball Tournament (Winthrop) and a No. 1 seed in the NCAA Baseball Regionals (Coastal Carolina). In fact, Coastal Carolina’s baseball program has been a No. 1 seed four out of the last seven years - including a national seed for the fi rst time in 2010, while the Chanticleers’ FCS playoff berth in 2006 came in just the fi fth-year of the Big South’s football existence. The 2009-10 season saw Liberty’s Sam Chelanga win two NCAA National Championships (cross country, 10,000-meter run), Coastal Carolina’s baseball team reach the Super Regionals for the second time in three years as well as being ranked No. 1 in the national RPI and as high as No. 3 in the national polls; and three women’s basketball teams reach the postseason for the fi rst time in Conference history. Last season, Chelanga won two more NCAA National Championships (cross country, outdoor 5,000-meter run), the Big South had its fi rst automatic bid recipient in football (Coastal Carolina), UNC Asheville reached the Second Round of the NCAA Men’s Basketball Tournament, Coastal Carolina’s women’s golf team was the fi rst in Conference history to advance to the NCAA Championship out of Regional play, and a League-record 18 baseball players were drafted in the 2011 MLB First-Year Player Draft.
Several former Big South student-athletes have also reached national prominence in recent years. Coastal Carolina’s Amber Campbell made the 2008 U.S. Olympic Team - one of fi ve former Big South athletes to compete in the Games; VMI’s Reggie Williams reached the NBA with the Golden State Warriors in 2010, UNC Asheville’s Ty Wigginton was named an American League All-Star in 2010, and Coastal Carolina’s Dustin Johnson has won four PGA Tour events since departing the Big South Conference in 2007 and tied for runner-up at the 2011 Open Championship.
The Conference’s tagline, “Developing Leaders Through Athletics” was unveiled in 2008-09 in conjunction with the Conference’s 25th Anniversary. The League also honored its heritage with the Top 25 “Best of the Best” moments in League history from 1983-2008, with Liberty University’s 10-year women’s basketball championship run from 1996-2007 being crowned the No. 1 moment in the Big South’s fi rst 25 years. The Conference’s on-fi eld accomplishments have been duplicated in the classroom. Annually, more than 40 percent of Conference student-athletes are named to the Big South’s Presidential Honor Roll for maintaining a cumulative 3.0 grade-point average, and the League has had more than 95 Academic All-Americans in its 27 years of existence. Furthermore, the Big South has a record number of NCAA Public Recognition Awards for APR progress the last two years.
THE BIG SOUTH
3535
BIG SOUTH CONFERENCE7233 Pineville-Matthews Road, Suite 100
Charlotte, NC 28226Phone: (704) 341-7990
Fax: (704) 341-7991www.BigSouthSports.com
Founded 1983
PresidentPenelope W. Kyle, Radford University
Vice PresidentDr. Frank Bonner, Gardner-Webb University
SecretaryDr. Anne Ponder, UNC Asheville
CommissionerKyle B. Kallander
Associate CommissionerDawn Turner
Assistant Commissioner - Public RelationsMark Simpson
Assistant Commissioner - MarketingChad Cook
Director of Multimedia DevelopmentMark Bryant
Director of Administration & FinanceNancy Perkins
Assistant Director of MarketingTBA
Assistant Director of Public RelationsNic Bowman
Assistant Director of ComplianceSherika McLean
Marketing Assistant InternCaitlin Munchel
Public Relations Assistant InternBrittany Hill
Administrative Assistant InternTBA
Coordinator of Football Offi cialsDoug Rhoads
Coordinator of Men’s Basketball Offi cialsJoe Forte
Coordinator of Women’s Basketball Offi cialsCharlene Curtis
Coordinator of Baseball UmpiresTony Thompson
Coordinator of Volleyball Offi cialsDaniel Leake
Coordinator of Men’s Soccer Offi cialsPaul James
Coordinator of Softball UmpiresBetsy Kidd
Full-Time Member Institutions (11): Campbell University, Charleston Southern University, Coastal Carolina University, Gardner-Webb University, High Point University, Liberty University, Presbyterian College, Radford University, UNC Asheville, Virginia Military Institute, Winthrop University.
Associate Members: Stony Brook University (football), Bucknell University (women’s golf), College of the Holy Cross (women’s golf).
Geographical Breakdown (3 states): North Carolina (4) – Campbell University, Gardner-Webb University, High Point University, UNC Asheville; South Carolina (4) – Charleston Southern University, Coastal Carolina University, Presbyterian College, Winthrop University; Virginia (3) – Liberty University, Radford University, Virginia Military Institute.
Championship Sports (19): Baseball, Men’s Basketball, Women’s Basketball, Men’s Cross Country, Women’s Cross Country, Football, Men’s Golf, Women’s Golf, Men’s Soccer, Women’s Soccer, Softball, Men’s Tennis, Women’s Tennis, Men’s Indoor and Outdoor Track & Field, Women’s Indoor and Outdoor Track & Field, Volleyball, Women’s Lacrosse (2012-13)
Council of Chief Executive Offi cers: Jerry Wallace, Campbell; Jairy C. Hunter, Jr., Charleston Southern; David DeCenzo, Coastal Carolina; Frank Bonner, Gardner-Webb; Nido Qubein, High Point; Jerry L. Falwell, Jr., Liberty; John V. Griffi th, Presbyterian College, Penelope W. Kyle, Radford; Anne Ponder, UNC Asheville; J.H. Binford Peay III, VMI; Anthony J. DiGiorgio, Winthrop.
BIG SOUTH QUICK FACTS
3636
Game RecordsGoals: 4, Kristi Cummings vs. Charleston (1993) 4, Lynae King vs. UNC Wilmington (1995)Assists: 4, Megan Harris vs. SC State (2000) 4, Olivia Korman vs. The Citadel (2001)Points: 9, Kristi Cummings vs. Charleston (1993) 9, Lynae King vs. UNC Wilmington (1995)Shots: 10, Kristi Cummings vs. Charleston (1993)Saves: 20, Tracy Brainard vs. UMBC (1992)
Season RecordsGoals: 21, Hilary McKay (2001)GW Goals: 4, Emily Langill (2004)Assists: 8, Amanda Wilkinson (2000) 8, Megan Harris (2000) 8, Kelsey Dawson (2002)Points: 48, Hilary McKay (2003)Shots: 96, Hilary McKay (2005)Saves: 125, Tracy Brianard (1992)Shutouts: 12, Jill Young (1995)
Career RecordsGoals: 53, Hilary McKay (2002-05)GW Goals: 13, Hilary McKay (2002-05) Assists: 22, Hilary McKay (2002-05)Points: 128, Hilary McKay (2002-05)Shots: 302, Hilary McKay (2002-05)Saves: 297, Jill Young (1993-96)Shutouts: 25, Jill Young (1993-96)
Season Top 10Goals:1. Hilary McKay 21 20032. Hilary McKay 17 20053. Mackenzie Miller 13 19954. Robyn Busha 12 20055. Kristi Cummings 10 1993 Mackenzie Miller 10 19977. Mackenzie Miller 9 1998 Kelsey Dawson 9 2002 Hilary McKay 9 200210. Becky Frankwicz 8 1994 Alison Gehringer 8 1996 Kelsey Dawson 8 2000 Kelsey Dawson 8 2001 Ellen Sims 8 2001 Robyn Busha 8 2006
Assists:1. Amanda Wilkinson 8 2000 Megan Harris 8 2000 Kelsey Dawson 8 20022. Hilary McKay 7 2005 Robyn Busha 7 20055. Mackenzie Miller 6 1995 Lynae King 6 1995 Alison Gehringer 6 1996 Alison Gehringer 6 1997 Hilary McKay 6 2003 Kelsey Dawson 6 2003 Stephanie Feltis 6 2005
Points:1. Hilary McKay 48 20032. Hilary McKay 41 20053. Mackenzie Miller 32 19954. Robyn Busha 31 2005 5. Kelsey Dawson 26 20026. Mackenzie Miller 25 19977. Kristi Cummings 23 19938. Alison Gehringer 22 19969. Mackenzie Miller 21 1998 Robyn Busha 21 2006
Saves:1. Tracy Brainard 125 19922. Caroline Jacobsen 119 20003. Christine Geske 113 19994. Jill Young 112 19945. Veronica Lazar 111 20086. Michelle Mattos 88 20027. Veronica Lazar 82 20068. Michelle Mattos 81 20049. Jill Young 77 199510. Michelle Mattos 75 2005
Career Top 10Goals:1. Hilary McKay 53 2002-052. Mackenzie Miller 39 1995-983. Kelsey Dawson 36 2000-03 Kristi Cummings 36 1993-965. Robyn Busha 35 2005-086. Ashley Hart 20 1995-987. Lynae King 19 1993-96 Alison Gerhinger 19 1995-979. Ellen Sims 14 2001-0210. McKenna Stockhausen 10 2006-09 Assists:1. Hilary McKay 22 2002-052. Kelsey Dawson 18 2000-03 Lynae King 18 1993-964. Amanda Wilkinson 17 1997-2000 Alison Gerhinger 17 1995-97 Mackenzie Miller 17 1995-987. Ashley Hart 13 1995-988. Robyn Busha 11 2005-089. McKenna Stockhausen 9 2006-0910. Megan Harris 8 2000-00
Points:1. Hilary McKay 122 2002-052. Mackenzie Miller 95 1995-983. Kelsey Dawson 90 2000-034. Robyn Busha 85 2005-085. Kristi Cummings 83 1993-966. Lynae King 56 1993-967. Alison Gerhinger 55 1995-968. Ashley Hart 53 1995-969. Ellen Sims 29 2001-02 McKenna Stockhausen 29 2006-09
Saves:1. Jill Young 297 1993-962. Michelle Mattos 292 2002-053. Veronica Lazar 267 2006-094. Christine Geske 238 1996-995. Tracy Brainard 125 1992-936. Caroline Jacobson 119 2000-017. Mary Scherger 59 2001-028. Dawn McDonald 49 1993-939. Shanna Brown 40 2005-07
Shutouts:1. Jill Young 25 1993-962. Michelle Mattos 20 2002-053. Christine Geske 16 1996-994. Veronica Lazar 10 2006-09
RECORDS SECTION
3737
GoalsGame: 11, vs. Lenior-Rhyne, Oct. 14, 1996Season: 52, 1995AssistsGame: 11, vs. Lenior-Rhyne, Oct. 14, 1996Season: 42, 1995PointsGame: 33, vs. Lenior-Rhyne, Oct. 14, 1996Season: 144, 1995ShotsGame: 36, vs. Lenior-Rhyne, Oct. 14, 1996WinsSeason: 16, 1995Consecutive: 6, 1996, 2005Conference: 6, 2004, 2005Consecutive: 5, 2005LossesSeason: 14, 2007Consecutive: 8, 1992Conference: 7, 1992Consecutive: 7, 1992Ties3, 1999, 2003, 2006Season Winning Percentage.762, (16-5) 1995Fewest Goals AllowedSeason: 16, 1995 and 1996Most Goals AllowedGame: 9, vs. Clemson, 1999Season: 52, 1992
Miscellaneous RecordsShutouts in a Season12, 1995Largest Margin of Victory11, vs. Lenior-Rhyne, Oct. 14, 1996Largest Margin of Defeat9, vs. Clemson, 1999Fastest Goal Scored:05, Kristi Cummings, vs. Furman, 1995 (Standing NCAA Record)Consecutive Shutout Minutes530, Michelle Mattos, 9/18- 10/9, 2004Longest Unbeaten Streak7, 1996, 2004Most Consecutive Home Wins9, 1995-97Most Consecutive Conference Wins4, 11/26-10/9, 2004Most Consecutive Shutouts5, 1995 and 2004Most Improved Win-Loss Record7-10-2 in 1994 to 16-5-0 in 1995
Best Goals Against Average0.75, 1995Most Overtime Games Played5, 1997, 1998, and 2008Most Overtime Wins4, 1998Most Overtime Losses2, 1997 and 2008Record in Penalty Kicks3 wins, 4 lossesLast Penalty Kick WinNov. 9, 2007 4-2 at Charleston Southern (BSC quarters)Last Penalty Kick LossNov. 8, 2003, 2-3, vs. High Point (BSC Final)
GoalKeeper RecordsSeasonMost Minutes: 1,820, Jill Young, 1995Most Shots Faced: 275, Veronica Lazar, 2008Most Saves: 125, Traci Brainard, 1992Best Goals Against Avg.: 0.75, Jill Young, 1995Most Shutouts: 12, Jill Young, 1995CareerMost Minutes: 5,957, Michelle Mattos (2002-05)Most Shots Faced: 570, Jill Young (1993-96)Most Saves: 297, Jill Young (1993-96)Best Goals Against Avg.: 1.19, Michelle Mattos (2002-05)Most Shutouts: 25, Jill Young (1993-96)
RECORDS SECTION
Veronica Lazar
3838
