Engineering a Replication-Competent, Propagation-Defective MiddleEast Respiratory Syndrome Coronavirus as a Vaccine Candidate
Fernando Almazán,a Marta L. DeDiego,a Isabel Sola,a Sonia Zuñiga,a Jose L. Nieto-Torres,a Silvia Marquez-Jurado,a German Andrés,b
Luis Enjuanesa
Department of Molecular and Cell Biology, Centro Nacional de Biotecnología (CNB-CSIC), Campus Universidad Autónoma de Madrid, Cantoblanco, Madrid, Spaina; Centrode Biología Molecular Severo Ochoa (CBMSO-CSIC-UAM), Campus Universidad Autónoma de Madrid, Cantoblanco, Madrid, Spainb
F.A. and M.L.D. contributed equally to this work.
ABSTRACT Middle East respiratory syndrome coronavirus (MERS-CoV) is an emerging coronavirus infecting humans that isassociated with acute pneumonia, occasional renal failure, and a high mortality rate and is considered a threat to public health.The construction of a full-length infectious cDNA clone of the MERS-CoV genome in a bacterial artificial chromosome is re-ported here, providing a reverse genetics system to study the molecular biology of the virus and to develop attenuated viruses asvaccine candidates. Following transfection with the cDNA clone, infectious virus was rescued in both Vero A66 and Huh-7 cells.Recombinant MERS-CoVs (rMERS-CoVs) lacking the accessory genes 3, 4a, 4b, and 5 were successfully rescued from cDNAclones with these genes deleted. The mutant viruses presented growth kinetics similar to those of the wild-type virus, indicatingthat accessory genes were not essential for MERS-CoV replication in cell cultures. In contrast, an engineered mutant virus lack-ing the structural E protein (rMERS-CoV-�E) was not successfully rescued, since viral infectivity was lost at early passages. In-terestingly, the rMERS-CoV-�E genome replicated after cDNA clone was transfected into cells. The infectious virus was rescuedand propagated in cells expressing the E protein in trans, indicating that this virus was replication competent and propagationdefective. Therefore, the rMERS-CoV-�E mutant virus is potentially a safe and promising vaccine candidate to prevent MERS-CoV infection.
IMPORTANCE Since the emergence of MERS-CoV in the Arabian Peninsula during the summer of 2012, it has already spread to10 different countries, infecting around 94 persons and showing a mortality rate higher than 50%. This article describes the de-velopment of the first reverse genetics system for MERS-CoV, based on the construction of an infectious cDNA clone insertedinto a bacterial artificial chromosome. Using this system, a collection of rMERS-CoV deletion mutants has been generated. Inter-estingly, one of the mutants with the E gene deleted was a replication-competent, propagation-defective virus that could only begrown in the laboratory by providing E protein in trans, whereas it would only survive a single virus infection cycle in vivo. Thisvirus constitutes a vaccine candidate that may represent a balance between safety and efficacy for the induction of mucosal im-munity, which is needed to prevent MERS-CoV infection.
Received 9 August 2013 Accepted 12 August 2013 Published 10 September 2013
Citation Almazán F, DeDiego ML, Sola I, Zuñiga S, Nieto-Torres JL, Marquez-Jurado S, Andrés G, Enjuanes L. 2013. Engineering a replication-competent, propagation-defectiveMiddle East respiratory syndrome coronavirus as a vaccine candidate. mBio 4(5):e00650-13. doi:10.1128/mBio.00650-13.
Editor Michael Buchmeier, University of California, Irvine
A new coronavirus (CoV) emerged during the summer of 2012in Saudi Arabia (1–3). This virus has been named the Middle
East respiratory syndrome coronavirus (MERS-CoV) by the In-ternational Coronavirus Study Group of the International Com-mittee on Taxonomy of Viruses (ICTV) (4). Based on its genomesequence, the virus has been classified within lineage C of thegenus Betacoronavirus. MERS-CoV is closely related to Tylonyc-teris bat CoV HKU4 and Pipistrellus bat CoV HKU5, the two pro-totype species in lineage C Betacoronavirus. MERS-CoV is evencloser in sequence to two CoVs found in bats circulating in theNetherlands and Spain (5–7). Therefore, reemergence of the virusin these and other European and Middle Eastern countries is arealistic possibility. Using a nonhuman primate disease model
(rhesus macaques), it has been shown that Koch’s postulates canbe fulfilled (8).
MERS-CoV has been disseminated into 10 countries of theMiddle East, North Africa and Europe. The virus may havecrossed from bats to a domesticated or agricultural animal speciesand subsequently spread from there into humans. To date, theidentities of both reservoir and intermediate hosts remain un-known, complicating virus control efforts. Human-to-humantransmission has been documented in at least four independenthospital settings (9–12). As of 7 August 2013, a total of 94 caseshave been confirmed, of which around 50% were fatal (http://www.cdc.gov/coronavirus/mers/index.html). This might be anoverestimation of the case fatality risk, as many infected patients
likely have not required hospital assistance. In fact, recent datasuggest that mild respiratory illness might also be part of the clin-ical spectrum of MERS-CoV infection (3). In addition to mild oracute respiratory illness, other reported clinical symptoms are ab-dominal pain and diarrhea, fever, and in some cases, renal failure(9). Many hospitalized cases occurred in persons with chronicunderlying medical conditions or immunosuppression (3, 13).The virus loads are highest in lower respiratory tract samples,although low concentrations of viral RNA can also be found instool, urine, and blood samples (12).
The genome of MERS-CoV includes more than 30,100 nucle-otides and contains at least 10 predicted open reading frames(ORF1a, ORF1b, S, 3, 4a, 4b, 5, E, M, and N), 9 of which seem to beexpressed from a nested set of eight mRNAs (14, 15). Interestingly,the partial genome sequences of three independent MERS-CoVisolates reveal that it evolved following a strict molecular clockmodel (6).
A functional receptor of MERS-CoV is dipeptidyl peptidase 4(DPP-4) from both human and bat (16). This receptor binds to a231-residue region in the spike (S) protein of MERS-CoV (17, 18),a domain different from the receptor-binding site of other Beta-coronaviruses (18). Infection of human airways by MERS-CoVprevents the induction of interferon-regulating factor 3 (IRF-3)-mediated antiviral alpha/beta interferon (IFN-�/�) responses.However, MERS-CoV was markedly more sensitive to the antivi-ral state established by ectopic IFN than severe acute respiratorysyndrome CoV (SARS-CoV) (14, 19, 20).
Soon after MERS-CoV emergence, a diagnostic assay was de-signed (21). Similarly, antivirals inhibiting virus replication, suchas cyclosporine A, IFN-�, or ribavirin, have been described (14,22, 23). In contrast, reliable vaccines have not yet been developed,although the S protein and the receptor-binding site within thisprotein induce neutralizing antibodies and, in principle, couldserve as a subunit vaccine (17). CoVs infect respiratory and entericmucosal areas, and thus, induction of mucosal immunity is nec-essary to protect these tissues from infection. Live attenuated vi-ruses are expected to elicit mucosal immunity more efficientlythan nonreplicating antigens, which elicit reduced secretory im-mune responses. Live attenuated viruses can be generated by thedeletion of genes conferring virulence, a procedure that requiresthe availability of a reverse genetics system for MERS-CoV. In thisarticle, we describe the construction of an infectious cDNA cloneof MERS-CoV using a bacterial artificial chromosome (BAC). Us-ing this clone, recombinant MERS-CoV (rMERS-CoV) deletionmutants were constructed lacking genes nonessential for virusreplication. In addition, we deleted the structural envelope (E)protein gene, because in previous work from our laboratory, de-letion of the E gene in two other CoVs led to mutants that wereeither replication-competent, propagation-defective viruses or at-tenuated viruses (24–26). All deletion mutants efficiently repli-cated and spread in cell cultures except the one in which the E genewas deleted, which was replication competent but propagationdefective. This virus was propagated in cells by providing E pro-tein in trans. Therefore, this deletion mutant missing the E genecan serve as the basis for a safe vaccine candidate.
