2011–2012 Quincentennial “Viva Florida” Grant Leu Gardens, Orlando, Orange County — Exit Survey Please enter your 7 character Project Code: BOW0752 PROJECT MANAGER CONTACT INFORMATION Name: Robert Bowden Address: 1920 North Forest Ave., Orlando, FL 32803 Email: [email protected]Phone Number: 407-246-2625 Cell Phone Number: 407-719-2625 ATTENDANCE Please report the number of Florida residents who visited your garden or facility. June–December 2012: 38469 Jan–December 2013: 76455 Please report the number of Non-Florida residents who visited your garden or facility. June–December 2012: 29020 Jan–December 2013: 57677 Please report the number of Florida residents who visited the native wildflower demonstration area. June–December 2012: 25000 Jan–December 2013: 50450 Please report the number of Non-Florida residents who visited the native wildflower demonstration area. June–December 2012: 19000 Jan–December 2013: 38000 EDUCATIONAL PROGRAMS In the space provided below, please report any educational PROGRAMS offered that incorporate the native wildflower demonstration garden. Please include an estimate of the attendance for each program. • Go Native, Wednesday, March 2, 2011, 7-9:00 pm Join our botanical records specialist in this presentation covering the flowering native plants that grow in Central Florida. Eric will focus on native plants that are attractive, drought tolerant, low maintenance, pest resistant, beneficial for wildlife and sized for homeowner needs. Attendance: 8. • Green Gardening: Design, Install, and Maintain, Thursday, September 15, 2011, 7-9:00pm Learn how to create and maintain your dream garden and successfully work with design professionals and landscape maintenance contractors. You will be empowered to ‘do it yourself’ to create a water-wise garden with cold hardy, low maintenance Florida Friendly landscaping principles. Attendance: 12. • Go Native, Tuesday, November 8, 2011, 6:30-8:30pm Join our botanical records specialist in this presentation covering the flowering native plants that grow in Central Florida. Eric will focus on native plants that are attractive, drought tolerant, low maintenance, pest resistant, beneficial for wildlife and sized for homeowner needs. Cancelled due to low registration. • Planting for Pollinators, Saturday, January 21, 2012, 1:30-3pm Learn which host plants you should plant to attractive native butterflies and moths. Discover which flowering native plants will attract a host of native bees and what to plant to attract migrating hummingbirds. Attendance: 11. • Planting for Pollinators, Saturday, June 9, 2012, 1:30-3pm Learn which host plants you should plant to attractive native butterflies and moths. Discover which flowering native plants will attract a host of native bees and what to plant to attract migrating hummingbirds. Attendance: 8. • Green Gardening: Design, Install, and Maintain, Monday, July 16, 2012, 7-9:00pm Learn how to create and maintain your dream garden and successfully work with design professionals and landscape maintenance contractors. You will be empowered to ‘do it yourself’ to create a water-wise garden with cold hardy, low maintenance Florida Friendly landscaping principles. Cancelled due to low registration. BOW0752 Page 1
Transcript
2011–2012 Quincentennial “Viva Florida” Grant Leu Gardens, Orlando, Orange County — Exit Survey
Please enter your 7 character Project Code: BOW0752
PROJECT MANAGER CONTACT INFORMATIONName: Robert BowdenAddress: 1920 North Forest Ave., Orlando, FL 32803Email: [email protected] Number: 407-246-2625Cell Phone Number: 407-719-2625
ATTENDANCEPlease report the number of Florida residents who visited your garden or facility.
June–December 2012: 38469Jan–December 2013: 76455
Please report the number of Non-Florida residents who visited your garden or facility.June–December 2012: 29020Jan–December 2013: 57677
Please report the number of Florida residents who visited the native wildflower demonstration area.June–December 2012: 25000Jan–December 2013: 50450
Please report the number of Non-Florida residents who visited the native wildflower demonstration area.June–December 2012: 19000Jan–December 2013: 38000
EDUCATIONAL PROGRAMSIn the space provided below, please report any educational PROGRAMS offered that incorporate the native wildflower demonstration garden. Please include an estimate of the attendance for each program. • Go Native, Wednesday, March 2, 2011, 7-9:00 pm
Join our botanical records specialist in this presentation covering the flowering native plants that grow in Central Florida. Eric will focus on native plants that are attractive, drought tolerant, low maintenance, pest resistant, beneficial for wildlife and sized for homeowner needs. Attendance: 8.