RECORDS SECTIONYear By Year LeadersYear Goals Assists Points Saves1992 Candi Enneking (2) Candi Enneking (4) Tracy Brainard (125)1993 Kristi Cummings (10) Kristi Cummings (3) Kristi Cummings (23) Dawn McDonald (49)1994 Becky Frankwicz (8) Jodi Winterton (4) Becky Franwicz (19) Jill Young (112)1995 Mackenzie Miller (13) Mackenzie Miller (6) Mackenzie Miller (32) Jill Young (77) Lynae King (6) 1996 Alison Gehringer (8) Alison Gehringer (6) Alison Gehringer (22) Jill Young (60)1997 Mackenzie Miller (10) Alison Gehringer (6) Mackenzie Miller (25) Christine Geske (58)1998 Mackenzie Miller (9) Kara Strehle (5) Mackenzie Miller (21) Christine Geske (61)1999 Joanna Stocking (5) Amanda Wilkinson (5) Joanna Stocking (10) Christine Geske (113)2000 Kelsey Dawson (8) Amanda Wilkinson (8) Kelsey Dawson (19) Caroline Jacobsen (119)2001 Kelsey Dawson (8) Olivia Korman (4) Kelsey Dawson (17) Mary Scherger (59) Ellen Sims (8) Ellen Sims (17) 2002 Kelsey Dawson (9) Kelsey Dawson (8) Kelsey Dawson (26) Mich Mattos (88) Hilary McKay (9)2003 Hilary McKay (21) Hilary McKay (6) Hilary McKay (48) Mich Mattos (48) Kelsey Dawson (6)2004 Hilary McKay (6) Hilary McKay (4) Hilary McKay (16) Mich Mattos (81) Emily Langill (6)2005 Hilary McKay (17) Hilary McKay (7) Hilary McKay (41) Mich Mattos (75) Robyn Busha (7)2006 Robyn Busha (8) Robyn Busha (5) Robyn Busha (21) Veronica Lazar (82)2007 Robyn Busha (8) Robyn Busha (3) Robyn Busha (19) Veronica Lazar (74)2008 Robyn Busha (8) Juliana Duncan (5) Robyn Busha (14) Vernoica Lazar (111) McKenna Stockhausen (5)2009 Chloe McCleary-Small (4) Meagan Bradham (2) Chloe McCleary-Small (9) Veronica Lazar (59)2010 Leilani Halkiotis (4) Leilani Halkiotis (3) Leilani Halkiotis (11) Megan Dent (84)
Big South All-Conference PerformersFirst TeamKristi Cummings (1995, 1996)Kelsey Dawson (2000, 2001, 2002, 2003)Alison Gehringer (1995, 1996, 1997)Christine Geske (1998, 1999)Amanda Hutson (1997)Kirstin Kiphardt (1999)Mary Milligan (1994, 1996)Mackenzie Miller (1998)Joanna Stocking (1999)Jill Young (1994, 1995, 1996)Hilary McKay (2002, 2003, 2005)Robyn Busha (2005, 2008)Emily Langill (2005)Michelle Mattos (2005)Sara Pahl (2006)Ashleigh Carter (2006)
Second TeamKatrin Casey (1997, 1998)Kristi Cummings (1993, 1994)Sandi Dror (1993)Kerry Gaschler (1998)Christine Geske (1997)Megan Harris (2000)Ashley Hart (1995, 1998)Caroline Jacobsen (2000)Emily Langill (2002, 2003)Lynae King (1996)Dawn McDonald (1993)Mary Milligan (1993, 1995)
Mackenzie Miller (1996, 1997)Brita Nordgren (2003)Kelly Ratterman (1999)Sharon Sawdowski (1997)Jodi Winterton (1995)Joanna Stocking (1998)Sara Pahl (2005)Robyn Busha (2006, 2007)Veronica Lazar (2006)Kate Barrow (2007)McKenna Stockhausen (2008)Chloe McCleary-Small (2009)Mary Kate Tucker (2009)
All-Freshman (Big South)Veronica Lazar (2006)Keri Skelton (2006)Mary Kate Tucker (2008)Hannah Jeske (2009)
All-Tournament (Big South)Kristi Cummings (1995)Jodi Winterton (1995)Jill Young (1995)Kerry Gaschler (1995, 1996, 1998)Alison Gehringer (1995, 1996, 1997)Mackenzie Miller (1995, 1996, 1997)Ashley Hart (1995)Mary Milligan (1995)Amanda Hutson (1998)Joanna Stocking (1998)Christine Geske (1999)
Keri Caneveri (2000)Mary Sparks (2001)Emily Langill (2002, 2003, 2005)Erin Trigonoplos (2002)Michelle Mattos (2002)Kate Barrow (2003, 2006, 2007)Hilary McKay (2003)Shoshana Fried (2005)Sara Pahl (2005, 2006)Ashleigh Carter (2006)Juliana Duncan (2006)Veronica Lazar (2007)Robyn Busha (2008)
Big South Scholar Athlete of the YearAlison Gehringer (1997)Mackenzie Miller (1998)
Big South Coach of the YearMichele Cornish (1995, 2005)
Big South Tournament MVPAlison Gehringer, Jill Young (1995)Ashleigh Carter (2006)
Big South Rookie of the YearHilary McKay (2002)
Big South Player of the YearEmily Langill (2004)Hilary McKay (2005)
3939
ALL-TIME LETTERWINNERSASally Averett, 2000
BKate Barrow, 2003-07Mary Beale, 2009-Christina Beam, 1993Katy Beeler, 2007-10Gina Beer, 2010-Rebecca Bostian, 2001-04Cindi Bradford, 1992Lindsey Bragg, 2007-08Meagan Bradham, 2006-09Traci Brainard, 1992-94Shanna Brown, 2005-07Robyn Busha, 2005-08
CBecky Call, 2002-03Keri Caneveri, 2000Ashleigh Carter, 2003-06Katrin Casey, 1995-98Ceclia Chan, 1992Chesa Cofi ni, 1993-96Shannon Constello, 2000Dawn Cothran, 1993-94Natasha Creticos, 2002-05
DLauren Danielik 1997Amelia Davis, 2005-08Kelsey Dawson, 2000-03Megan Dent, 2009-10Jennifer Donish, 1994Sandi Dror, 1993-97Adriane Dufty, 2000-03Juliana Duncan, 2005-08
EEmily Elliot, 2009Evin Ellis, 1998-01Emily Elstrom, 2006-Candi Enneking, 1992-94
FStephanie Feltis, 2001-05Samia Fercha, 1998-01Susan Fletcher, 1994Kersten Flink, 1997Becky Frankwicz, 1993-94Shoshana Fried, 2004-07
GHeather Gallagher, 1998-99Kerry Gaschler, 1995-98Alison Gerhlinger, 1995-97Christine Geske, 1996-99Bridget Goss, 1999-2002Sharon Goss, 2002Erin Graham, 2005Ashley Gray, 2003Mary Guerrero, 1992Pamela Gutbier, 1993-96
HLeilani Halkiotis, 2008-Kelly Hall, 2006-07Megan Harris, 2000Melissa Harris, 2009-10Ashley Hart, 1995-98Joy Haynes, 2004-07Sara Marie Holland, 2005-09Meredith Horne, 1994Amanda Hutson, 1995-98
JCaroline Jacobsen, 2000Hannah Jeske, 2009-Erin Jordan, 1997-98
KErin Kelly, 1992Elizabeth Keil, 2009-Lynae King, 1993-96Kirsin Kiphardt, 1996-99Amanda Knapp, 2010-Olivia Korman, 2001-04
LEmily Langill, 2002-05Jenny Larson, 1992Kristen Lawson, 2010-Veronica Lazar, 2006-09Hannah Lee, 1999-00Katie Lilley, 2006-08 Heather Lynch, 1993-94
MKim Maddox, 1993Christine Martin, 2000Tanell Martin, 1993Nicole Matters, 1995-96Michelle Mattos, 2002-05Chloe McCleary-Small, 2009Mary Ashley McCullough, 2004-07Dawn McDonald, 1993Hilary McKay, 2002-05Mackenzie Miller, 1995-98Meredith Miller, 1992Mary Milligan, 1993-96Kristini Montuori, 2006-09
NLaura Nagle, 1992Brita Nordgren, 2002-05OCarolyn O’Brien, 2008-
PSara Pahl, 2003-06Emily Pifer, 1993
RKelly Ratterman, 1996-99Ferriss Roberts, 2009-Cecily Rogers, 2000-2002Erin Ryan, 2010-
SSharon Sawdowski, 1997Mary Elizabeth Scherger, 1999, 2001-02Tracy Schmidt, 1998-99Bailey Schultz, 2000-03Emma Sell-Goodhand, 2010-Ellen Sims, 2001-2002Janet Singletary, 1992Keri Skelton, 2006-09Angelina Smith, 2006Amber Snipes, 1998Mary Sparks, 1999-2002Dana Sroka, 2007-10Francis Staelin, 2010-Joann Stephenson, 2003McKenna Stockhausen, 2006Jessica Stocking, 1997Joanna Stocking, 1997-00Kara Strehle, 1995-98Jennifer Supko, 2003Allison Svenstrup, 2009
TTarrah Tate, 2010-Bethany Teague, 2008-10Sara Thorp, 2001Mary Kate Tucker, 2008-Lauren Turnburke, 2006-10Erin Trigonoplos, 2001-04
VSara Vank, 1995-98
WDiane Walton, 1992Emily Weld, 1998-01Carly West, 2006Amanda Wilkinson, 1997-00Lauren Wingo, 2003-06Jodi Winterton, 1993-96Elsa Wright, 1992
YJill Young, 1993-96
Current players in Bold
4040
YEAR-BY-YEAR RESULTS SINCE 19931993 • Overall: 6-12-0 Big South: 2-4-09/4 Charleston W 5-2 OT9/5 at Radford* L 1-2 OT9/7 Catawba L 0-29/10 at UMBC* L 0-49/11 at Towson State* L 0-49/14 at Lenoir-Rhyne L 0-29/18 at Campbell* L 1-59/21 at Virginia Tech W 2-19/24 at Tusculum W 4-09/26 Vanderbilt L 0-39/28 UNC Greensboro L 0-310/2 Charleston Sou.* W 2-110/5 Davidson L 0-410/9 at Mercer L 1-510/10 vs. Centenary L 0-210/14 Georgia Southern W 4-010/20 Liberty* W 2-1 OT10/23 Kentucky L 0-3*Big South Matches
1994 • Overall: 7-10-2 Big South: 2-4-09/3 at Louisville T 1-1 OT9/4 at Kentucky L 0-19/6 South Alabama L 1-2 OT9/10 St. Francis W 5-09/11 UNC Charlotte T 1-1 OT9/16 at Charleston Sou.* L 2-49/18 at UNC Wilmington W 6-09/20 at Furman W 4-19/24 Towson State* W 1-09/25 UMBC* W 1-09/28 at UNCG* L 0-410/1 at Davidson L 0-410/4 at Clemson L 0-510/11 at Charleston W 3-010/15 at Liberty* L 0-110/18 at Georgia Southern L 1-310/22 Appalachian State W 3-010/23 Radford* L 2-310/28 vs. Radford^ L 0-1*Big South Matches^Big South Tournament Match
1995 • Overall: 16-5-0 Big South: 4-1-0 • Big South Champions •9/2 UNC Wilmington W 5-09/3 Davidson W 2-19/7 Furman W 5-09/9 at Wake Forest L 0-29/12 Catawba W 1-09/15 at Lenoir-Rhyne W 9-09/19 Wofford W 3-09/23 Liberty* W 2-09/26 UNC Greensboro* L 2-39/29 at Radford* W 2-09/30 vs. Louisville W 3-010/7 Charleston Sou.* W 3-110/11 at Appalachian St. W 2-010/14 at UMBC* W 3-210/15 at American L 0-110/17 at Clemson L 0-510/20 at Wofford W 3-010/26 at UNC Charlotte L 0-310/28 Charleston W 3-111 vs. UMBC^ W 3-011 vs. UNCG^ W 1-0*Big South Matches^Big South Tournament Match
1996 • Overall: 10-3-1 Big South: 4-1-0 • Big South Runner-Up •9/1 at Clemson L 1-49/13 Radford* W 3-2 (OT)9/21 UMBC* W 1-09/24 at UNC Greensboro* L 2-49/29 Appalachian State W 5-010/5 at Charleston Sou.* W 2-1 (OT)10/9 at Tennessee L 1-210/12 at Liberty* W 2-010/14 Lenoir-Rhyne W 11-010/18 at Davidson W 2-110/26 Wofford W 3-110/29 Wake Forest W 2-011/8 vs. UMBC^ W 3-011/10 vs. UNCG^ T 1-1 (PK)*Big South Matches^Big South Tournament Match
1997 • Overall: 9-8-2 Big South: 2-3-0 • Big South Runner-Up •9/5 at South Carolina L 1-29/7 at Georgia Southern T 1-1 (OT)9/13 at Tennessee Tech W 4-09/16 East Tennessee St. W 5-09/20 at Richmond L 0-29/21 at East Carolina L 1-2 (OT)9/27 Liberty* W 2-09/28 Davidson L 0-210/3 at Appalachian State W 2-110/4 Middle Tennessee W 5-010/8 at Elon W 1-0 (OT)10/11 at UMBC* L 2-3 (OT)10/12 at Howard W 4-010/17 South Alabama* L 0-210/22 at Wofford T 1-1 (OT)10/25 Charleston Southern* W 6-111/1 at Radford* L 1-311/6 Charleston Sou.̂ W 3-011/7 South Alabama^ L 1-2*Big South Matches^Big South Tournament Match
1998 • Overall 11-7-1 Big South 3-1-1 • Big South Runner-Up •9/2 Appalachian State W 1-0 (OT)9/4 Mars Hill W 7-09/11 Tennessee Tech W 2-09/13 Howard* W 4-19/18 Tennessee L 1-89/22 Richmond L 0-29/26 Radford* W 1-010/3 at Charleston Sou.* T 1-1 (OT)10/4 at South Carolina L 1-610/8 at Wofford L 0-310/10 at Clemson L 0-510/17 Elon W 2-1 (OT)10/20 High Point W 3-110/24 at Liberty* W 3-010/27 at East Tennessee St. W 5-010/29 at Davidson W 2-1 (OT)11/1 at South Alabama* L 0-111/6 vs. Charleston Sou.̂ W 2-1 (OT)11/7 vs. Radford^ L 0-1*Big South Matches^Big South Tournament Match
1999 • Overall 5-10-3 Big South: 2-4-08/27 at Clemson L 0-99/1 Western Carolina W 3-09/4 Liberty* L 0-19/7 East Tennessee State W 1-09/11 Davidson L 0-29/13 Tusculum W 3-09/17 vs. Xavier L 0-59/22 Wofford L 2-3
9/25 at Elon* L 0-29/28 at Tennessee L 0-610/2 vs. VCU T 0-0 (OT)10/3 at Richmond L 0-410/9 at Radford* L 1-2 (OT)10/12 at High Point* W 1-010/16 at Charleston Sou.* W 2-110/27 at Appalachian State T 0-0 (OT)10/29 at Howard L 0-111/4 vs. Elon^ T 0-0 (PK)*Big South Matches^Big South Tournament Match
2000 • Overall: 4-12-1 Big South: 1-4-18/30 at Davidson L 2-79/2 Union W 4-29/8 High Point* T 0-0 (OT)9/10 at Tennessee L 0-79/14 at Western Carolina L 1-29/20 at East Tennessee St. L 1-49/22 at Clemson L 0-59/23 vs. N.C. State L 1-39/27 Radford* W 2-19/30 S.C. State W 8-010/3 at Mars Hill W 10-110/7 Elon* L 0-110/9 at Coastal Carolina* L 0-210/14 at Liberty* L 0-210/21 at Charleston Sou.* L 0-110/24 Appalachian State L 1-210/26 vs. Liberty^ L 1-3*Big South Matches^Big South Tournament Match
2001 • Overall: 5-11-0 Big South: 1-4-09/5 Western Carolina L 0-59/9 at Radford* L 2-49/18 at Appalachian State L 0-29/22 Liberty* L 1-29/25 East Tennessee State W 4-29/29 at Wofford W 3-110/3 Tennessee Tech W 2-1 (OT)10/6 at Elon* L 0-410/9 at Gardner-Webb L 0-110/12 Coastal Carolina* W 2-110/17 The Citadel W 10-210/20 Charleston Southern* L 0-210/24 at Clemson L 0-510/27 at Birmingham-Sou. L 0-211/3 at High Point* L 0-411/8 vs Charleston Sou.̂ L 0-2*Big South Matches^Big South Tournament Match
4141
2002 • Overall 7-8-3 Big South: 2-4-0 • Big South Runner-Up •9/2 at East Tennessee St. L 1-29/7 Campbell W 4-29/11 at Tennessee Tech L 0-79/20 at Coastal Carolina* L 0-29/22 at UNC Wilmington L 0-29/25 S.C. State W 5-19/28 High Point* W 2-010/2 Appalachian State W 3-210/5 Elon* L 1-210/9 Gardner-Webb W 2-110/12 at Liberty* L 1-210/23 at Charleston Sou.* W 3-2 (OT)10/26 Radford* L 0-111/2 Birmingham-Sou. W 5-311/4 at Western Carolina T 1-1 (OT)11/7 vs. Elon^ T 1-1 (PK)11/8 vs. Liberty^ T 1-1 (PK)11/9 vs. Radford^ L 0-2*Big South Matches^Big South Tournament Match