RESULTSConstruction of a MERS-CoV infectious cDNA clone as a BAC.An infectious cDNA clone was assembled as a BAC under thecontrol of the cytomegalovirus (CMV) immediate-early pro-
moter, based on the genome sequence of the MERS-CoV-EMC12strain (GenBank accession number JX869059) (15). To this end,the same approach described for the generation of other CoVinfectious cDNA clones (27–30) was used. This system allows theefficient intracellular production of viral RNA from the cDNAclone without the need for in vitro ligation and transcription steps.
The BAC clone carrying the MERS-CoV infectious cDNA wasgenerated in several steps (Fig. 1). After selection of appropriaterestriction sites in the viral genome (Fig. 1A), the intermediateplasmid pBAC-MERS-5=3= (Fig. 1B) was generated as the back-bone to assemble the full-length cDNA clone. This plasmid con-tained the first 811 nucleotides of the viral genome fused to theCMV promoter, a multicloning site containing the restrictionsites selected in the first step (BamHI, StuI, SwaI, and PacI), andthe last 4,272 nucleotides of the genome, followed by a 25-nucleotide (nt) poly(A) stretch, the hepatitis delta virus (HDV)ribozyme, and the bovine growth hormone (BGH) terminationand polyadenylation sequences. Finally, the full-length MERS-CoV infectious cDNA clone (pBAC-MERSFL) was assembled bysequential cloning of four chemically synthesized overlappingDNA fragments (MERS-1 to MERS-4) into the plasmid pBAC-MERS-5=3= (Fig. 1C). The full-length clone sequence was identicalto that reported for the MERS-CoV-EMC12 strain (15), with theexception of a silent point mutation (T to C) introduced in thecDNA at position 20,761 (Fig. 1C). This mutation, which elimi-nates an additional SwaI restriction site at position 20,760, wasintroduced to facilitate the cloning process and was used as a ge-netic marker to identify the virus recovered from the cDNA clone.
The assembled infectious cDNA clone was stable during itspropagation in Escherichia coli DH10B cells for more than 200generations, as determined by restriction endonuclease analysis(data not shown).
Rescue of infectious rMERS-CoV from the cDNA clone inVero A66 and Huh-7 cells. Infectious viruses were recovered fromthe full-length cDNA clone, using susceptible Vero A66 andHuh-7 cells, with titers of around 106 PFU/ml at 72 h posttrans-fection (h.p.t.). The recovered viruses were cloned by three roundsof plaque purification, and their phenotypic and genotypic prop-erties were determined. Viruses rescued from both cell lines(rMERS-CoV) induced a clear cytopathic effect (CPE), character-ized by the induction of cell fusion, which was more apparent inHuh-7 cells (Fig. 2). In addition, the replication of the rMERS-CoV was confirmed by indirect immunofluorescence microscopyusing a nucleocapsid (N) protein-specific antibody, showing a cy-toplasmic staining pattern in both cell lines (Fig. 2).
To further confirm the identity of the rMERS-CoV, the full-length genome sequences of two independent clones rescued inVero A66 and Huh-7 cells were analyzed. The recombinant vi-ruses rescued in Huh-7 cells presented the same sequence as thecDNA clone, including the genetic marker at position 20,761.However, in the case of the viruses rescued in Vero A66 cells,several changes in the region of the accessory genes were detectedin both clones. One of them presented a deletion of 179 nucleo-tides (from nucleotide 26,721 to 26,900) that disrupted gene 4band eliminated the transcription-regulating sequence (TRS) andthe first 20 amino acids of gene 5. The second clone presented a1-base insertion at position 27,143 that changed the reading frameand promoted the expression of a truncated gene 5. Taking thesedata into consideration, two new virus clones rescued in Vero A66cells were sequenced, and only one of them presented the wild-
type sequence, suggesting that the MERS-CoV was more stable inHuh-7 cells. Therefore, Huh-7 cells were selected for further work.
Rescue of infectious rMERS-CoVs lacking accessory genes 3,4a and 4b, and 5. The availability of the pBAC-MERSFL infectiousclone opened the door to investigate the importance of accessorygenes 3, 4a, 4b, and 5 for MERS-CoV replication. To this end,cDNA clones with genes 3 (pBAC-MERS-�3), 4a and 4b (pBAC-MERS-�4ab), or 5 (pBAC-MERS-�5) deleted were constructedfrom pBAC-MERSFL (Fig. 3A). The expression of gene 3 was ab-rogated by deletion of its TRS and coding sequence, with the ex-ception of the 3= last 41 nucleotides, containing the 4a TRS, inorder to preserve the expression of gene 4a. In the case of genes 4aand 4b, the majority of both coding sequences was deleted, exceptfor the last 81 nucleotides of gene 4b, which overlap the gene 5TRS. Finally, the expression of gene 5 was avoided by deletion ofits TRS and complete coding sequence.
Infectious viruses were recovered in Huh-7 cells from plasmidspBAC-MERS-�3, pBAC-MERS-�4ab, and pBAC-MERS-�5 with
virus titers similar to that of the parental rMERS-CoV (around106 PFU/ml). After one passage on fresh cell monolayers, the re-combinant viruses were cloned by three plaque isolation steps andtheir genetic structure was confirmed by sequencing. All the dele-tion mutant viruses (rMERS-CoV-�3, rMERS-CoV-�4ab, andrMERS-CoV-�5) were identical to the parental virus (rMERS-CoV) in terms of CPE and plaque morphology (data not shown).The growth kinetics of these viruses were also similar, reachingmaximum virus titers at 72 h postinfection (h.p.i.) (Fig. 3B). In thecase of rMERS-CoV-�4ab, the viral titer was around 10-fold lowerthan that obtained from the parental virus (Fig. 3B). These dataindicated that the proteins encoded by genes 3, 4a, 4b, and 5 werenot essential for MERS-CoV replication in cell cultures.
Generation of a rMERS-CoV mutant lacking the structural Eprotein gene. Based on published data showing that the deletionof CoV E protein resulted in either replication-competent,propagation-defective viruses (24) or attenuated viruses (25, 26,31), a cDNA clone with the E gene deleted (pBAC-MERS-�E) was
FIG 1 Assembly of a MERS-CoV full-length cDNA clone as a BAC. (A) Genome organization of the MERS-CoV-EMC12 strain. Viral genes (ORF 1a, ORF 1b,S, 3, 4a, 4b, 5, E, M, and N) are illustrated by boxes in this genome scheme. The relevant restriction sites used for the assembly of the infectious cDNA clone andtheir genomic positions (first nucleotide of the recognition sequence) are indicated. L, leader sequence; UTR, untranslated region; An, poly(A) tail. (B) Schematicrepresentation of pBAC-MERS-5=3=. Relevant restriction sites, the CMV transcription start, the HDV ribozyme (Rz), and the BGH termination and polyade-nylation sequences (BGH) are shown. (C) Strategy to assemble the MERS-CoV infectious cDNA clone. Four overlapping DNA fragments (MERS-1 to MERS-4),generated by chemical synthesis, were sequentially cloned into the plasmid pBAC-MERS-5=3= to generate the MERS-CoV infectious cDNA clone (pBAC-MERSFL). Relevant restriction sites and the genetic marker (T to C) introduced at position 20,761 to abrogate the SwaI restriction site at position 20,760 areindicated. Acronyms for viral genes and regulatory elements are as described for panels A and B.
constructed from pBAC-MERSFL. The expression of the E genewas abrogated by the deletion of its TRS and coding sequence,with the exception of the 3= last 49 nucleotides, in order to pre-serve the expression of gene M (Fig. 4A). To recover infectiousvirus, BHK cells were transfected with pBAC-MERS-�E or thefull-length cDNA clone pBAC-MERSFL. Six h.p.t. the transfectedcells were overlayed on Vero A66 cell monolayers, and at 72 h.p.t.,the supernatants were harvested and serially passaged three timeson fresh Huh-7 cells. Infectious rMERS-CoV was recovered withtiters of around 106 PFU/ml, whereas visible plaques were notdetected for rMERS-CoV-�E virus throughout these passages(data not shown). Since CPE was observed at passages 0 and 1, thecell supernatants from the different passages were titrated inHuh-7 cells by limiting dilution. In contrast to the wild-type virus,which was recovered with high titers (around 1 � 106 50% tissueculture infection dose [TCID50]/ml), the rMERS-CoV-�E was de-tected only at passage 0 with apparent low titers (around 2 � 103
TCID50/ml) (Fig. 5A). This apparent low titer was most probablydue to the transfer of detached cells transfected with the pBAC-MERS-�E. These cells were taken with the supernatant used toinfect the next cell monolayer and formed syncytia with the non-transfected cells, giving the impression of virus production. Infact, rMERS-CoV-�E virus was lost at subsequent passages in sev-eral independent experiments performed in two different celllines, Vero A66 and Huh-7 cells (data not shown). The presence ofviral proteins was analyzed by immunofluorescence microscopyin Huh-7 cells infected with either rMERS-CoV or rMERS-CoV-�E from passage 0. As expected, E protein was detected incells infected with rMERS-CoV but not in those infected withrMERS-CoV-�E (Fig. 4B). Viral N protein was detected in thecytoplasm of both rMERS-CoV- and rMERS-CoV-�E-infectedcells (Fig. 4B). Interestingly, whereas the N protein was detectedall over the cell monolayer in rMERS-CoV-infected cells, it wasonly detected in small syncytia in cells infected with rMERS-CoV-�E. Altogether, these data suggested that E protein was requiredfor efficient virus propagation.
