2017 Baseball Fact Book - History - Amazon S3€¦ · For graphics or abbrevia ons, we ask that you...

2017 FRESNO STATE BASEBALL FACT BOOK

1 2008 NATIONAL CHAMPIONS • 4 COLLEGE WORLDS SERIES APPEARANCES • 34 NCAA BERTHS

AuAuAuAuAuAuAuAuAuAuststststststststststinininininininin G G G G G Guiuiuiuiuiuiuiuiuiuiuiboboboboboboboboboboboboborrrrrrr

SeSeSeSeSeSeSeninininininiororororororor - - - - - - - O O O O O O O OututututututututututfiefiefiefiefiefiefiefiefiefiefiefiefieldldldldldldldldldldMaMaMaMaMajojojojojojojojor:r:r:r:r: K K K Kinininininesesesesesesesesesesesioioioioioiolololololololololololologygygygygygygygygygygygy-S-S-S-S-S-S-S-S-S-Spopopopopopopopopopopopoportrtrtrtrtrtrtrt A A A A A Admdmdmdministration

JeJeJeJeJeJeJeJeJeJeJeJeJeJeJesssssssssssssssssssssssssssssse e e e e e e e e e MeMeMeMeMeMeMeMeMeMeMeMeMeMeMedrdrdrdrdrdrdrdrdrdrdrdrdrdranananananananananananananananananananananoooooooooooo

SeSeSeSeSeSeSeSenininininininiororororororor - - - - - I I I I I InfinfinfinfinfinfinfinfinfieleleldddddddMaMaMaMaMaMajojojojojojojor:r:r:r: C C C C C Comomomomommumumumumumumumuninininininininicacacacacacacacacacacacatitititititititititititititiononononononononononononononssssssssssss





TABLE OF CONTENTSIntro ........................................................................32017 Quick Facts .....................................................42017 Schedule ..........................................................52017 Roster ..............................................................6

2017 Bulldogs .........................................................7Returning Players ...............................................7-17Newcomers .......................................................18-19

Coaches & Sta! .....................................................20Head Coach Mike Batesole .................................... 20Assistant Coach Steve Rousey ................................ 21Assistant Coach Ryan Overland ............................. 21Support Sta! .......................................................... 22

2016 Review .......................................................... 232016 Overall Statistics ................................................. 232016 Mountain West Statistics ................................... 242016 Results .................................................................. 25

History .................................................................. 26Year-by-Year Team Record/Championships ............ 26All-Time Series Records ............................................. 27Year-by-Year Results...............................................28-43

History .................................................................. 44Game-by-Game Postseason History ....................44-45All-Time Record vs. Opp. in Postseason ..................46Bulldogs in the College World Series Record Book .........47-48Fresno State National TV Appearances ....................48

Bulldogs in the Pros ............................................. 49Bulldogs in the MLB Dra" ................................... 50-52

Records ................................................................. 53Team Records Summary ............................................. 53Individual Records Summary .................................... 54Top 10 Career Hitting Leaders................................... 55Top 10 Career Pitching Leaders ................................. 56Top 10 Single-Season Hitting Leaders ...................... 57Top 10 Single-Season Pitching Leaders .................... 58Yearly Statistical Leaders ...................................... 59-60Bulldogs in the NCAA Records Books ............... 61-62All-American Selections ............................................. 63Other National Honors ............................................... 64Conference Honors ............................................... 65-67All-Time Letterwinners ........................................ 68-72Bulldog Hall of Fame .................................................. 73Fresno State Legacy: Bob Bennett ............................. 74

Credits# e 2017 Fresno State baseball media supplement is a product of the Fresno State Athletic Communications o$ ce. Written, edited and designed by Travis Blanshan and Matt Burkholder. Cover by.

Photos by Cary Edmondson and Keith Kountz.

FRESNO STATE IDENTIFICATION

For athle� cs department purposes, the University prefers to be called simple FRESNO STATE - never

Fresno State University and never shorten to Fresno.

For graphics or abbrevia� ons, we ask that you pleas use FS - not FRES, FSU, CSUF or Fresno. Another

acceptable abbrevia� ons is Fresno St.

The University’s formal name is California State University, Fresno. Fresno State is the preferred

reference, less formal name for the university. It is acceptable as a fi rst text reference, as well as

subsequent references.

“V” IS FOR VALLEYFresno State prides itself on being the “Valley’s team.” This pride can be seen in the form of a green

V on the Bulldogs’ uniforms, as a symbol to the agricultural community of Central Valley of California.

The San Joaquin Valley is the world’s richest agricultural valley in export dollars.

Paul Loe% er

BULLDOG SPORTS NETWORK

940 AM ESPN Radio is the home of the Bulldog Sports Network. Fresno State baseball games are broadcast live on ESPN’s 50,000-watt signal, allowing fans all over the Valley to listen to Fresno State baseball games.

Paul Loe% er is the Voice of Bulldog baseball, football and men’s basketball. Former Bulldogs Bryan Marsoobian and Steve Hosey will be joining Loe% er in the booth as analysts for select home games.

Station Frequency LanguageKFIG-ESPN 940 AM EnglishKFPT-ESPN 790 AM English“# e Deuce”



Fresno State Baseball

2017 Quick Facts

GENERAL INFORMATION Name of School .................................................................Fresno State

Loca� on .................................................................... Fresno, CA 93740

Founded ....................................................................................... 1911

Enrollment ................................................................................. 24,136

Nickname ................................................................................Bulldogs

School Colors ................................................................... Red and Blue

Home Field (Capacity) .... Pete Beiden Field at Bob Benne� Stadium (3,575)

Surface/Dimensions L-R .......................... Grass/330-370-400-370-330

Affi lia� on ......................................................................NCAA Division I

Conference ..................................................... Mountain West (5th Yr.)

President ................................................................ Dr. Joseph I. Castro

Director of Athle� cs .............................................................Jim Bartko

Athle� c Dept. Phone ......................................................559-278-2643

Ticket Offi ce Phone .........................................................559-278-3647

Baseball Offi ce ................................................................559-278-2178

TEAM HISTORY First Season of Baseball ................................................................ 1922

All-Time Record .....................................................2,530-1512-4 (.626)

Highest Ranking .................................................... No. 1 (4x, last 2008)

NCAA Titles .............................................................................. 1 (2008)

NCAA College World Series Appearances (last) ....................... 4 (2008)

NCAA Tournament Appearances (last) .................................. 34 (2012)

NCAA Tournament Record .................................................67-74 (.475)

NCAA Regional Record.......................................................58-66 (.478)

Conference Championships .............................................................. 34

Last Conference Championship .......................................... 2016 (MW)

COACHING STAFF Head Coach .......Mike Batesole (Cal State Fullerton, ‘90), 15th Season

Record at Fresno State ............................................478-376 (14 years)

Career Record ...................................................... 734-534-1 (21 years)

NCAA Tournament Record (App.) ...........................................17-20 (8)

Conference Championships .............................................................. 10

Na� onal Championships ......................................................... 1 (2008)

Na� onal Coach of the Year .................................................. 2 (‘98, ‘08)

Assistant Coaches ..... Steve Rousey (Cal State Fullerton, ‘88), 7th Season

............................................Ryan Overland (Fresno State, ‘08), 5th Season

Volunteer Assistant Coach ............................... JJ Mascolo, 2nd Season

Undergraduate Assistant Coach ................ Kody Batesole, 2nd Season

Director of Opera� ons ........................................ Tim Borst, 1st Season

Athle� c Trainer ............................................................ TBA, 1st Season

ATHLETIC COMMUNICATIONS Primary Baseball Contact .............................................Travis Blanshan

E-mail .......................................................... [email protected]

Offi ce ..............................................................................559-278-4647

Cell ..................................................................................559-575-1399

Fax ..................................................................................559-278-4689

Press Box Phone .............................................................559-278-5951

Offi ce Address ........................................5305 N. Campus Drive NG 27

.................................................................................. Fresno, CA 93740

Website ..............................................................www.gobulldogs.com

Facebook/Instagram/Youtube ..............................FresnoStateAthle� cs

Twi� er ......................................................................@FresnoStateBSB

TEAM INFORMATION 2016 Overall Record .................................................................... 36-22

Home/Away/Neutral (Overall)......................................26-7/10-13/0-2

2016 Conference Record/Finish ..............................................21-9/1st

Home/Away (Conf.) ................................................................ 12-3/9-6

2016 Conference Tournament ......................................................... 0-2

2016 Postseason ............................................................Did not qualify

2016 Final Ranking ...........................................................................NR

Starters Returning ..............................Posi� on Players - 7 , Pitchers - 2

Starters Lost .........................................Posi� on Players - 1, Pitchers - 1

Number of Newcomers .................................................................... 11

RETURNING STARTING POSITION PLAYERS Name ............... Yr. ..........Pos. ................Avg ... HR ..................... RBI

Aaron Arruda ......Jr. .......... INF ............. .. ..320 ....11 ........................ 44

Korby Batesole ....Jr. .......... INF .............. .. .243 ......0 ........................ 15

Aus� n Guibor .... Sr. ...........OF .............. .. .293 ......7 ........................ 36

Jesse Medrano... Sr. .......... INF .............. .. .326 ......0 ........................ 26

Sco� Silva .......... Sr. .......... INF .............. .. .357 ......4 ........................ 23

Jake Stone .......... Sr. ...........OF .............. .. .312 ......3 ........................ 35

Nick Warren ....... Jr. ............ C ................ .. .229 ......0 ........................ 11

TOP RETURNING PITCHERS Name .................. Yr. ........L/R .......... W-L-SV ....ERA .......IP ......... SO

Edgar Gonzalez .... So. .......... R .............2-3-0 .......3.97 .... 56.2 ..........47

Mark Reece...........Sr. ........... R .............1-3-1 .......2.96 .... 24.1 ..........16

Rickey Ramirez ...... Jr. ........... R .............4-1-4 .......4.54 .... 39.2 ..........42

Ricky Tyler Thomas... Jr. ............L .............9-4-0 .......2.16 .... 104.0 ......108

Kenny Varnell ....... So. ...........L .............1-1-0 .......8.24 .... 19.2 ..........12

NEWCOMERS Name ................Yr. .......... Pos..................................Previous School

Jared Akins .........Jr. .......... OF ............................................Glendale JC

JT Arruda ........... Fr. .......... INF ......................................... Buchanan HS

Carter Bins ......... Fr. ..........C ........................................... Rodriguez HS

Joel Bustos ......... Fr. ..........RHP ........................................ Sunnyside HS

Oscar Carvajal .... Fr. ..........RHP ................................................ Gahr HS

Isaiah Davis ........ Fr. ..........RHP/OF ........................................ Carter HS

Ryan Jensen ....... Fr. ..........RHP ............................................. Salinas HS

Tiegen Jones ...... Fr. ..........LHP ..............................Capitol Chris� an HS

Adam Medrano . Fr. ..........RHP .....................................Charter Oak HS

Davis Moore ...... Fr. ..........RHP/OF .................................... Los Osos HS

JJ Santa Cruz .......Jr. ..........LHP .............................. Fresno City Colllege

KEY LOSSES Name ....................... Pos. ............................................. Reason Le!

Jimmy Lambert ...........RHP . Jr. - MLB Dra! (5th Rd., Chicago White Sox)

Dylan Lee ....................LHP .... Sr. - MLB Dra! (10th Rd., Miami Marlins)

Brody Russell ..............OF .............................................. Sr. - Gradua� on

Tim Borst ....................RHP ............................................ Sr. - Gradua� on

Kevin Viers ..................INF ............................................. Sr. - Gradua� on

Brennon Williams .......LHP ............................................ Sr. - Gradua� on



2017 SEASON SCHEDULEFEBRUARYDay Date Opponent Location Time (PT) Friday Feb. 17 Oregon Bob Bennett Stadium 6:05 P.M.Saturday Feb. 18 Oregon Bob Bennett Stadium 6:05 P.M.Sunday Feb. 19 Oregon Bob Bennett Stadium 1:05 P.M.Monday Feb. 20 Oregon Bob Bennett Stadium 6:05 P.M.Friday Feb. 24 UC Riverside Bob Bennett Stadium 6:05 P.M.Saturday Feb. 25 UC Riverside Bob Bennett Stadium 2:05 P.M.Sunday Feb. 26 UC Riverside Bob Bennett Stadium 1:05 P.M.Tuesday Feb. 28 Pacifi c Bob Bennett Stadium 6:05 P.M.

MARCHDay Date Opponent Location Time (PT) Friday March 3 Nevada* Bob Bennett Stadium 6:05 P.M.Saturday March 4 Nevada* Bob Bennett Stadium 6:05 P.M.Sunday March 5 Nevada* Bob Bennett Stadium 1:05 P.M.Tuesday March 7 @ Pepperdine Malibu, Calif. 2 P.M.Friday March 10 Eastern Michigan Bob Bennett Stadium 6:05 P.M.Saturday March 11 Eastern Michigan Bob Bennett Stadium 6:05 P.M.Sunday March 12 Eastern Michigan Bob Bennett Stadium 1:05 P.M.Wednesday March 15 @ San Francisco San Francisco, Calif. 3 P.M.Friday March 17 @ Air Force* USAFA, Colo. 2 P.M.Saturday March 18 @ Air Force* USAFA, Colo. 12 P.M.Sunday March 19 @ Air Force* USAFA, Colo. 12 P.M.Wednesday March 22 Pepperdine Bob Bennett Stadium 6:05 P.M.Friday March 24 San Diego State* Bob Bennett Stadium 6:05 P.M.Saturday March 25 San Diego State* Bob Bennett Stadium 6:05 P.M.Sunday March 26 San Diego State* Bob Bennett Stadium 1:05 P.M.Tuesday March 28 Cal Poly Bob Bennett Stadium 6:05 P.M.Friday March 31 @ New Mexico* Albuquerque, N.M. 5:30 P.M.

APRILDay Date Opponent Location Time (PT) Saturday April 1 @ New Mexico* Albuquerque, N.M. 1 P.M.Sunday April 2 @ New Mexico* Albuquerque, N.M. 12 P.M.Wednesday April 5 @ Sacramento State Sacramento, Calif. 6 P.M.Friday April 7 @ Michigan State East Lansing, Mich. 12 P.M.Saturday April 8 @ Michigan State East Lansing, Mich. 10 A.M.Sunday April 9 @ Michigan State East Lansing, Mich. 10 A.M.Tuesday April 11 San Francisco Bob Bennett Stadium 6:05 P.M.Thursday April 13 Air Force* Bob Bennett Stadium 6:05 P.M.Friday April 14 Air Force* Bob Bennett Stadium 6:05 P.M.Saturday April 15 Air Force* Bob Bennett Stadium 2:05 P.M.Wednesday April 19 @ Pacifi c Stockton, Calif. 6 P.M.Friday April 21 @ Nevada* Reno, Nev. 6 P.M.Saturday April 22 @ Nevada* Reno, Nev. 6 P.M.Sunday April 23 @ Nevada* Reno, Nev. 1 P.M.Tuesday April 25 @ Cal Poly San Luis Obispo, Calif. 6 P.M.Friday April 28 San Jose State* Bob Bennett Stadium 6:05 P.M.Saturday April 29 San Jose State* Bob Bennett Stadium 6:05 P.M.Sunday April 30 San Jose State* Bob Bennett Stadium 1:05 P.M.