2003 • Overall: 11-6-3 Big South: 4-3-1 • Big South Runner-Up •8/31 Davidson L 1-29/2 at VCU L 0-79/6 at Gardner-Webb W 5-29/10 South Carolina State W 4-09/13 at Campbell W 3-29/15 East Tennessee State W 2-19/19 UNC Wilmington W 2-09/26 Coastal Carolina* L 1-310/1 at Appalachian State L 1-210/6 Western Carolina T 2-2 (OT)10/11 at Radford* T 2-2 (OT)10/12 at VMI* W 4-010/15 at High Point* W 2-010/20 Charleston Southern* W 3-010/24 Winthrop* W 3-010/27 Liberty* L 0-111/1 at Birmingham-Sou.* L 2-311/6 vs. Winthrop^ W 2-111/7 vs. Charleston Sou.̂ W 3-011/8 vs. High Point^ T 0-0 (PK)*Big South Matches^Big South Tournament Match
2004 • Overall: 11-6-2 Big South: 6-0-2 • Big South Regular Season Champs •8/27 vs. Kennesaw State L 0-28/29 at Tennessee Tech L 0-29/3 at Western Carolina W 3-09/6 at East Tennessee St. L 0-19/14 Gardner-Webb L 0-29/18 at Coastal Carolina* T 1-1 (OT)9/22 Appalachian State W 1-09/26 Birmingham-Sou.* W 1-09/29 at Davidson W 1-010/2 High Point* W 1-010/6 at Winthrop* W 1-010/9 at Charleston Sou.* W 3-110/12 at Clemson L 0-710/15 Radford* T 2-2 (OT)10/23 at Liberty* W 1-010/26 at S.C. State W 4-010/20 VMI* W 4-011/4 vs. Winthrop^ W 1-011/5 vs. High Point^ L 1-3*Big South Matches^Big South Tournament Match
2005 • Overall: 13-6-0 Big South: 6-2-0 • Big South Regular Season Champs •8/26 East Tennessee St. W 3-09/2 Tennessee Tech W 4-09/10 South Carolina State W 6-09/13 Western Carolina L 0-29/18 Coastal Carolina* W 4-09/20 at Appalachian State L 0-29/24 Charleston Southern* L 1-2 (OT)9/30 at Birmingham-Sou.* W 1-010/4 Winthrop* W 1-010/10 Liberty* W 4-110/15 at Radford* W 3-010/18 at Francis Marion W 3-110/22 at VMI* W 3-2 (OT)10/23 at Longwood L 1-310/26 at High Point* W 0-210/29 Campbell W 4-111/3 at Winthrop^ W 1-011/4 vs. Charleston Sou.̂ W 3-111/6 vs. Liberty^ L 0-3*Big South Matches^Big South Tournament Match
2006 • Overall: 10-7-3 Big South: 4-2-2 • Big South Champions •9/3 Austin Peay W 3-09/8 at Tennessee Tech L 0-29/14 Appalachian State W 2-19/16 Radford* W 2-09/20 at Winthrop* T 1-1 (OT)9/23 Longwood L 0-29/26 at Western Carolina L 0-39/30 at Liberty* T 0-0 (OT)10/2 Birmingham-Southern* L 0-110/6 High Point* W 1-010/15 VMI* W 4-010/18 at Furman L 1-310/21 at Coastal Carolina* L 0-110/25 at East Tennessee State W 2-110/28 at Charleston Southern* W 2-110/30 at Campbell W 2-011/2 vs. Birmingham-Sou.̂ W 1-0 (OT)11/3 vs. Winthrop^ W 2-111/5 vs. Liberty^ T 0-0 (PK)11/10 at North Carolina# L 0-7*Big South Matches^Big South Tournament Match#NCAA College Cup Matach
2007 • Overall: 3-14-1 Big South: 1-6-09/2 Tennessee Tech W 1-0 (OT)9/5 Western Carolina L 1-29/7 ar Gardner-Webb L 1-59/9 vs. Birmingham-Sou. L 1-39/11 at Appalachian State L 0-29/16 at Austin Peay L 0-29/20 Furman L 1-59/23 Chattanooga W 6-19/26 Francis Marion L 0-210/6 Coastal Carolina* L 0-210/13 at Radford* L 2-310/17 Winthrop* L 0-110/20 Charleston Southern* L 0-110/24 at High Point* L 0-210/28 at VMI* W 5-010/31 Liberty* L 1-211/9 vs. Charleston Sou.̂ T 1-1 (PK)11/10 vs. High Point^ L 0-1*Big South Matches^Big South Tournament Match
2008 • Overall: 5-13-1 Big South: 3-6-08/24 East Tennessee State L 0-18/31 at Clemson L 0-89/5 at Murray State L 0-39/7 vs. UT-Martin T 0-0 (OT)9/10 at Furman L 1-2 (OT)9/12 vs. Georgia State L 1-59/14 at Jacksonville W 3-2 (OT)9/17 Presbyterian* W 4-19/21 at Tennessee Tech W 2-19/23 Appalachian State L 0-29/27 at Winthrop* W 1-0 (OT)10/1 High Point* L 0-110/4 at Gardner-Webb* W 3-010/7 at Coastal Carolina* L 2-310/11 at Liberty* L 1-310/21 VMI* L 0-110/25 at Charleston Southern* L 0-311/1 Radford* L 2-311/6 vs. Radford^ L 1-2 (OT)*Big South Matches^Big South Tournament Match
2009 • Overall: 5-10-1 Big South: 2-7-08/30 at Appalachian State L 0-19/3 at Wofford W 1-09/6 at East Tennessee State W 1-09/9 Furman L 1-29/13 Tennessee Tech W 2-19/18 vs. Elon L 1-29?20 at Western Carolina T 0-0 (OT)10/2 at Radford* L 0-110/4 at VMI* L 0-210/10 Presbyterian* W 3-010/16 Charleston Southern* L 0-110/18 Coastal Carolina* L 0-210/23 at Winthrop* L 1-210/25 at Gardner-Webb* L 0-110/30 Liberty* L 0-111/1 High Point* W 1-0*Big South Matches^Big South Tournament Match
2010 • Overall: 1-16-0 Big South: 0-9-08/20 ETSU L 1-4 8/26 Western Carolina L 0-4 9/5 at Tennessee Tech L 1-3 9/09 at Elon L 0-3 9/10 Wofford College L 2-3 9/15 at Furman L 1-4 9/19 Francis Marion W 2-1 9/27 at South Carolina State L 1-3 10/1 Radford* L 0-2 10/3 VMI* L 2-3 10/9 at Presbyterian College* L 0-3 10/15 at Charleston Southern* L 0-8 10/18 at Coastal Carolina* L 1-4 10/22 Winthrop* L 0-4 10/24 Gardner-Webb* L 0-3 10/27 at Liberty* L 3-6 10/29 at High Point* L 1-2 (OT) *Big South Matches^Big South Tournament Match
4242
ALL-TIME RESULTS SINCE 1993Team W L T Last Meeting ScoreAmerican 0 1 0 Oct. 15, 1995 AU 1, ASHEVILLE 0Appalachian State 6 7 1 Aug. 30, 2009 ASU 1, ASHEVILLE 0Austin Peay 1 1 0 Sept. 16, 2007 APSU 2, ASHEVILLE 0Birmingham-Southern 4 4 0 Sept. 9, 2007 BSC 3, ASHEVILLE 1Campbell 4 2 0 Oct. 30, 2006 ASHEVILLE 3, CU 0Catawba 1 1 0 Sept. 12, 1995 ASHEVILLE 1, CC 0Centenary 0 1 0 Oct. 10, 1993 CC 2, ASHEVILLE 0Charleston, College of 2 0 0 Oct. 11, 1994 ASHEVILLE 2, CofC 0Charleston Southern 13 9 2 Oct. 15, 2010 CSU 8, ASHEVILLE 0Charlotte 0 1 1 Oct. 26, 1995 UNCC 3, ASHEVILLE 0Chattanooga 1 0 0 Sept. 23, 2007 ASHEVILLE 6, UTC 1 Citadel 1 0 0 Oct. 17, 2001 ASHEVILLE 10, CIT 2Clemson 0 4 0 Oct. 12, 2004 CU 7, ASHEVILLE 0Coastal Carolina 2 8 1 Oct. 18, 2010 CCU 4, ASHEVILLE 1Davidson 4 6 0 Sept. 29, 2004 ASHEVILLE 1, DC 0East Carolina 0 1 0 Sept. 21, 1997 ECU 2, ASHEVILLE 1East Tennessee State 8 5 0 Aug. 20, 2010 ETSU 4, ASHEVILLE 1Elon 2 6 1 Sept. 9, 2010 ELON 3, ASHEVILLE 0Francis Marion 2 1 0 Sept. 19, 2010 ASHEVILLE 2, FMU 1Furman 2 5 0 Sept. 15, 2010 FUR 4, ASHEVILLE 1 Gardner-Webb 3 5 0 Oct. 24, 2010 GWU 3, ASHEVILLE 0Georgia Southern 1 1 1 Sept. 7, 1997 ASHEVILLE 1, GSU 1Georgia State 0 1 0 Sept. 12, 2008 GSU 5, ASHEVILLE 1High Point 7 6 2 Oct. 29, 2010 HPU 2, ASHEVILLE 1 (OT)Howard University 2 1 0 Oct. 29, 1999 HU 1, ASHEVILLE 0Jacksonville 1 0 0 Sept. 14, 2008 ASHEVILLE 3, JU 2 (OT)Kennesaw State 0 1 0 Aug. 27, 2004 KSU 2, ASHEVILLE 0Kentucky 0 2 0 Sept. 4, 1994 UK 1, ASHEVILLE 0Lenior-Rhyne 2 1 0 Oct. 14, 1996 ASHEVILLE 11, LRC 0Liberty 7 12 3 Oct. 27, 2010 LU 6, ASHEVILLE 3Longwood 0 2 0 Sept. 23, 2006 LU 2, ASHEVILLE 0 Louisville 1 0 1 Sept. 30, 1995 ASHEVILLE 3, UL 0Mars Hill 2 0 0 Oct. 3, 2000 ASHEVILLE 10, MHC 1Mercer 0 1 0 Oct. 9, 1993 MU 5, ASHEVILLE 1Middle Tennessee 1 0 0 Oct. 4, 1997 ASHEVILLE 5, MTSU 0Murray State 0 1 0 Sept. 5, 2008 MSU 3, ASHEVILLE 0North Carolina State 0 1 0 Sept. 23, 2000 NCSU 3, ASHEVILLE 1Presbyterian College 2 1 0 Oct. 9, 2010 PC 3, ASHEVILLE 0Radford 6 14 2 Oct. 1, 2010 RU 2, ASHEVILLE 0Richmond 0 3 0 Oct. 3, 1999 UR 4, ASHEVILLE 0Saint Francis 1 0 0 Sept. 10, 1994 ASHEVILLE 5, SFC 0South Alabama 0 4 0 Nov. 1, 1998 USA 1, ASHEVILLE 0South Carolina 0 2 0 Oct. 4, 1998 USC 6, ASHEVILLE 1South Carolina State 5 1 0 Sept. 27, 2010 SCSU 3, ASHEVILLE 1Tennessee 0 4 0 Sept. 10, 2000 UT 7, ASHEVILLE 0Tennessee-Martin 0 0 1 Sept. 7, 2008 ASHEVILLE 0, UTM 0 (2OT)Tennessee Tech 7 4 0 Sept. 5, 2010 TTU 3, ASHEVILLE 1 Towson State 1 1 0 Sept. 24, 1994 ASHEVILLE 1, TSU 0Tusculum 2 0 0 Sept. 13, 1999 ASHEVILLE 3, TC 0UMBC 5 2 0 Oct. 11, 1997 UMBC 3, ASHEVILLE 2UNC Greensboro 1 4 1 Nov. 10, 1996 ASHEVILLE 1, UNCG 1UNC Wilmington 3 1 0 Sept. 19, 2003 ASHEVILLE 2, UNCW 0Union College 1 0 0 Sept. 2, 2000 ASHEVILLE 4, UC 2Vanderbilt 0 2 0 Sept. 26, 1993 VU 3, ASHEVILLE 0Virginia Commonwealth 0 1 1 Sept. 2, 2003 VCU 7, ASHEVILLE 0Virginia Tech 1 0 0 Sept. 21, 1993 ASHEVILLE 2, VT 1VMI 5 3 0 Oct. 3, 2010 VMI 3, ASHEVILLE 2Wake Forest 1 1 0 Oct. 29, 1996 ASHEVILLE 2, WFU 0Western Carolina 2 6 3 Aug. 26, 2010 WCU 4, ASHEVILLE 0 Winthrop 8 3 1 Oct. 22, 2010 WU 4, ASHEVILLE 0Wofford 5 3 1 Sept. 10, 2010 WC 3, ASHEVILLE 2Xavier 0 1 0 Sept. 17, 1999 XU 5, ASHEVILLE 0
Bold indicates 2010 Opponents
4343
4444
4545
Fiske Guide Gives High Marks to UNC Asheville and its Environmental Studies ProgramFiske Guide Gives High Marks to UNC Asheville and its Environmental Studies Program
UNC Asheville is once again ranked among the nation’s top colleges in the 2011 edition of the “Fiske Guide UNC Asheville is once again ranked among the nation’s top colleges in the 2011 edition of the “Fiske Guide to Colleges” published in July. The Fiske Guide calls UNC Asheville “one of the best educational bargains in the to Colleges” published in July. The Fiske Guide calls UNC Asheville “one of the best educational bargains in the country.”country.” “This public liberal arts university offers all the perks that are generally associated with pricier private “This public liberal arts university offers all the perks that are generally associated with pricier private institutions: rigorous academics, small classes, and a beautiful setting,” says the Fiske Guide, noting that UNC Asheville institutions: rigorous academics, small classes, and a beautiful setting,” says the Fiske Guide, noting that UNC Asheville provides all this for a fraction of the cost of a private college.provides all this for a fraction of the cost of a private college. In addition, for the seventh consecutive year, UNC Asheville’s Environmental Studies Program was named In addition, for the seventh consecutive year, UNC Asheville’s Environmental Studies Program was named to the Fiske Guide’s list of pre-professional programs with unusual strength in preparing students for careers. to the Fiske Guide’s list of pre-professional programs with unusual strength in preparing students for careers. Students in UNC Asheville’s program learn to address environmental issues through a multidisciplinary approach that Students in UNC Asheville’s program learn to address environmental issues through a multidisciplinary approach that includes biology, ecology, geology, chemistry, physics, economics, public policy, and other natural and social sciences. includes biology, ecology, geology, chemistry, physics, economics, public policy, and other natural and social sciences. Undergraduate research is an important feature of the curriculum, and the Environmental Studies Department Undergraduate research is an important feature of the curriculum, and the Environmental Studies Department stresses on-the-job internships in organizations involved with environmental issues. stresses on-the-job internships in organizations involved with environmental issues. The Fiske Guide also fi nds plenty to appreciate in UNC Asheville’s “picturesque mountain location in one of the The Fiske Guide also fi nds plenty to appreciate in UNC Asheville’s “picturesque mountain location in one of the most liveable small cities anywhere.” According to the Fiske Guide, “whether it’s the lush environment or the money most liveable small cities anywhere.” According to the Fiske Guide, “whether it’s the lush environment or the money you’re saving, the University of North Carolina at Asheville will have you seeing green.” you’re saving, the University of North Carolina at Asheville will have you seeing green.”