Complementation of rMERS-CoV-�E in cells expressing Eprotein in trans. Previous reports from our laboratory showed
that deletion of the transmissible gastroenteritis coronavirus(TGEV) E gene leads to a propagation-defective virus that canonly spread from cell to cell by expression of the E protein in trans(24, 32). To analyze whether rMERS-CoV-�E could also be com-plemented in cells transiently expressing E protein, the rescue ofrMERS-CoV-�E and of rMERS-CoV as a control was analyzed inHuh-7 cells that did not express E protein (E�) and in cells tran-siently expressing the E protein (E�). The transfection efficienciesin E� cells varied between 40 and 50% in each independent exper-iment. Infectious rMERS-CoV was rescued from both E� and E�
cells with virus titers of around 4 � 105 TCID50/ml and 1 � 106
TCID50/ml, respectively (Fig. 5A). In contrast, rMERS-CoV-�Ewas rescued in E� cells with titers of around 1 � 103 TCID50/mlbut not in control E� cells, in which the virus was not detectablefrom passage 1 (limit of detection, 50 TCID50/ml) (Fig. 5A). Thesedata indicated that the E protein was necessary for either viralRNA synthesis or virus propagation. To evaluate the role of the Eprotein in viral RNA synthesis, the level of genomic RNA (gRNA)was evaluated by quantitative reverse transcription-PCR (RT-qPCR) at each passage. Viral gRNA was detected for rMERS-CoVin both E�- and E�-expressing cells, as expected. However,MERS-CoV-�E viral RNA was detected at high levels in E� cells atpassages 0, 1, 2, and 3, whereas it was only detected at similar levelsin E� cells at passage 0, suggesting that MERS-CoV-�E was areplication-competent virus (Fig. 5B). To further confirm thesedata, viral RNA synthesis was analyzed in a single-cycle infection.E� cells were infected with either rMERS-CoV or rMERS-CoV-�E grown in E� cells. At 5 h.p.i., the levels of gRNA andsubgenomic mRNA 8 (sgmRNA N) were evaluated by RT-qPCR(Fig. 6). Similar levels of gRNA and sgmRNA N were detected incells infected with both viruses, indicating that E protein was notrequired for efficient viral replication and transcription. Overall,these data indicated that rMERS-CoV-�E was a replication-competent, propagation-defective virus.
DISCUSSION
The emergence of MERS-CoV represents a public health threatthat requires further research to understand the virus biology and
FIG 2 Identification of the virus recovered from the cDNA clone. Vero A66 and Huh-7 cells were mock infected or infected with the rMERS-CoV rescued inthese cell lines at an MOI of 0.001 PFU/cell. The induction of syncytium formation (CPE) and N protein expression were analyzed 48 h.p.i. by light microscopyand indirect immunofluorescence assay (IFA), respectively. Pictures were taken with a 40� objective.
provide the basis for the development of control strategies. Thispaper describes for the first time the construction of a reversegenetics system for MERS-CoV, using BACs as vectors. The re-combinant viruses described in this work were rescued using acombination of synthetic biology and reverse genetics techniques,as previously described for other CoVs (33). This system consti-tutes a valuable molecular tool for the rational design and launch-ing of attenuated viruses that may serve as efficient and safe vac-cine candidates. In addition, the infectious cDNA clone will beuseful to study the role of specific viral genes in virus-host inter-actions in the context of the complete viral cycle.
A full-length cDNA copy of MERS-CoV-EMC12 was gener-ated from synthetic fragments cloned downstream from the CMVpromoter in a BAC. The BAC-based strategy allows the efficientand reproducible intracellular production of viral RNA, since it isfirst synthesized in the nucleus by the cellular RNA polymerase II(Pol II) and then amplified in the cytoplasm by the viral replicaseencoded in the RNA itself (27, 28). The MERS-CoV infectiouscDNA was stably maintained in bacteria for more than 200 gen-erations, allowing the easy and direct manipulation of the viral
cDNA for molecular studies. In addition, this BAC-based systemallows for the generation of viral replicons that may be used for thescreening of drugs affecting viral RNA synthesis (27, 34).
The full-length sequence of rMERS-CoV, recovered from theinfectious cDNA clone, was completely identical to that publishedfor the original MERS-CoV-EMC12 isolate (15), except for thesilent point mutation introduced as a genetic marker. Therefore,both viruses should have the same biological properties. In fact,the growth kinetics and CPE caused by both viruses were similarwhen the same multiplicity of infection (MOI) was used to infectHuh-7 cells (14).
Interestingly, the rMERS-CoV sequence seemed more stable inHuh-7 cells than in Vero A66 cells. However, the data presented inthis article are statistically very limited to definitively concludethat virus genome stability depends on the cell type used. Based onthe preliminary data presented here, it would be interesting toanalyze the evolution of the MERS-CoV sequence in different celltypes, including human respiratory epithelial cells.
The 3= third of the MERS-CoV genome contains a set of acces-sory genes encoding proteins with no similarity to other viral or
FIG 3 Rescue and growth kinetics of rMERS-CoV deletion mutants. (A) Genetic structure of rMERS-CoV-�3, rMERS-CoV-�4ab, and rMERS-CoV-�5deletion mutants. TRSs and viral genes are depicted as boxes. The genomic positions of the deletions introduced (gray boxes) are indicated; the numberscorrespond to the last and first nondeleted nucleotide in each case. Acronyms for viral genes are as defined in the legend to Fig. 1. (B) Growth kinetics of thedeletion mutants. Huh-7 cells were infected at an MOI of 0.001 PFU/cell with rMERS-CoV-�3, rMERS-CoV-�4ab, rMERS-CoV-�5, or the wild-type virus(rMERS-CoV), and at the indicated times postinfection, virus titers were determined by plaque assay on Huh-7 cells. Error bars represent standard deviations ofthe mean from three experiments.
mammalian known proteins (35). In general, CoV accessory genesare not essential for virus growth in vitro (36–39). The reversegenetics system described in this article was used to study theimportance of these proteins in cell culture. MERS-CoV genes 3,4a, 4b, and 5 were each found to be dispensable for virus replica-tion in tissue cultures. Interestingly, some of the rMERS-CoV vi-ruses recovered from Vero A66 cells contained mutations in theaccessory gene genome region that would prevent the expressionof any of these genes. Similar results were previously reported forthe original MERS-CoV-EMC12 isolate after passage in Vero cells(15). These data suggested an apparent lack of selection pressureon MERS-CoV accessory genes during passages in cell culture andreinforced the dispensability of these genes for virus growth invitro.