MAYDay Date Opponent Location Time (PT) Wednesday May 3 @ UC Riverside Riverside, Calif. 3 P.M.Friday May 5 @ UNLV* Las Vegas, Nev. 6:05 P.M.Saturday May 6 @ UNLV* Las Vegas, Nev. 2:05 P.M.Sunday May 7 @ UNLV* Las Vegas, Nev. 1:05 P.M.Tuesday May 9 Sacramento State Bob Bennett Stadium 6:05 P.M.Friday May 12 New Mexico* Bob Bennett Stadium 6:05 P.M.Saturday May 13 New Mexico* Bob Bennett Stadium 6:05 P.M.Sunday May 14 New Mexico* Bob Bennett Stadium 1:05 P.M.Thursday May 18 @ San Diego State* San Diego, Calif. 6 P.M.Friday May 19 @ San Diego State* San Diego, Calif. 6 P.M.Saturday May 20 @ San Diego State* San Diego, Calif. 1 P.M.Monday May 22 Gonzaga Bob Bennett Stadium 6:05 P.M.Wed.-Sun. May 24-28 Mountain West Championships TBD

Bold Games in Home (Fresno, Calif.) * Mountain West Game



2017 NUMERICAL ROSTERNo. Name Pos. B/T Ht. Wt. Yr. Hometown (Previous School)

4 Korby Batesole INF L/R 6-1 180 Jr. Clovis, Calif. (Buchanan HS)

5 Jeremiah Burks INF R/R 6-2 200 So. Vacaville, Calif. (William C. Wood HS)

6 Sco� Silva INF R/R 5-10 180 Sr. Clovis, Calif. (Fresno City College)

7 Ricky Tyler Thomas LHP L/L 6-1 185 Jr. San Diego, Calif. (Mira Mesa HS)

10 Nick Warren C R/R 6-2 200 Jr. Saugus, Calif. (Saugus HS)

11 Ryan Dobson OF R/R 6-0 170 Sr. Culver City, Calif. (Junipero Serra HS)

12 Torin Goldstein C L/R 6-3 205 Jr. Irvine, Calif. (Arnold O. Beckman HS)

14 McCarthy Tatum INF R/R 6-4 200 Jr. Clovis, Calif. (Clovis HS)

15 JT Arruda INF L/R 5-11 185 Fr. Clovis, Calif. (Buchanan HS)

16 Jesse Medrano INF R/R 5-10 200 Sr. Concord, Calif. (Clayton Valley Charter HS)

19 Ross Dodds C R/R 6-1 210 So. Clovis, Calif. (Buchanan HS)

20 Ryan Sullivan RHP R/R 6-4 230 So. El Dorado Hills, Calif. (Oak Ridge HS)

21 Aus� n White OF R/R 6-2 190 RFr. Studio City, Calif. (Grover Cleveland HS)

25 Joe Prior C R/R 6-0 190 Sr. Los Alamitos, Calif. (Servite HS)

27 Aaron Arruda INF R/R 6-3 220 Jr. Fresno, Calif. (Buchanan HS)

29 Carter Bins C R/R 6-0 180 Fr. Fairfi eld, Calif. (Rodriguez HS)

30 Rickey Ramirez RHP R/R 6-0 180 Jr. Marysville, Calif. (River Valley HS)

31 Dominic Topoozian RHP R/R 6-0 195 RSr. Clovis, Calif. (Fresno City College)

32 Zach Ashford OF L/R 5-10 180 So. Clovis, Calif. (Buchanan HS)

33 Aus� n Guibor OF L/R 5-10 185 Sr. Campbell, Calif. (St. Francis HS)

35 Oscar Carvajal RHP R/R 6-2 180 Fr. Cerritos, Calif. (Gahr HS)

36 Adam Medrano RHP R/R 6-3 220 Fr. Covina, Calif. (Charter Oak HS)

37 Ryan Jensen RHP R/R 6-0 180 Fr. Salinas, Calif. (Salinas Union HS)

38 Mark Reece RHP R/R 6-5 220 Sr. Roseville, Calif. (Nevada/Roseville HS)

39 Edgar Gonzalez RHP R/R 6-1 200 So. Newark, Calif. (Newark Memorial HS)

40 Jared Akins OF L/R 6-3 195 Jr. Glendale, Calif. (Glendale JC)

42 Fred Schlichtholz LHP L/L 6-3 220 Jr. Coronado, Calif. (Coronado HS)

43 Isaiah Davis RHP R/R 6-2 190 Fr. Rialto, Calif. (Carter HS)

45 Kenny Varnell LHP L/L 6-3 210 So. Moorpark, Calif. (Moorpark HS)

48 Tiegen Jones LHP L/L 6-4 190 Fr. Sacramento, Calif. (Capitol Chris� an HS)

49 JJ Santa Cruz LHP L/L 6-7 220 RJr. Fresno, Calif. (Fresno City College)

51 Jake Stone OF L/R 6-0 200 Sr. Carlsbad, Calif. (Rancho Buena Vista HS)

55 Joel Bustos RHP R/R 6-1 190 Fr. Fresno, Calif. (Sunnyside HS)

56 Davis Moore RHP R/R 6-4 200 Fr. Rancho Cucamonga, Calif. (Los Osos HS)

COACHING STAFF

44 Mike Batesole – Head Coach (15th Season)

34 Steve Rousey – Assistant Coach & Pitching Coach (7th Season)

24 Ryan Overland – Assistant Coach & Third Base Coach (5th Season)

46 JJ Mascolo – Volunteer Assistant Coach (2nd Season)

9 Kody Batesole – Undergraduate Assistant Coach & First Base Coach (2nd Season)



KORBY BATESOLE INF | L/R | 6-1 | 180 | Jr. | 3rd YearClovis, Calif. (Buchanan HS)

CAREER GAMES: 100 CAREER STARTS: 842016 STARTS: 51

2016 �SOPHOMORE�: Batesole appeared in 56 of the ‘Dogs 58 games as a sophomore...

started 51 contests with 46 coming at shortstop and fi ve at second base... hit .243 from the

plate fi nishing the season with 43 hits (one double), 13 runs scored and 15 RBIs... had a .249

slugging percentage, .308 on-base percentage and a .955 fi elding percentage... had 12 mul� -

hit games including a three-hit performance and scored a run in the ‘Dogs 14-1 win over Air

Force on Apr. 1... had a season-long eight game hi� ng streak from Apr. 16- Apr. 30... named

Academic All-MW for second � me... Mountain West Scholar-Athlete.

2015 �FRESHMAN�: Appeared in 44 games for the Bulldogs ... made 33 starts on the year with

18 coming at shortstop and 15 at second base ... hit .232 from the plate collec� ng 22 hits in

95 at-bats... drove in 13 RBI and scored seven runs ... notched four doubles and a home run...

recorded four mul� -hit games ... went 2-for-2 with his fi rst career home run in a 5-4, 10-inning

win over San Diego State on April 24 ... also collected two hits, including a RBI-single, the fol-

lowing day against the Aztecs ... named Academic All-MW.

HIGH SCHOOL: A three-year le! erman at Buchanan High School under head coach Tom Don-

ald ... helped lead the Bears to a 25-8 record playing shortstop and second base - was the

runner-up in the 2014 CIF Central Sec� on Baseball Playoff s ... Buchanan was a top 25 ranked

team in the state all year as Batesole started each game.

PERSONAL: Son of head coach Mike Batesole, and Susie Batsole ... has three siblings - Kody,

Kassy and Kally ... also enjoys golf, basketball and football ... favorite athlete is Allen Iverson

because of his charisma ... favorite baseball moment in high school was his walk-off hit in the

CIF semifi nals as a senior ... chose Fresno State for its environment and teammates ... is a pre-

athle� c training major at Fresno State.

4

KORBY BATESOLE’S SINGLE-GAME HIGHS

AT BATS: 6 (at Air Force-1, 4/30/16)

RUNS: 2 (3x)

HITS: 3 (vs. Air Force, 4/2/16)

RBIS: 2 (6x)

DOUBLES: 1 (5X)

TRIPLES: --

HOME RUNS: 1 (vs. SDSU, 4/24/15)

TOTAL BASES: 5 (vs. SDSU, 4/24/15)

WALKS: 4 (vs. San Jose State, 4/24/16)

STRIKEOUTS: 3 (at Air Force, 4/19/15)

SAC HITS: 2 (vs Cal Poly, 2/17/15)

SAC FLIES: 1 (2x)

STOLEN BASES: 1 (2x)

HIT BY PITCH: 1 (6x)

ASSISTS: 6 (5x)

ERRORS: 4 (at UCSB, 4/4/15)

KORBY BATESOLE’S CAREER STATS

Year Avg GP GS AB R H 2B 3B HR RBI TB SLG% BB

2015 .232 44 33 95 7 22 4 0 1 13 29 .305 6 2016 .243 56 51 177 13 43 1 0 0 15 44 .249 15 TOTAL .239 100 84 272 20 65 5 0 1 28 73 . 21

Year HBP SO GDP OB% SF SH SB ATT PO A E FLD%

2015 4 22 2 .302 1 6 0 1 70 91 14 .920 2016 2 29 3 .308 1 7 2 4 71 142 10 .955 TOTAL 6 51 5 .268 2 13 2 5 141 233 24 .940

JEREMIAH BURKS INF | R/R | 6-2 | 200 | So. | 2nd YearVacaville, Calif. (William C. Wood HS)

CAREER GAMES: 33 CAREER STARTS: 20

2016 �FRESHMAN�: Burks appeared in 33 games as a freshman making 20 starts... started 12

games at shortstop, four at second base and four in le# fi eld... hit .188 from the plate fi nish-

ing the season with 12 hits, including three doubles and a home run... totaled seven runs and

eight RBIs... had one stolen base at #3 Texas A&M (Mar. 11)... had a season-high two hits in the

fi rst game of a doubleheader sweep over Youngstown State (Feb. 27) ... hit a three-run home

run in a 9-5 win over Cal Poly (May 10).

HIGH SCHOOL: A! ended William C. Wood High School where he was a three-year le! er win-

ner on the diamond playing shortstop for the Wildcats... hit .303 from the dish with 23 hits,

six doubles, 16 runs scored and six RBI’s in 24 games as a sophomore... also hit .283 as a junior

and .228 as a senior... was a member of the Oakland Athle� cs Area Code Team in 2014.

PERSONAL: Born in Fairfi eld, Calif... son of Bert and Sharon Burks... has two brothers, Ethan

and Ma! ... kinesiology major at Fresno State... wants to become a personal trainer... chose

Fresno State for its historically-strong baseball program and to earn a degree...brother, Ma!

played baseball at Eastern New Mexico University for two years...enjoys fi shing, playing bas-

ketball and spending � me with friends and family in his free � me.

5

JEREMIAH BURKS’ CAREER STATS


2016 .188 33 20 64 8 12 3 0 1 7 18 .281 12 TOTAL .188 33 20 64 8 12 3 0 1 7 18 .281 12


2016 1 29 1 .325 0 1 1 2 23 35 6 .906 TOTAL 1 29 1 .325 0 1 1 2 23 35 6 .906

JEREMIAH BURKS’ SINGLE-GAME HIGHS

AT BATS: 4 (5x)

RUNS: 2 (vs. Youngstown State-1,

2/27/16)

HITS: 2 (vs. Youngstown State-1,

2/27/16)

RBIS: 3 (vs. Cal Poly, 5/10/16)

DOUBLES: 1 (3x)

TRIPLES: --

HOME RUNS: 1 (vs. Cal Poly,

5/10/16)

TOTAL BASES: 4 (vs. Cal Poly,

5/10/16)

WALKS: 2 (at Pacifi c, 4/5/16)

STRIKEOUTS: 4 (vs. Creighton,

2/19/16)

SAC HITS: 1 (vs. SDSU, 5/7/16)

SAC FLIES: --

STOLEN BASES: 1 (vs. Texas A&M,

3/11/16)

HIT BY PITCH: 1 (vs. Air Force,

4/1/16)

ASSISTS: 4 (4x)

ERRORS: 2 (vs. Youngstown State,

2/26/16)



SCOTT SILVA INF | R/R | 5-10 | 180 | RSr. | 5th YearClovis, Calif. (Fresno City College/Clovis West High School)


2016 �JUNIOR�: Earned second-team All-MW honors as a junior... appeared in 39 games mak-

ing 32 starts on the season... started a team-high 25 games at second base and also made

fi ve starts at DH and two at third base... ranked third on the team with a .357 ba� ng average

from the plate fi nishing the season with 50 hits, including 11 doubles and four home runs...

ranked second on the team with 31 runs scored and drove in 23 RBIs... totaled a .400 on-base

percentage and a .521 slugging percentage... � ed for fourth on the club with 14 mul� -hit

games, including notching a season-high four hits in three games... had four hits, including a

grand slam and six RBIs in the ‘Dogs 14-1 win over Air Force (April 1)... also totaled four hits

and scored two runs against SJSU (April 24) and had four hits, an RBI and three scored against

San Francisco (May 19)... had a season-best 10-game hi� ng streak from Apr. 6-24 and reached

base in 11 straight games... went 2-for-5 with a home run and three RBIs against Air Force

(May 26) in the MW Tournament.

PRIOR TO FRESNO STATE: Spent a year at Gonzaga University in 2012-13 where he redshirt-

ed ... spent the last two seasons at Fresno City College playing for head coach Ron Sco! and

the Rams ... was a team captain for Fresno City earning All-American, All-State and All-Central

Valley Conference honors ... hit .362 from the plate with 11 doubles, four triples, three home

runs and 40 RBI in 2015 and added a .378 on-base percentage and .560 slugging percentage.

HIGH SCHOOL: A! ended Clovis West High School where he was a 2012 graduate ... was a

three-year le! er winner as a Golden Eagle and earned a pair of Tri-River Athle� c Conference

all-conference honors ... also earned All-Valley and All-State honors at CWHS ... member of the

North/South All-Star Team.

PERSONAL: Born in Fresno, Calif. ... son of Cherie and Randy Silva ... has one older brother,

Sean, who played baseball at Southern Cal ... economics major and entrepreneurship minor at

Fresno State ... wants to pursue a profession in real estate ... father, Randy played baseball and

football at Fresno City College ... chose to a! end Fresno State a" er growing up in Fresno and

always wan� ng to be a Bulldog and knows he will become a be! er man on and off the fi eld at

Fresno State ... enjoys golfi ng and traveling in his free � me.

6

SCOTT SILVA’S SINGLE-GAME HIGHS

AT BATS: 6 (at New Mexico, 4/9/16)

RUNS: 3 (vs. San Francisco, 5/19/16)

HITS: 4 (2X)

RBIS: 6 (vs. Air Force, 4/1/16)

DOUBLES: 1 (11x)

TRIPLES: --

HOME RUNS: 1 (4x)

TOTAL BASES: 7 (vs. Air Force, 4/1/16)

WALKS: 2 (at New Mexico, 4/10/16)

STRIKEOUTS: 2 (3x)

SAC HITS: 1 (4X)

SAC FLIES: --

STOLEN BASES: 1 (vs. Pacifi c, 4/12/16)

HIT BY PITCH: --

ASSISTS: 5 (2X)

ERRORS: 2 (at Sacramento St.,

4/27/16)

SCOTT SILVA’S CAREER STATS


2016 .357 39 32 140 31 50 11 0 4 23 73 .521 10 TOTAL .357 39 32 140 31 50 11 0 4 23 73 .521 10


2016 0 21 3 .400 0 4 1 3 55 59 6 .950 TOTAL 0 21 3 .400 0 4 1 3 55 59 6 .950

RICKY TYLER THOMAS’S CAREER STATS

Year ERA W L App GS GC SHO CBO SV IP H R ER

2015 3.92 4 3 15 7 0 0 2 1 41.1 37 20 18 2016 2.16 9 4 15 15 3 1 0 0 104.0 86 36 25 TOTAL 2.67 13 7 30 22 3 1 2 1 145.1 123 56 43

Year BB SO 2B 3B HR BF B/Avg. WP HBP BK SFA SHA

2015 23 35 9 0 2 183 .245 2 3 1 0 6 2016 16 108 14 1 6 418 .223 7 7 0 1 8 TOTAL 39 143 23 1 8 601 .229 9 10 1 1 14

RICKY TYLER THOMAS’S SINGLE-GAME HIGHS

INNINGS PITCHED: 9.0 (vs. San Jose St.,

4/22/16)

RUNS ALLOWED: 6 (2x)

EARNED RUNS: 4 (5x)

WALKS ALLOWED: 4 (at SJSU, 5/1/15)

HITS ALLOWED: 9 (2x)

STRIKEOUTS: 11 (vs. Youngstown St.,

2/26/16)

DOUBLES ALLOWED: 3 (2x)

TRIPLES ALLOWED: --

HOMERS ALLOWED: 2 (at Texas

A&M, 3/11/16)

WILD PITCHES: 2 (at UNLV, 5/13/16)

HIT BATTERS: 2 (2X)

RICKY TYLER THOMAS LHP | L/L | 6-1 | 185 | Jr. | 3rd YearSan Diego, Calif. (Mira Mesa HS)

CAREER APPEARANCES: 30 CAREER STARTS: 222016 STARTS: 15

2016 �SOPHOMORE�: Earned First-Team All-Mountain West honors a" er pos� ng a 9-4 record

with 2.16 ERA in 15 starts... tossed three complete games at No. 3 Texas A&M (March 11), at

New Mexico (April 8) and at home against San Jose State (April 22) throwing a two-hit shutout

striking out four and allowed no walks in a 6-0 win... led the Mountain West in strikeouts with

108... ranked second in the MW in innings pitched (104.0), ERA (2.16) and wins (9)... limited

opponents to a .223 ba� ng average... allowed only 25 earned runs, � ed for second-fewest in

the MW among qualifi ed starters... posted a 6.75 strikeout-to-walk ra� o only allowing 16 walks

on the season... tossed six or more innings in 14 of his 15 starts, including 10 of seven-plus...

allowed two or less earned runs in 10 starts... had 11 starts with six or more strikeouts, including

a career-high 11 in only six innings in a 8-3 win over Youngstown State (Feb. 26)... earned three

Mountain West Pitcher of the Week honors a" er standout performances against Air Force, San

Jose State and UNLV... pitched for the USA Collegiate Na� onal Team making seven relief appear-

ances on the summer tour... posted a 1-1 mark with a 0.95 ERA and � ed for the team lead with

21 strikeouts... tossed 5.1 innings in the team’s fi nal game clinching the fi rst-ever series win over

Cuba and limited Cuba to no runs, two hits, one walk and struck out four.