UNC Asheville Ranked Among Nation’s Best Colleges by U.S. News & World Report UNC UNC Asheville received high marks in the 2011 edition of U.S. News & World Report’s “Best Colleges” rankings released on August 17. UNC Asheville ranked fi fth among National Liberal Arts Colleges in “The 2011 Up-and-Comers” list, which highlights schools with “the most promising and innovative changes.” This select list leads the overall rankings in the 2011 edition of the U.S. News & World Report “Best Colleges” guidebook, which will be available on-line August 17 and on newsstands August 24. UNC Asheville was also one of only 25 universities in the nation to make the U.S. News & World Report list of “stellar” schools for undergraduate research/creative projects. UNC Asheville, Duke, and UNC-Chapel Hill are the lone North Carolina representatives on this list. UNC Asheville, which founded the National Council for Undergraduate Research more than 20 years ago, has made this roster annually since it began nine years ago. In addition, UNC Asheville was included on the list of 39 National Liberal Arts Colleges with the strongest commitment to undergraduate teaching. U.S. News & World Report’s overall rankings include a number of factors, including fi nancial support from alumni, grades and test scores of incoming freshmen and admissions selectivity along with the quality of instruction and curriculum. UNC Asheville was ranked sixth among public institutions in the National Liberal Arts Colleges category and number 158 in the category overall. Again this year, UNC Asheville was recognized by U.S. News & World Report for affordability as measured by student debt. The university ranked 14th among National Liberal Arts Colleges for least debt among graduating students. This is consistent with fi ndings from other leading college rankings services. The 2011 edition of the “Fiske Guide to Colleges,” issued in July, called UNC Asheville “one of the best educational bargains in the country.” In January, Princeton Review named UNC Asheville to its “Best College Values for 2010” list.
UNC Asheville Named One of the 50 “Best Value” Public Colleges in the U.S. by Princeton Review
Rising costs in today’s challenging economy has pushed up the price of everything from gas to groceries. But there are still great values to be found in higher education, according to “Best Value Colleges for 2010” ranking released today from the Princeton Review. UNC Asheville was among just 50 institutions nationwide named to the “Best Value” Public Colleges list. The Princeton Review also published a 50 “Best Value” Private Colleges list, for a total of 100 colleges in all. UNC Asheville was the only college or university in Western North Carolina to make the list. This is the fourth year that UNC Asheville has been selected by the Princeton Review as one of the 50 best value public colleges in the country. According to the Princeton Review, the schools that made the “Best Value” list are “fi rst-rate institutions offering outstanding academics at a relatively low cost of attendance and/or generous fi nancial aid.” The Princeton Review praised UNC Asheville’s growing national academic reputation, noting that the University provides “students a private school experience at a public school cost.” It also favorably notes the University’s numerous academic options, small class size and strong focus on the liberal arts. The ranking applauds UNC Asheville’s accessible faculty and the diverse offering of student activities both on and off campus. The Princeton Review selected the top 100 institutions as its “Best Value” choices for 2010 based on its surveys of administrators and students at more than 650 public and private colleges and universities. The selection criteria covered more than 30 factors in three areas: academics, costs of attendance, and fi nancial aid, using the most recently reported data from each institution for the 2008-09 academic year.
UNC Asheville consistently ranks as one of the nation’s best values in higher education. It has made the Fiske Guide to Colleges’ “Best Buy” list for the past 16 years and is among the Kiplinger’s Personal Finance magazine’s 100 best value public colleges and universities. And according to U.S. News & World Report’s current college rankings, UNC Asheville is among the top 25 liberal arts colleges in the nation whose students graduated with the least debt in 2008.
WHAT OTHERS ARE SAYING WHAT OTHERS ARE SAYING
4646
WWWWWiWWiWiWiWWWWiWiWiWiW hhhhththththh a a a aaabobobobobobbbobboboboboboobobobooututututuu 3 333,7,7,700000 sstututudededeeeennntntntntttnts s ss sss frfrfrfrf omomomomomm 4 4 4 44 4422 2 2 2 ststststatatatatatesesese aaaa aaandndndndndndndndndndndndndndndnddndndndndnddndndndnn 11 9 9 cocococoooooococoocooooooooooooc uuunununuunuuuuunnnuunttrtrtttrtrt iieieies,s, UU UUUUNCNCNCNCNCNCCCCCCNCNCCNCCCCCNNCCCCCCCCCCCCCCCCCCC AAA A AA AAA AAAA A AAAA AAAAAAAAAAAAAAAAAAAAAAshshshshhshshshshshsshshhhshs eveveveveeveveeveeeeeeeeve ilililililillillli leeleeeeee is ononoonnne off tthhhehe nnnnnnnatatiiooo ’n’n’n’’n’nn sssssssssssstototototototototototottottotoooopp ppppppp p pp p p p pp ppp pp pupupupupupppupupupupuuupppppppppp blblbblicicicic l l llibibibibibbbbbbibbbbiberererererererereererererereerralalalalalaaaaaaa a artrttsss s unununununu ivivvivererererrsisisisisis titititititiesesee a aandndnddnd o oooneneneee o o o offfff f ffffffff ththtthththththe ee ee 171717717 iiinsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnn ttititittttttttitututt titions in t t t ttttttttt tttttttttttheheheheheheheheheheheheheheheheheheehehhheeeheeh U UU UU U UUUUUUU UUUUUUUUUUUUUUUUUUUUnininininnnininininininininininnnininnnininn vvevevevevevevevvevevevvevvvvvevvevvversrsrsrsrsrsrsrsrssssssssittitititttty y yyyyyyyy yyyyyyyyyyyyyyyyy ofofff NN NN NNN NNNNNNNNNorrrthhthhthtt CCCCCCCCCCCCCarrrrrrrrrrrolinaaaaasyssysysysyssssyystttttttttsttttstsssteememmmmmmm. . UNUNUNUUNUNUUNUNUNUNUUUNUNUNUNUNUUNUNUNUNUUUNUUUUUUUUUUUUNC C C C CCCCCCCCCC AsAsAshehehevviviviviviviviviviivviviilllllllllllllllllllllllle ee eeee ee ofofofofoffefefefeersrsrsrsrs m mmmororororre e ththhhhhananann 333 3 3 333 33333330 00000000000 0000 mmmmmmmamm jooojojojorsrsrsrsrsrsrs l l ll l lllleaeaeaeaeae dddididididdidididiiidddiidididid nnnnngnggnnnnnnnnnnnnnngggggg t to o ththe babababababababababababbabbabbbbbbachchchchchchchelelelelelllelelelelellelelelllle ororoorooororororororororororooroorrororrororrorr oooo oo oooooooooooooofffff f ff ff ff ff fffff f f fffff f f arararararararararararararararrrarrarrarararaarra tststststststststststststststssssssss, , , , , , , ,,, bababababaabababababbbababaabababbbbbabbachchchchchchchchchchhchchhchchchchchchchchcchchhchhcchhcchchhcccchhheleeeeeeeeeee or ooooooooooof ff ff fffffffffffffffffffff scscscscscscsssscscsccieieeieieieieei ncnceeeaaanananaand d d d mamamamaaaasttstststststtereeeeereeeeeeeeeeeeee ooooo of fffff ffffffffffff lilililililililillililiiiiiiiiiiibebebebbebebebbebebebebebeeebebbebbbebbbbbbbb rararararararrrr l l lllll l ararartstststststststsstss dd ddd egegegegegrereeesesssss.....
HHHeHeHeHHerererere a aa arerere a a a f f fewewewe m m mororore eeeee ee e fafafactctctssssss s ssssss aaanananaaaaaa d dd fi fi gugureeeeeereress.s.ss.s.s.s.s.s.s.s
AcAcAcAcAcAAcAcAcAcAcAAcAcAcA adadaddddadaaaaaaaaa ememememmmememmmmmicicicicicii sssssAAvAvAverereeeragagaaagge e ClClClCCClCClClCllCllasasasasaaaaaaaaaaa s s s s SiSiSiSizezezeeeezezee::: ::::: 1919191919191919
MoMoMoststst PP Popoppuulululaaaarararaaa M M MMaaaaaajaaaajajorororss sss s bbbbybybybybb E E EEEEEEEEEEEEEnrnrrrrrrrrroloollmlmenent:t: P PPPPPPPPPPPPPPPPsysyssysyyyysyyyyyyysyychchchhchhchhc oooololoololooolooolololoooolooloolo ogogogogooggogoogoogggogyyy,y,y,y,yy,yy L L L LLLLititittittererererereere atatatturururureeee,e,ee,e, EEEEEE EEEEEEEEEEnvnvnvnvnvvnvvvvvvvvvvnvvvviririrrrrrrononononnnnnnnonononnnnonnnnnnnnnno mmmemememeeeeeememeeemeeeem ntntntntntnntntntnntnntnnnnnnnntnntnn alalaalalalalalalaallllalallallalaaaaaa SSSSS SSSSSSSSSSSSSS S S S Stututututututututututtuutuututututututututututututututtuuutuuuudididdidididididdidddididdidididididididddddidid esesesesesesessesesesesssesessseseesssessessseeseessssseesss, , , ,, ,,,,,,,ArArArArAAArt ttt anand d HiHiHiHiHHiHHiiiiiistsstssssssss oroory y y
FuFuFulblblblbbriririighghghghght t t t AAAAwwwwwwwwarararardsdsdsdssssss:: :: ::::::::::::: 3434343444343434343434344334444444444 s s ssttututututtt ddddeeeeeeeeeeenttttntntntntntnntntntnts s s hahahahavevevev reeeeececceceeeee eeieieieiieieiiiveveveveveveeveveed d ddd d d dddddddd thththhththhhhthththhee prprprpresesesestitit gigig ououuuus ss s s sss s awawawawaaawawawawawawawaaawwwaaawawawwaaaaaaaa aaaaaaaarararaaaaraaaaaaaaaaa dddddddddddd
UnUnUnUnnnnnnnnnnnnUnnUnUnUnU ddddedededdddddddddd rgrgrgrgrgggggrgggrggggraraaaaaaaaadduuuuuuaatatate e e ReReReReReRReRRRRReeRRRReRRRReRReRReesseseseseseseeeseeseseseesesesesesearaararrrararchchchch:::::: : : MoooMM rerer t thahan hhhahahhahahaaahhhahhahhalflflfflffffflff ooo oo o offff f f fffff ststststststuuuuuududuuuuu eeneenenennenee tttsttstststststststs ccc c cc c comomomomplplplpleeeeeteettettteeeteteteete eeeee e ee eeeeeeee ee oorooooorrrrooorrorrorooooooooo igigggggggggggggininininininininininnnaaaalalaaaaaaaaa rrrrrrrrr reeeeeeeseseeseeeee eaeaeaeaeaeaeaaaeaaeaaeeaeaeeaeee rcrcrccrcccccchhhhhh hhhhh hhhhhhh ininininininnninnniinnininiinnn ttttt t t tttttttttthhehheheheeheehehehehehehehehhehhhehhehhhhhehhhheiriririririiirir fi fififi fififi fifi ee ee e eldldldldlddlddd ooo o o oof f f f ffff stsstststststss udududududyyyyythththththhthht rrorororoororoororrorororouguguguggugggugugguggguggghhhhhh h hhh ththhhhthhhhe e eeeeee UnUnUnUnUnUnUnUnivivivivivviiverererererersisisisitytytytytyyyyy’s’s’s’s nn aaaatata ioionanan lllllly yy rrerererereerrrrrecococococooooocogngngngnnngngngnnnnng iziziizizzeeededddedededde UUUUUUndnddddndndddddndndnddddddddddeeeeerererereeeeeeee grgrgrgradadadadaa uauauuuauauauauaaaaaaauauauuauaaaauauattteteteteteeeteteteeeee R RRRRR RRReeseseseseseseseseeseseeese eeeeeaeaeaeaeeaeeeee rcrcrcrcrcrccrcrcrcrcrcrcrrrrcr h h hhhhhhhhh PrPrPrPPrPPrPrPrPrPPPPP ogooooogogogogogoogggooo rarrrararrararraraarrrararrrrarrrrrarrararrrarrrrarrrararamm.m.mmm.mmmmmm.m.m.m.mmmm.mmmmmmmmmmmm UU UUUUU NCNCNCNCNCNCNCCN A A AAAshsshshshshshs evevevevevevevvvililililillilllleleleleleleefofofounundedeed dd ththhhhhthhhhhhhheeeeeeee eee e NaNaNNaNaNaNaNaNaNaNaNNaNaatititittitititittiiitiononononononononnononnalalalalalalaaaa C C C Coooouuuuuuuooouuuoo ncncncncncnncncncililil f f fororor U UUUndddddnddndddddererrrrreerrrrgrgrggrgrgrgggggg adadadadaddaadadadaadadaddaduauauaauauaauauaauau teteteteeeteeeeetettetetett RR RRRRRRRR RRR RRRR RRR RR RRRRRRRRRResesesesesesessessesssesseesseeesesesesseseesssessse eeaeeaeaeaeaeaeeaeaeeaeaeeaeeeaeaeae rcrcrcrcrcrrch hh h hhhh momomommomomomoomomommomoooomooooooomoorererererererererererererrereerererererere t thhhahahahahahhaaahahahahaaahahahahhahahahaahhaaaaahaannnnnn n nnnn nnnnnnnnnnn n 22225252525525255225252555252522255252555 y yyyyy y yyy yyyyy y yyyyyyyyy yy yyyyyyyyyyyyeaeaeaeaeaeaeaeaeaeaeaeeeaeaeaeeaeaaeee rsssssrsssssssssssssrsssssssssssssrss a a aaa aaa aa gogogogogggooogoogogogogogogoogoggogoggoggogggogogggogogoggogggggogggg .. . .... . ..