Although not essential in tissue culture, these MERS-CoV ac-cessory genes could have an important role in virus-host interac-tion in vivo, leading to attenuated phenotypes. CoV accessorygenes have been associated with the modulation of viral virulence(40). Among all CoVs, SARS-CoV contains the largest number ofaccessory genes, and it has been proposed that these genes mayhave important contributions to its high virulence (26, 39). Todate, mouse hepatitis virus (MHV) ns2 and 5a, TGEV 7, andSARS-CoV 3b and 6 proteins have been implicated in the modu-lation of innate immune responses, using different mechanisms toinfluence virus virulence (36, 41–44).
rMERS-CoV-�E was a replication-competent, propagation-deficient virus and was only efficiently disseminated in cells ex-pressing the E protein in trans. In the presence of transiently ex-
pressed E protein, rMERS-CoV-�E yielded maximum progenyviral titers of around 103 TCID50/ml. This modest yield could beimproved by the generation of cell lines stably expressing the Eprotein. In fact, a direct relation between viral titers and theamount of E protein expressed was previously observed for TGEV(45). However, high expression levels of E protein could induceapoptosis, as described for MHV E protein expression (46). Toovercome this potential adverse effect in the case of MERS-CoV,an inducible system for E protein expression would have to beestablished.
rMERS-CoV-�E did not spread in cells in the absence of Eprotein, thus constituting a single-cycle replicative virus. How-ever, infected cells produced syncytia, which suggests good ex-pression of viral S protein. In addition, high levels of N proteinwere observed by immunofluorescence. These data suggested thatthe high expression levels of viral proteins might serve as potentimmunogens to elicit a protective immune response. In the case ofSARS-CoV, it has been shown that nonreplicating SARS-CoV-likeparticles bearing the E, S, and membrane (M) proteins inducedimmune responses that were protective against SARS in mice (47,48). In addition, SARS-CoV inactivated viruses induced adaptiveimmunity that protected against challenge (49–52). The potentialof rMERS-CoV-�E as a vaccine candidate is reinforced by previ-ous observations indicating that a SARS-CoV lacking the E gene(SARS-CoV-�E) is attenuated and induces protection in ham-sters, transgenic mice, and conventional aged mice (53–55).
MERS-CoV infects mucosal areas in the lungs and, probably,the enteric tract. Mucosal immunity in a specific tissue, such as in
FIG 4 Rescue of rMERS-CoV-�E. (A) Genetic structure of rMERS-CoV-�E. TRSs and viral genes are illustrated as boxes. The genomic position of theintroduced deletion (gray box) is indicated; the numbers correspond to the last and first nondeleted nucleotides. Acronyms for viral genes are as defined in thelegend to Fig. 1. (B) Identification of the recovered viruses by immunofluorescence microscopy. Huh-7 cells were mock infected (MOCK) or infected withrMERS-CoV-�E and rMERS-CoV viruses from passage 0, and the expression of viral proteins E and N was analyzed 48 h.p.i. by immunofluorescence microscopyusing specific antibodies.
lung infections with MERS-CoV, is optimally induced by localstimulation. Therefore, immunization with live attenuated formsof rMERS-CoV-�E virus grown in a packaging cell line providingthe E protein in trans may be a convenient option, particularly incomparison with purified MERS-CoV antigens, such as the S pro-tein, that could serve as a subunit vaccine.
Vaccines based on live attenuated viruses may present bio-safety problems associated with the possibility of reversion to vir-ulent phenotypes or causing disease in immunocompromised in-dividuals. In this sense, the use of rMERS-CoV-�E would be asafer option, as it does not propagate in the absence of E proteinexpression, preventing straightforward reversion to virulence. Toincrease the biosafety of a rMERS-CoV-�E-based vaccine, addi-tional safety guards could be included, such as the previously de-
scribed attenuating mutations in distant genomic locations, likethose encoding the nsp1 (56, 57) or nsp14 (58) replicase proteins,or by introducing genomic rearrangements (59). Overall, we con-sider rMERS-CoV-�E a promising vaccine candidate that shouldbe further developed.
rMERS-CoV-�E could also be used as the starting point togenerate an inactivated vaccine in case of an urgent need to con-trol the disease. In order to guarantee the absence of virulent vi-ruses after an incomplete chemical inactivation due to clump for-mation, potential noninactivated viruses would be propagationdefective and, therefore, attenuated.
rMERS-CoV-�E, in which one of the nonessential accessoryproteins was deleted, could be considered a marker vaccine, as itwill allow the sera of field-infected patients to be distinguishedfrom sera of vaccinated patients, based on the lack of antibodiesspecific for nonessential viral proteins (60).
The rMERS-CoV-�E could also be considered a viral replicon,as its genome self amplifies in infected cells but infection is notefficiently spread from cell to cell. The construction of a minimalreplicon is also possible with reduced effort using the infectiousclone, a project that is currently in progress in our laboratory.Therefore, the introduction of a reporter gene, such as green flu-orescent protein, within this replicon could easily generate a use-ful tool for MERS-CoV antiviral drug screening.
In this paper, we describe for the first time a reverse geneticssystem of MERS-CoV engineered on BACs, which has allowed thegeneration of the first modified live vaccine candidate to protectagainst MERS-CoV. Furthermore, this reverse genetics system is auseful tool for the identification of viral genes involved in patho-genesis and the associated signaling pathways. Drugs inhibitingthese pathways would be potential antivirals.
MATERIALS AND METHODSCells and viruses. Baby hamster kidney cells (BHK-21) were obtainedfrom American Type Culture Collection (ATCC CCL-10). Human liver-derived Huh-7 cells were kindly provided by R. Bartenschlager (Univer-sity of Heidelberg, Germany). African green monkey kidney-derived VeroA66 cells were kindly provided by A. Carvajal (University of Leon, Spain).
FIG 5 Rescue of rMERS-CoV-�E in cells expressing E protein in trans. (A)Virus rescue. After Huh-7 cells expressing (E�) or not expressing (E�) the Eprotein in trans were transfected with plasmids pBAC-MERS-�E and pBAC-MERSFL, cell culture supernatants were serially passaged 3 times on fresh E�
and E� cells every 72 h.p.i., and the virus titers of the rescued rMERS-CoV(WT) and rMERS-CoV-�E (�E) were determined by limiting dilution. Theblack dashed line represents the detection threshold of the virus titration assay(50 TCID50/ml). Error bars represent standard deviations of the means fromthree experiments. (B) Viral gRNA analysis. The levels of viral gRNA in E� andE� cells infected with either rMERS-CoV (WT) or rMERS-CoV-�E (�E) wereanalyzed at each passage. Total RNA was extracted and analyzed by RT-qPCR.gRNA levels were normalized by 18S rRNA levels. Error bars represent stan-dard deviations of the means from three experiments.
FIG 6 Analysis of replication and transcription levels in rMERS-CoV-�E-infected cells. Huh-7 cells were infected with rMERS-CoV-�E and rMERS-CoV at an MOI of 0.001 TCDI50/ml, and at 5 h.p.i., the levels of gRNA andsgmRNA N were evaluated by RT-qPCR. Both gRNA and sgmRNA N levelswere normalized by 18S rRNA levels. In addition, sgmRNA N levels were maderelative to gRNA levels. Error bars represent standard deviations of the meansfrom three experiments.
In all cases, cells were grown in Dulbecco’s modified Eagle’s medium(DMEM) supplemented with 25 mM HEPES, 1% nonessential aminoacids (Sigma), and 10% fetal bovine serum (FBS) (BioWhittaker). Virustitrations were performed on Vero A66 or Huh-7 cells following standardprocedures and using closed flasks or plates sealed in plastic bags. Forplaque assays, infected cells were overlaid with DMEM containing 0.6%low-melting agarose and 2% FBS, and at 72 h.p.i., cells were fixed with10% formaldehyde and stained with crystal violet. For 50% tissue cultureinfectious dose (TCID50) assays, CPE was recorded at 72 h.p.i. All workwith infectious virus was performed in biosafety level 3 facilities by per-sonnel wearing positive-pressure air-purifying respirators (high-efficiency particulate Air-Mate).
Plasmids and bacteria strains. Plasmid pBeloBAC11 (61), kindly pro-vided by H. Shizuya (California Institute of Technology, Pasadena, CA),was used to assemble the MERS-CoV infectious cDNA clone. This plas-mid is a low-copy-number plasmid (one to two copies per cell) based onthe E. coli F factor (62) that allows the stable maintenance of large DNAfragments in bacteria. E. coli DH10B (Gibco/BRL) cells were transformedby electroporation using a MicroPulser unit (Bio-Rad) according to themanufacturer’s instructions. BAC plasmid and recombinant BACs wereisolated and purified using a large-construct kit (Qiagen), following themanufacturer’s specifications.