• Green Gardening: Design, Install, and Maintain, Thursday, September 15, 2011, 7-9:00pm Learn how to create and maintain your dream garden and successfully work with design professionals and landscape maintenance contractors. You will be empowered to ‘do it yourself’ to create a water-wise garden with cold hardy, low maintenance Florida Friendly landscaping principles. Attendance: 12.
• Go Native, Tuesday, November 8, 2011, 6:30-8:30pm Join our botanical records specialist in this presentation covering the flowering native plants that grow in Central Florida. Eric will focus on native plants that are attractive, drought tolerant, low maintenance, pest resistant, beneficial for wildlife and sized for homeowner needs. Cancelled due to low registration.
• Planting for Pollinators, Saturday, January 21, 2012, 1:30-3pm Learn which host plants you should plant to attractive native butterflies and moths. Discover which flowering native plants will attract a host of native bees and what to plant to attract migrating hummingbirds. Attendance: 11.
• Planting for Pollinators, Saturday, June 9, 2012, 1:30-3pm Learn which host plants you should plant to attractive native butterflies and moths. Discover which flowering native plants will attract a host of native bees and what to plant to attract migrating hummingbirds. Attendance: 8.
• Green Gardening: Design, Install, and Maintain, Monday, July 16, 2012, 7-9:00pm Learn how to create and maintain your dream garden and successfully work with design professionals and landscape maintenance contractors. You will be empowered to ‘do it yourself’ to create a water-wise garden with cold hardy, low maintenance Florida Friendly landscaping principles. Cancelled due to low registration.
BOW0752 Page 1
• Go Native, Wednesday, February 6, 2013, 7-9:00 pm Join our botanical records specialist in this presentation covering the flowering native plants that grow in Central Florida. Eric will focus on native plants that are attractive, drought tolerant, low maintenance, pest resistant, beneficial for wildlife and sized for homeowner needs. Attendance: 14.
• Florida’s Fabulous Wildflowers, Thursday, May 9, 2013, 7-8:30pm Help us celebrate Wildflower Week by learning how to give your garden “punch” by growing these beauties at home. Florida’s wildflowers provide a sense of place that is uniquely La Florida, “land of flowers.” This workshop will teach about species that grow in central Florida landscapes, seed and plant sources and much more. Attendance: 6.
Were any educational or informational SIGNS installed that explain the wildflower demonstration garden and its environmental, historical and/or cultural significance?
YESWere any educational or informational BROCHURES or PAMPHLETS created to explain the wildflower demonstration garden and its environmental, historical and/or cultural significance?
NO
WILDFLOWER DISPLAYList all species by scientific name that were part of the native wildflower demonstration garden. Note those that were purchased with funds from this grant.
In 2013, the native wildflower demonstration garden planting is best described as: Moderately successful
In 2013, the wildflower display is best described as: Slightly showy
Optional: Please provide any additional comments about the showiness of the wildflower display.The showiness of the wildflower display varies greatly throughout the year. We encourage our guests and visitors to visit this area when there are more flowers to create an increased interest.
If your planting was not successful, please explain why it failed (e.g. succumbed to weed pressure, accidental mowing, flooding, etc.), what you are doing to help re-establish it, and how you are educating the public about the failed planting.
N/A
BOW0752 Page 2
MEDIA COVERAGEWas a story published in a newspaper or newsletter that described the wildflower demonstration garden and included information about the environmental, historical and/or cultural significance of Florida’s native wildflowers?
YESIf YES, please provide the following information:
newspaper/newsletter name The Garden Viewdate of publication Winter 2012reporter’s namehyperlink to article*approximate circulation of newspaper/newsletter Estimated circulation: 5,000 copies
Was a story done by a local TV station that described the wildflower demonstration garden and included information about the environmental, historical and/or cultural significance of Florida’s native wildflowers?
NOWas a story published on a website that described the wildflower demonstration garden and included information about the environmental, historical and/or cultural significance of Florida’s native wildflowers?
NOWas a story posted on a YouTube or other online video site that described the wildflower demonstration garden and included information about the environmental, historical and/or cultural significance of Florida’s native wildflowers?
NOOptional: If other outreach methods were used, please describe the results.
We continue to post updates about Leu Gardens and the plants that are in flower or of special interest on our Facebook page, www.facebook.com/leugardens. As these wildflowers continue to flower we will post these with supporting cultural information and plan to have a “Wildflower Week” of postings this summer.
IMPACTThe impact of your native wildflower demonstration garden is very important to the Foundation. The following questions evaluate how much and what type of information people learned from visiting the native wildflower demonstration planting and/or attending a native wildflower educational program at your garden.As a result of visiting your demonstration garden and/or attending related educational programming...