SSStStStStStStStSStSSStStSStStStttudududuuuuuuuuuu y y y yy yyyy AbAbAbroroaaaadaddda a aaaaaaaaaaaaaandnddndndndndndnddndndndndndnddnddddnd SS S S S SSSSSSSSS SSSStutttututututututututtututttttutt ddydydydydyddydyddddddy A A AAA A AAAAAwwaway:y:y: 1 1 7 7 7 pepepeeeeeeercrcrcrrcrceeeneneenenene tt tt fofofoff s sssssssstututututuuutuuuuuuuudedededddddddededededddddededddddddddddd ntntnntnnnnntntnttntnnnntnnnnnnnnntttn ss s ssssss s ss sssssssssss ttatatatatatttatatatattatatatataatatatatattatakkekekekkekekekekekekkkkekekkkekkke a aaaa aa a aaa aaa aaadvdvdvdvdvddddvdvddvvdddvdvvvvvvananananannnannnananannnnannnnnnnnnnnnnttataattatagegeeggeegeegegegeeegeeeeegeeeeeegeeeeee o oo o o o o o oooooffffffff f f lelelelelleleeleeararararararararrararaararrarraarnininninininiininingngngngngngngngngngnngngnn ooooo oooooo oooo ooooooo ooooppppppppppppppppppppppppppp ortutunin titiiesesess i iiinnnnnnnotototoootototototthehheheheheheheehhhhh r rrrrrrrr rrrrrrr ststsss atatesesesesesssesesese aaanndddddddddndddddddddddddd ccccccc cc c cccc ccouououoouououououooououuuoouoouoouuuuouounntntntntnttnntntntntntntntnnntririririrrrirrrrrrrrr esessesesss www wwhihilele e eenrnrroolollolllllleleeleddddd d d ddddd atatattattt U U U U NCNCNNNNCNCNCCCCNCNCCNC A AAAA AAAAAAAAAAAAAAAAAAAAAAAAAshshshshhhhhhhshhhhhhhhhhhhhhhevevevvvvvvvevvevvvvvvvvvvvvvvevvvvviilillllii lellllllelelelllllelell .. . .
StStStStStSttududududu enenenene ttttt t ttt AtAtAtAtAtAtAAtAttAAAthlhlhlhhlhlhhhletetttttteee eeeeeeeeee GrGGrGrGrGrGrGrGGGrGGrG adddduauauauauauaauattiiititt onononnoon R R RRatatatate:e:ee: U UUUNCNCCCC AAAAshshhshevevevvilililililillelleell ss ssssssstuttuudededdennnnnntnntntnntntnnnnntnn -a---a-a-aththhleleeleteetetetet sss s ss ssss hahahahaahahahahahahaaahhaahahahavevevevvevevvveveve oooo oonnenenneneee o oo ooooooooooooooooff fffff ff ffffffffffffff thtttththththththththththttheeeee e hihhihihihihhihhhii hghhghghhghgheseseeeestt grr daduauaaatititionononnrarar tetess s s inininininninn t t t t tthheheeeeehe NNNNN N NNNNNCCCACAACAACAACAACAA.AA.A.AA.AAA. O OOOOOOOOOururururururururruurrururru s s ss s stututututttutudddeeeeeeeededeeedededeeeeedeennnnnnttttntnntnnnnntnntnnt aaa-a-athththththtththhthleleleleleleeletetetetetetetesssss s onononononon aaaa a aaththhtthhththllleleleelll tititit c scsssssscssssssssssssschohooooooooolallalalaalalalaaaaalalalal rsrsrsrsrssrsrsrsrsrsrsrssshihhihhihihihihihihhihihihhhihihiihihhihhihippspspspspspspspspspspspsspspspsppspspspspspspspsppsp w w wwwwwwwwww wwww ww ww wwhhhhohhohohhohohohohohhhho ppllalall y y lala l l fof urur y yyeaearsrsrsrssrsrss aaaaaa aat tttt tt UUNUNUNUNCCCCAAsAsAsAAAAAAAsAAsheheehheheheh viviiiviiivivivilllllllllllll e e e e ee hhhahahahahaveeeve aaa aaaaa 9999 9 999999999 99 pepepepepepepercrcrcrcrcrccenenenenenennntttttt t t grgrgrgrgrgradadadadadddaduuauauauauaatitititititit ononnoo rrratattatte.e..ee
FaFFaFacucucucucucultlttltlty:y:yy:y:yy: 222 2 222 211111111111 fff ff fulululuu l-l-l-l titititimemememee p prororooofefefesssssssorororororororoo s,s,sss,ssss 8 888885%5%5%5%5%%5%% ww w w ww wwwitititititititth h hhhhhh tetettettermrmrrrmrmmrminnnininnalalalalllaaal ddddddd d ddegegegegegegeggeggrerererererereeerr esesesesesesesesessessssess
COCCOCCCOCOPLPLPLPLACACACCAC::: UNNUNUNUNCCCCC AAsAAsAAsAsAsheheheheehevivivivillllllllleee e iiiiisisississ ttttttt t thhhhhehehhhhheeh nnnn newewewewew hhhhhhhhh heaeaeaeaeaddddqddqdqdquaauauaartrtrtttttrterereererersssss ffffofffofofoforrrrr thththththee ee CoCCCoCCoCoCoCoCoCoununununun iiicicicicicilllllll offofofofof PPPP P P bubbbbbububububu lilillililililiccccc c LiLLLLiLiLLLiLiLiLiLibbbbbebebbebbbeberararalllll AArAAAAAAAAArArArArtttststststs CCCCCCC C llollolololllleleeegegeges, a2525-member r ororgaganinizazatitionon of ff sts atte-e susupppporortetedd lililibebeberaral l artsts c c lolllelegeges s thaatat rrrecececooognize theh impmporortance offff lilibeberarall arartsts aa dnd sssccicienee cecc s education for succeess s innn a complex gloobbaball societetety.y.
CaCaCaaaaaaaaaaaaaaaampmmmmmmmmmmm us LifeRRRRReReReReRRReRReRReRR sisisisiss dedededededeeeeedeeencnnnnnnnnn e Halls: AAbooutt one-third of ststududenentsts l livive e on campus, whileeeeeeeeeeeeeee aa a a a a a a a a a aa aaaa aaa aaaanononononononnonononononononoonononooonononnonon ththththththththththththhththhthththththththththhthherererrerrrrrrrr t t tttt ttt ttttttttttt thihihihihihihihihihihihiihiihihihiihihihhihihhh rdrdrdrdrdrdrdrdrdrdrdrdrdrdrdrdrdrrdrdrdrdrddrdrddddddr lll l l l l lllivivivivivivivvvivivvvivvvvvvve withthinin a a one-milleerararrrarararaaaddididiididd usususususususus o oo o oo o oofffffff ffff f ff f cacccccccc mpmpusus.
AtAtAtAtAtAtAtAttA hlhlhlhlhlhlhletetetetetetticicicicicci ss:s:s:s:s:s:s: 11 11111444444 444 4 44444 NNNNNCNCNNNNNNNNNNNNN AAAA DDivvision 1 1 tetetetettettetetttttteet amamamamamamammammmamammmmmmmmms s ssssssssss
StStStSStStStStStSSStStStSStudududdudududuuududuuudenenenenneneneeenenent t ttt tttttt GrGrGrGrGrGGrGrGrGrGGrououououououououououo pspspspspspspspspsps:::: :: :: MoMoMoMoMoMoMMMoMMMMMMoooooooooMM rereeee t hah n 606006006006000600060006000000 c c cccccc c c c cccccccccccc clululululululululululuulullululululllulululululuuuubsbsbsbsbsbsbsbsbsbsbbsbssbsbbsbssbbsbbsbbs aandnd o ooorgrrrrrr annizizatatioonsns, raaaaaaaaaaaaaaaaaangngngngngnngngngngngngngngnggngnggngngngngnngnggininininininininininninininninnininnnninnnnnng ggg g gg g g g gg gggggggggggg frfrfrfrfrfrfrfrfrfrfrfrfrfrfrrfrfrfrrfrfrrromomomomomomomomomomomomomomomomomomomoomomomoomomoomomoommomoom h h h h hhh hhhhh hhhhhhhhhhhhhhhhonoooononononononononononononononoonoonoonoonnooonnnnnnoooroooorooooorooorororoorororooroooor s s s s s sococococoocieieieieietitititit esesesese ttttttttttto o ooo oooooo iniinininnnninnnntttttrttrtrtrtrtrtrtrttrttrrttrtt amamamamamamamaaamamaamaaaaaa uurururuuurururururuurrrrrruuuuu alaalalalalalalalalaaalalalalaaalaallaspspspsppspspspspspspororororororororororrtstststsstststststststststs
InInInInInInnIInnnInInIIntettttettetetetetetercrcrcrcrcrcrcuullulullullulululu ttttuttuttuturaaaaaararall l CeCCeCeCCeC ntntnttttttttttttterererererererererererererererrerre :: : : :: :::::: :: :: ThThThThThThThThThThThThThTTT e e eeee ee eeeee neneneeeeneennnneewwwwwwww wwwww InInInInInInntercultural Center houses coomfffffmfffffforororororororororooorortatatatatatatatatattatablblblblblblbblblbbblblbb eeeeeee ee spspspspspspsspspspsppacacacacacaa esesesese ffffoororrrrrrrrrrr m m m m m m m m m mmeeeeeeeeeeeeeeeeeeeeeeeetitititititittitittitingngngngngngngngngngngngs,s,s,s,sss s sss sssssssssssssssssssssococococococooocococococoocococooooocooocoococoococoococoocociaiaiaiaiaiaiaiaiaiaiaaaiaaiaiaiaiaiaaiaaaiaaaaiaiaai lllllllllllllllllllllllevevevvvvvvenennne tstsss a aaaaaaaandnndndndndnnd pp p p ppppppppppprorororororooogggrgrgrggggggggg amamamamamamammamamamamamamammms sssssssssssss inininnininiinininininninnninnvovovovovovovovovovovovovov lvlvlvlvvlvlvlvvlvlvlvlvlvininininninini g gggggggggg sussusuususssuchchchchccch dddddddivivivvviviviverererererererersesesesesesesesesse gg g gggg g g gggroroorororooorororor upupupupupuupuupuupupupuppsss ssssss ss s asasasasasasasasasasaassass AA AAAAAAAAAAAAAllllllllllllllllllllllliaiaiaaiaiaiiaaiaiaiancnncncncncncnncnccnncncnnnccce,e,e,e,e,e,e,e,e,e,eee, B B B B B B B B B Blaack Studddededdedededentntntntnnnnttttssss sss ss AsAsAsAAsAssAsssssssosososososososososoosocicicicicicicccc atatatatatioioioiioionn,n,n,n,n,n,n,nn, IIIIII III IIntntntntntntntntntnnn eeereererrrrrrrrrrreeerrrerrnanananananananananaanananannaanananaaanananananan ----------------------iiiitititititititittiititttitiionooononoonnnonoonnoonononnaaaalalallllalalalalal SS SSSSSSSSSS SStttututututuuttuudeeddddededdedededeenntntnnnttt AA A A AAAssssssssssss ococococcococococoocococococococcciaiaiaiaiaiaiaiaiaiaiaiaaiaiaiaatitititititititttititittittitionononoononononononononononononononon, ,,,,,, ,AsAsAsAsAsAsAsAAAAsAsAAAsAsAsA iaiaiaaiaiaiaiaiaiaiaiaiann nnnnnnnn nnnnnnn StStStStStSStSttS uudu entsss iin n n nnAsAsAsAsAshehehehehehehevivivivivivivilllllllllllllee,ee,e,eeeeeee HHHererererere mmmaaaammananananas ss s ssss OrOOOrOOOOrOOOOO guguggguuuuuuguulllllllllllllllllllllllllllosososososososososososososoososo osososososososososososo e ee ee e e eennnnnnnnnn LaLaaLaaLaLaaLaLaLaas sssAmA errrriiiciciiicicicicasasasasasasasasasasas ( (( ((((((((( (HOHOHHOHOHOHOHOHHHH LLLLALALALALALALALALALALALALALLALLLALAALALALALAALALALLAAALALALLA)))))))))))))))))))))))))))))))))))))
aannnnnnaaanna d ddd d d dd HHHiiiHH llllllllleleleleleeeeele . . . .
CCCCeCeCeCCeCeCeCeeC ntntnteeerrrereeee ffffororororr JJJJ ewewewewewewewewisisisisssssssisisi hh hh StStStStStStStStStStStStStSttS ududududududududududududududududieieieieieieieieieieieieieieieieees:s:s:s:ss:s:s:s:sss:s:s:s:s TT T T TT T T TT TTT TTTThehehehehehehehehehehehehehehehehee 2 2 222222222222266-6-6-6----666-6666666 yyeyeyyeyeeeeaarararararararar o o ooooooooooldldddddddddddd U U U U U U U U UUU UU UUUUUUUUNCNCNCNCNCNCNCCNCNCNCCNCCNCNNNNCNNNNN A A A A A AAAAAAAAAAsshsshshshshshsssshs evevevevvveveve ilililllelelelelee C C CCCCCCCCCCCCCCCeeneneenenennnnennneeenenentttttttteteeteeteteteteteter r rr r r r rrrrrrr ffffofofofofofofofofoffoffofofoff r rrrrrrrrrr r JeJJJJeJeeJeJeeeeeeeeeJeeeewiwwwiwwiwiwwwiiwiiwwwwww shhshshshshshshhsshsh S SSS tututututuudidididd eeesesesesseseseeeesssessesss p p p ppp p ppp pp pprrrrrorororrrrrrror vivividededeessss s sssssss aaaaaa a aaaaaaaaaa rereeeeeerere----------sosososososssssososoosososoururururururururururcecececececececcece f ff fffffffffffforororororororororor J J JJ JJ J JJJJeweweweweweweweweewwissisisisisisisi h hh h hhhh stststststststststststststs ududududdududududududdududududenenenenneneneenenentstststtstststsststs a aaaaaa aaaaas s sss ssssss wewewewewewewewewewewewelllllllllllllllllllllll a a aa aa aa aaaasssssssss sss hhhhohooststininnng g gg lelelectttururururesesesesesesssessessese ,,,, , fifi fi fifififififififififififififillmlmlmlmmllmmlmlm sssssssss ssssss sereerererererererrererererereeereerereeererrieieieieiieieieieieieeieieieieieieieeiei sss ss s sss s sssssssss ananananananananananananannaanaannndd dd d d dddddddddd otootototototototootototottoo hehhhhhehhhh rrr r rr r spssppppececececiiiaaaaaaaaaaaaial l l ll ll eveveveveveevevevvevvevevvvvvevvvvevvenenenentstststs f fff ororooorororrrrror tttthheheheheheheheheheeheheheeheheeheheheheeeheheeheeeAsAsAsAsAAsAAAAshehehhh viviv lllllle e cococommmmmmunununuu itittitititity.y.y.y.y.y.