Construction of a full-length cDNA clone of MERS-CoV. Based onthe data of the full-length sequence of the MERS-CoV-EMC12 strain(GenBank accession number JX869059) (15), a MERS-CoV infectiouscDNA clone was assembled in BAC using a three-step strategy. In the firststep, the restriction sites BamHI (genomic position 806), StuI (genomicpositions 7,620 and 9,072), SwaI (genomic position 20,898), and PacI(genomic position 25,836), present in the viral genome, were selected(Fig. 1A). Second, the intermediate plasmid pBAC-MERS-5=3= was con-structed as the backbone for assembly of the full-length cDNA clone(Fig. 1B). To generate this plasmid, two DNA fragments were generatedby chemical synthesis (Bio Basic, Inc.). The first fragment contained theCMV promoter fused to the first 811 nucleotides of the viral genomeflanked by SfoI and BamHI sites, and the other one contained a multi-cloning site with the restriction sites selected in the first step (BamHI, StuI,SwaI, and PacI) followed by the last 4,272 nucleotides of the viral genomejoined to a 25-nt poly(A), HDV ribozyme, and BGH termination andpolyadenylation sequences. The first DNA fragment was cloned intopBeloBAC11�StuI (a pBeloBAC without the StuI restriction site) and di-gested with SfoI and BamHI to generate the plasmid pBAC-MERS-5=, andthen the plasmid pBAC-MERS-5=3= was generated by cloning the secondDNA fragment, digested with BamHI and SfiI, into pBAC-MERS-5= di-gested with the same restriction enzymes. Finally, the third step was theassembly of the full-length cDNA clone (pBAC-MERSFL) by sequentialcloning of four overlapping DNA fragments (MERS-1 to MERS-4) intothe multicloning site of the intermediate plasmid pBAC-MERS-5=3=(Fig. 1C). The overlapping DNA fragments flanked by the appropriaterestriction sites were generated by chemical synthesis (Bio Basic, Inc.). Inthe case of fragment MERS-3, a silent mutation (T to C) was introduced atposition 20,761 in order to eliminate the SwaI restriction site at position20,760 and to use it as a genetic marker. The genetic integrity of the clonedDNAs was verified throughout the assembly process by extensive restric-tion analysis and sequencing.
Construction of MERS-CoV cDNA clones lacking accessory genes 3,4a, 4b, and 5. The deletion of gene 3 was generated by PCR-directedmutagenesis using the plasmid pUC-MERS-1 (a pUC plasmid containingthe MERS-1 fragment spanning nucleotides 20,898 to 25,836 of theMERS-CoV genome) as the template and the oligonucleotides MERS-S-Tth111I-VS (5= TGCTATTTGACAAAGTCACTATAGCTGATC 3=,where the restriction site Tth111I is underlined) and MERS-S-PacI-RS(5= CCCTTAATTAACTGAGTAACCAACGTCAAAAAGATTCACACTATTAGTGAACATGAACCTTATGCGGCTCGAGGTCGTATTCC 3=,where the restriction site PacI is underlined). The PCR product, includingthe deletion (from nucleotides 25,518 to 25,803), was digested with
Tth111I and PacI and cloned into the same sites of pUC-MERS-1, leadingto pUC-MERS-1-�3. To generate pBAC-MERS-�3, the SwaI-PacI diges-tion product from pUC-MERS-1-�3 was cloned into the same restrictionsites of pBAC-MERSFL (Fig. 3A).
The deletions of genes 4a, 4b, and 5 were introduced by PCR-directedmutagenesis, using as a template the plasmid pBAC-MERS-3= (a BACplasmid containing the MERS-3= fragment spanning nucleotides 25,836to 30,107 of the MERS-CoV genome). For deletion of genes 4a and 4b,overlapping PCR fragments were amplified using oligonucleotidesdel4ab-VS (5= GAACTCTATGGATTACGGTTGTCTCCATACGGTC3=) and del4ab-RS (5= GACCGTATGGAGACAACCGTAATCCATAGA
GTT 3=). The final PCR product was amplified with outer oligonucleo-tides T7 and SA27201RS (5= CAAACAGTGGAATGTAGG 3=), digestedwith PacI and NheI, and cloned into the same restriction sites of pBAC-MERS-3=, leading to pBAC-MERS-3=-�4ab that contains a deletion span-ning nucleotides 25,862 to 26,751 of the MERS-CoV genome. For gene 5deletion, a PCR fragment lacking gene 5 (nucleotides 26,835 to 27,513)was amplified using oligonucleotides SA25834VS (5= GTTAATTAACGAACTCTATGGATTACG 3=, where the restriction site PacI is underlined)and del5-SanDI-RS (5= CACGGGACCCATAGTAGCGCAGAGCTGCTGTTAAAATCCTGGATG 3=, where the restriction site SanDI is under-lined), digested with PacI and SanDI, and cloned in the same sites ofpBAC-MERS-3=, leading to pBAC-MERS-3=-�5. To generate plasmidspBAC-MERS-�4ab and pBAC-MERS-�5, the PacI-RsrII digestion prod-ucts from plasmids pBAC-MERS-3=-�4ab and pBAC-MERS-3=-�5 werecloned in the same sites of pBAC-MERSFL (Fig. 3A). All cloning steps werechecked by sequencing of the PCR fragments and cloning junctions.
Construction of a MERS-CoV cDNA clone lacking the structural Egene. The pBAC-MERS-�E, encoding a MERS-CoV lacking the E gene,was constructed from the full-length plasmid pBAC-MERSFL. To this end,the SanDI-RsrII DNA fragment (2,634 bp) from pBAC-MERSFL was ex-changed with a chemically synthesized (Bio Basic, Inc.) SanDI-RsrII DNAfragment with a deletion from nucleotides 27,580 to 27,786 that includedthe TRS core sequence and the first 197 nucleotides of the E gene (Fig. 4A).The genetic integrity of the cloned DNA was verified by restriction anal-ysis and sequencing.
Recovery of recombinant viruses from the cDNA clones. To recoverinfectious virus, BHK cells were grown to 95% confluence in a 12.5-cm2
flask and transfected with 6 �g of the infectious cDNA clone using 18 �gof Lipofectamine 2000 (Invitrogen) according to the manufacturer’s spec-ifications. At 6 h.p.t., cells were trypsinized, plated over a confluent mono-layer of either Vero A66 or Huh-7 cells grown in a 12.5-cm2 flask, andincubated at 37°C for 72 h. The cell supernatants were harvested andpassaged once on fresh cells, and the recovered viruses were cloned bythree rounds of plaque purification, following standard procedures.
Virus genome sequencing. The complete genome sequence of eachrescued recombinant MERS-CoV was determined by sequencing overlap-ping RT-PCR fragments of 2.5 kb covering the full-length viral genome.Reverse transcription and PCRs were performed with specific oligonucle-otides using ThermoScript reverse transcriptase (Invitrogen) and the Ex-pand high-fidelity PCR system (Roche), respectively, following the man-ufacturers’ recommendations. The genomic 5=- and 3=-terminalsequences were determined using the 5=/3= RACE (rapid amplification ofcDNA ends) kit (Roche) according to the manufacturer’s specifications.Sequence assembly and comparison with the consensus sequence of theMERS-CoV-EMC12 strain were performed with the SeqMan and MegA-lign programs (Lasergene, Madison, WI).
Generation of Huh-7 cells expressing MERS-CoV E protein. For thegeneration of Huh-7 cells transiently expressing E protein, cells werenucleofected with the plasmid pcDNA3-E (expressing the MERS-CoV Eprotein under the CMV promoter) by using a 4D Nucleofector device(Lonza) and the buffer and program recommended by the manufacturer.For the construction of plasmid pcDNA3-E, the E gene was amplified byPCR using pBAC-MERSFL as the template and the specific oligonucleo-tides E1-EcoRI-VS (5= GTGCTGGAATTCGCCGCCATGTTACCCTTT
GTCCAAGAACGAA 3=, restriction site EcoRI is underlined) and E249-XhoI-RS (5= CGCCCAGCTCGAGTTAAACCCACTCGTCAGGTGG 3=,restriction site XhoI is underlined) and cloned into the plasmid pcDNA3(Invitrogen) digested with EcoRI and XhoI.