2015 �FRESHMAN�: Appeared in 15 games on the mound for the ‘Dogs making seven starts..

posted a 4-3 record with a 3.92 ERA... also notched his fi rst career save in a 3-1 win against Ne-

vada on April 12... fi nished sixth on the team in both innings pitched (41.1) and strikeouts (35).

HIGH SCHOOL: Three-year le! erwinner in baseball and a two-year le! erwinner in

basketball at Mira Mesa High in San Diego ... was a two-� me All-Eastern League performer in

baseball ... was a U.S. Na� onal Army Scholar-Athlete of the Year.

PERSONAL: Was born in San Diego to parents Ricky and Tammy Thomas ... has a sister, Tasiana

... favorite athlete is Jackie Robinson . chose Fresno State because of the great

environment and the teammates ... is a pre-psychology major at Fresno State.

7



10

NICK WARREN C | R/R | 6-2 | 200 | Jr. | 4th YearSaugus, Calif. (Saugus HS)


2016 �FRESHMAN�: Dodds appeared in 11 games as a freshman making one start at fi rst

base against Youngstown State (Feb. 28)... hit .133 from the plate with two hits with a double

against YSU on Feb. 27... added a run scored and three RBIs... drew a pair of walks and was

hit by a pitch.

2015 �REDSHIRT FRESHMAN�: Appeared in 24 games for the Bulldogs, including a pair of

starts behind the plate at catcher against Oregon State (March 7) and at No. 15 UC Santa

Barbara (April 3) ... fi nished the year with a .293 ba! ng average with 12 hits, including four

for extra-bases...had two doubles, a triple and one home run...scored six runs and drove in

fi ve RBI ... notched a .463 slugging percentage and a .326 on-base percentage ... tallied three

mul" -hit games ... hit his fi rst career home run, a solo shot, against Sacramento State and

scored two runs in a 6-2 home win on March 3 ... hit a bases-clearing triple down the right-

fi eld line driving home three runs in a 10-1 win over Wagner (March 11).

2014 �FRESHMAN�: U" lized redshirt season.

HIGH SCHOOL: Three-year le# erwinner at Saugus High School of the Foothill League under

coach John Maggiora ... played catcher all four years of high school ... senior year was named

Defensive Player of the Year, fi rst-team all-league and fi rst-team all-area ... hit .406 as a senior

and threw out 75 percent of runners while in high school ... named team captain both junior

and senior seasons ... graduated with 3.5 GPA.

PERSONAL: Born in Glendale, Calif. ... son of Gary and Nancy Warren ... has one older brother,

Jonathan ... admires his en" re family for helping him get to where he is today ... chose Fresno

State for its great reputa" on and to be a part of a family ... favorite athlete is Hanley Ramirez

of the Boston Red Sox ... interests other than baseball are football, golf and wakeboarding.

NICK WARREN’S CAREER STATS


2015 .293 24 2 41 6 12 2 1 1 5 19 .463 2 2016 .229 49 44 131 17 30 3 0 0 11 33 .252 14 TOTAL .244 73 46 172 23 42 5 1 1 16 52 .302 16


2015 0 11 0 .326 0 0 0 0 17 5 1 .957 2016 4 23 4 .320 1 4 0 1 312 35 5 .986 TOTAL 4 34 4 .321 1 4 0 1 329 40 6 .984

NICK WARREN’S SINGLE-GAME HIGHS

AT BATS: 4 (15X)

RUNS: 2 (2X)

HITS: 3 (2X)

RBIS: 3 (vs Wagner, 3/11/5)

DOUBLES: 1 (5x)

TRIPLES: 1 (vs Wagner, 3/11/5)

HOME RUNS: 1 (VS SAC STATE, 3/3/15)

TOTAL BASES: 5 (VS SAC STATE, 3/3/15)

WALKS: 2 (at Air Force-2, 4/30/16)

STRIKEOUTS: 3 (2X)

SAC HITS: 2 (at San Jose State, 3/25/16)

SAC FLIES: 1 (vs. Youngstown St., 2/27/16)

STOLEN BASES: --

HIT BY PITCH: 1 (4X)

ERRORS: 1 (6x)

PASSED BALLS: 1 (8x)

RYAN DOBSON OF | R/R | 6-0 | 170 | Sr. | 4th YearCulver City, Calif. (Junipero Serra HS)


11

2016 �JUNIOR�: Dobson appeared in 39 games making 24 starts on the season... started 20

games at second base and four in centerfi eld... ranked among the team leaders with a .364

ba! ng average... had 36 hits in 99 at-bats with three doubles and three triples... tallied seven

RBIs and 28 runs scored including fi ve mul" -run contests... notched a .407 on-base percent-

age, a .455 slugging percentage and a .956 fi elding percentage... registered nine mul" -hit

games, including a fi ve-hit performance against San Jose State (Apr. 24)... had an 11-game

hi! ng streak from Apr. 3 through Apr. 30 hi! ng .469 (23-49) in that stretch adding eight

runs, four RBIs and three doubles... closed the season reaching base in his fi nal nine games....

earned Academic All-MW honors.

2015 �SOPHOMORE�: Appeared in 54 games for the Bulldogs ... started 44 games making 29

starts at shortstop and 15 at second base ... hit .245 from the plate with 37 hits in 151 at-bats

... scored 20 runs and drove in seven ... added two doubles and one triple ... stole fi ve bases

in nine a# empts ... notched seven mul" -hit games ... had a season-high three hits, scored two

runs and had a RBI at New Mexico on March 27 ... collected a pair of hits and scored two runs

at UC Santa Barbara on April 4.

2014 �FRESHMAN�: Started in 36 games and appeared in 43 of the 57 games as a true fresh-

man ... all 36 starts were at shortstop ... ba# ed from the nine spot in 32 games and from

the eight-hole in four games ... ranked " ed for second on the team and " ed for sixth in the

Mountain West for the most successful sacrifi ce bunts (8) ... set the team single-game season-

high with 10 fi elding assists against Cal State Fullerton on April 23, the 10 assists " ed the

MW individual season game-high for the year ... recorded fi rst career triple and home run

in the same game on April 19 at Nevada ... had a season-best three-game series vs. Nevada,

April 17-19 - ba! ng .545 (6-for-11) with fi ve runs, one double, one triple, one home run and

two RBI - later named Fresno State Sysco Student Athlete of the Week (April 21) ... owned a

season-best seven-game hi! ng streak from April 15-26 ... registered a .233 season ba! ng

average with 27 hits ... recorded fi ve doubles, one triple, one home run as a freshman ... stole

four bases on fi ve a# empts ... one of fi ve Bulldogs to record double-digit mul" -hit games (10)

... named Academic All-MW.

HIGH SCHOOL: Three-year le# erwinner at St. Bernard before fi nishing high school career at

Junipero Serra ... made fi rst-team all-league all four years of high school ... member of Serra’s

CIF Southern Sec" on Championship baseball team senior year.

PERSONAL: Born in Los Angeles ... son of Bobby and Sandi Dobson ... has one brother, Jason,

and a sister, Lisa ... chose Fresno State because it is a place he felt he could develop into a

be# er baseball player and felt welcomed and wanted ... major at Fresno State is pre-business.

RYAN DOBSON’S SINGLE-GAME HIGHS

AT BATS: 5 (7X)

RUNS: 3 (at Nevada, 3/19/14)

HITS: 3 (3x)

RBIS: 2 (3x)

DOUBLES: 1 (7X)

TRIPLES: 1 (2x)

HOME RUNS: 1 (at Nevada, 4/19/14)

TOTAL BASES: 7 (at Nevada, 4/19/14)

WALKS: 2 (at Air Force-1, 4/30/16)

STRIKEOUTS: 3 (3x)

SAC HITS: 1 (22X)

SAC FLIES: 1 (2x)

STOLEN BASES: 2 (VS. OKLAHOMA, 3/15/16)


ASSISTS: 10 (vs. CS Fullerton,

4/23/14)

ERRORS: 2 (2X)

RYAN DOBSON’S CAREER STATS


2014 .233 43 36 116 18 27 5 1 1 4 37 .319 32015 .245 54 44 151 20 37 2 1 0 7 41 .272 8 2016 .364 39 24 99 28 36 3 3 0 7 45 .455 6 TOTAL .273 136 104 366 66 100 10 5 1 18 123 .336 17


2014 0 28 0 .252 0 8 4 5 61 77 13 .914 2015 5 32 2 .303 1 8 5 9 83 112 13 .938 2016 2 11 0 .407 1 6 5 8 55 32 4 .956 TOTAL 7 71 2 .316 2 22 14 22 199 221 30 .933



TORIN GOLDSTEIN C | L/R | 6-3 | 205 | Jr. | 4th YearIrvine, Calif. (Arnold O. Beckman HS)


2016 �SOPHOMORE�: Goldstein appeared in 20 games for the ‘Dogs as a sophomore before

being sidelined by a season-ending injury... hit .214 from the dish fi nishing with six hits...

scored his lone run of the season at San Jose State (Mar. 24) and added four RBIs... also drew

two walks on the season... hit a two-run RBI single in the fi rst game of a doubleheader sweep

over Youngstown State (Feb. 27)... came off the bench to hit a pinch-hit RBI single in the ‘Dogs

10-5 win over San Diego State (Mar. 5).

2015 �REDSHIRT FRESHMAN�: Appeared in 14 games for the Bulldogs ... made a pair of

starts at designated hi! er against No. 15 UC Santa Barbara ... notched six hits in 16 at-bats

for a .375 average ... drove in fi ve runs, including four in the Mountain West Tournament ...

smashed a three-run double down the le" fi eld line in the Bulldogs’ 15-7 win over San Diego

State in the MW Tournament ... also picked up a hit as a pinch-hi! er in the MW Tournament

win over UNLV.

2014 (Freshman): U# lized redshirt season.

HIGH SCHOOL: Le! ered three years at Arnold O. Beckman High School in Irvine, Calif. ...

played in the Pacifi c Coast League ... played either second base or third base all three years ...

named CIF all-city fi rst-team, fi rst-team all-league and third-team all-county.

PERSONAL: Born in San Diego ... son of David and Kris# Goldstein ... has a younger brother

and sister, Jus# n and Megan ... enjoys surfi ng on his free # me ... the people he admires the

most are his mom and dad due to their work ethic ... major at Fresno State is kinesiology-

exercise science.

12

TORIN GOLDSTEIN’S SINGLE-GAME HIGHS

AT BATS: 4 (2x)

RUNS: 1 (at San Jose State, 3/24/16)

HITS: 1 (12X)

RBIS: 2 (vs. Youngstown St.-1, 2/27/16)

DOUBLES: 1 (VS. SDSU, 5/21/15)

TRIPLES: --

HOME RUNS: --

TOTAL BASES: 2 (VS. SDSU, 5/21/15)

WALKS: 1 (3x)

STRIKEOUTS: 3 (at Texas A&M,

3/12/16)

SAC HITS: --

SAC FLIES: --

STOLEN BASES: --

HIT BY PITCH: --

ERRORS: --

TORIN GOLDSTEIN’S CAREER STATS


2015 .375 14 2 16 0 6 1 0 0 5 7 .438 1 2016 .214 20 0 28 1 6 0 0 0 4 6 .214 2 TOTAL .273 34 2 44 1 12 1 0 0 9 13 .295 3


2015 0 3 0 .412 0 0 0 0 0 0 0 .000 2016 0 10 1 .267 0 0 0 0 0 0 0 .000 TOTAL 0 13 1 .319 0 0 0 0 0 0 0 .000

McCARTHY TATUM INF | R/R | 6-4 | 200 | Jr. | 3rd YearClovis, Calif. (Clovis HS)


14

2016 �SOPHOMORE�: Tatum appeared in 38 games for the Bulldogs as a sophomore making

24 starts, 23 at third base and one at fi rst base... hit .218 from the plate with 19 hits in 87 at-

bats... added two doubles, eight runs scored and eight RBIs... had a .241 slugging percentage

and a .317 on-base percentage... added fi ve stolen bases... tallied fi ve mul# -hit games, includ-

ing a season-high three in the fi rst game of the season going 3-for-4 with a run scored and a

stolen base in a 2-1 win over Creighton (Feb. 19)... had a season-high two RBIs in four games...

drew 10 walks, including a pair at home vs. CSU Bakersfi eld (March 1)... had 16 assists and a

.897 fi elding percentage... named Academic All-Mountain West.

2015 �FRESHMAN�: Appeared in 20 games for the ‘Dogs in his fi rst season, making eight

starts ... made all eight starts at shortstop ... hit .192 from the plate with fi ve hits ... got his

fi rst career hit against UC Davis on March 13 ... scored fi rst career run against Oregon State in

game two of the doubleheader with the Beavers and ended the year with four runs scored ...

had 26 assists and a .917 fi elding percentage.

HIGH SCHOOL: Three-year le! erwinner for coach James Patrick at Clovis High ... led team to

a 33-5 record and a Central Sec# on championship his senior year ... team fi nished ranked No.

1 in the state in 2014 ... three-# me All-TRAC, All-Valley player ... was named All-State his junior

and senior year and also played in the City-County All-Star Game his senior season.

PERSONAL: Was born in Clovis to parents Mary and Joe Tatum ... has a brother, Darby, and

a sister, Erin ... biggest athle# c thrill was winning the Valley Championship his senior year ...

chose to a! end Fresno State because it is the hometown team and the coaches ... was dra" ed

in the 20th round by the Minnesota Twins in the 2014 MLB Dra" ... major at Fresno State is

construc# on management.

MCCARTHY TATUM’S SINGLE-GAME HIGHS

AT BATS: 4 (7X)

RUNS: 1 (12x)

HITS: 3 (vs. Creighton, 2/19/16)

RBIS: 2 (4X)

DOUBLES: 1 (2X)

TRIPLES: --

HOME RUNS: --

TOTAL BASES: 3 (2X)

WALKS: 2 (vs. CSU Bakersfi eld, 3/1/16)

STRIKEOUTS: 2 (4x)

SAC HITS: 1 (7X)

SAC FLIES: 1 (VS. YOUNGSTOWN ST.-1,

2/27/16)

STOLEN BASES: 1 (5X)


ASSISTS: 5 (2X)

ERRORS: 3 (vs. Oakland, 2/23/16)

McCARTHY TATUM’S CAREER STATS


2015 .192 20 8 26 4 5 0 0 0 0 5 .192 2 2016 .218 38 24 87 8 19 2 0 0 8 21 .241 10 TOTAL .212 58 32 113 12 24 2 0 0 8 26 .248 12


2015 1 6 0 .276 0 3 0 1 7 26 3 .917 2016 3 19 0 .317 1 4 5 9 16 36 6 .897 TOTAL 4 25 0 .308 1 7 5 10 23 62 9 .904



JESSE MEDRANO INF | R/R | 5-10 | 200 | Sr. | 4th YearConcord, Calif. (Clayton Valley Charter HS)


16

2016 �JUNIOR�: Medrano appeared in 49 games for the ‘Dogs as a junior... made 37 starts

with 33 coming at third base and four at second base... notched a .326 average from the dish

fi nishing with 45 hits... added nine doubles and a triple... totaled 11 mul� -hit games, including

six of the fi nal eight games of the season... had a season-high four hits against Air Force on

Apr. 30 with three singles and a double... totaled 20 runs scored and 26 RBIs... had a season-

high four RBIs in a 10-5 win over #16 Long Beach State (Mar. 29)... stole a team-high seven

bases... had a .359 on-base percentage and a .406 slugging percentage... reached base in a

season-high nine straight games from Apr. 15 through Apr. 30... named Academic All-MW for

the third straight year.