4747
KKuKuKuKKKKuKKuKuKuKKKuKuKKuKuKuKKKuKuKuKuKuKKKuKuKKuKKuKuKuuKudodododododododododododododododdodododdddoododdddododododossssssssssssssUUNUNUNUNUNUNUNUNUUNUUUNUNUUNNUNNNNUNUUU C CC CCCCCCCCCCCC AsAsAsAAAAAsAsAsAssAsAssAsAAssssheheheheheheheeeheheeeeeeeeeeevivivivivivivivivivivivivvivivivvvvvv lllllllllllllllllllll ee e e eeeeeeeeeeee isisisisisisisisiisisiis ““ “ “ononononononononononononononnononnonoonoo e ee ee e e ee eeeeeeeeee ofoofoofofofofofofoofoofoofoffffoof ttt tt tttttttttthehehehehehehehhhhhheeeee b b bb bbbbbbbbbbeseseseseseseseseesesessesest t t tttttt ttttttt edededededededdededdeddddducucucuccucucucucucucuuucuuuu atatatatattatatatatatatatataa ioioioiooioioioioioiooiooioioiooooonanananaanannaananananannnaanaaaaal ll l llll bababababababaabababaababbaargrgrgrgrgrgrgrgrgrrgrgrggrgrgrgggggaaiaiaiaiaiaiaiaiaiaiaiaaaaaa nnsnsnsnsnsnsnssnnnn iiiiiiiinnnnn nnnnn nnnn thththtthhhhtththtththtthhthhe ee e ee e e eeeee e eee cococococococococooocococooooocococouununununununununuunuunuunuunununuuuntrtrtrtrtrtrtrtrttrrry.y.y.y.yyy.y.yyyy.y...” ”” ” ” ””””””””” -- -- - - FiFiFiFiFiFFiiiFiFiFiFiFiFiFiskskskskskkksksksksksksksksskkeeee ee eeee e e eeeeee GuGuGuGuGuGuGuuGuGuGuGuGuuuGuuGGGGGG ididididididdidiidddddddidddddddddee e ee eee eeee ee e eee ttttototototottttt CCCololollo leleeeleeeeeeegegegeggegeggeegegeggegegeeegeggggg s,s,s,sss, 2 2201010001000100 11111111
FoFoFFoFoFFoF r rr rr r sseseseseseseeseseeeseeseeseseseeeseevevevevevevvvvevvven nn nn n n cococococococococoooonnsnsnsnnsnsnsnsssnsnsnsnnnsnssnnsnnnn ececeecececeecececececececececececeececeeeecutututtututtuttttuttu ivivivivivivvivivivvvvvveee ee eee ee e eee yeyeyeyeyeyeyeyeyeyeyeeeeyeeeeyyeeyeyy aararararss,ss,, U UUU NCNCNCNCNCNC AA A AAA hshshshhss evevevvililillillelelele’ssssss EE E EEnvvnvnvnvirriririronoonononno memmemememm ntntntntnn alalalallal SSS S S Stututututtuudididididididiesseseseseses PPP PP Prorororororoooogrgrggrgrgrgrgrgrgrggggggg amamamamammmmm hhh hh hhassasasasaaa b b b bb beeeeeeeeeeeeeeeeeeeeeennnnnn nnnnn nananannanananaananamememememememmeddddd d totottotootototoo tttt t t t tthehhehehheeehehehe lilililililiistststststststtststststtsttsttt o ooooo ooooooooooo oof f fff fffffffff pprprpprprprprprrrre-e-e-e-e-e--e---e---ee prprprprprprprpprprprofofofofofoooooofoofofofofoooffofffofoofooooo eseseseseseseseseeeseeseeeseseseseseseesssesee sisisisissisisisisisissisisisiississss onononononononononononnonononononononoonnoonnonnonalalalaaalaalalalaa p p p pppp ppp pp pppproororoororogrgrgrgrgrgrgramamamamam wwww ww wwwiiiititttitiitttiitti hhhhhhhhhhhhh hhh h h unununuunu ususususuu uauauauauallllllllll ll ttttstssstststs rererererengngngngng hthhthhthhhthhthththtththhthth iiiiiiii ii innnnnn n prrprprprprp epepeepepeppparrararariiiiiiinininini gggg g tttststststs ddddddddddududududenenenenttttststststss ffffffffffff forororor ccc carararareeeeeeeersrrsrsr . . - FiFiFFiFiFiiFiFiFiiFiFiF kkkkkkkskskskkeeee GGGGGGGGGGGGGGGuGuGuGuGuididiidididddddddididididideeee etotototototttttottototo C C C CCCCCCC CC CCoololooololooololleleeleeleleeeeleeeeelegegegegegeegeegegegegeggggggggg sssssssssssssss
UNUNNUNUNNUNUNUNUNUNUNUNUNNUU C CCCCCCCCCCCCCCCCC AsAAsAsAAAsAsAAssAssAssAsAsAAAAssAssAsAAAAshehehehheheeheheehehhehhhehheeeeh vivivvvvivivivivivvvvvivivvvivvviviviiillllllllllllllllllllllllle eeeeee e iiisiisisiisisisisisisisisisssssss o o oo ooooooooooooooooooooneneneeeeeene o o oo oooofffff ffff thththe ee nannn titit onon’ss 1000000000 b besst t vavaavavavalullll eses in n pupublblicciccc ccolo leeleeegegeg s. -- - - -- - KiKiKiKiKiKiKiKKKKiplplplplplplppplpp ininnininniiniinnnnnnnnnnnngegegegeegeggegggggegegeggegggggggggg r’r’r’r’’’’’r’r’r sss s ssssssssss PePePPePePePePePePePePePPePPePePeePePeeePePP rrrrrrrsrsrsssssrrrrr ooooononnonoononnoo alalalallaalllaaaa FFF F F FFFFFiiinnnnninnnnanannnnnnnnnnana cececececececececeececeeee MMMMMMM MMMM M MMMM MMMagagagagagagagagggagaagaagagggazazaaazazazazazazazazazazzzza inininininininininininiinininii e,e,e,e,e,e,e,ee,eeee,e, 222 22 2 22222 222222220101010100101001000101010101010 0000000000000000000000
UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUNNNNNCNNCCNCNNNCNNNNCNCNNCCCCNCNNCNN A AAAAA AAA A AAAAAAAAAshshshshshshshshshhhhhshshsshsheeevevevevvvvveeveeevvilililiililiiilililiiiililiiiiillllii lelleleleleleeeeeleleeee iiii i iiii sssss sss s s ss s ssssss aaamamamamamammamammaa ononoonoononnnnnnnonnno g g jujujujujuujujuststststsststst 5 5555555555550 0 00000000000 inininnnininininststsststststtstsststststs itititititititutututuuuuuutuuutututioioioioioiioonsnsnsnsnnssnsnsns nnnnn n natattttatatatattataatatttioioioioioioooioooiooonwnwwwnwnwnnwnwwwnwwnwwwidididddiddididde ee eeeeee nonoteted d d asasa a a “ “BeBeBeststst V V Vala ueuee” ” ” pupup blblicic c cololleleleeeeeeeleleeeeeeegegegegegegegegegegegegeegegegege. . .. ..- --- -- - PPrPrPrPrPrPrPP inininnnnnninnnninnnnnnnnnceccecececececcccetototootoooon nnnnnn ReeReReReReReRReReReReReReReReReReRReeRRReReRReeeviiiivivivivivviiviv ewewewewewewewwwewwwwwwewwewwww,, , , 20202020202020200202020002020202022020202202222020011111000001
NUNNUNNNNC CCCCCC AsAshehevvvvvviviviviiivivvivvvvvvviv llllllleeeeee e eee isis t thehe ooooooooooooooonlnlnlnlnnnnnnnnlnlnnnlnlyyyy yy yyyyyyyy NoNoNoNNNooNorrtrtrthh h CaCaarorooolilinanaaaaaa i iinsnnsnn tititututitioonoo listeeeeed d d amamonong g NaNaN titiononnnalal L Libibereralala A AArtrts s CoCoC llllllllllllegegegegegegegesesesesesesses whwhosose e ststududddddddddddddddddenenenenenttttststtttttttttt g graraduduatate eeeeeeee wiwiw thththh tt hehheehe llllllllleaeastst aaamomooununnnt t fffofof ddddd d d bebbbbbbebebebe t.tttttttttt. - - UUUUUUUUUUUUU UU UU SSSSSSSSSS.S.SSSSSS. . NeNeNeNeNeNeNNeNeNeeeNeNeNeNeNewswswswswswswwswwswswswwsws &&&&&&&&& &&&& & && WWWWWWWWWWWWW W W WW Worororoorororooororoorooorldlddldldd RRRRR R RR RR RRRRRRepepepeepepeeepepepepeepeeppport’s s “AAmem rir caca’s’s BeBeBeBBBestst C Colleegegegegeggegegeegeeeegegggegegeeees,s,ssss,s,ss ”””” ”””””””””””” 20220202020202020220202022022000020202020202022202010101010011010101010000000101010000
ThThe e UNUNCC AsAsheheheeheehevivvivivivivivivivvvvviv lllllllllllllllllllllll eeeeeeeeeeeeeeee eeee “f“f“ff“ffffffffffffffacacacacacaaaacacaacacacacacaaacculllululuulluuuluuuluuluululultytytytytyttytytyytytyttyt hhhhhhhhhhhhhhhhhh hhhasasasasasasaaasasasasasaasaaasss a a aaaaaaa aaaannnnnnnnn n nnn unuuununununununununuunununununu ususuuuususususuusususususususssussuauauauauauuauauuaauauauauauuauuuau llllllllllllllllllllllllllyyyyyyyyyyyyyyyyy y stststtsttttstststsststttttrororrorororoorororoorororoorororongngngngngnngngngngngngngggnggg c c ccccccomomomomomomomommmmmimimmimmimim tmtmtmtmtmtmttmmeneneneenent t t ttt tototototototottt u uu uuuuuuuuuuuundndnnndndnndnndddddderererereeeeee grggrgrgg adadadaadaduauaauaauaaatetetetetetetetttte t ttt tt t ttteaeaeaeaeaeaeae hhhchchchhhhhchhchhhchhhchhhc iniinininininniiinininggggg.ggg.gg.g.gg” ”” ” ”””””””””””” - - - U.U.UUUUUUUUU S.S.SSS NeNews & & W Worldd R Repeeporort’t’s s “A“Amemeriricaca’s’s B Besest t CoCollllegegeses,”,” 2 20100100
UNNC C AsAshevillee is the onlly y pup blic liberall arts colleggee nonotted asa aa ““ToTop p UpUp-aandnd-C-Comomining g ScSchohoolol” ” amamonong g NaNaN tional Libeeral AArtrts Collllegges. UNNC Asheville is rrannkeed d fi fth h inin t thhis distinguisishehed d cac tegog ry. - UU.SS. NeN ws & Wororldd R Reporrt’t s “AAmeriricac ’s Best Colleges,”, 2201100
UUNC Ashevillle’s UnUndergrgradduate Reseearch Program haas bbeeeen ranknkeded aamom ng theh bbesest t inin tthehe n natatioion n fof r rnnine conseccutivee y yeaearrs. - - U.U S.S. N Newews & WoW rld Report’ss “AmAmerica’s Best Colleges,”” 200100
UUNC AsAsAsAsAsssshheheheheheeevivivivivivvilllllllllllleee eee isisisisisss aaaa a amoomomomomonngngngngngggg jj j j jjjjjusususuuuu t tt 212121 s s smamamallllll ss stattatatatetetete ss sschchchchchoooooooooooolslslslsls o ooonnnn nnnnn ththhhhhthththeee ee “““C“CCCoolo lllelegegegg AAA AAAA-LLisist”t”t” forrrrr offfffferrrriinining ggggg a aaa “a bbbbigigigigigg-leaguee eeducatioion.n.nn.n.nn””””””-- PaParararararararararaarr dedededeedededeedede m m m mm m mmmagagagggazzzzazazzazazazazazininininninininine,e,e,e,, 222 2 20101010 00000000
UNUNUNUNUNUNUNUNUNNUNNUNNCCCCC C CCCCC C AsAsAsAsAsAsAAsAsAsA hehehehehhhehehhhhhh vivivivvivivvivillllllllllllllle eeeeeeee isisisisisisisis o oooooo o o o oonenenenenenenennenneeenen oo oooooooff ff fff ththththththththththht ee e e eeee totototototopppp p p ppppp grgrgrrrrrrrggrreeeeeeeeeeeee nnn n nnn cococcooccc lllllllegegegegeeeeegegegegesesesesesesessse ii iiii i i innnnnn nn nn thhhhtht e eee SoSoSoSSooooooSoS ututututututututututhhhheeehehhhehhh aasaast.t.tt.t.ttt. -- -- Blueeee eeeeee RiRiRiRiRiRiRRiRiR dgdgdggdgdgdgdgdgdge OOuuuuuuuttdtdtdtddoooooooooooorsrsrsrsrsrsrsr ,, , , , , 20202002222 100000
UNUNUNUNUNUNUUNUNUNUUUNUNNCCCC CCCC C CC C AsAsAsAsAsAAsAsAAsAsAsAAAAshehehehheheheheeheheheheheheeeeevivivivivivivivivivivivivivvvv llllllllllllllllll e is lissteted d aammononnooononononononnnngggggggggg ggg jjjujujujujujustst 228686 UU.S.S. . cococococococoooccooollllllllleeeegegegeggegee eseseseseeeeseseseses a aaaaa aaaaa ddndndndnn uu uu inininininivevevevevvvvevv rsrsrsrssrsititititittieieieieieessss s thththhthtttt atatatatatt hhh hhavavavavavvaa eeeee eee dededededeedd momomomomoonsnsnsnsnsssn trtrtrtrtrrrratatatatatataatatttedededededededeeededeeee “ ““ “ anananaananaanananaa exexexexxxxxxxemememeeeeeeeemplplplplplplplplpllpplpppp aaarrrrararrararararraraaaaaa yyyyyyy yyyyyyyy cococococommmmmmmmmmmiiititititititititmememmemeememmeeemm ttntntntntnntntntntnnt ttt ttt tt ttoo ooooooo suuuusuusuusus stststst iiiiiaiiiaiaiaiinanaaaaanaannabibibbibibibbibibibbbibiib lililililillililililiillittytytytytyytytytytyt ”””””””.””.””. - - ---- “““ “ ““““ThThThThThThTThThThThTThhThThTT ee ee ee eeeee PrPrPrPrPrPrPrPrPrPrPrPPrPPP iniinninnnncecccetttooooonn n ReReeeReee iviviiivivivvv eewewewewewewwwewee ’’’sssss GGGGG GGG G GGGuiuiuiuiuiuiuiuiuiuuuiuuuuidededededededddedededdededde tt tttt t t oo oo ooo 2828228288282828282822822822 6 666 66 6 6666 GrGrGGGGrGrGrrGreeeee nnnn nn n CoCoCoCoCoCoooCoCCooooooollllllllllllllllllllllllllllegegegegegegggeseseseseeses””,,, 20202020200000202010101010010001000000010101001010100101010
AdAdAdAdAdAdAdAdAAAdAddmmimimimiimmmmimmiim ssssssssssssssssssssssssssssiioioooioooioioooioiooioi nsnsnsnsnsnsnsnnsnsnsnsnsnsnsssMiMiMiMiMiMiMiMiMiMiMMMiiddddddddddddddddddddddddddddd leleleelelleleleleeeeeeee 55555 55555555 555 550%0%0%0%0%0%%00%0%0%%0%0%0%0%0%0%%%%0%0%00%00%00000%0 o o ooooo ooooooooofffffffffffffff fffffffff ininininininiinnnninnnnnnnnncccococococococccccccococococcococcoocccccccccc mimimmimimiimimimmmimiiinnngnngngngngngggnnngnngnnnngnnggnggggg fff f fffff ffffrrereereererererererrererrererereererrrrr shshhshsshsssssshshhshhhshhhshsssss mmememememememememmememennnnnnnnnnnnnnn nnn n SASASASAASAASASASASASASASASASASAAASASASASASASASAAASSAAAATTTT TTTTTTTTTTTTTT TTTTTT TTTTTTT sssscscccscscss orororororrrrrrorrrrrorrrrrrrrrrrooree:e:ee:ee:ee:e:e:e:e:eeeee 1 1 111 111111111111111111111110-0-000-0-0-0-0-000-000-0-0-0-0-0-0-00000 12111222122222211112212121212212211212909090909090900090900909000909090990090909999999090000
AnAAAAAAAnAAnAAAnAnAnAnAnAAAAA nnnnnunuuunuunuuuuuuuuuaaalalalalaaaaaaaaaa II IIIIIIIn-n-n-nnn-nn-nnnnn StStStStStStStStttStttS atatatattatte eeeeee eee eeeeeee ee TuTTuTuTTuTuTuTuTuTuTTTuTuTuuitittititiii iioioioionnnnnn n nnn anannaaaaanaaaaaaaaa dddddddddddddd dddd FeFeFeFFeFFeFFeFeFeFeFeFeFeFeFeeeeseeeseseseseseseseeeseseeeese :::: : $4$4$4$44$ ,7,77,7,777777,777777777777772722772727272777277272727777727777 (((((( ( ((((((( (((((202020202020202020202020202222222 10101010101010100100000100100--1111-1-1-1-1-1-1-1-- 1)1)1)1)11))))11)1)1))
AnAnAnnnAAnnnnnnAnnnnnnuununuununununnnunnuunn aala OOOOOOOOOOOOuuututututututuuutut-o-of-f-f-f-StStStSttStS atatttttatattttttteeeeeee e eee TuTuTTuTuTuuTuuTTuuTTuTuTTuuTuTTTuTTuuTTuTuuuT ititttiittititioioiooioioioion n n aaanaananananaaaaannnnnd d FeFeeeesesesesssesessseses:::::::: $1$1$1$$1$1$1$1$$1$1$$$$$$1$$$1$$$$$$1$1$1$1$$ 7777777777,7777777777,7,554545454455454545545455545454545455545544555554444454445554545444444444444 4444 4 444444444444 (((2(2(2(2(2(2(2(2(2001010111000-0-0-0-0-000-000-0000 111111111111))))))))))))) ))) )