Analysis of viral RNA synthesis by RT-qPCR. Total intracellular RNAwas extracted from transfected or infected cells with the RNeasy miniprepkit (Qiagen) according to the manufacturer’s specifications. In the case oftransfected cells, the residual DNA was removed from samples by treating7 �g of each RNA with 20 U of DNase I (Roche) in 100 �l for 30 min at37°C, and DNA-free RNAs were repurified using the RNeasy miniprep kit(Qiagen). Viral RNA synthesis was quantified by RT-qPCR. Total cDNAwas synthesized with random hexamers from 100 ng of total RNA using ahigh-capacity cDNA reverse transcription kit (Invitrogen). Using thiscDNA, the viral RNA synthesis was analyzed using two custom TaqManassays specific for MERS-CoV gRNA (forward primer 5= GCACATCTGTGGTTCTCCTCTCT 3=, reverse primer 5= AAGCCCAGGCCCTACTATTAGC 3=, and MGB probe 5= TGCTCCAACAGTTACAC 3=) andsgmRNA N (forward primer 5= CTTCCCCTCGTTCTCTTGCA 3=, re-verse primer 5= TCATTGTTATCGGCAAAGGAAA 3=, and MGB probe5= CTTTGATTTTAACGAATCTC 3=). Data were acquired with an Ap-plied Biosystems 7500 real-time PCR system and analyzed with ABIPRISM 7500 software, version 2.0.5. The relative quantifications wereperformed using the cycle threshold (2���CT) method (63). To normalizefor differences in RNA sampling, the expression of eukaryotic 18S rRNAwas analyzed using a specific TaqMan gene expression assay(Hs99999901_s1; Applied Biosystems).
Generation of polyclonal antisera specific for MERS-CoV N and Eproteins. Rabbit polyclonal antisera (pAb) specific for MERS-CoV N andE proteins were purchased from BioGenes. In brief, peptides NTGRS-VYVKFQDSKPPL (corresponding to E protein amino acids 60 to 76) andAAAKNKMRHKRTST (N protein amino acids 244 to 257) were synthe-sized and used to immunize two rabbits with each peptide according tothe company’s standard protocol. The polyclonal antisera obtained wereevaluated by enzyme-linked immunosorbent assay (ELISA) using the syn-thetic peptides, leading to titers ranging from 1:150,000 to 1:200,000 in allcases.
Indirect immunofluorescence assay. Vero A66 and Huh-7 cells weregrown to 80% confluence on glass coverslips and infected with the recom-binant MERS-CoVs. At 48 h.p.i., cells were fixed either with 4% parafor-maldehyde in phosphate-buffered saline (PBS) at room temperature for20 min or with methanol at �20°C for 15 min. For N protein immuno-detection, paraformaldehyde-fixed cells were permeabilized with 0.2%saponin in PBS containing 10% FBS for 20 min and incubated withMERS-CoV N protein pAb (dilution 1:200) in PBS containing 10% FBS atroom temperature for 90 min. For E protein immunodetection,methanol-fixed cells were incubated with MERS-CoV E protein pAb (di-lution 1:500) in PBS containing 10% FBS overnight at 4°C. Coverslipswere washed 4 times with PBS and incubated at room temperature for45 min with goat anti-rabbit antibody conjugated to Alexa Fluor 488(Invitrogen) diluted 1:500 in PBS containing 10% FBS. Nuclei werestained using DAPI (4=,6=-diamidino-2-phenylindole) (1:200, Sigma). Tofully inactivate the samples’ infectivity, methanol-fixed cells were treatedwith 4% paraformaldehyde in PBS as described above. Finally, coverslipswere mounted in ProLong Gold antifade reagent (Invitrogen) and ana-lyzed on a Leica SP5 confocal microscope. Images were acquired with thesame instrument settings and analyzed with Leica software.
ACKNOWLEDGMENTS
We thank N. M. Beach for critical reading of the manuscript. We alsothank Milagros Guerra for skillful technical assistance.
This work was supported by grants from the Ministry of Science andInnovation of Spain (MCINN) (BIO2010-16705), the European Commu-nity’s Seventh Framework Programme (FP7/2007-2013) under the proj-ect “EMPERIE” (HEALTH-F3-2009-223498), and the U.S. National In-stitutes of Health (NIH) (2P01AI060699-06A1). G.A. was supported bythe Amarouto Program for senior researchers from the Comunidad Au-
tónoma de Madrid. S.M.-J. received a predoctoral fellowship from theNational Institute of Health (ISCIII) of Spain. J.L.N.-T. and M.L.D. re-ceived contracts from the U.S. National Institutes of Health (NIH)(2P01AI060699-06A1) and the European Community (EMPERIE projectHEALTH-F3-2009-223498), respectively.
REFERENCES1. Danielsson N, Catchpole M, ECDC Internal Response Team. 2012.
Novel coronavirus associated with severe respiratory disease: case defini-tion and public health measures. Euro Surveill. 17:20282.
2. Zaki AM, van Boheemen S, Bestebroer TM, Osterhaus AD, FouchierRA. 2012. Isolation of a novel coronavirus from a man with pneumonia inSaudi Arabia. N. Engl. J. Med. 367:1814 –1820.
4. de Groot RJ, Baker SC, Baric RS, Brown CS, Drosten C, Enjuanes L,Fouchier RA, Galiano M, Gorbalenya AE, Memish ZA, Perlman S,Poon LL, Snijder EJ, Stephens GM, Woo PC, Zaki AM, Zambon M,Ziebuhr J. 2013. Middle East respiratory syndrome coronavirus (MERS-CoV): announcement of the Coronavirus Study Group. J. Virol. 87:7790 –7792.
5. Annan A, Baldwin HJ, Corman VM, Klose SM, Owusu M, NkrumahEE, Badu EK, Anti P, Agbenyega O, Meyer B, Oppong S, Sarkodie YA,Kalko EK, Lina PH, Godlevska EV, Reusken C, Seebens A, Gloza-Rausch F, Vallo P, Tschapka M, Drosten C, Drexler JF. 2013. Humanbetacoronavirus 2c EMC/2012-related viruses in bats, Ghana and Europe.Emerg. Infect. Dis. 19:456 – 459.
6. Cotten M, Lam TT, Watson SJ, Palser AL, Petrova V, Grant P, PybusOG, Rambaut A, Guan Y, Pillay D, Kellam P, Nastouli E. 2013.Full-genome deep sequencing and phylogenetic analysis of novel humanbetacoronavirus. Emerg. Infect. Dis. 19:736 –742.
7. Falcón A, Vázquez-Morón S, Casas I, Aznar C, Ruiz G, Pozo F,Perez-Breña P, Juste J, Ibáñez C, Garin I, Aihartza J, Echevarría JE.2011. Detection of alpha and betacoronaviruses in multiple Iberian batspecies. Arch. Virol. 156:1883–1890.
8. Munster VJ, de Wit E, Feldmann H. 2013. Pneumonia from humancoronavirus in a macaque model. N. Engl. J. Med. 368:1560 –1562.
9. Assiri A, McGeer A, Perl TM, Price CS, Al Rabeeah AA, Cummings DA,Alabdullatif ZN, Assad M, Almulhim A, Makhdoom H, Madani H,Alhakeem R, Al-Tawfiq JA, Cotten M, Watson SJ, Kellam P, Zumla AI,Memish ZA, KSA MERS-CoV Investigation Team. 2013. Hospital out-break of Middle East respiratory syndrome coronavirus. N. Engl. J. Med.369:407– 416.
10. HPA. 2013. Evidence of person-to-person transmission within a familycluster of novel coronavirus infections, United Kingdom, February 2013.Euro Surveill. 18:20427.
11. Mailles A, Blanckaert K, Chaud P, van der Werf S, Lina B, Caro V,Campese C, Guéry B, Prouvost H, Lemaire X, Paty MC, Haeghebaert S,Antoine D, Ettahar N, Noel H, Behillil S, Hendricx S, Manuguerra JC,Enouf V, La Ruche G, Semaille C, Coignard B, Lévy-Bruhl D, Weber F,Saura C, Che D, investigation team. 2013. First cases of Middle EastRespiratory Syndrome coronavirus (MERS-CoV) infections in France,investigations and implications for the prevention of human-to-humantransmission, France, May 2013. Euro Surveill. 18:20502.