2015 �SOPHOMORE�: Appeared in 44 games for the Bulldogs ... made 25 starts on the year

with 17 coming at second base and eight at shortstop ... hit .229 from the plate with 22 hits

in 96 at-bats ... scored 16 runs and drove in seven RBI ... had two doubles on the season, one

against UNLV (May 9) and the other in the season fi nale against SDSU in the MW Tournament

(May 23) ... went a perfect 6-for-6 in stolen base a! empts... had a season-high two hits in four

games against UC Irvine (Feb. 15), Nevada (Feb. 21), UC Davis (March 14) and San Diego State

(April 26) ... named Academic All-MW.

2014 �FRESHMAN�: Started in 24 games and made 37 appearances in the 57-game season ...

made 13 starts at shortstop and 11 at second base ... hit from the No. 8 and No. 9 spots in the

lineup 12 � mes each ... registered a single-game team season-best two successful sacrifi ce

bunts on March 5 vs. Sacramento State ... fi rst career hit was a double down the le" -fi eld line

on his sixth career at-bat in the 10th inning of the Bulldogs’ second game of the season vs. UC

Irvine on Feb. 15 ... fi rst career RBI was vs. then-ranked No. 18 Texas A&M in the fi rst game

of a doubleheader on March 1 ... owned a .220 season ba$ ng average ...tallied 18 hits, three

doubles, six RBI and eight runs scored ... posted a .966 fi elding percentage ... named the

Mountain West Preseason Freshman of the Year by Baseball America ... named Academic

All-MW.

HIGH SCHOOL: Four-year le! erwinner playing the infi eld for Clayton Valley Charter High

School in Concord, Calif. ... named Diablo Valley Athle� c League MVP senior year ... garnered

back-to-back best defensive player awards from the Bay Area World Series (2011) and Reebok

Norcal World Series (2012) ... named by Prospect Wire an underclass All-American ... also

played football - set school record for most forced fumbles (8) ... graduated with a 3.0 GPA

- named Student of the Year ... received P.E. Award and Eagle Award ... awarded Hot Stove

Dinner scholarship.

PERSONAL: Born in An� och, Calif. ... son of Rick and Kim Medrano ... has three sisters, Sariana,

Rhea and Amanda ... chose Fresno State for its baseball environment and community fan base

... major at Fresno State is communica� ons ... admires his parents for their sacrifi ces to give

him all the opportuni� es he has ... favorite athlete is current New York Yankee Derek Jeter ...

believes biggest athle� c thrill is to come up clutch defensively or at the plate for his teammates.

JESSE MEDRANO’S SINGLE-GAME HIGHS

JESSE MEDRANO’S CAREER STATS


2014 .220 37 24 82 8 18 3 0 0 6 21 .256 1 2015 .229 44 25 96 16 22 2 0 0 7 24 .250 0 2016 .326 49 37 138 20 45 9 1 0 26 56 .406 6 TOTAL .269 130 86 316 44 85 14 1 0 39 101 .320 7


2014 3 21 1 .253 1 5 1 1 38 75 4 .966 2015 3 20 1 .253 0 4 6 6 82 79 7 .958 2016 4 21 4 .359 5 8 7 9 37 83 6 .952 TOTAL 10 62 6 .301 6 17 14 16 157 237 17 .959

AT BATS: 5 (4x)

RUNS: 2 (2x)

HITS: 4 (at Air Force-1, 4/30/16)

RBIS: 4 (2x)

DOUBLES: 1 (14X)

TRIPLES: 1 (vs. Air Force, 4/2/16)

HOME RUNS: --

TOTAL BASES: 4 (vs. SJSU, 3/25/16)

WALKS: 1 (7x)

STRIKEOUTS: 3 (vs. Nevada, 4/16/16)

SAC HITS: 2 (at Sac. St., 3/5/14)

SAC FLIES: 2 (vs. Long Beach St., 3/29/16)



ASSISTS: 7 (vs UNLV, 2/27/15)

ERRORS: 2 (2x)

ROSS DODDS INF | R/R | 6-1 | 200 | So. | 2nd YearClovis, Calif. (Buchanan HS)


2016 �FRESHMAN�: Dodds appeared in 11 games as a freshman making one start at fi rst

base against Youngstown State (Feb. 28)... hit .133 from the plate with two hits with a double

against YSU on Feb. 27... added a run scored and three RBIs... drew a pair of walks and was

hit by a pitch.

HIGH SCHOOL: A! ended Buchanan High School where he was a four-year le! er winner in

baseball ... hit .386 from the dish as a senior smacking three home runs and earned fi rst-team

All-Valley and fi rst-team Tri-River Athle� c Conference honors ... named third-team all-state

by Cal-Hi Sports as a senior as the Bears posted a 29-4 record and was a 2014 Cal-Hi Sports

fi rst-team all-state underclassman ... earned a 2015 North/South All-Star game par� cipant ...

also competed at the 2014 Area Code games for the Oakland A’s ... was a three-� me Marlins

Scout Team Par� cipant ... ranked as the second-best high school third baseman in California by

Perfect Game ... tabbed as the 136th-best prep player in the country in the 2015 class and 21st

in California ... also recruited by UCSB, CS Fullerton, Long Beach State, Arizona, Iowa and UCLA.

PERSONAL: Born in Visalia, Calif. ... son of Jeff and Kara Dodds ... has an older brother, Jake ...

undeclared major at Fresno State ... wants to pursue a profession in business ... chose Fresno

State because he knew it would be the best place for him to grow and compete for

championships ... enjoys ping pong and music in his free � me.

19

ROSS DODD’S SINGLE-GAME HIGHS

AT BATS: 3 (2x)

RUNS: 1 (vs. Youngstown State-2,

2/27/16)

HITS: 1 (2x)

RBIS: 2 (vs. Youngstown State-2,

2/27/16)

DOUBLES: 1 (vs. Youngstown

State-2, 2/27/16)

TRIPLES: --

HOME RUNS: --

TOTAL BASES: 2 (vs. Youngstown

State-2, 2/27/16)

WALKS: 1 (2x)

STRIKEOUTS: 2 (vs. SDSU, 5/7/16)

SAC HITS: --

SAC FLIES: --

STOLEN BASES: --

HIT BY PITCH: 1 (vs. San Francisco,

5/19/16)

ASSISTS: 1 (vs. Youngstown State,

2/28/16)

ERRORS: --

ROSS DODD’S CAREER STATS


2016 .133 11 1 15 1 2 1 0 0 3 3 .200 2 TOTAL .133 11 1 15 1 2 1 0 0 3 3 .200 2


2016 1 7 0 .278 0 0 0 0 4 1 0 1.000 TOTAL 1 7 0 .278 0 0 0 0 4 1 0 1.000



RYAN SULLIVAN RHP | R/R | 6-4 | 230 | So. | 2nd YearEl Dorado Hills, Calif. (Oak Ridge HS)


2016 �FRESHMAN�: Sullivan made eight appearances on the mound as a freshman... tossed

eight innings with a 7.88 ERA... tallied 12 strikeouts while allowing only fi ve walks... only al-

lowed an earned run in two of his eight appearances... tossed a season-high two innings twice

at Pacifi c (April 5) and at Cal Poly (April 19)... struck out a season-best four at Cal Poly... named

Mountain West Scholar-Athlete.

HIGH SCHOOL: A! ended Oak Ridge High School in El Dorado Hills, Calif., where he was a two-

sport athlete playing baseball and football ... was a three-year star" ng pitcher for the Trojans

and earned fi rst-team all-league and all-metro honors ... notched fi ve wins and posted a 2.35

ERA while holding opponents to a .199 ba# ng average in 50.2 innings of work as a senior ... on

the gridiron, Sullivan was a two-year starter at " ght end, a team captain, and tallied 39 recep-

" ons for 474 yards and seven touchdowns as senior ... was the Oak Ridge Athlete of the Year

for his class as a freshman, sophomore and senior and earned the best career athlete award

... earned the 2013 Delta River League Sportsmanship Award ... also a member of the Na" onal

Honor Society and was a character combine intern.

PERSONAL: Son of Ed and Robin Sullivan ... has one older brother, Kevin ... undeclared major

at Fresno State ... chose Fresno State for its great baseball program and the program’s strong

emphasis on academics and blue collar a# tude of school ... enjoys watching sports and play-

ing sports in his free " me.

20

RYAN SULLIVAN’S CAREER STATS


2016 7.88 0 0 8 0 0 0 0 0 8.0 11 7 7 TOTAL 7.88 0 0 8 0 0 0 0 0 8.0 11 7 7


2016 5 12 2 0 0 40 .333 1 2 0 0 0 TOTAL 5 12 2 0 0 40 .333 1 2 0 0 0

RYAN SULLIVAN’S SINGLE-GAME HIGHS

INNINGS PITCHED: 2.0 (2X)

RUNS ALLOWED: 5 (at Pacifi c, 4/5/16)

EARNED RUNS: 5 (at Pacifi c, 4/5/16)

WALKS ALLOWED: 3 (5 (at Pacifi c,

4/5/16)

HITS ALLOWED: 6 (5 (at Pacifi c,

4/5/16)

STRIKEOUTS: 4 (at Cal Poly, 4/19/16)

DOUBLES ALLOWED: 2 (vs.

Youngstown-2, 2/27/16)

TRIPLES ALLOWED: --

HOMERS ALLOWED: --

WILD PITCHES: 1 (vs. Youngstown-2,

2/27/16)

HIT BATTERS: 1 (2x)

AUSTIN WHITE OF | R/R | 6-2 | 190 | RFr. | 2nd YearStudio City, Calif. (Cleveland HS)

2016: Redshirted.

HIGH SCHOOL: A! ended Cleveland High School in Reseda, Calif ... was a four-year le! er

winner for the Cavaliers playing both ou$ ield and u" lity ... was a team captain as a junior and

senior ... earned fi rst-team all-conference accolades (West Valley League) as a senior a% er

hi# ng .330 from the plate and was selected to the second-team as a sophomore ... was

named to the city sec" on All-Star team as senior ... helped lead the Cavaliers to runner-up

fi nishes in 2013 and 2015 in the city sec" on Division I championship.

PERSONAL: Born in Los Angeles, Calif. ... son of Jon and Michele White ... has a sister, Maya

... a business major at Fresno State ... wants to pursue a profession in marke" ng when he is

fi nished with his degree ... chose Fresno State because it was the best place to be! er himself

on the baseball fi eld and in the classroom.

21

JOE PRIOR C | R/R | 6-0 | 190 | Sr. | 4th YearLos Alamitos, Calif. (Servite HS)


25

2016 �JUNIOR�: Prior appeared in 33 games as a junior making 14 starts behind the plate at

catcher... posted a .206 average from the plate... fi nished with 14 hits including three doubles

and two home runs... added 11 RBIs and eight runs scored... had a pair of two-hit performanc-

es against Youngstown State (Feb. 26) and San Jose State (Apr. 22)... had a double and two

RBIs against the Penguins and smacked two home runs and fi nished with three RBIs against

the Spartans... had hits in his fi rst four games to start the season and reached base in his fi rst

fi ve games... had a .247 on-base percentage and a .338 on-base percentage... also had a .971

fi elding percentage making only fi ve errors on the season and threw out two baserunners...

named Academic All-MW.

2015 �SOPHOMORE�: Appeared in 42 games for the ‘Dogs making 20 starts, all at fi rst base

... hit .247 from the plate ... recorded 24 hits, including three doubles and one home run ...

scored six runs and drove in 17 RBI ... tallied three mul" -hit games in contests at home against

Cal Poly (Feb. 17), at Nevada (Feb. 20) and vs. San Jose State (Mar. 22) ... hit a three-run home

run on April 12 to propel the ‘Dogs past Nevada at home 3-1 and clinch a series win ... added

a .309 slugging percentage and a .288 on-base percentage ... recorded a double and a pair

of RBI’s in the 5-4 season-opening win at home over UC Irvine ... named Academic All-MW.

2014 �FRESHMAN�: Started in three games and appeared in 16 games of the 57-game season

as a true freshman ... all three starts were as the designated hi! er ... played the fi eld one " me

as a subs" tute, fi rst base on Feb. 19 vs. Sacramento State - recorded two putouts ... fi rst career

hit and RBI was on Feb. 23 vs. Nevada, connected for a pinch-hit RBI-single in the sixth inning

... fi rst career start was on April 12 at New Mexico (0-for-3) ... in second career start on May

3 at San Jose State he connected on a 2-2 off ering to right fi eld for his fi rst career triple and

added his third career RBI to his resume, scored on ensuing wild pitch during the next at-bat

... owned a .263 season ba# ng average and a .348 on-base percentage ... recorded fi ve hits

on 19 at-bats.

HIGH SCHOOL: Three-year le! erwinner of the Servite High School baseball team and one-

" me football le! erman ... named team MVP junior and senior year ... earned fi rst-team All-Los

Angeles Times in baseball.

PERSONAL: Born in Newport Beach, Calif. ... son of Donald and Jill Prior ... has one sister,

Kate ... chose Fresno State because it was a good fi t for him ... admires his mom most because

she showed him how to be strong and always put family fi rst ... favorite athlete is Bo Jackson

because he is the best pure athlete to ever play a sport ... also enjoys hanging out with family,

friends and his dog.

JOE PRIOR’S CAREER STATS


2014 .263 16 3 19 2 5 0 1 0 3 7 .368 0 2015 .247 42 20 97 6 24 3 0 1 17 30 .309 5 2016 .206 33 14 68 8 14 3 0 2 11 23 .338 2 TOTAL .230 91 37 184 16 43 6 1 3 31 60 .326 7


2014 3 4 1 .348 1 1 0 0 2 0 0 1.000 2015 3 23 5 .288 6 3 0 0 166 17 2 .989 2016 2 10 0 .247 1 3 0 0 153 14 5 .971 TOTAL 8 37 6 .280 8 7 0 0 321 31 7 .981

JOE PRIOR’S SINGLE-GAME HIGHS

AT BATS: 5 (3x)

RUNS: 2 (vs. San Jose State, 4/22/16)

HITS: 2 (6x)

RBIS: 3 (2x)

DOUBLES: 1 (6x)

TRIPLES: 1 (at SJSU, 5/3/14)

HOME RUNS: 2 (vs. San Jose State, 4/22/16)

TOTAL BASES: 8 (vs. San Jose State,

4/22/16)

WALKS: 1 (7x)

STRIKEOUTS: 3 (at Texas A&M,

3/11/16)

SAC HITS: 1 (7x)

SAC FLIES: 1 (8x)

STOLEN BASES: --

HIT BY PITCH: 2 (vs UNLV, 2/27/15)

ASSISTS: 4 (at Saint Mary’s, 3/22/16)

ERRORS: 2 (at Texas A&M, 3/13/16)



AARON ARRUDA OF | R/R | 6-3 | 220| Jr. | 3rd YearFresno, Calif. (Buchanan HS)


2016 �SOPHOMORE�: Arruda earned fi rst-team All-Mountain West honors as a sophomore...

appeared in 54 games making 41 starts with 35 at fi rst base and six at designated hi� er...

ranked fi � h on the club with a .320 average from the dish and fi nished second on the team

with 62 hits... totaled 15 doubles and a team-high 11 home runs... had a team-leading 44 RBIs

and totaled a team-best 12 mul� -RBI games... scored 37 runs scoring in 32 contests... led the

team with 110 total bases... tallied a .406 on-base percentage, .567 slugging percentage and

a .987 fi elding percentage... had six three-hit contests including smacking a double and home

run along with four RBIs in an 11-10 win over Oakland... had a team-best 13-game hi� ng

streak from Apr. 27 through May 19 hi� ng .396 over that stretch... fi nished the season on a

17-game on-base streak.

2015 �FRESHMAN�: Appeared in 45 games for the Bulldogs in his inagural season, including

making 24 starts ... started 20 games in right fi eld and four as the designated hi� er ... hit .248

from the plate with 26 hits in 105 at-bats ... scored 14 runs and drove in 12 runs ... added four

doubles and one home run ... � ed for team-lead with seven hit by pitches ... had a season-high

two hits fi ve � mes ... went 2-for-3 with a double and two runs scored at Nevada (Feb. 21) and

added two hits and scored two runs along with two RBIs at USC (March 17).