How much information did they learn about landscape uses for native wildflowers and plants?0-25% of Florida resident visitors Learned something new26-50% of Florida resident visitors Learned something new51-75% of Florida resident visitors Learned a great deal of new information76-100% of Florida resident visitors Learned something new0-25% of non-Florida resident visitors Learned something new26-50% of non-Florida resident visitors Learned something new51-75% of non-Florida resident visitors Learned a great deal of new information76-100% of non-Florida resident visitors Learned something new
How much did they learn about the availability of native wildflowers and plants?0-25% of Florida resident visitors Learned something new26-50% of Florida resident visitors Learned nothing new51-75% of Florida resident visitors Learned a great deal of new information76-100% of Florida resident visitors Learned something new0-25% of non-Florida resident visitors Learned something new26-50% of non-Florida resident visitors Learned nothing new51-75% of non-Florida resident visitors Learned something new76-100% of non-Florida resident visitors Learned something new
BOW0752 Page 3
BOW0752 Page 4
Environmental significance of native wildflowers and plants?0-25% of Florida resident visitors Learned nothing new26-50% of Florida resident visitors Learned something new51-75% of Florida resident visitors Learned something new76-100% of Florida resident visitors Learned something new0-25% of non-Florida resident visitors Learned nothing new26-50% of non-Florida resident visitors Learned something new51-75% of non-Florida resident visitors Learned nothing new76-100% of non-Florida resident visitors Learned something new
Historical significance of native wildflowers and plants?0-25% of Florida resident visitors Learned nothing new26-50% of Florida resident visitors Learned nothing new51-75% of Florida resident visitors Learned something new76-100% of Florida resident visitors Learned something new0-25% of non-Florida resident visitors Learned nothing new26-50% of non-Florida resident visitors Learned nothing new51-75% of non-Florida resident visitors Learned something new76-100% of non-Florida resident visitors Learned something new
Cultural significance of native wildflowers and plants?0-25% of Florida resident visitors Learned something new26-50% of Florida resident visitors Learned nothing new51-75% of Florida resident visitors Learned nothing new76-100% of Florida resident visitors Learned nothing new0-25% of non-Florida resident visitors Learned something new26-50% of non-Florida resident visitors Learned nothing new51-75% of non-Florida resident visitors Learned nothing new76-100% of non-Florida resident visitors Learned nothing new
The following questions evaluate how likely visitors are to start planting native wildflowers in their landscape OR include more native wildflowers in their landscape as a result of visiting the native wildflower demonstration planting and/or attending a native wildflower educational program.
How many homeowners are you aware of thatestablished a new native wildflower garden, landscape bed, or meadow? 1-5 visitorsare planning to establish a new native wildflower garden, landscape bed, or meadow? 6-10 visitorsare strongly considering establishing a new native wildflower garden, landscape bed, or meadow? 1-5are considering establishing a new native wildflower garden, landscape bed, or meadow? 1-5 visitors
How likely were visitors or attendees BETWEEN JUNE 2012 and DECEMBER 2012 to plant native wildflowers in their garden or landscape?
0-25% of Florida resident visitors Moderately likely26-50% of Florida resident visitors Very likely51-75% of Florida resident visitors Slightly likely76-100% of Florida resident visitors Slightly likely
How likely were visitors or attendees BETWEEN JANUARY 2013 and JUNE 2013 to plant native wildflowers in their garden or landscape?
0-25% of Florida resident visitors Not likely26-50% of Florida resident visitors Moderately likely51-75% of Florida resident visitors Very likely76-100% of Florida resident visitors Slightly likely
How likely were visitors or attendees BETWEEN JULY 2013 and DECEMBER 2013 to plant native wildflowers in their garden or landscape?
0-25% of Florida resident visitors Slightly likely26-50% of Florida resident visitors Very likely51-75% of Florida resident visitors Moderately likely76-100% of Florida resident visitors Moderately likely
Before
Before
Volunteers install new plants
Before
Volunteers install new plants
After the installation
BOW0752 Page 5
2011–2012 Quincentennial “Viva Florida” Grant Leu Gardens, Orlando, Orange County — Installation Photos
BOW0752 Page 6
After After
After
Attendees of the Go Native plant program get instruction from horticulturist Pinky Ormand
Construction Methods As a part of the Idea Garden at Leu Gardens, existing beds were used to display and promote Florida wildflowers. These beds are steel edged with crushed granite walkways added to give the area a slightly formal appeal. To improve the post-‐construction soil, compost was added and incorporated to the planting beds. Weeds and other debris were removed, as well as very aggressive Symphytotrichum elliottii (formerly Aster elliottii), Southern Swamp Aster plants. A volunteer work day was organized to involve the community in the planting of these native wildflowers. After the garden was planted mini pine bark nuggets were used to mulch the garden, helping to suppress weeds and conserve moisture.