12. Drosten C, Seilmaier M, Corman VM, Hartmann W, Scheible G, SackS, Guggemos W, Kallies R, Muth D, Junglen S, Muller MA, Haas W,Guberina H, Rohnisch T, Schmid-Wendtner M, Aldabbagh S, DittmerU, Gold H, Graf P, Bonin F, Rambaut A, Wendtner CM. 2013. Clinicalfeatures and virological analysis of a case of Middle East respiratory syn-drome coronavirus infection. Lancet Infect. Dis. 13:745–751.
13. Guery B, Poissy J, el Mansouf L, Séjourné C, Ettahar N, Lemaire X,Vuotto F, Goffard A, Behillil S, Enouf V, Caro V, Mailles A, Che D,Manuguerra JC, Mathieu D, Fontanet A, van der Werf S, MERS-CoVstudy group. 2013. Clinical features and viral diagnosis of two cases ofinfection with Middle East respiratory syndrome coronavirus: a report ofnosocomial transmission. Lancet 381:2265–2272.
14. de Wilde AH, Raj VS, Oudshoorn D, Bestebroer TM, van NieuwkoopS, Limpens RW, Posthuma CC, van der Meer Y, Bárcena M, HaagmansBL, Snijder EJ, van den Hoogen BG. 2013. MERS-coronavirus replica-tion induces severe in vitro cytopathology and is strongly inhibited bycyclosporin A or interferon-alpha treatment. J. Gen. Virol. 94:1749 –1760.
15. van Boheemen S, de Graaf M, Lauber C, Bestebroer TM, Raj VS, ZakiAM, Osterhaus AD, Haagmans BL, Gorbalenya AE, Snijder EJ,Fouchier RA. 2012. Genomic characterization of a newly discovered coro-navirus associated with acute respiratory distress syndrome in humans.mBio 3(6):e00473-12.
16. Raj VS, Mou H, Smits SL, Dekkers DH, Müller MA, Dijkman R, MuthD, Demmers JA, Zaki A, Fouchier RA, Thiel V, Drosten C, Rottier PJ,Osterhaus AD, Bosch BJ, Haagmans BL. 2013. Dipeptidyl peptidase 4 isa functional receptor for the emerging human coronavirus-EMC. Nature495:251–254.
17. Mou H, Raj VS, van Kuppeveld FJ, Rottier PJ, Haagmans BL, Bosch BJ.2013. The receptor binding domain of the new MERS coronavirus maps toa 231-residue region in the spike protein that efficiently elicits neutralizingantibodies. J. Virol. 87:9379 –9383.
18. Lu G, Hu Y, Wang Q, Qi J, Gao F, Li Y, Zhang Y, Zhang W, Yuan Y,Bao J, Zhang B, Shi Y, Yan J, Gao GF. 2013. Molecular basis of bindingbetween novel human coronavirus MERS-CoV and its receptor CD26.Nature 500:227–231.
19. Zielecki F, Weber M, Eickmann M, Spiegelberg L, Zaki AM, Matroso-vich M, Becker S, Weber F. 2013. Human cell tropism and innate im-mune system interactions of human respiratory coronavirus EMC com-pared to those of severe acute respiratory syndrome coronavirus. J. Virol.87:5300 –5304.
20. Chan RW, Chan MC, Agnihothram S, Chan LL, Kuok DI, Fong JH,Guan Y, Poon LL, Baric RS, Nicholls JM, Peiris JS. 2013. Tropism of andinnate immune responses to the novel human betacoronavirus lineage Cvirus in human ex vivo respiratory organ cultures. J. Virol. 87:6604 – 6614.
21. Corman VM, Eckerle I, Bleicker T, Zaki A, Landt O, Eschbach-BludauM, van Boheemen S, Gopal R, Ballhause M, Bestebroer TM, Muth D,Muller MA, Drexler JF, Zambon M, Osterhaus AD, Fouchier RM,Drosten C. 2012. Detection of a novel human coronavirus by real-timereverse-transcription polymerase chain reaction. Euro Surveill. 17:20285.
22. Falzarano D, de Wit E, Martellaro C, Callison J, Munster VJ, FeldmannH. 2013. Inhibition of novel beta coronavirus replication by a combina-tion of interferon-alpha2b and ribavirin. Sci. Rep. 3:1686. doi:10.1038/srep01686.
23. Lu L, Liu Q, Du L, Jiang S. 2013. Middle East respiratory syndromecoronavirus (MERS-CoV): challenges in identifying its source and con-trolling its spread. Microbes Infect. 15:625– 629.
24. Ortego J, Escors D, Laude H, Enjuanes L. 2002. Generation of areplication-competent, propagation-deficient virus vector based on thetransmissible gastroenteritis coronavirus genome. J. Virol. 76:11518 –11529.
25. DeDiego ML, Alvarez E, Almazán F, Rejas MT, Lamirande E, RobertsA, Shieh WJ, Zaki SR, Subbarao K, Enjuanes L. 2007. A severe acuterespiratory syndrome coronavirus that lacks the E gene is attenuated invitro and in vivo. J. Virol. 81:1701–1713.
26. DeDiego ML, Pewe L, Alvarez E, Rejas MT, Perlman S, Enjuanes L.2008. Pathogenicity of severe acute respiratory coronavirus deletion mu-tants in hACE-2 transgenic mice. Virology 376:379 –389.
27. Almazán F, DeDiego ML, Galán C, Escors D, Alvarez E, Ortego J, SolaI, Zuñiga S, Alonso S, Moreno JL, Nogales A, Capiscol C, Enjuanes L.2006. Construction of a SARS-CoV infectious cDNA clone and a repliconto study coronavirus RNA synthesis. J. Virol. 80:10900 –10906.
28. Almazán F, González JM, Pénzes Z, Izeta A, Calvo E, Plana-Durán J,Enjuanes L. 2000. Engineering the largest RNA virus genome as an infec-tious bacterial artificial chromosome. Proc. Natl. Acad. Sci. U. S. A. 97:5516 –5521.
29. Bálint A, Farsang A, Zádori Z, Hornyák A, Dencso L, Almazán F,Enjuanes L, Belák S. 2012. Molecular characterization of feline infectiousperitonitis virus Strain DF-2 and studies of the role of ORF3abc in viral celltropism. J. Virol. 86:6258 – 6267.
30. St-Jean JR, Desforges M, Almazán F, Jacomy H, Enjuanes L, Talbot PJ.2006. Recovery of a neurovirulent human coronavirus OC43 from aninfectious cDNA clone. J. Virol. 80:3670 –3674.
31. Kuo L, Masters PS. 2003. The small envelope protein E is not essential formurine coronavirus replication. J. Virol. 77:4597– 4608.
32. Ortego J, Ceriani JE, Patiño C, Plana J, Enjuanes L. 2007. Absence of Eprotein arrests transmissible gastroenteritis coronavirus maturation in thesecretory pathway. Virology 368:296 –308.
33. Becker MM, Graham RL, Donaldson EF, Rockx B, Sims AC, Sheahan T,Pickles RJ, Corti D, Johnston RE, Baric RS, Denison MR. 2008. Syn-
thetic recombinant bat SARS-like coronavirus is infectious in culturedcells and in mice. Proc. Natl. Acad. Sci. U. S. A. 105:19944 –19949.
34. Almazán F, Galán C, Enjuanes L. 2004. The nucleoprotein is required forefficient coronavirus genome replication. J. Virol. 78:12683–12688.
35. Woo PC, Wang M, Lau SK, Xu H, Poon RW, Guo R, Wong BH, GaoK, Tsoi HW, Huang Y, Li KS, Lam CS, Chan KH, Zheng BJ, Yuen KY.2007. Comparative analysis of twelve genomes of three novel group 2c andgroup 2d coronaviruses reveals unique group and subgroup features. J.Virol. 81:1574 –1585.
36. Cruz JL, Sola I, Becares M, Alberca B, Plana J, Enjuanes L, Zuñiga S.2011. Coronavirus gene 7 counteracts host defenses and modulates virusvirulence. PLoS Pathog. 7:e1002090.