HIGH SCHOOL: Three-year le� erwinner in baseball for coach Tom Donald at Buchanan High

... also won a le� er in football in 2013 ... teams won at least 20 games in all three seasons at

Buchanan ... was a City-County All-Star in 2014.

PERSONAL: Born in Modesto, Calif., to parents Jennifer and Tony Arruda ... has two

brothers, J.T. and Jacob ... enjoys hanging out with friends, golfi ng and watching movies

... favorite athlete is Derek Jeter ... chose Fresno State because he always wanted to play

here since the Na� onal Championship season in 2008 ... major at Fresno State is civil

engineering.

AARON ARRUDA’S SINGLE-GAME HIGHS

AT BATS: 5 (9x)

RUNS: 3 (vs. Long Beach St., 3/29/16)

HITS: 3 (6x)

RBIS: 4 (vs. Oakland, 2/23/16)

DOUBLES: 1 (19X)

TRIPLES: --

HOME RUNS: 1 (12x)

TOTAL BASES: 7 (2x)

WALKS: 3 (vs Wagner, 3/11/15)

STRIKEOUTS: 3 (at UNLV, 5/14/16)

SAC HITS: 2 (vs. Wagner, 3/10/15)

SAC FLIES: 1 (vs. Nevada, 4/16/16)

STOLEN BASES: 1 (3X)

HIT BY PITCH: 2 (vs. Creighton,

2/19/16)

ASSISTS: 3 (vs. SDSU, 5/6/16)

ERRORS: 1 (4X)

AARON ARRUDA’S CAREER STATS


2015 .248 45 24 105 14 26 4 0 1 12 33 .314 6 2016 .320 54 41 194 37 62 15 0 11 44 110 .567 21 TOTAL .294 99 65 299 51 88 19 0 12 56 143 .478 27


2015 7 24 4 .331 0 2 0 1 43 2 0 1.000 2016 8 52 2 .406 1 0 3 3 286 22 4 .987 TOTAL 15 76 6 .380 1 2 3 4 329 24 4 .989

27

RICKEY RAMIREZ RHP | R/R | 6-0 | 180 | Jr. | 3rd YearMarysville, Calif. (River Valley HS)

CAREER APPEARANCES: 41 CAR CAREER STARTS: 12016 STARTS: 1

30

2016 �SOPHOMORE�: Earned second-team All-MW honors as a sophomore... appeared in

26 games on the mound with 25 coming in relief and made one start against Pacifi c (Apr.

12)... went 4-1 with a 4.54 ERA and converted four saves on the year... in 12 appearances in

Mountain West play, went 1-0 with a 0.45 ERA and picked up all four saves against MW foes

(Air Force twice, San Diego State and San Jose State)... tossed 39.2 innings and notched 42

strikeouts... held opponents to a .271 ba� ng average.... had a season-high four strikeouts

on three occassions at Texas A&M (Mar. 13), UNLV (Mar. 20) and San Jose State (Apr. 23)...

onlysurrendered an earned run in seven appearances... named Academic All-Mountain West.

2015 �FRESHMAN�: Appeared in 15 games on the mound ... tossed 16.1 innings, pos� ng an

0-2 record with a 7.71 ERA ... notched 12 strikeouts, including a season-high three in his fi rst

appearance of the season against Cal Poly ... threw a season-high 2.1 innings, including a pair

of strikeouts, in a 6-3 win at home over San Jose State on March 22 ... named Academic All-

MW ... also earned Mountain West Scholar-Athlete honors.

HIGH SCHOOL: Three-year le� erwinner for coach Brandon Asher at River Valley High in Yuba

City, Calif. ... led his team during senior year to a 20-win season in which he was 9-2 on the

mound with a 1.15 ERA with 96 strikeouts ... struck out 176 ba� ers over his junior and senior

seasons ... was a All-Tri County League player junior and senior season and was also named

All-Area both years.

PERSONAL: Was born in Walnut Creek, Calif., to his parents Donna Brown and Mark Ramirez

... has one brother, Nico, and three sisters, Angel, Chloe and Francesca ... enjoys going to the

movies and going to Naco Taco with his closest friends back home ... favorite athlete is Roy

Halladay because he mastered the art of pitching and competes 100 percent of the � me ...

chose to come to Fresno State because it was the best fi t for him and gave him a chance to play

Division I baseball while enhancing his educa� on.

RICKY RAMIREZ’S SINGLE-GAME HIGHS

INNINGS PITCHED: 3.2 (2x)

RUNS ALLOWED: 7 (vs. Nevada,

5/27/16)

EARNED RUNS: 7 (vs. Nevada,

5/27/16)

WALKS ALLOWED: 3 (vs. Pacifi c,

4/12/16)

HITS ALLOWED: 6 (vs. Nevada,

5/27/16)

STRIKEOUTS: 4 (3x)


TRIPLES ALLOWED: 1 (2x)

HOMERS ALLOWED: 2 (vs. Pacifi c, 4/12/16)

WILD PITCHES: 1 (12x)

RICKEY RAMIREZ’S CAREER STATS


2015 7.71 0 2 15 0 0 0 0 0 16.1 22 16 14 2016 4.54 4 1 26 1 0 0 1 4 39.2 42 28 20 TOTAL 5.46 4 3 41 1 0 0 1 4 56.0 64 44 34


2015 11 12 5 1 2 85 .319 3 3 0 0 2 2016 22 42 8 1 3 187 .271 9 6 0 1 3 TOTAL 33 54 13 2 5 272 .286 12 9 0 1 5



DOMINIC TOPOOZIAN RHP | R/R | 6-0 | 195 | RSr. | 5th YearClovis, Calif. (Fresno City College/Buchanan HS)


2016 �REDSHIRT�: Redshirted.

2015 �JUNIOR�: Appeared in 14 games in his fi rst year at Fresno State ... made one start on

the year in game two of the doubleheader at Oregon State ... posted a 1-2 record with a 5.66

ERA ... threw 20.2 innings and added 12 strikeouts ... picked up his fi rst career victory at Fresno

State in a 4-3 triumph in 16 innings against CSUN (May 5) pitching a season-high four innings

allowing four hits and one strikeout ... had two strikeouts against Cal Poly (Feb. 17), Wagner

(March 11) and SDSU (April 25).

PRIOR TO FRESNO STATE: A" ended Fresno City College (2013-14) ... was an all-state

performer in 2013 while going 6-3 with a 2.03 ERA, striking out 94 in 102 innings of work ...

was a preseason All-American heading into the 2014 season.

HIGH SCHOOL: Two-year le" erwinner for coach Tom Donald at Buchanan High School in Clo-

vis ... went 11-0 with a 1.02 ERA in his junior season while helping the Bears fi nish as the No.

1 ranked team in the country ... was the Buchanan Pitcher of the Year his junior and senior

seasons.

PERSONAL: Born in Fresno to parents Lydia and Tom Topoozian ... has four brothers, Adam,

Dus# n, Ryan and Sonny; as well as a sister, Amanda ... enjoys playing Xbox, working out and

hanging out with friends ... favorite athlete is Tim Lincecum because he’s not a very big guy,

like Dominic, but he competes ... biggest athle# c thrill was winning the valley, state and na-

# onal championship at Buchanan his junior year ... chose Fresno State because he has always

wanted to play for his hometown team and be a Bulldog since he was a kid ... major at Fresno

State is business management.

DOMINIC TOPOOZIAN’S CAREER STATS


2015 5.66 1 2 14 1 0 0 1 0 20.2 29 13 13 2016 REDSHIRTED TOTAL 5.66 1 2 14 1 0 0 1 0 20.2 29 13 13


2015 9 12 4 1 3 104 .326 4 2 0 0 2 2016 REDSHIRTED TOTAL 9 12 4 1 3 104 .326 4 2 0 0 2

31

DOMINIC TOPOOZIAN’S SINGLE-GAME HIGHS

INNINGS PITCHED: 6.2 (at UNLV, 5/9/15)

RUNS ALLOWED: 4 (at Nevada, 2/21/15)

EARNED RUNS: 4 (at Nevada, 2/21/15)

WALKS ALLOWED: 4 (at SJSU, 5/1/15)

HITS ALLOWED: 6 (at UNLV, 5/9/15)

STRIKEOUTS: 7 (at Sac. St., 4/22/15)

DOUBLES ALLOWED: 2 (at UNM,

3/29/15)

TRIPLES ALLOWED: --

HOMERS ALLOWED: 1 (2X)


HIT BATTERS: 1 (3X)

ZACH ASHFORD OF | L/R | 5-10 | 180 | So. | 2nd YearClovis, Calif. (Buchanan HS)


2016 �FRESHMAN�: Ashford appeared in 49 games as a freshman making 25 starts on the

season... made 17 starts in le$ fi eld and eight at designated hi" er... one of the top hi% ng

freshman in the Mountain West, Ashford hit .316 from the plate and totaled 36 hits with

three doubles and a triple... scored 24 runs and totaled 14 RBIs along with stealing three

bases... fi nished the season with a .360 slugging percentage, .402 on-base percentage and a

perfect 1.000 on-base percentage... had eight mul# -hit games... tallied a season-best three

hits in three contests including a 3-for-3 performance with two doubles, two RBIs and two

runs scored in a 6-4 win over CSU Bakersfi eld... Academic All-MW selec# on... Mountain West

Scholar-Athlete.

HIGH SCHOOL: A" ended Buchanan High School in where he was a three-year le" er winner in

the ou& ield for the Bears ... as a senior in 2015, he hit .478 from the plate and had 27 stolen

bases leading Buchanan to a 29-4 overall record and the Central Sec# on Division I champion-

ship ... earned many top accolades for his senior year performance as he was named the

Fresno Bee Player of the Year, the Tri-River Athle# c Conference Player of the Year and the

Clovis Roundup Athlete of the Year ... also named fi rst-team all-state and to the 2015 Region 8

ABCA/Rawlings High School All-Region team, a list made up of the best prep talent in the coun-

try... as a junior, he hit .403 and had 11 stolen bases and was named fi rst-team All-TRAC ... was

awarded the 2014 Silver Slugger Award for leading Buchanan in hi% ng ... par# cipated in the

2014 NorCal Rebook World Series and played in the California North-South All-Star game as a

member of the North squad ... was ranked by Perfect Game as the 53rd-best prep ou& ielder in

California ... also played wide receiver football for the Bears earning a pair of le" ers and was

named second-team All-TRAC twice.

PERSONAL: Born in Clovis, Calif. ... son of Kevin and Joanie Ashford ... has an older brother,

Cody, and an older sister, Kathryn ... undeclared major ... chose Fresno State because he grew

up going to Fresno State games and always wanted to be a Bulldog ... enjoys bowling and

watching movies in his free # me.

32

ZACH ASHFORD’S CAREER STATS


2016 .316 49 25 114 24 36 3 1 0 14 41 .360 14 TOTAL .316 49 25 114 24 36 3 1 0 14 41 .360 14


2016 3 23 1 .402 1 4 3 5 30 1 0 1.000 TOTAL 3 23 1 .402 1 4 3 5 30 1 0 1.000

ZACH ASHFORD’S SINGLE-GAME HIGHS

AT BATS: 5 (4x)

RUNS: 2 (4x)

HITS: 3 (3x)

RBIS: 2 (3x)

DOUBLES: 1 (3x)

TRIPLES: 1 (at Long Beach State,

3/7/16)

HOME RUNS: --

TOTAL BASES: 4 (vs. CSU

Bakersfi eld, 3/1/16)

WALKS: 2 (vs. UNLV, 3/19/16)

STRIKEOUTS: 3 (at SJSU, 3/25/16)

SAC HITS: 1 (4x)

SAC FLIES: 1 (at New Mexico,

4/9/16)



ASSISTS: 1 (vs. Youngstown State,

2/28/16)

ERRORS: --



33

AUSTIN GUIBOR OF | L/R | 5-10 | 185 | Sr. | 4th YearCampbell, Calif. (St. Francis HS)


2016 �JUNIOR�: Guibor appeared in all 58 games as a junior making 57 starts in right fi eld...

hit .293 from the plate ranking third on the team with 61 hits and was fourth with 17 extra-

base hits totaling seven doubles, three triples and seven home runs... led the team and ranked

� ed for 14th in the MW with 44 runs scored... also had a team-high 36 RBIs to rank 19th in

the MW... totaled 10 mul� -RBI games, including a season-high four in the ‘Dogs 14-1 win

over Air Force on Apr. 1... ranked third on the team with 16 mul� -hit games notching three

hits fi ve � mes... had a team-best 17 game on-base streak to fi nish the season... drew a team-

high 37 walks for the fi � h-most in the MW.... led the team and ranked � ed for the MW lead

with 12 sacrifi ce bunts... stole four bases and fi nished with a .404 on-base percentage and

.457 slugging percentage... named Academic All-MW for third straight year.... Mountain West

Scholar-Athlete.

2015 �SOPHOMORE�: Earned second-team All-Mountain West honors ... appeared in 54 of

the Bulldogs’ 59 games in the ou! ield ... made 49 starts on the year, spli" ng � me between

le� fi eld (25 starts) and right fi eld (24) ... ranked second on the club with a .339 average ... was

third on the team with 62 hits ... � ed for second on the team with 39 runs scored, including

eight mul� -run games ... tallied 16 extra-base hits with six doubles, a team-high fi ve triples

along with fi ve home runs ... drove in 21 runs ... had a team-high .440 on-base percentage

and ranked second with a .508 slugging percentage ... stole a team-best seven bases in 11

a# empts ... led team with 11 sacrifi ce hits ... notched 15 mul� -hit games, including four three-

hit performances ... had a 2-for-4 performance with a RBI triple and scored three runs in a 15-7

victory over San Diego State in the Mountain West Tournament ... went 3-for-3 with a leadoff

home run and a pair of singles and scored three runs in a 10-5 win over UNLV on Feb. 27 ... col-

lected three hits, including a triple, drove in a pair and scored a run in a 5-4 win over UC Davis

on March 13 ... went 2-for-4 with a two-run home run to le� -center in a 4-3 win at home over

New Mexico on May 15 ... named Academic All-MW ... was also one of four ‘Dogs selected to

be a Mountain West Scholar-Athlete.

2014 �FRESHMAN�: Started 18 games and made 43 appearances in the 57-game season as a

true freshman ... all 18 starts were in le� fi eld ... ba# ed from the leadoff posi� on nine � mes,

hit from the No. 5 spot fi ve � mes and the No. 2 and No. 6 posi� ons two � mes each ... ap-

peared as a pinch-hi# er in a team-high 23 games ... fi rst career hit was an RBI-single in fi rst

career start on March 8 in the second game of a doubleheader at Air Force, also registered

fi rst career double in same game (2-for-5) ... registered fi rst two career runs in the following

game vs. Air Force on March 9, going 2-for-3 ... registered fi rst career home run on April 17 at

Nevada. ... posted a 1.000 fi elding percentage in le� fi eld ... named Academic All-MW.

HIGH SCHOOL: Le# ered two years in baseball and two years in football in the West Catholic

Athle� c League ... played ou! ield at Saint Francis High School ... his baseball team fi nished

with a 55-9 record during his high school career ... earned championships in baseball and

football in the 2013 Division 2 CCS ... fi rst-team all-league in baseball.

PERSONAL: Born in Santa Clara, Calif. ... son of Jeff and Lori Guibor ... has an older brother,

Jase ... enjoys golfi ng, playing football and going to the beach ... people he admires the most

are his parents because he would never be where he is at today without them ... chose Fresno

State because of the reputa� on the program upholds ... majoring in kinesiology-sport admin-

istra� on.