AvAAAAAvererererererraaggggagagagagaaaagagagggee e eeee e HHoHoHoHooousususuuuuu inininnnnnininnnnnnnnnnnnnnnnnnnnnnnngggg ggggggggg anand ddd MeMeMeeMeeaalalalalalala PPPPPPPPPPPPPPPP PPPP alllaaaaaaaaaaaaaalalaaaaalannnnnnn nn n FeFeFeFeFeFeFeFeFeFeFeFeeFeFeFFFeFeeeseseseseeeeeeee : : $7$7$7$7$7777777 00000000,0,04044040404040400440404040 (((( (((((((((( ((((2222020202022222 11010101 ---1111- 1)11)))1)1)1)1))))111
FiFiFFFFFFFiFFiFiFFFiFiFiFinananananannanananannannncncncnccccccccccccnccciiiaiiiiiiiiaiall l AAiAiAiAiAiAiiAAiAAid:d:d:d:d:d:d:dd:ddd:d:dd MMMMMMM MMMMororee ththanan h hallllllllllla ffffffff f ofofofofofofofofoffo ss sss s sstutuuuttt dddddedededdeedd ntntntntttts s ss sss rerererererereeeeeeerer cccceceeeeeceeececceeeeecec iviviivivivvvvvvvivvivivvviviivi eee eee eeeeeeeee fi fi fifi fi fi fifififififififififififi fi nnnnnanananann ncnciaial l aiaiiid,dd,d,d w w wwwwitiitititittittthhhhhhh hhhh hh h momomomomoomorerererererereeee t tthahahhahhhahahahahahahhhahh nn n 8555585858555 pp ppppppereerererereeee ccccececececccecececececeeentntntntntntntntntnnn ooo ooooffff fff stststttstudududududududududududududududdddudeneneneneeneneneeeneneneneneennnttttststststttststts’ ’’ fi fifi nannn ncnccccccccciaaiaiaiaiaiai l ll neneeeneneneenenenen edededededededddded m m mmmmmmmmmmmmmmmmeteteteteet..
4848
Dr. Anne Ponder became the sixth Chancellor of the University of North Caro-lina Asheville in October 2005.
Chancellor Ponder is a native of Asheville and a lifelong educator. She earned her bachelor’s, master’s and doctoral degrees in English from the University of North Carolina-Chapel Hill. She began her academic career at Elon College (now Elon University) in North Carolina, where she was the fi rst woman and fi rst pre-tenure professor to receive the Daniels-Danieley Award for Excellence in Teaching. During her nine years at Elon, she taught English and communications, and founded the college’s Honors Program.
She later joined Guilford College in North Carolina, where she was an associate professor of English and interdisciplinary studies and served as associate academic dean. At Kenyon College in Ohio, she served as professor of English and drama, academic dean, adding ‘vice president for information technology’ to her portfolio.
In 1995, she was selected to become president at Colby-Sawyer College, a private liberal arts college in New London, N.H., where she would serve for ten years.
At UNC Asheville, Chancellor Ponder has led a campuswide collaboration resulting in a fi ve-year Strategic Plan and then imple-mented an administrative reorganization that focuses University resources on the Strategic Plan’s highest priorities. As part of that strategy, the UNC Asheville campus now serves as the new na-tional headquarters for the Council of Public Liberal Arts Col-leges.
Chancellor Ponder is a nationally known expert on institu-tional effectiveness, strategic planning, and fundraising and re-source development. She has been a frequent faculty member of Harvard University’s Institutes for Higher Education, and has writ-ten a chapter on strategic planning for the book “Leading Ameri-ca’s Branch Campuses,” edited by Samuel Schuman and published by the American Council on Education.
In addition to serving the University, Chancellor Ponder is a member of the Mission Hospitals Audit Committee and the Asheville Area Chamber of Commerce Board of Directors. She also serves as a member of the Asheville Community and Eco-nomic Development Alliance.
Chancellor Ponder is the daughter of the late Herschel and Eleanor Ponder, both of whom traced their Asheville family roots back to the 1780s. She is married to Christopher Brookhouse, an award-winning writer and publisher previously on the English faculty at UNC Chapel Hill.
Dr. Anne PonderChancellor
University of North Carolina Asheville
4949
Janet R. Cone is in her eighth year as Director of Athletics at UNC Asheville. Since arriving in 2004, she has led the Department of Athletics through a fi ve-year strategic plan that has resulted in improvements in the student-athlete experience, resources for coaches and staff, facilities, competition levels and increased community support.
Last year, Chancellor Anne Ponder appointed Cone to the newly-created position of Senior Administrator for University Enterprises. In this position, Cone will oversee the North Carolina Center for Health and Wellness, manage specifi c community relationships and serve as a member of UNC Asheville’s fundraising team. She will continue as a member of the Chancellor’s Senior Staff and assist Chancellor Ponder in more closely aligning the university with the North Carolina Center for Creative Retirement.
Student-Athletes have excelled in the classroom under Cone’s leadership. In 2004, she created the Athletic Director’s 3.0 + Club that recognizes all student-athletes who make a 3.0 or better grade point average each semester. More than 600 student-athletes have made the club during Cone’s seven years, and in 2009-10, a record
number of student-athletes earned that distinction.
During that same time period, more than 600 student-athletes have been named to the Big South Presidential Honor Roll, and in 2009-10 more than 60 percent of UNC Asheville’s student-athletes have earned this impressive academic distinction. The Department of Athletics has also successfully hosted two Big South Conference Tournaments that produced revenue for the school.
Cone has overseen construction projects that will dramatically improve the facilities in which UNC Asheville’s Bulldog student-athletes compete and train. (1) Cone helped raise more than seven million dollars in private funds to construct the Kimmel Arena, a major convocation space that will accommodate larger group events than the campus has been able to host before. Among other things, this will allow the university to host its own graduation on campus, attract major venue speakers and performances, and will secure a future home for men’s and women’s basketball teams. (2) Renovation and repairs to the Karl Straus Track began in the spring of 2009 and should be completed in the next year. Cone helped raised more than one million dollars in private funding for the track project. (3) Cone negotiated a partnership with the Crowne Plaza Hotel and Resort for construction of a new Bulldog tennis facility which has indoor courts, composition courts and six hard courts that each Bulldog team played in the past two seasons.
She has also been a leader in the Asheville community. Last year, Cone helped create the Asheville Sports Commission which helps bring athletic events to Buncombe County. She worked closely with the commission to help bring the Southern Conference Men’s and Women’s Basketball Tournament back to Asheville starting in March of 2012 with some of the games being played at Kimmel Arena.
The 2007-08 year was another outstanding year for Cone and the Department of Athletics. The men’s basketball team was co-regular season champions of the Big South Conference and earned a bid to the National Invitational Tournament, making UNC Asheville the fi rst men’s basketball team in Big South history to receive a bid to the NIT. Cone helped the department successfully host the Big South Conference Men’s Basketball Tournament and Women’s Basketball Tournament in back-to-back weekends. In October of 2007, Cone was named the 2007 Division I-AAA Administrator of the Year by the National Association of Collegiate Women Athletic Administrators. UNC Asheville Chancellor Anne Ponder was delighted to see Cone receive the award. “Janet Cone’s inspirational leadership has set a very high standard for our student-athletes and our coaches, all of whom continue to be winners both on and off the fi eld,” stated Ponder. “We are thrilled that she is being recognized in this way for her vision, her energy, and her tenacity, qualities our University benefi ts from each and every day.”
Janet R. ConeDirector of AthleticsSenior Administrator for University Enterprises
5050
In 2006-07, UNC Asheville three different teams UNC Asheville teams won Big South Conference championships and advance to the NCAA Tournament. In May of 2006, the UNC Asheville baseball team completed an amazing run with their fi rst ever championship and a trip to Clemson for the NCAA Regional. In the fall of 2006, the women’s soccer team became the fi rst women’s team in school history to qualify for the NCAA Tournament when the Bulldogs won the league title and earned a spot against top-seed UNC Chapel Hill in the College Cup. In March of 2007, the UNC Asheville women’s basketball team won its fi rst ever Big South Conference championship Asheville advanced to the NCAA Tournament for the fi rst time where it took on Final Four-bound LSU.
The South Carolina native has promulgated a signifi cant increase in corporate sponsorships and Bulldog Athletic Association donations, critical to an organization that is not allowed to receive state funds of any kind. She has also overseen a new partnership with the Asheville City and Buncombe County Parks and Recreation Departments, an improved Athletics web-site, and the implementation of internet broadcasts and video-streaming for six different sports.
In September of 2008, she began a four-year term on the NCAA Division I Leadership Council. In July of 2006, the Summerville, S.C. native was one of just 14 female athletic administrators to be picked by the NCAA/NACWAA to attend The Institute of Athletics Executives in Denver. In September of 2008, she began a four-year term on the NCAA Division I Leadership Council.
Cone is extremely active in the community. In the spring of 2006, she was named as an Outstanding Executive Manager by the Asheville-Buncombe Excellence in Public Service. In the summer of the 2006, she helped lead a group of community leaders to bring the Big South Conference Women’s Basketball Tournament to UNC Asheville’s Justice Center in 2007 and 2008. Cone also initiated the “Our Turn to Play” women’s luncheon for local business, civic, and community leaders the past two years. Cone was recognized as one of “10 Women to know in Western North Carolina.” In March of 2009, she earned a YWCA Twin Award for her leadership skills. Cone was tapped to be a member of the Clear Channel Local Advisory Committee. She also was the task force leader for the formation of the new Asheville Sports Commission.
Cone was born and raised in Summerville, South Carolina. She was a four-year letterwinner on the basketball team and was an all-conference performer at Summerville HS for two years. Cone is a member of that schools’ Athletics Hall of Fame. She graduated magna cum laude from Furman University in 1978 and was named Physical Education Student of the Year while lettering in basketball and fi eld hockey as an undergraduate. While earning her Masters from the University of South Carolina in 1986, she completed her studies with a perfect 4.0 grade point average.
Cone came to Asheville from Samford University where she served as the fi rst head women’s basketball coach in 1996. She coached the Bulldogs for fi ve seasons and, in 1999-2000, the team posted a 19-10 record. Cone was named Assistant Athletics Director before being promoted to Associate Athletics Director in 2003. Prior to Samford, Cone served as the fi rst full time Assistant Athletics Director, and the head women’s basketball and volleyball coaches at Saint Leo University in Florida. She also directed programs at Western Carolina University and Mars Hill College. Cone fi rst began her career as a teacher and coach in Gilbert, South Carolina. She coached against UNC Asheville eight times in her career and had a 5-3 record against the Bulldogs.
A life-long learner, Cone is a 2003 graduate of the NACWAA/HERS Institute of Administrative Advancement. She is a member of NACDA, NACWAA, NCAA Division I-AAA Athletics Directors Association, Women’s Sports Foundation, and the Fellowship of Christian Athletes.