Maintenance Schedule Weekly-‐ The wildflower garden does have an in-‐ground irrigation system. It is monitored closely, and often remains off throughout our rainy season. During the cooler, drier weather from October to May this area is on a timer for weekly irrigation. Our team of volunteers checks this garden weekly for weeds and any branches or damage. Monthly-‐ To maintain a well-‐kept demonstration garden, plants are cutback or heavily pruned as needed on a monthly basis. This ensures that walkways are kept open and any diseased plants are removed. Yearly-‐ Mulch is refreshed in this garden and any plants that have died are replaced. We assess the overall impact of the garden and decide if any plants need to be moved within the display or possibly removed. Signage is checked and replaced as necessary and plant labels are verified.
2
4
Attached Supporting Documents Before view 1: Before view 2: Before view 3:
Itemized Expense Report Date Expense Detail Cost 8.15.2012 The Natives, Davenport FL-‐ Plants for new beds $682.50 250 plants, 25 different species 8.24.2012 Biosphere Nursery, Winter Garden FL-‐ Plants for new beds $168.25 45 plants, 7 different species 8.20.2012 Orange Blossom Landscape Supply, Orlando FL-‐ Mulch $62.00 20 bags pine bark minis 8.21.2012 Orlando Rock, Orlando FL-‐ Crushed granite for walkways $387.31 5 tons washed screenings, delivered Total $1300.06
Leu Gardens Contributions Date Expense Detail Value Spring 2012
Design of Wildflower Garden by Donald Wishart, Landscape Architect, AECom. In-‐kind donation for design for Leu Gardens.
8.25.2012 Volunteer time-‐ Value of a volunteer hour in Florida is $18.66. Estimate 5 hours x 6 people x 18.66= $559.80
$559.80
Total $1267.32 After assessing the site for the wildflower planting it was determined that the full $3000.00 value of the grant would not be needed. Almost 300 plants were purchased for this project and any more would have created maintenance issues and demonstrated incorrect planting to our visitors. The landscape beds were planted very densely with the above purchased plants and other expenses were limited.
Final Design Plan Developed by Donald Wishart, Landscape Architect with AECom in Orlando, Florida. Please see page 2 for design drawing.
1
Harry P. Leu Gardens Final Report
2011-‐12 Quincentennial "Viva Florida" Gardens
Itemized Expense Report Date Expense Detail Cost 8.15.2012 The Natives, Davenport FL-‐ Plants for new beds $682.50 250 plants, 25 different species 8.24.2012 Biosphere Nursery, Winter Garden FL-‐ Plants for new beds $168.25 45 plants, 7 different species 8.20.2012 Orange Blossom Landscape Supply, Orlando FL-‐ Mulch $62.00 20 bags pine bark minis 8.21.2012 Orlando Rock, Orlando FL-‐ Crushed granite for walkways $387.31 5 tons washed screenings, delivered Total $1300.06
Leu Gardens Contributions Date Expense Detail Value Spring 2012
Design of Wildflower Garden by Donald Wishart, Landscape Architect, AECom. In-‐kind donation for design for Leu Gardens.
8.25.2012 Volunteer time-‐ Value of a volunteer hour in Florida is $18.66. Estimate 5 hours x 6 people x 18.66= $559.80
$559.80
Total $1267.32 After assessing the site for the wildflower planting it was determined that the full $3000.00 value of the grant would not be needed. Almost 300 plants were purchased for this project and any more would have created maintenance issues and demonstrated incorrect planting to our visitors. The landscape beds were planted very densely with the above purchased plants and other expenses were limited.
Final Design Plan Developed by Donald Wishart, Landscape Architect with AECom in Orlando, Florida. Please see page 2 for design drawing.
1
Harry P. Leu Gardens Final Report
2011-‐12 Quincentennial "Viva Florida" Gardens
Itemized Expense Report Date Expense Detail Cost 8.15.2012 The Natives, Davenport FL-‐ Plants for new beds $682.50 250 plants, 25 different species 8.24.2012 Biosphere Nursery, Winter Garden FL-‐ Plants for new beds $168.25 45 plants, 7 different species 8.20.2012 Orange Blossom Landscape Supply, Orlando FL-‐ Mulch $62.00 20 bags pine bark minis 8.21.2012 Orlando Rock, Orlando FL-‐ Crushed granite for walkways $387.31 5 tons washed screenings, delivered Total $1300.06
Leu Gardens Contributions Date Expense Detail Value Spring 2012
Design of Wildflower Garden by Donald Wishart, Landscape Architect, AECom. In-‐kind donation for design for Leu Gardens.