AUSTIN GUIBOR’S CAREER STATS


2014 .241 43 18 87 15 21 7 1 2 15 36 .414 8 2015 .339 54 49 183 39 62 6 5 5 21 93 .508 29 2016 .293 58 57 208 44 61 7 3 7 36 95 .457 37 TOTAL .301 155 124 478 98 144 20 9 14 72 224 .469 74


2014 1 17 2 .306 2 3 0 1 42 3 0 1.000 2015 4 31 2 .440 0 11 7 11 94 4 4 .961 2016 3 34 1 .404 2 12 4 6 107 6 2 .983 TOTAL 8 82 5 .401 4 26 11 18 243 13 6 .977

AUSTIN GUIBOR’S SINGLE-GAME HIGHS

AT BATS: 6 (3x)

RUNS: 3 (3x)

HITS: 3 (9x)

RBIS: 4 (vs. Air Force, 4/1/16)

DOUBLES: 1 (20X)

TRIPLES: 1 (9x)

HOME RUNS: 2 (vs. Sac. St., 4/6/16)

TOTAL BASES: 8 (vs. Sac. St., 4/6/16)

WALKS: 3 (vs. Youngstown St.-1,

2/27/16)

STRIKEOUTS: 3 (2x)

SAC HITS: 2 (vs. Long Beach St.,

3/29/16)

SAC FLIES: 1 (4X)

STOLEN BASES: 2 (vs. Youngstown

St.-1, 2/27/16)


ASSISTS: 1 (13X)

ERRORS: 1 (6x)

MARK REECE RHP | R/R | 6-5 | 220 | Sr. | 5th YearRoseville, Calif. (Nevada/Roseville HS)


38

2016 �JUNIOR�: Reece made 17 appearances on the mound as a junior with 16 coming in

relief and started against Saint Mary’s (Mar. 22)... went 1-3 with a 2.96 ERA... tossed 24.1 in-

nings and picked up 16 strikeouts while allowing only 11 runs (eight earned) and 13 walks...

held opponents to a .231 ba" ng average... picked up the win over Cal Poly (May 10) pitching

2.2 innings allowing only two hits in a 9-5 victory for the Bulldogs... had a season-high four

strikeouts in three innings of work and also picked up his lone save of the season against

Youngstown State (Feb. 26) ... named Academic All-MW and also earned Mountain West

Scholar-Athlete honors.

2015 �REDSHIRT SOPHOMORE�: Appeared in 21 games on the mound ... posted a 2-0 record

with a 4.95 ERA ... tossed 20.0 innings on the season with 16 strikeouts ... held opponents to a

.222 ba" ng average ... allowed only 11 earned runs ... threw a season-best 2.1 innings against

USC, while also tossing three strikeouts in a tough extra-inning loss to the Trojans ... tossed

0.2 innings in a 4-0 shutout at home against UNLV on March 1 ... also had a three-strikeout

performance against Nevada (Feb. 20) ... named Academic All-MW ... earned Mountain West

Scholar-Athlete honors.

2014 �SOPHOMORE�: U� lized redshirt season.

PRIOR TO FRESNO STATE: Pitched at Nevada as a true freshman in 2013, throwing 22.2 in-

nings in 10 appearances for the Wolf Pack ... threw 5.1 quality innings with six strikeouts in a

start against Northern Illinois on Feb. 24, 2013.

HIGH SCHOOL: Prepped at Roseville High School in Roseville, Calif. ... was a three-year

le# erwinner in baseball from 2010-2012 and also played a year of varsity basketball in 2011 ...

helped team win a CIF Sac-Joaquin Sec� on championship in 2011 ... earned All-Sierra Foothill

League honors his junior and senior year and also earned All-City honors his senior season ...

threw two no-hi# ers during his senior year, including one at Raley Field -- home of the AAA

Sacramento RiverCats -- on his mother’s birthday.

PERSONAL: Born in Fresno ... parents Glenn and Debra Reece ... has two older brothers, Kevin

and Brian ... one of his siblings is a professional athlete, Kevin - MMA fi ghter ... enjoys fi shing

and watching movies ... was a sports journalist for his high school and once had one of his

stories run on the Sacramento FOX 40 online website ... list his biggest athle� c thrill as being

the day he threw a no-hi# er on his mom’s birthday ... most admires his parents because they

have set such a great example, being suppor� ve and for always being there no ma# er what

... chose to come to Fresno State because of the great history of the baseball program and

because he has deep roots here with lots of rela� ves a# ending Fresno State in the past ...

majoring in health science.

MARK REECE’S CAREER STATS


2015 4.95 2 0 21 0 0 0 1 0 20.0 16 11 11 2016 2.96 1 3 17 1 0 0 0 1 24.1 21 11 8 TOTAL 3.88 3 3 38 1 0 0 1 1 44.1 37 22 19


2015 15 16 3 1 0 95 .222 4 6 0 1 1 2016 13 16 4 2 0 111 .231 1 2 0 3 2 TOTAL 28 32 7 3 0 206 .227 5 8 0 4 3

MARK REECE’S SINGLE-GAME HIGHS

INNINGS PITCHED: 3.2 (vs. Saint

Mary’s, 5/3/16)


EARNED RUNS: 4 (vs. SDSU, 4/25/15)

WALKS ALLOWED: 2 (5x)

HITS ALLOWED: 4 (at Long Beach

State, 3/7/16)

STRIKEOUTS: 4 (vs. Youngstown St.,

2/26/16)



HOMERS ALLOWED: --

WILD PITCHES: 2 (vs UNM, 5/16/15)

HIT BATTERS: 2 (vs. SDSU, 4/25/15)



EDGAR GONZALEZ RHP | R/R | 6-1 | 200 | So. | 2nd YearNewark, Calif. (Newark Memorial HS)


2016 �FRESHMAN�: Gonzalez appeared in 16 games on the mound for the Bulldogs as a fresh-

man... emerged as the ‘Dogs third star� ng pitcher over the course of the season making 15

starts tying for the team lead with Ricky Tyler Thomas & Jimmy Lambert... posted a 2-3 overall

record and a 3.97 ERA... ranked third on the team with 56.2 innings pitched and was fourth

in strikeouts with 47... held opponents to a .272 ba� ng average and allowed only one home

run...picked up his fi rst career win over CSU Bakersfi eld (Mar. 1) tossing fi ve innings allowing

four hits, one earned run and struck out two in a 6-4 win over the Roadrunners... also notched

a win over Air Force (Apr. 3) throwing a season-best 5.2 innings allowing no earned runs with

fi ve strikeouts

HIGH SCHOOL: A! ended Newark Memorial High School ... was a four-year le! er winner as a

pitcher as a Cougar for head coach Phil Castellanos, tossing 62 innings and 75 strikeouts in his

career ... also collected 43 hits, 28 RBI and 21 runs at the plate.

PERSONAL: Born in Mountain View, Calif ... son of Jose Juan Gonzalez and Yolanda

Hermosillo ... has two younger siblings, Diego and Lisandro ... chose Fresno State for its strong

athle� c atmosphere and opportunity to be! er himself as a sudent-athlete as a Bulldog ...

enjoys going out and fi nding new and cool places to hang out with his friends.

39

EDGAR GONZALEZ’S CAREER STATS


2016 3.97 2 3 16 15 0 0 0 0 56.2 62 37 25 TOTAL 3.97 2 3 16 15 0 0 1 0 56.2 62 37 25


2016 25 47 6 0 1 262 .272 14 2 0 3 4 TOTAL 25 47 6 0 1 262 .272 14 2 0 3 4

EDGAR GONZALEZ’S SINGLE-GAME HIGHS

INNINGS PITCHED: 5.2 (vs. Air Force,

4/3/16)


EARNED RUNS: 6 (at New Mexico,

4/10/16)

WALKS ALLOWED: 4 (at UNLV,

5/15/16)

HITS ALLOWED: 7 (3X)

STRIKEOUTS: 6 (2X)

DOUBLES ALLOWED: 2 (at Air Force,

5/1/16)

TRIPLES ALLOWED: --

HOMERS ALLOWED: 1 (vs. Okla-

homa, 3/15/16)


HIT BATTERS: 2 (at Long Beach

State, 3/7/16)

FRED SCHLICHTHOLZ LHP | L/L | 6-3 | 220 | Jr. | 4th YearCoronado, Calif. (Coronado HS)

CAREER APPEARANCES: 14 CAREER STARTS: 0

2016 �REDSHIRT SOPHOMORE�: Made three relief appearances on the mound for the

‘Dogs... tossed a season- best one inning at home against San Francisco (May 19) allowing

only one hit... also made appearances at Texas A&M (March 13) and against Nevada (May 27)

in the Mountain West Tournament.

2015 �SOPHOMORE�: Redshirted.

2014 �FRESHMAN�: Named Mountain West Pitcher of the Week on April 28 (for the week of

April 21-27) - in only appearance of the week, entered play in the 14th inning of a 1-1 game vs.

then-ranked No. 29 Cal State Fullerton on April 23, re� red nine consecu� ve ba! ers faced that

set up a 2-1 walk-off win in the bo! om of the 16th inning ... appeared 11 � mes in relief as a

true freshman ... posted a 1-0 record with one save in 20.2 innings pitched ... registered a 5.66

season ERA, allowed 13 runs, all earned ... tallied 13 strikeouts against eight walks ... recorded

fi rst career save on March 11 in his longest ou� ng of the season (4.0 IP) vs. Penn State ... fi rst

career Division I win earned in relief against Cal State Fullerton on April 23 ... ranked � ed for

16th in the MW for most games fi nished (6).

HIGH SCHOOL: Three-year le! erwinner at Coronado High School under coach Sam Ceci ...

pitched and played ou# ield all three seasons with a focus being on the mound ... named

pitcher of the year for junior and senior seasons ... fi rst-team all-central league ... invited to

Scout Ball All-Star game ... named team captain senior year.

PERSONAL: Born in Chula Vista, Calif. ... son of Chris Schlichtholz ... has two older brothers,

Chris and Alex ... admires his Dad and brothers for being successful men from not coming from

much ... chose Fresno State for the coaches and team environment ... favorite athlete is Sandy

Koufax for the way he played the game of baseball ... biggest athle� c thrill is coming through

in the clutch when the game is on the line .

42

INNINGS PITCHED: 4.0 (vs. Penn State,

3/11/14)

RUNS ALLOWED: 5 (vs. Nevada,

5/27/16)

EARNED RUNS: 5 (vs. Nevada,

5/27/16)


HITS ALLOWED: 6 (at Nevada, 4/17/14)

STRIKEOUTS: 6 (vs. Penn State, 3/11/14)

DOUBLES ALLOWED: 3 (vs. Nevada, 5/27/16)

TRIPLES ALLOWED: 1 (at Texas A&M, 3/13/16)

HOMERS ALLOWED: 1 (vs. Penn State,

3/11/14)

WILD PITCHES: 2 (at Nevada, 4/17/14)

HIT BATTERS: 1 (4X)

FRED SCHLICHTHOLZ’S SINGLE-GAME HIGHS

FRED SCHLICHTHOLZ’S CAREER STATS


2014 5.66 1 0 11 0 0 0 0 1 20.2 25 13 132015 REDSHIRTED 2016 22.50 0 0 3 0 0 0 0 0 2.0 7 5 5 TOTAL 7.30 1 0 14 0 0 0 0 1 22.2 32 18 18


2014 8 13 7 0 1 94 .313 5 4 0 0 2 2015 REDSHIRTED 2016 2 0 3 1 0 14 .583 0 0 0 0 0 TOTAL 10 13 10 1 1 108 .348 5 4 0 0 2



KENNY VARNELL LHP | L/L | 6-3 | 210 | So. | 2nd YearMoorpark, Calif. (Moorpark HS)

CAREER APPEARANCES: 11 CAREER STARTS: 3

2016 �FRESHMAN�: Varnell made 11 appearances on the mound as a freshman... he started

three games at home against Sacramento State (April 6) & Saint Mary’s (May 3) and at Cal

Poly (April 19)... posted a 1-1 record with a 8.24 ERA... tossed 19.2 innings and struck out

12... limited opponents to nine walks... tossed a season-high 5.1 innings allowing three

earned runs and struck out two to pick up his fi rst win as a Bulldog in his star� ng debut, a 7-5

win over Sacramento State... tossed a season-high four strikeouts in 2.1 innings allowing only

one hit in a 7-1 loss at Pacifi c (April 12).

HIGH SCHOOL: A! ended Moorpark High School in Moorpark, Calif ... was named the 2015

Ventura County Pitcher of the Year and 2015 Coastal Canyon Conference Pitcher of the Year

a" er pos� ng a 10-1 mark on the mound with a 1.08 ERA and 74 strikeouts in 71.1 innings

pitched ... also tabbed Ventura County Star fi rst-team ... was a 2014 California Baseball

Coaches Associa� on North/South Series par� cipant on the South Team ... was a 2014 Las-

orda Elite Team and Perfect Game par� cipant ... named a 2014 Red Sox Scout Team member

... ranked as the 33rd-best le" -handed prep pitcher by Perfect Game ... was also recruited by

UCSB, Sea! le, Saint Mary’s, Pacifi c and Dartmouth.

PERSONAL: Born in Kirkland, Wash. ... son of Chris and Jennifer Varnell... has two siblings,

Chris� na and Kevin... business major at Fresno State... choose Fresno State because

becoming a Bulldog was the opportunity of a life� me.

45

KENNY VARNELL’S SINGLE-GAME HIGHS

INNINGS PITCHED: 5.1 (vs. Sacramen-

to State, 4/6/16)

RUNS ALLOWED: 5 (at Cal Poly,

4/19/16)

EARNED RUNS: 4 (2x)


HITS ALLOWED: 7 (at Cal Poly,

4/19/16)

STRIKEOUTS: 4 (vs. Pacifi c, 4/12/16)



HOMERS ALLOWED: 1 (vs.

Sacramento State, 4/6/16)


HIT BATTERS: 1 (3x)

KENNY VARNELL’S CAREER STATS


2016 8.24 1 1 11 3 0 0 0 0 19.2 26 19 18 TOTAL 8.24 1 1 11 3 0 0 0 0 19.2 26 19 18


2016 9 12 3 2 1 95 .333 2 3 0 2 3 TOTAL 9 12 3 2 1 95 .333 2 3 0 2 3

JAKE STONE OF | L/R | 6-0 | 190 | Sr. | 4th YearCarlsbad, Calif. (Rancho Buena Vista HS)


2016 �JUNIOR�: Earned second-team All-Mountain West honors as a junior... joined Aus� n

Guibor as one of two ‘Dogs to start all 58 games on the season... made 37 starts in LF, 20 in CF

and one in RF... led the team in at-bats (218), hits (68), doubles (18), triples (4), runs (44) and

sacrifi ce fl ies (7)... hit .312 from the dish and added three home runs & 35 RBIs... fi nished with

a .384 on-base percentage and a .472 slugging percentage... ranked second on the team with

10 sacrifi ce hits and six stolen bases... had a team-high 19 mul� -hit games, including a season-

best three hits in seven contests... added seven mul� -RBI contests, including a season-high

four at UNLV (May 13) hi$ ng a two-run home run and a two-run RBI triple in a 9-1 win over

the Rebels...fi nished the season on a 12-game hi$ ng streak and reached base in the fi nal 16

contests... named Academic All-MW for the third straight year.

2015 �SOPHOMORE�: Started 20 games for the ‘Dogs and appeared in 37 of the 59 games

on the season ... made 14 starts in right fi eld, fi ve in center fi eld and one at designated hi! er

... had a .220 ba$ ng average and a .317 slugging percentage ... tallied 18 hits on the season,

including three doubles, one triple and a home run ... scored nine runs and drove in four RBIs

... notched a .304 on-base percentage ... had four mul� -hit games and one mul� -RBI game ...

hit his fi rst career home run, a three-run shot, in a 7-2 win over No. 21 California on March 25

... also had a pair of hits, including a double, and scored a run in the fi rst games of a double-

header against Oregon State ... named Academic All-MW for second consecu� ve year.

2014 �FRESHMAN�: Started 18 games and appeared 44 � mes in the 57-game season as a true

freshman ... made 12 starts in le" fi eld and six in center fi eld ... u� lized in fi ve diff erent spots

in the star� ng lineup, ba$ ng seventh in seven games, four � mes at the No. 6, led-off three

� mes and ba! ed from the No. 2 and No. 8 spots two � mes each ... registered his fi rst career

hit during his second career start on March 1 vs. then-ranked No. 18 Texas A&M ... posted fi rst

career RBI in his third career start on March 8 at Air Force with a two-RBI single - a 2-for-5 per-

formance with a single-game season-high three RBI ... owned a .218 season ba$ ng average

and .295 on-base percentage ... registered 17 hits, eight runs scored, two doubles and seven

RBI ... recorded a 1.000 fi elding percentage with 46 chances ... named Academic All-MW.

HIGH SCHOOL: Mul� -sport athlete that earned two le! ers in baseball and one in football

at Rancho Buena Vista High School ... was named second-team all-league as an ou' ielder ...

owned a .420 ba$ ng average with two home runs and had a 1.000 percent fi elding

percentage with 72 putouts as a senior ... played wide receiver for the football team and was

named a fi rst-team all-league selec� on a" er hauling in 462 yards receiving ...

graduated high school with a 3.0 GPA.