5151
Terri BrneAssociate Director of Athletics of Internal Affairs
Terri Brne begins her sixth year at UNC Asheville. She serves as Associate Athletics Director of Internal Affairs and is also the athletic department’s Director of Compliance and Sport Oversight. Brne came to UNC Asheville in the fall of 2006. She is responsible for the interpretation of rules by the NCAA and Big South Conference. Brne is the department’s liaison with Admissions, Financial Aid, Registrar and the Big South Conference. She educates UNC Asheville’s student-athletes and staff on all of the NCAA rules and regulations. In addition, Brne is the administrator for men’s and women’s soccer and baseball. She also serves as the Game Administrator for women’s basketball. The Illinois native was an assistant basketball coach at both South Dakota State and St. Andrews Presbyterian College. While at St. Andrews, she assisted in NCAA Compliance in NCAA Compliance. Brne earned a Bachelor of Science degree in physical education from Illinois State. She earned her Master’s degree at Tarleton State in Exercise and Sports Studies and is currently completing a doctorate in Sports Administration.
Mike GoreAssociate Director of Athletics for External Affairs
Mike Gore is in his 26th year of service to the UNC Asheville Athletics Department. He currently serves the school as an Associate Athletics Director for External Affairs. In his post, Gore is the liaison with the media, handling all media-related activities concerning the athletic department. He also assists with game management and sport oversight. In 2004, Gore served as the school’s Interim Athletics Director for six months prior to the hiring of Janet Cone. He is the chairman of the school’s Athletics Department Hall of Fame and the Big South Conference Hall of Fame committee. The Buffalo native has been a longtime contributor to the Asheville Citizen-Times , Hendersonville Times-News and has written for Blue Ribbon Basketball Magazine. For the past 13 years, Gore has been the offi cial scorer for the Class A Asheville Tourists baseball team. In 2005, Gore was honored with the fi rst ever Mike Gore Bulldog Service Award at UNC Asheville’s Athletics Banquet. Gore is a 1984 graduate of Appalachian State University with a bachelor’s degree in communications. His wife Lisa is an Assistant District Attorney for the 28th Judicial District.
ASHEVILLE SUPPORT STAFF
5252
Judith BohanBusiness Manager
Linda MarshallAssistant
Business Manager
Ken Hogue Director of
Development
Megan HammondsAssistant
Athletic Trainer, ATC
Harmon TurnerTicket Manager
Tim WhiteHead
Athletic Trainer, ATC
Kellen PetroneAssistant Volleyball
Coach
Mary CaseyAssistant Women’s
Soccer Coach
Dr. Herman HoltFaculty AthleticsRepresentative
Rebecca Nelms-KeilDirector of Student
Athlete Affairs
Erin Punter-SpenceDirector of Marketing
and Promotions
Matt PellegrinDirector of Athletics
Media Communications
ASHEVILLE SUPPORT STAFF
Aaron RembertAssistant Baseball
Coach
Andrea KaufmanAthletic Trainer, ATC
Brett CareyAssistant Men’s
Basketball Coach
Aaron SandersDirector of Sherrill
Center
Joe Burnette Assistant Men’sSoccer Coach
Tom HandAssistant
Tennis Coach
Curtis MettenAssistant Women’s Basketball Coach
Lauren PowellAssistant Women’sBasketball Coach
Nick McDevittAssistant Men’s
Basketball Coach
Joel WilliamsAssistant Track & Field
Coach
Adam PuettAssistant Cross Country Coach
Tiffany GwynnAssistant Women’sBasketball Coach
Donna PeekAdministrative
Assistant
5353
Betsy BloseWomen’s Basketball
10th year as head coach
Michele DemkoWomen’s Soccer
2nd year as head coach
Matt KernMen’s Soccer
2nd year as head coach
Tom SmithBaseball
3rd year as head coach
Jesse NormanCross Country/Track
5th year as head coach
Omar AhmadStrength and Conditioning
1st year as head coach
Lise GregoryTennis
5th year as head coach
Eddie BiedenbachMen’s Basketball
16th Year as head coach
Frederico SantosVolleyball
1st year as head coach
ASHEVILLE HEAD COACHES
5454
Since UNC Asheville fi rst fi elded athletics teams in the 1930s (then known as Biltmore College), the bulldog has been its mascot. Early students chose the bulldog for its fi erce and tenacious reputation. In the decades that have followed, the bulldog has become a beloved symbol of our University.
In 1948, “Puck,” arrived on campus and began a tradition of live bulldog mascots that lasted into the 1980s. Puck, named after the character in Shakespeare’s A Midsummer Night’s Dream, was followed by Puck II and in the 1960s by Chug-a-lug. In the 1980s the campus welcomed Winston, named after British Prime Minister Winston Churchill, both for his bulldogged resolve as well as his appearance. Winston appeared for only a year and the tradition of a live mascot fell out of use. In 2009 thanks to a group of student organizers, UNC Asheville welcomed a new bulldog mascot to the University community. “Rocky I” made his fi rst public appearance at halftime of UNC Asheville’s homecoming basketball game on Feb. 21, 2009. Alumni couple, Alexis Johnson (’97) and Ed Johnson (’96), also a member of the math faculty, are his keepers.
The name “Rocky” was suggested by staff member Nancy Williams during a naming contest sponsored by the Athletics Department in 1995. Though the rumor has often been that the name came from Sylvester Stallone’s famous character, Rocky Balboa, which is based on the American prize fi ghter Rocky Marciano, the name was chosen because it means steadfast, much like the mountains that surround campus. Ironically, the name “Rocky,” which is of English origin, is a derivation of the name “Roch” (also Rocco and Roque) after St. Roch, the Patron Saint of Dogs.
In addition to the live bulldogs, the UNC Asheville mascot has also been depicted by an army of costumed students. Since the 1960s, students dressed as the bulldog have rallied the fans at thousands of games in support of Bulldog Athletics. The present incarnation of Rocky was introduced during the 2006-2007 season and is the fi rst to accurately refl ect the logo image of the bulldog used on signs and in print publications. That image, introduced during the 2004-05 season is the fi fth offi cial incarnation of the UNC Asheville bulldog logo.
In the late 1990s, the image of the bulldog, or “Rocky,” was immortalized in aluminum through a gift by the Class of 1998. Sculpted by Matt West (‘00) and modeled after a canine friend of the University, Pete “Bubba” McGill, the statue of Rocky stands in front of the Justice Center as a sentinel over campus. Careful observers will note a chipped tooth and a torn ear, signs of his ferocity. Despite his tough outward appearance, the statue of Rocky is beloved by fans. Continuing a tradition begun by the Class of 1998, each year, during convocation and commencement, freshman and seniors rub his head for good luck before going to the ceremonies. Seniors are also often spotted getting their picture made riding Rocky in the days leading up to graduation.
UNC Asheville is proud of its bulldog heritage. Today, Rocky, in all of his forms serves as a rallying point for fans far and wide.
1990-2003
2004-Present
ROCKY
5555
Important NCAA Terms
A prospective student-athlete is a student who has started classes for the ninth grade. In addition, a student who has not started classes for the ninth grade be-comes a prospective student-athlete if the institution provides such an individual (or the individual’s relatives or friends) any fi nancial assistance or other benefi ts that the institution does not provide to prospective students generally. An indi-vidual remains a prospective student-athlete until one of the following occurs (whichever is earlier):
(a) The individual offi cially registers and enrolls in a minimum full-time program of studies and attends classes in any term of a four-year collegiate institution’s regular academic year (excluding summer); or(b) The individual participates in a regular squad practice or competition at a four-year collegiate institution that occurs before the beginning of any term; or (Revised: 1/11/89, 1/10/90)(c) The individual offi cially registers and enrolls and attends classes during the summer prior to initial enrollment. (Adopted: 4/28/05, Revised: 1/17/09)
Contact: A contact is any face-to-face encounter between a prospective student-athlete or the prospective student-athlete’s parents, relatives or legal guardians and an institutional staff member or athletics representative during which any dialogue occurs in excess of an exchange of a greeting. Any such face-to-face encounter that is prearranged (e.g., staff member positions himself or herself in a location where contact is possible) or that takes place on the grounds of the prospective student-athlete’s educational institution or at the site of organized competition or practice involving the prospective student-athlete or the prospective student-athlete’s high school, preparatory school, two-year college or all-star team shall be considered a contact, regardless of whether any conversation occurs. How-ever, an institutional staff member or athletics representative who is approached by a prospective student-athlete or the prospective student-athlete’s parents, relatives or legal guardians at any location shall not use a contact, provided the encounter was not prearranged and the staff member or athletics representative does not engage in any dialogue in excess of a greeting and takes appropriate steps to immediately terminate the encounter.
Contact Period: A contact period is that period of time when it is permissible for authorized athletics department staff members to make in-person, off-campus recruiting contacts and evaluations.
Evaluation: Evaluation is any off-campus activity designed to assess the academic qualifi ca-tions or athletics ability of a prospective student-athlete, including any visit to a prospective student-athlete’s educational institution (during which no contact occurs) or the observation of a prospective student-athlete participating in any practice or competition at any site.
Evaluation Period:An evaluation period is a period of time when it is permissible for authorized ath-letics department staff members to be involved in off-campus activities designed to assess the academic qualifi cations and playing ability of prospective student-athletes. No in-person, off-campus recruiting contacts shall be made with the prospective student-athlete during an evaluation period.
Quiet Period: A quiet period is a period of time when it is permissible to make in-person recruiting contacts only on the institution’s campus. No in-person, off-campus recruiting contacts or evaluations may be made during the quiet period.
Dead period: A dead period is a period of time when it is not permissible to make in-person recruiting contacts or evaluations on or off the institution’s campus or to per-mit offi cial or unoffi cial visits by prospective student-athletes to the institution’s campus. The provision of complimentary admissions to a prospective student-athlete during a dead period is prohibited, except as provided in Bylaw 13.7.2.5 for a prospective student-athlete who visits an institution as part of a group. During a dead period, a coaching staff member may not serve as a speaker at or attend a meeting or banquet at which prospective student-athletes are in at-tendance, except as provided in Bylaw 13.1.8.1, and may not visit a prospective student-athlete’s educational institution. It remains permissible, however, for an institutional staff member to write or telephone a prospective student-athlete during a dead period.
Initial Eligibility: A student-athlete who enrolls in a member institution as an entering freshman with no previous full-time college attendance shall meet specifi c NCAA academic requirements, as certifi ed by the NCAA Eligibility Center, as approved by the Executive Committee, and any applicable institutional and conference regulations, to be considered a qualifi er and thus be eligible for fi nancial aid, practice and competition during the fi rst academic year in residence. For further information please visit, www.eligibilitycenter.org.
Frequently Asked Questions
What is the National Letter of Intent (NLI)?The NLI is a contract between a prospect and an institution. By signing a NLI, a prospect agrees to attend UNC Asheville for at least one academic year. In exchange, UNC Asheville must provide athletic fi nancial aid for one academic year. The NLI early signing period for Basketball, Baseball, Tennis and Volleyball is November 10-17, 2010. The regular signing period for Basketball is April 13 - May 18, 2011. The regular signing period for Baseball, Tennis and Volleyball is April 13- August 1, 2011. The NLI signing period for Soccer and Track is February 2-August 1, 2011. The NLI regular signing period for all other sports is April 13-August 1 2011. For more information, visit the NLI website: http://www.ncaa.org/wps/wcm/connect/nli/nli.
What is the difference between an offi cial visit and unoffi cial visit?After opening day of classes of the prospect’s senior year, the prospect may take fi ve offi cial visits to different Division I or II schools. Before the visit, the prospect must present a high school transcript, proof of SAT, ACT, PACT, PSAT test to UNC Asheville, register with the NCAA Eligibility Center, and be placed on the Institution’s IRL. An offi cial visit may not occur if the prospect is not registered with the NCAA Eligibility Center. Offi cial visits are paid in part and extended by UNC Asheville coaches only. All visits must be comparable to normal student life.
Prospects may make unlimited number of unoffi cial visits and may visit UNC Asheville anytime except during a dead period. Prospects are solely responsible for all expenses of unoffi cial visits. However, prospects may receive three com-plimentary admissions to any home athletic contest, excluding Big South Confer-ence Post Season Tournaments.
What is the NCAA Eligibility Center?It is the agency that certifi es both a prospect’s academic and amateur eligibility for Division I and II. A prospect should register with the NCAA Eligibility Center at the beginning of their senior year in high school. Visit the NCAA Eligibility Center website for registration information.
This is a brief summary of regulations which outlines the basic recruiting rules to help prospective student-athletes and parents better understand the recruiting process. UNC Asheville is committed to recruiting and conducting its athletics program with the highest level of integrity. If you have any questions about NCAA rules, please contact Terri Brne, Associate Athletics Director, at 828-251-6930.
THE NCAA
5656
For over 30 years, the Bulldog Athletics Association has been the athletics scholarship fundraising arm of the UNC Asheville Athletics Department, but in its simplest terms, the Bulldog Athletics Club is YOU. Construction workers, doctors, teachers, lawyers, bankers, manufacturers, brokers, and technicians who are friends, fans, alumni, and countless combinations of others from Asheville, Weaverville, Arden, Hendersonville, …and places all over North Carolina, the United States, and the world. They all have one thing in common—a passion for Bulldog Athletics. While we have high expectations for conference and NCAA competition, we also have high expectations for outstanding graduation rates, personal growth, and community involvement. As a member of the Bulldog Athletics Association, you become a critical part of a successful athletics program with a tradition of developing a student-athlete. We must raise funds not only to increase the amount of scholarship money we can offer but also to offset the rising costs of a college education. The confi dence of knowing your investment will be maximized is one reason supporting UNC Asheville Bulldog Athletics is a great investment. UNC Asheville Athletics receives no state funding for scholarships, so 100 percent of your gift will enable UNC Asheville to recruit and retain student-athletes who will succeed in the classroom, athletics arena, and the community – following our motto:
Champions in Athletics, Leaders in Life.
For more information about the Bulldog Athletics Association, please contact us:UNC Asheville Athletics
Justice Center, CPO #2600One University Heights
Asheville, NC 28804Phone: (828) 251-6459
Fax: (828) 251-6386www.uncabulldogs.com
“UNC Asheville is a point of pride for this community, as an alumnus and business owner. We are proud to support the athletics department and student-athletes as they represent our community and bring attention to WNC.”
--Rich Davis ’93, Jan Davis Tire Store
“The athletics scholarship I received from UNC Asheville allowed me to focus solely on my academics and soccer, without being concerned about how to pay for school. I donate to the Bulldog Athletics Club now so that current and future student-athletes can enjoy the same experience I did. Being a student-athlete at UNC Asheville was one of the best experiences of my life and the values and lessons I learned have helped me in my professional career and my personal life. Go Bulldogs!”
--Pat Britz ’90; former men’s soccer player
BULLDOG ATHLETICS ASSOCIATION