37. de Haan CA, Masters PS, Shen S, Weiss S, Rottier PJ. 2002. Thegroup-specific murine coronavirus genes are not essential, but their dele-tion, by reverse genetics, is attenuating in the natural host. Virology 296:177–189.
38. Sola I, Alonso S, Zúñiga S, Balasch M, Plana-Durán J, Enjuanes L. 2003.Engineering the transmissible gastroenteritis virus genome as an expres-sion vector inducing lactogenic immunity. J. Virol. 77:4357– 4369.
39. Yount B, Roberts RS, Sims AC, Deming D, Frieman MB, Sparks J,Denison MR, Davis N, Baric RS. 2005. Severe acute respiratory syn-drome coronavirus group-specific open reading frames encode nonessen-tial functions for replication in cell cultures and mice. J. Virol. 79:14909 –14922.
40. Perlman S, Netland J. 2009. Coronaviruses post-SARS: update on repli-cation and pathogenesis. Nat. Rev. Microbiol. 7:439 – 450.
41. Koetzner CA, Kuo L, Goebel SJ, Dean AB, Parker MM, Masters PS.2010. Accessory protein 5a is a major antagonist of the antiviral action ofinterferon against murine coronavirus. J. Virol. 84:8262– 8274.
42. Kopecky-Bromberg SA, Martínez-Sobrido L, Frieman M, Baric RA,Palese P. 2007. Severe acute respiratory syndrome coronavirus open read-ing frame (ORF) 3b, ORF 6, and nucleocapsid proteins function as inter-feron antagonists. J. Virol. 81:548 –557.
43. Zhao L, Rose KM, Elliott R, Van Rooijen N, Weiss SR. 2011. Celltype-specific type I interferon antagonism influences organ tropism ofmurine coronavirus. J. Virol. 85:10058 –10068.
44. Cruz JL, Becares M, Sola I, Oliveros JC, Enjuanes L, Zúñiga S. 2013.Alphacoronavirus protein 7 modulates host innate immune response. J.Virol. 87:9754 –9767.
45. Ortego J, Sola I, Almazán F, Ceriani JE, Riquelme C, Balasch M, PlanaJ, Enjuanes L. 2003. Transmissible gastroenteritis coronavirus gene 7 isnot essential but influences in vivo virus replication and virulence. Virol-ogy 308:13–22.
46. An S, Chen CJ, Yu X, Leibowitz JL, Makino S. 1999. Induction ofapoptosis in murine coronavirus-infected cultured cells and demonstra-tion of E protein as an apoptosis inducer. J. Virol. 73:7853–7859.
47. Lokugamage KG, Yoshikawa-Iwata N, Ito N, Watts DM, Wyde PR,Wang N, Newman P, Tseng K, Peters CJ, Makino S. 2008. Chimericcoronavirus-like particles carrying severe acute respiratory syndromecoronavirus (SCoV) S protein protect mice against challenge with SCoV.Vaccine 26:797– 808.
48. Lu X, Chen Y, Bai B, Hu H, Tao L, Yang J, Chen J, Chen Z, Hu Z, WangH. 2007. Immune responses against severe acute respiratory syndromecoronavirus induced by virus-like particles in mice. Immunology 122:496 –502.
49. See RH, Zakhartchouk AN, Petric M, Lawrence DJ, Mok CP, Hogan RJ,Rowe T, Zitzow LA, Karunakaran KP, Hitt MM, Graham FL, Prevec L,Mahony JB, Sharon C, Auperin TC, Rini JM, Tingle AJ, Scheifele DW,Skowronski DM, Patrick DM, Voss TG, Babiuk LA, Gauldie J, RoperRL, Brunham RC, Finlay BB. 2006. Comparative evaluation of two severeacute respiratory syndrome (SARS) vaccine candidates in mice challengedwith SARS coronavirus. J. Gen. Virol. 87:641– 650.
50. Spruth M, Kistner O, Savidis-Dacho H, Hitter E, Crowe B, Gerencer M,Brühl P, Grillberger L, Reiter M, Tauer C, Mundt W, Barrett PN. 2006.A double-inactivated whole virus candidate SARS coronavirus vaccinestimulates neutralising and protective antibody responses. Vaccine 24:652– 661.
51. Qin E, Shi H, Tang L, Wang C, Chang G, Ding Z, Zhao K, Wang J,Chen Z, Yu M, Si B, Liu J, Wu D, Cheng X, Yang B, Peng W, Meng Q,Liu B, Han W, Yin X, Duan H, Zhan D, Tian L, Li S, Wu J, Tan G, LiY, Liu H, Lv F, Zhang Y, Kong X, Fan B, Jiang T, Xu S, Wang X, Li C,Wu X, Deng Y, Zhao M, Zhu Q, Zhu Q. 2006. Immunogenicity and
protective efficacy in monkeys of purified inactivated Vero-cell SARS vac-cine. Vaccine 24:1028 –1034.
52. Zhou J, Wang W, Zhong Q, Hou W, Yang Z, Xiao SY, Zhu R, Tang Z,Wang Y, Xian Q, Tang H, Wen L. 2005. Immunogenicity, safety, andprotective efficacy of an inactivated SARS-associated coronavirus vaccinein rhesus monkeys. Vaccine 23:3202–3209.
53. Lamirande EW, DeDiego ML, Roberts A, Jackson JP, Alvarez E,Sheahan T, Shieh WJ, Zaki SR, Baric R, Enjuanes L, Subbarao K. 2008.A live attenuated SARS coronavirus is immunogenic and efficacious ingolden Syrian hamsters. J. Virol. 82:7721–7724.
54. Netland J, DeDiego ML, Zhao J, Fett C, Alvarez E, Nieto-Torres JL,Enjuanes L, Perlman S. 2010. Immunization with an attenuated severeacute respiratory syndrome coronavirus deleted in E protein protectsagainst lethal respiratory disease. Virology 399:120 –128.
55. Fett C, DeDiego ML, Regla-Nava JA, Enjuanes L, Perlman S. 2013.Complete protection against severe acute respiratory syndromecoronavirus-mediated lethal respiratory disease in aged mice by immuni-zation with a mouse-adapted virus lacking E protein. J. Virol. 87:6551– 6559.
56. Narayanan K, Huang C, Lokugamage K, Kamitani W, Ikegami T, TsengCT, Makino S. 2008. Severe acute respiratory syndrome coronavirus nsp1suppresses host gene expression, including that of type I interferon, ininfected cells. J. Virol. 82:4471– 4479.
57. Wathelet MG, Orr M, Frieman MB, Baric RS. 2007. Severe acute respi-ratory syndrome coronavirus evades antiviral signaling: role of nsp1 andrational design of an attenuated strain. J. Virol. 81:11620 –11633.
58. Graham RL, Becker MM, Eckerle LD, Bolles M, Denison MR, Baric RS.2012. A live, impaired-fidelity coronavirus vaccine protects in an aged,immunocompromised mouse model of lethal disease. Nat. Med. 18:1820 –1826.
59. de Haan CA, Volders H, Koetzner CA, Masters PS, Rottier PJ. 2002.Coronaviruses maintain viability despite dramatic rearrangements of thestrictly conserved genome organization. J. Virol. 76:12491–12502.
60. Enjuanes L, DeDiego ML, Alvarez E, Deming D, Sheahan T, Baric R.2008. Vaccines to prevent severe acute respiratory syndrome coronavirus-induced disease. Virus Res. 133:45– 62.
61. Wang K, Boysen C, Shizuya H, Simon MI, Hood L. 1997. Completenucleotide sequence of two generations of a bacterial artificial chromo-some cloning vector. Biotechniques 23:992–994.
62. Shizuya H, Birren B, Kim UJ, Mancino V, Slepak T, Tachiiri Y, SimonM. 1992. Cloning and stable maintenance of 300-kilobase-pair fragmentsof human DNA in Escherichia coli using an F-factor-based vector. Proc.Natl. Acad. Sci. U. S. A. 89:8794 – 8797.
63. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression datausing real-time quantitative PCR and the 2(-Delta Delta C(T)) method.Methods 25:402– 408.