8.25.2012 Volunteer time-‐ Value of a volunteer hour in Florida is $18.66. Estimate 5 hours x 6 people x 18.66= $559.80
$559.80
Total $1267.32 After assessing the site for the wildflower planting it was determined that the full $3000.00 value of the grant would not be needed. Almost 300 plants were purchased for this project and any more would have created maintenance issues and demonstrated incorrect planting to our visitors. The landscape beds were planted very densely with the above purchased plants and other expenses were limited.
Final Design Plan Developed by Donald Wishart, Landscape Architect with AECom in Orlando, Florida. Please see page 2 for design drawing.
BOW0752 Page 10
5
Educational Programming The following programs were held in conjunction with the new demonstration beds installed with the Viva Florida Grant:
• Go Native, Wednesday, March 2, 2011, 7-‐9:00 pm Join our botanical records specialist in this presentation covering the flowering native plants that grow in Central Florida. Eric will focus on native plants that are attractive, drought tolerant, low maintenance, pest resistant, beneficial for wildlife and sized for homeowner needs.
• Green Gardening: Design, Install, and Maintain, Thursday, September 15, 2011, 7-‐9:00pm Learn how to create and maintain your dream garden and successfully work with design professionals and landscape maintenance contractors. You will be empowered to ‘do it yourself’ to create a water-‐wise garden with cold hardy, low maintenance Florida Friendly landscaping principles.
• Go Native, Tuesday, November 8, 2011, 6:30-‐8:30pm Join our botanical records specialist in this presentation covering the flowering native plants that grow in Central Florida. Eric will focus on native plants that are attractive, drought tolerant, low maintenance, pest resistant, beneficial for wildlife and sized for homeowner needs.
• Planting for Pollinators, Saturday, January 21, 2012, 1:30-‐3pm Learn which host plants you should plant to attractive native butterflies and moths. Discover which flowering native plants will attract a host of native bees and what to plant to attract migrating hummingbirds.
• Planting for Pollinators, Saturday, June 9, 2012, 1:30-‐3pm Learn which host plants you should plant to attractive native butterflies and moths. Discover which flowering native plants will attract a host of native bees and what to plant to attract migrating hummingbirds.
• Green Gardening: Design, Install, and Maintain, Monday, July 16, 2012, 7-‐9:00pm Learn how to create and maintain your dream garden and successfully work with design professionals and landscape maintenance contractors. You will be empowered to ‘do it yourself’ to create a water-‐wise garden with cold hardy, low maintenance Florida Friendly landscaping principles.
• Go Native, Wednesday, February 6, 2013, 7-‐9:00 pm Join our botanical records specialist in this presentation covering the flowering native plants that grow in Central Florida. Eric will focus on native plants that are attractive, drought tolerant, low maintenance, pest resistant, beneficial for wildlife and sized for homeowner needs.
• Florida’s Fabulous Wildflowers, Thursday, May 9, 2013, 7-‐8:30pm Help us celebrate Wildflower Week by learning how to give your garden “punch” by growing these beauties at home. Florida’s wildflowers provide a sense of place that is uniquely La Florida, “land of flowers.” This workshop will teach about species that grow in central Florida landscapes, seed and plant sources and much more.
6
Educational Signage in the Garden:
“Wildflower Garden” This sign teaches homeowners the best ways for incorporating wildflowers into their home landscape. It advises to match the growing conditions with the plant’s preferred ecosystem and the natural ebb and flow of a native garden. “Florida Wildflowers” Commemorating 500 years of La Florida and the sponsorship of this Viva Florida! garden. Individual plants throughout the Wildflower Garden are labeled with signs similar to the one shown here.
![Original DNA sequence GGC [TACGAGCTTCGAAATTTGCCGATC] CCA mRNA:AUG – CUC – GAA – GCU – UUA – AAC – GGC – UAG A.A.s MET – LEU – GLU – ALA - LEU – ASP – GLY.](https://static.documents.pub/doc/80x56/5a4d1ae17f8b9ab059977456/original-dna-sequence-ggc-tacgagcttcgaaatttgccgatc-cca-mrnaaug-cuc.jpg)