PERSONAL: Born in Encinitas, Calif. ... son of Jeff and Julie Stone ... has one older brother,

Joshua ... chose Fresno State because of its winning tradi� on ... majoring in criminology-law

enforcement ... admires his parent for always being suppor� ve ... biggest athle� c trill to date

is going to the CIF Finals ... favorite athletes are Andrew McCutchen and Larry

Fitzgerald.

51

JAKE STONE’S SINGLE-GAME HIGHS

AT BATS: 7 (at New Mexico, 4/9/16)

RUNS: 3 (3x)

HITS: 3 (6X)

RBIS: 4 (at UNLV, 5/13/16)

DOUBLES: 3 (at San Jose State,

3/24/16)

TRIPLES: 1 (5x)

HOME RUNS: 1 (4x)

TOTAL BASES: 7 (3x)

WALKS: 3 (2x)

STRIKEOUTS: 3 (5x)

SAC HITS: 2 (2X)

SAC FLIES: 1 (8x)



ASSISTS: 1 (8X)

ERRORS: 2 (at SDSU, 3/4/16)

JAKE STONE’S CAREER STATS


2014 .218 44 18 78 8 17 3 0 0 7 20 .256 7 2015 .220 37 20 82 9 18 3 1 1 4 26 .317 8 2016 .312 58 58 218 44 68 18 4 3 35 103 .472 27 TOTAL .272 139 96 378 61 103 24 5 4 46 149 .394 42


2014 2 29 2 .295 1 2 1 2 43 3 0 1.000 2015 2 22 0 .304 0 1 0 0 40 1 1 .976 2016 3 44 2 .384 7 10 6 13 109 4 5 .958 TOTAL 7 95 4 .349 8 13 7 15 192 8 6 .971



2017 NEWCOMERSJT ARRUDA INF | L/R | 5-11 | 185 | Fr. | 1st YearClovis, Calif. (Buchanan HS)

HIGH SCHOOL: A 2016 graduate of Buchanan High School, Arruda helped lead the Bears to

the 2015 & 2016 CIF Central Sec� on Baseball Championships and a No. 1 na� onal ranking in

the USA Today Super 25... earned All-league honors in the Tri-River Conference... Cougars

went a combined 59-5 in his fi nal two seasons... as a senior, Arruda appeared in 29 games for

the Bears hi� ng .344 from the plate with 32 hits in 93 at-bats with three doubles, two triples,

one home run and added 13 RBIs and 26 runs scored... had a .451 on-base percentage and a

.462 slugging percentage... was a dual-sport athlete also playing soccer where he helped the

Bears to the 2014 & 2015 CIF Central Sec� on Soccer Championships.

PERSONAL: Son of Jennifer and Tony Arruda... has two brothers, Aaron and Jacob ... en-

joys hanging out with friends and golfi ng... lists winning Valley championships in soccer

and baseball as a senior as biggest athle� c thrills... chose Fresno State because of the

great players on the team and a great coaching staff ... major at Fresno State is business.

15

RYAN JENSEN RHP | R/R | 6-0 | 180 | Fr. | 1st YearSalinas, Calif. (Salinas Union HS)

HIGH SCHOOL: A 2016 graduate of Salinas Union High School, Jensen ranked among the Top

500 players in the country by Perfect Game... was ranked by Perfect Game as the 16th-best

right-handed pitcher in the Class of 2016 in California... was a 2015 NOR CAL High School All

Star Team member... played in the North/South California Games where he was a South Par-

� cipant... also played on the Oakland A’s Area Code Team in 2015... earned All-County Honor-

able Men� on as a sophomore in 2014 before being named Second Team All-County and the

Salinas Union HS MVP in 2015... on the mound as a senior in 2016, Jensen went 2-5 with a 2.75

ERA tossing 40.2 innings with 48 strikeouts and held ba" ers to a .162 average from the plate.

PERSONAL: Son of Chris� ne and Dale Jensen... enjoys fi shing, playing with his dog Luna,

hanging out with friends, watching the Food Network and cooking.. lists scoring four touch-

downs in his last high school football game as his biggest athle� c thrill... chose Fresno State

because it is a championship program and they have his desired major ... major at Fresno State

is plant science and crop produc� on management.

37

OSCAR CARVAJAL RHP | R/R | 6-2 | 180 | Fr. | 1st YearCerritos, Calif. (Gahr HS)

HIGH SCHOOL: A 2016 graduate of Gahr High School in Cerritos, Calif., Carvajal was the Gahr

HS Rookie of the Year as a sophomore in 2014 and earned the team’s Most Improved Pitcher

as a junior in 2015... also helped lead his summer ball club the Playa Vista Orioles to Runner-

Up Silver honors... helped lead the Gladiators to a 25-7 mark as a senior in 2016, including a

perfect 10-0 record in conference ac� on... on the mound as a junior, Carvajal went 1-1 with a

3.86 ERA in 16.1 innings with eight strikeouts and held opponents to a .266 ba� ng average...

ranked among Top 300 players in California in the Class of 2016 by Perfect Game.

PERSONAL: Son of Salma Garcia and Oscar Carvajal Sr.... has two sisters, Breanna and Julian-

na... enjoys hanging out with friends and listening to music... biggest athle� c thrill is winning

a pair of league championships while at Gahr HS... choose Fresno State because they have a

great baseball program and it is a good school... major at Fresno State is kinesiology.

35

CARTER BINS C | R/R | 6-0 | 180 | Fr. | 1st YearFair! eld, Calif. (Rodriguez HS)

HIGH SCHOOL: A 2016 graduate of Rodriguez High School in Fairfi eld, Calif, Bins was a 35th-

round selec� on of the Philadelphia Phillies in the 2016 MLB Dra# ... played in 25 games as a

senior hi� ng .313 from the plate with three doubles, three triples and 21 hits in 67 at-bats

driving in nine RBIs and scored 11 runs... had a .427 on-base percentage and a .447 slugging

percentage... was a captain as a senior earning First-Team All Mon� celo Empire League honors

... named a two-� me Defensive Player of the Year... earned three le" ers in baseball.

PERSONAL: Son of Shelly and Brice Bins... has one brother, Jonathan ... enjoys hanging

out with friends and fi shing... lists bea� ng Vintage High School as a senior and advancing

in the playoff s as his biggest athle� c thrill... chose Fresno State to contribute to a winning

team and help bring Fresno State another College World Series championship ... major

at Fresno State is undecided.

29

ADAM MEDRANO RHP | R/R | 6-3 | 220 | Fr. | 1st YearCovina, Calif. (Charter Oak HS)

HIGH SCHOOL: A 2016 graduate of Charter Oak High School, Medrano ranked among the

Top 500 High School Players in the country by Perfect Game and Top 30 right-handed pitchers

in California... was a two-year team captain at Charter Oak High School and earned Second-

Team All-Hacienda League honors in 2015 and First-Team honors in 2016... as a senior on the

mound, Medrano went 1-1 with a 4.36 ERA tossing 17.2 innings with 14 strikeouts and only

allowed seven walks... was a three-year le" erwinner for the Chargers.

PERSONAL: Son of Herlinda and Humberto Arruda... has two brothers, Jacob and Moses

... enjoys running, cooking and hanging out with friends... was a four-year member of

the honor roll at Charter Oak High School gradua� ng with honors... chose Fresno State

because it felt like home and he enjoyed the opportunity to play for a talented program

... major at Fresno State is computer engineering.

36

JARED AKINS OF | L/R | 6-3 | 195 | Jr. | 3rd YearAltadena, Calif. (Glendale CC/La Salle HS)

GLENDALE COMMUNITY COLLEGE: Appeared in 36 games at Glendale Community College

in 2016... hit .379 from the plate... totaled 55 hits on the season adding six home runs, nine

doubles, 32 runs, 36 RBIs, 18 walks, 14 stolen bases... totaled a .468 on-base percentage and a

.621 slugging percentage... had a .989 fi elding percentage as an ou$ ielder... named the Western

State Conference South Division Player of the Year... also earned a spot on the All-Divison First

Team helping Glendale on its way to the second seed in the regional playoff s.

HIGH SCHOOL: A" ended De La Salle High School where he was a two-year varsity member of

the baseball team... as a senior in 2014, he appeared in 24 games hi� ng .353 with 24 hits in

68 at-bats, smacking four doubles, six triples, 12 RBIs and scored 16 runs... earned All-League

honors, All-CIF and All-State honors.

PERSONAL: Son of Tshobe & Prince Akins... has one sister, Jordyn ... enjoys doing art in his

free � me... was on the honor roll in high school... chose Fresno State because it was the

best place for him to compete and win ... major at Fresno State is art.

40



ISAIAH DAVIS RHP | R/R | 6-1 | 180 | Fr. | 1st YearRialto, Calif. (Carter HS)

HIGH SCHOOL: A 2016 graduate of Carter High School in Rialto, Calif., Davis was a four-year

varsity member of the Lions... as a senior in 2016, Davis hit .347 from the plate and added 19

extra-base hits, 26 RBIs and scored 33 runs in 27 games... earned All-CIF First-Team honors as

a junior in 2015 a� er hi� ng .393 with 10 doubles, three triples and four home runs along with

17 RBIs and scored 29 runs... was a All-CIF Citrus Belt League and First Team All-League selec-

� on as a sophomore in 2014 and was a Second-Team All-League selec� on as a freshman...

was a 2015 Perfect Game Underclass All-American Honorable Men� on and a North/South

California Games South Par� cipant... was a 2015 Scout Ball Team All-Star Team Par� cipant,

Tampa Bay Rays & Angels Elite Par� cipant.. ranked among the Top 225 players in California by

Perfect Game and the 40th-best ou� ielder.

PERSONAL: Son of Lane! e and Perry Davis II... has two brothers, Perry Davis III & Pryce and

two sisters, Lapresha & Ellisha... enjoys swimming, hikings and traveling in his free � me... big-

gest athle� c thrill is leading off a CIF game with a home run against one of the be! er pitchers

in the state... chose Fresno State because of the close knit community and it feels more like a

family than a school... major at Fresno State is biology.

43

TIEGEN JONES LHP | L/L | 6-4 | 190 | Fr. | 1st YearSacramento, Calif. (Capitol Christian HS)

HIGH SCHOOL: A 2016 graduate of Capitol Chris� an High School in Sacramento, Jones was

named the Division V Player of the Year as well as the California Junior Player of the Year in

2015... Earned First-Team All-State, All-City and All-League honors as a junior... helped lead

the Cougars to four straight Division V baseball championships... as a senior in 2016, he went

5-3 with a 1.84 ERA on the mound tossing 49.1 innings striking out 82 while only allowing 13

earned runs and limited opponents to a .197 ba� ng average... earned the Capitol Chris� an

HS team MVP as a sophomore in 2014 and was an Academic All-League selec� on....was also a

basketball standout helping the Cougars to three Division V championships, two NorCal state

� tles and was a Second-Team All-City selec� on.

PERSONAL: Son of Shana & Devon Jones... has two brothers, Isaiah & Myles and one

sister, Mila... enjoys playing sports and listening to music... lists winning championships

with his teammates in high school as his biggest athle� c thrill... choose Fresno State

because of the Valley pride and being welcomed by teammates... major at Fresno State

is business.

48

JJ SANTA CRUZ LHP | L/L | 6-7 | 220 | RJr. | 4th YearFresno, Calif. (Fresno City College)

FRESNO CITY COLLEGE: A! ended Fresno City College for a pair of years (2015-16)... earned

Second-Team All-Conference honors a� er making 15 appearances, including 11 starts, on the

mound in 2016... posted a 6-3 record with a 2.97 ERA tossing 60.2 innings with 64 strikeouts.

HIGH SCHOOL: Graduated from Liberty High School in Madera in 2013 where he was a two-

year le! erwinner in baseball and football... named an All-North Sequoia League fi rst baseman

as a junior in 2012... hit .395 from the plate as a junior with 30 hits, 12 RBIs and 12 runs scored.

PERSONAL: Son of Carrie and Jim Santa Cruz... has one sister, Cassidy... enjoys hanging

out with friends... choose Fresno State because he felt like it was the best place to win a

championship... major at Fresno State is communica� ons.

49

JOEL BUSTOS RHP | R/R | 6-1 | 190 | Fr. | 1st YearFresno, Calif. (Sunnyside HS)

HIGH SCHOOL: A 2016 graduate of Sunnyside High School in Fresno, Bustos earned First-

Team North Yosemite League honors as a senior... went 8-1 with a 1.41 ERA as a senior on

the mound making 10 starts throwing 49.2 innings while allowing only 10 earned runs and

tossed 73 strikeouts.

PERSONAL: Son of Selene Bustos... has two brothers, Noel and Jovanni... has one sister,

Jocelyne... enjoys playing football with his brothers... lists bea� ng Edison to advance to the

Division II semifi nals as his biggest athle� c thrill... choose to a! end Fresno State because he

always wanted to be a Bulldog from a young age... major at Fresno State is criminology.

55

DAVIS MOORE RHP | R/R | 6-4 | 200 | Fr. | 1st YearRancho Cucamonga, Calif. (Los Osos HS)

HIGH SCHOOL: A 2016 graduate of Los Osos High School in Rancho Cucamonga, Calif., Moore

was a 37th-round selec� on of the Chicago Cubs in the 2016 MLB Dra� ... was selected a Raw-

lings-Perfect Game Honorable Men� on All-American and named to the California-All-Region

Second Team... on the mound as a senior in 2016, Moore went 1-7 with a 4.62 ERA pitching

47.0 innings striking out 50 ba! ers while holding opponents to a .277 average from the plate...

hit .313 from the plate with 26 hits and 14 RBIs... was named a Southern Cal League All-Star in

2015 and was a member of the Los Angeles Angels of Anaheim Elite ScoutTeam... was named

the Los Osos HS Team Off ensive MVP in 2015 and the Pitcher of the Year in 2013... earned

Second-Team All-Baseline League honors in 2015.

PERSONAL: Son of Bill and Sara Moore... has one sister, Chelsea... enjoys playing sports,

listening to music and hanging out with friends... biggest athle� c thrill came playing sum-

mer ball games at Angel Stadium.. choose Fresno State because he wanted to be apart of

the baseball environment... major at Fresno State is undecided.

56



Mike Batesole Fresno State Head Coach15th Season | Cal State Fullerton (‘1990)

Mike Batesole, a two-time National Coach of the Year, enters his 15th season as the head coach of the Fresno State Bulldogs.

Under Batesole, the Bulldogs were put on stage in front of the nation and captured America’s hearts as he took the Bulldogs from underdogs to wonderdogs in 2008 to claim the school’s ? rst Division I national championship for any men’s sport. His Bulldogs won seven-straight con-ference titles from 2006-12 and made six NCAA appearances in that time, advancing to the regional title game three times before winning the National Championship.

Most recently, Batesole’s Bulldogs won the Mountain West regular season championship in 2016 with a 21-9 mark in the conference and ? nished 36-22 overall for its most wins in a season since 2011. Batesole picked up his ? rst career Mountain West Coach of the Year honor in 2016 as eight ‘Dogs earned All-MW honors with four being named First-Team and four picking up Second-Team honors.

Jimmy Lambert, who was named the Mountain West Co-Pitcher of the Year, Ricky Tyler V om-as, Brody Russell and Aaron Arruda gave the ‘Dogs their most First-Team selections since 2011, while Jake Stone, Rickey Ramirez, Tim Borst and Scott Silva were selected to the Second-Team.

In the second game of the season, a 2-1 win over Creighton, Batesole picked up his 700th career win and won his 450th contest at Fresno State on Feb. 28 in a 6-1 win over Youngstown State. V e Bulldogs had a player draX ed in the MLB DraX for the 40th consecutive season with a pair of ‘Dogs being selected as Lambert was a ? X h-round selection of the Chicago White Sox and Dylan Lee was taken in the 10th round by the Miami Marlins.

V e Bulldogs ? nished third in the Mountain West with a 18-12 record and a 31-28 overall mark in 2015. Fresno State got oZ to a great start in 2015, sweeping its season opening three-game series against 2014 College World Series participant UC Irvine. V e ‘Dogs posted a 20-8 mark at Beiden Field, and featured MW sweeps over UNLV and San Jose State in Fresno.

AX er Fresno State had six Bulldogs draX ed in the 2014 MLB draX , the ‘Dogs added three more draX selections in the 2015 MLB DraX . Junior catcher Taylor Ward became the ? X h ? rst-round selection to play under Batesole as the Oviedo, Fla., native became the highest draX ed catcher in Fresno State program history aX er he was the 26th overall selection by the Los Angeles Angels. Junior pitcher Jake Shull (11th Rd., Detroit Tigers) and senior pitcher Garrett Mundell (23rd Rd., New York Yankees) were also selected.

In Batesole’s 14-year tenure, the skipper has produced a total of 66 players who have been se-lected in the annual Major League Baseball DraX .

Dedicated not only to excellence on the diamond but in the classroom as well, Batesole saw 16 Bulldogs earn academic all-conference honors in 2016. Additionally, seven Diamond Dogs were celebrated with the Mountain West Scholar-Athlete honor, which recognizes student-athletes that maintain a 3.5 cumulative grade point average or better. Overall, Batesole has had 130 stu-dent athletes receive all-academic selections at Fresno State.

Batesole led the Bulldogs to a historical 2008 season aX er defying the odds and beating six ranked teams and facing six elimination games to win the program’s ? rst-ever National Championship. Six ‘Dogs oZ that team were draX ed to Major League Baseball.

Batesole earned three additional National Coach of the Year accolades that year from the Ameri-can Baseball Coaches Association, FieldTurf and the National College Baseball Writers Associa-tion. V e Bulldogs captured their third-consecutive WAC championship in 2008 and ? nished the postseason run with an overall record of 47-31. Fresno State saw ? ve players earn ? rst-team All-WAC honors in 2008. V e 2008 postseason run was the ‘Dogs fourth appearance at the Col-lege World Series and ? rst National Championship.

Batesole joined the Bulldogs aX er spending seven seasons as head coach at Cal State Northridge. During his tenure, the Matadors captured a Western Athletic Conference (1996) and Big West Conference titles (2002). V e Matadors made two NCAA Tournament appearances under Batesole and his career record of 256-158-1 at Northridge ranks him second all-time in program history in wins. In Batesole’s seven years at Cal State Northridge, 37 of his players made it to the professional ranks.

Batesole earned a bachelor’s degree in kinesiology from Cal State Fullerton in 1990 and received his master’s degree in biomechanics in 1992.

44

Hometown: Anaheim, Calif.

Date of Birth: March 28, 1964

Family: Wife: Susie Children: Kassy, Kally, Kody, Korby

Education: Cal State Fullerton: B.A. in Kinesiology (1990)

Cal State Fullerton: M.S. in Biomechanics (1992)

Overall Record: 734-534-1 (.579) (21 years)

Record at Fresno State: 478-376 (.560) (14 years)

Date Hired: May 28, 2002

• 2003-Present: Fresno State Head Coach

• 1996-2002: Cal State Northridge Head Coach

• 1994-95: Cal State Northridge Assistant Coach

• 1993: Cypress College Assistant Coach

• Los Angeles Dodgers Organization (1985-88)

- San Antonio Missions (‘88)

- Vero Beach Dodgers (‘87)

- Bakersfi eld Dodgers (‘86)

- Great Falls Dodgers (‘85)

• 1984 USA Baseball Team

• Oral Roberts (1983-85)

National Champions: 2008

National Coach of the Year: 2008

Conference Coach of the Year: 2008, 2010 (WAC), 2016 (MW)

Conference Tournament Championships: 6 (WAC)

Regular Season Conferece Championships: 6 (WAC - 5, MW -1)

Players of the Year: 7

Pitchers of the Year: 4

Rookies of the Year: 3

First-team All-Conference selections: 54

All-American selections: 35

First-round MLB Draft picks: 5

Total MLB draft choices: 66

Fresno State Coaching Highlights

Mike Batesole Pro) le

Coaching History

Playing History

MIKE BATESOLE’S YEAR-BY-YEAR RECORDYear School Record (Conf.) Finish 2016$ Fresno State 36-22 (21-9) First2015 Fresno State 31-28 (18-12) V ird2014 Fresno State 28-29 (13-17) FiX h2013 Fresno State 23-33 (14-16) Fourth2012^ Fresno State 31-28 (8-10) FiX h2011*^ Fresno State 40-16 (17-7) First2010* Fresno State 38-25 (16-8) First2009^ Fresno State 32-30 (12-12) V ird2008*^! Fresno State 47-31 (21-11) First2007*^ Fresno State 38-29 (17-7) First2006*^ Fresno State 45-18 (18-6) First2005 Fresno State 30-29 (16-14) Second2004 Fresno State 29-29 (17-12) Second2003 Fresno State 30-29 (14-16) V ird$ MW Regular Season Champion * WAC Regular Season Champion ^ WAC Tourney Champion! National Champion



STEVE ROUSEY Assistant Coach - Pitching 7th Season | Cal State Fullerton (1989)

Steve Rousey enters his seventh season as head coach Mike Batesole’s top assistant coach and the Bulldogs’ pitching coach. Rousey joined the Fresno State baseball sta! in the fall of 2010 and has assisted Batesole in a variety of pursuits that include recruiting, player development, and academic success.

Helping the ‘Dogs claim the 2016 Mountain West championship, the ‘Dogs pitching sta! , under the direction of Rousey, ranked " rst as a team in the MW in ERA (3.72), strikeouts (479), runs allowed (270), doubles allowed (83), opponents batting average (.261), hits allowed (526) and home runs allowed (26). # e ‘Dogs held Mountain West foes to a 2.99 ERA and nearly had a 3:1 strikeout-to-walk ratio in conference play.

Junior Jimmy Lambert was named MW Co-Pitcher of the Year and was selected in the 5th round of the MLB Dra$ by the Chicago White Sox. Senior southpaw Dylan Lee was a 10th round selection of the Miami Marlins as the ‘Dogs had multiple pitchers selected in the MLB Dra$ for the sixth straight season. Senior Tim Borst and junior Rickey Ramirez each picked up Second-Team All-Mountain West honors while Borst ranked second in the conference in saves (8) and Ramirez was tied for sixth in appearances (26).

In 2015, the Bulldogs pitching sta! led the MW with a .252 opposing batting average, and was led by Jake Shull who led the Mountain West with a 1.90 ERA. Splitting his time between start-ing and relieving, Shull " nished second in the conference in opposing batting average (.210) and third in saves (6) and went onto be an 11th round selection of the Detroit Tigers in the 2015 MLB Dra$ . Senior Garrett Mundell was also a 23rd round pick of the New York Yankees and picked up four saves.

In 2014, three of the six Bulldogs dra$ ed in the 2014 MLB Dra$ were pitchers. # e ‘Dogs were led by Jordan Brink as the junior posted an ERA of 2.87 and 62 strikeouts and went on to be selected by the Chicago Cubs in the 11th round, while Derick Velazquez was selected by the Houston Astros in the seventh round and Mundell forewent the MLB to return for his senior season a$ er being dra$ ed by the Arizona Diamondbacks.

Bulldog pitchers have been dra$ ed 18 times during Rousey’s tenure at Fresno State and 11 have earned all-conference honors.

Rousey came to Fresno State a$ er serving as the head coach at Cal State Northridge for eight seasons (2003-10). Rousey was Batesole’s predecessor at CSUN following his tenure as head coach of the Matadors from 1996-2002. In 2010, Rousey’s Cal State Northridge squad secured a winning season a$ er compiling back-to-back back top 40 recruiting classes for the Matadors. # e Matadors saw six players dra$ ed or signed by a Major League Baseball organization o! that team and also had four student-athletes earn All-Big West honors.

Before his career as a coach, he was a top pitcher at Cal State Fullerton. In three seasons with the Titans, he compiled an impressive 15-5 record with 120 strikeouts. Rousey played in the College World Series twice (‘82 & ’84), helping the team to the national championship in 1984.

Rousey earned his bachelor of arts in English from Cal State Fullerton in 1989 and his master’s degree in physical education & health from Azusa Paci" c University in 1992. Rousey and his wife Robin have four children, P.J., Gabbie, Nate, who attends Fresno State, and Faith, who is a freshman on the so$ ball team at Fresno State.

34

RYAN OVERLAND Assistant Coach - 3rd Base Coach 5th Season | Fresno State (2008)

Ryan Overland enters his fi � h season as an assistant coach for Fresno State. Overland works

with the catchers and serves as the third base coach on game days.

Overland helped the ‘Dogs capture their fi rst Mountain West championship in 2016 as it was

his fourth conference championship team he has been apart of at Fresno State a� er winning

three WAC championships as a player (2006-08).

Under Overland, standout Taylor Ward became the highest dra� ed catcher in Fresno State

program history in 2015 a� er being selected by the Los Angeles Angels with the 26th overall

selec� on. The junior started all 59 games leading the Bulldogs in home runs (7), RBI (42) and

total bases (104) and earned fi rst-team All-Mountain West.

The ‘Dogs have had four catchers selected in the last four MLB Dra� s as Ward joins Aus� n

Wynns (10th Rd., Bal� more Orioles) and Trent Garrison (28th Rd., New York Yankees) in 2013

and Trent Woodward (20th Rd., Houston Astros) in 2014.

Overland, who has a long history with Fresno State, was a catcher on the 2008 Na� onal Cham-

pionship team. He later served as the Bulldogs’ baseball intern in 2011 and then as the volun-

teer assistant coach in 2012. Overland obtained his fi rst full-� me assistant coaching posi� on at

Nevada in the fall of 2012 before rejoining Fresno State for the 2013 season.

In between his days as a Bulldog player and coach, Overland served as graduate assistant

coach at South Dakota State (2009-10). He helped lead the Jackrabbits to a regular season

Summit League Championship in 2010 a� er fi nishing the season with a 39-21 mark as the

hi� ng and catching coach.

Under Overland, the Jackrabbits were fi rst in the league in ba� ng average (.350) in 2010 and

set new school records in team hits, runs scored, doubles and wins. Eight all-league student-

athletes were produced under him.

He earned his master’s in health, physical educa� ons and recrea� on from South Dakota State

in 2010.

In his career as a Bulldog student-athlete, he played in over 180 games, won three WAC Cham-

pionships along with the 2008 Na� onal Championship.

Overland earned his bachelor’s degree in communica� ons studies from Fresno State in 2008.

24

Hometown: La Cresenta, Calif.

Date of Birth: March 30, 1964

Family: Wife: Robin Children: P.J., Gabbie, Nate, Faith

Education: Cal State Fullerton: B.A. in English (1988)

Azusa Pacifi c: M.S. in Physical Education (1992)

Date Hired: August 25, 2010

• 2011-Present: Fresno State Assistant Coach

• 2003-2010: Cal State Northridge Head Coach

• 1995-00: Los Angeles City College Head Coach

• 1998-99 (summer): Alaska Goldpanners Assistant Coach

• 1995 (summer): Brewster Whitecaps Head Coach

• 1993-95: Long Beach State Assistant Coach

• Seattle Mariners Organization - 4th Round Selection (1984)

- West Palm Beach Expos (‘87)

- Burlington Expos (‘87)

- Salinas Spurs (‘86)

- Wausau Timbers (‘85)

- Bellingham Mariners (‘84)

• Cal State Fullerton (1982-84)

Steve Rousey Pro! le

Coaching History

Playing History

Hometown: Atascadero, Calif.

Date of Birth: Oct. 25, 1985

Education: Fresno State: B.A. in Communication Studies (2008)

South Dakota State:

M.S. in Health, Physical Education and Recreation (2010)

• 2013-Present: Fresno State Assistant Coach

• 2012: Nevada Assistant Coach

• 2012: Fresno State Volunteer Assistant Coach

• 2011: Fresno State Baseball Intern

• 2009-10: South Dakota State Graduate Assistant Coach

• Fresno State (2005-08)

Ryan Overland Pro! le

Coaching History

Playing History

Date Hired: Jan. 2, 2013



JJ MASCOLO Volunteer Assistant Coach

2nd Season | Western Oregon (2010)

JJ Mascolo enters his second season as a volunteer assistant coach at Fresno State and works

with the ou� ielders and short game.

Mascolo helped the ‘Dogs capture their fi rst Mountain West championship in his fi rst season

with the Bulldogs in 2016.

In 2014 and 2015, Mascolo served as an assistant coach at Western Oregon University as the

infi eld coach helping the Wolves capture two Great Northwest Athle� c Conference � tles and

ranked in the top 20 in fi elding percentage and double plays turned.

Prior to his � me at WOU, Mascolo coached three years at Chemeketa Community College in

Salem, Ore. During his � me at WOU, he was the infi eld coach and recrui� ng coordinator mak-

ing two NWAC tournament appearances.

As a player, Mascolo spent the 2008 and 2009 seasons as a member of two Western Oregon

Baseball regional teams. He helped lead the Wolves to two GNAC conference � tles and in

2009, as a shortstop, was a member of the ABCA/Rawlings all-region team and fi rst-team all-

GNAC, commi� ng only four errors on the season and ba� ng .362 from the plate.

Prior to his � me at WOU, Mascolo played two seasons at San Mateo JC in San Mateo, Calif.

During his � me at San Mateo, the Bulldogs captured two Coast Conference Championships

and in 2007, Mascolo received the Bulldog Award.

Mascolo is a na� ve of Eugene, Ore., and received his bachelor’s degree from Western Oregon

in 2010 in exercise science. Mascolo, currently resides in Clovis with his wife, Jessica.

35

KODY BATESOLE Undergraduate Assistant Coach2nd Season | Buchanan High School (2013)

Kody Batesole enters his fi rst season as an undergraduate coach for the Fresno State baseball

team.

Batesole helped the ‘Dogs capture their fi rst Mountain West championship in his fi rst season

with the Bulldogs in 2016.

The son of head coach Mike Batesole, Kody was a member of the 2014 Diamond Dogs’ as he

redshirted the season.

Batesole was a three-year le! erwinner as a shortstop at Buchanan High School in Clovis, Calif.,

under coach Tom Donald and graduated in the spring of 2013. He was a member of the na-

� onal championship team that clinched the No. 1 ranking in the ESPN RISE POWERADE Fab 50

na� onal rankings in 2011 and graduated high school with a 3.0 GPA.

Batesole is a marke� ng major and has two older sisters, Kassy and Kally, and one younger

brother, Korby, who is currently a sophomore with the Bulldogs.

9

KALI HARTZOLD Graduate Assistant Athletic Trainer 1st Season | Ohio State (2016)

Kali Hartzold is in her fi rst year as the athle� c trainer with Fresno State Baseball.

Originally from Danvers, Illinois, she graduated with a Bachelor of Science in Athle� c Train-

ing from The Ohio State University in May of 2016. Prior to gradua� ng from Ohio State, she

worked as an athle� c training intern at Camp Woodward Tahoe. She is currently pursuing her

Master of Arts in Kinesiology at Fresno State with a focus on sport psychology.

Kali is a member of the Na� onal Athle� c Trainers’ Associa� on. She is Graston-trained and

recently a! ended the 2nd Annual Lewis A. Yocum Baseball Medicine Conference hosted by

TIM BORST Director of Operations 1st Season | Fresno State (2017)

Tim Borst is in his fi rst season as director of baseball opera� ons at Fresno State.

A na� ve of Moreno Valley, Calif., Borst is responsible for coordina� ng team travel, budget

planning, on-campus recrui� ng and the day-to-day opera� ons of the baseball program. In ad-

di� on, Walton serves as the liaison between the baseball staff and academic services,

media rela� ons, marke� ng, fundraising, � cke� ng and the training room staff .

Borst fi nished up his four-year Bulldog career in 2016 by earning Second-Team All-Mountain West

honors as a relief pitcher as he helped the ‘Dogs capture their fi rst Mountain West championship.

Borst went 3-3 with a 1.72 ERA in his fi nal campaign as a Bulldog appearing in a MW-

leading 28 games and � ed for second in the conference with eight saves. He tossed 59

strikeouts in 52.1 innings allowing only 10 earned runs and held ba! ers to a .227 average.

In his four-year career, Borst went 14-14 with a 3.35 ERA in 90 appearances (30 starts) on the

mound. He tossed 258.1 innings, struck out 195 and converted 13 saves. He is � ed for fourth

in program history in career saves and his eight saves in 2016 are � ed for seventh-best in a

single season.

ASHLEY JUDLIN Student Manager 3rd Season | James Madison High School (2014)

Ashley Judlin is in her third season as the Bulldog baseball team’s manager.

Judlin is a junior majoring in kinesiology and sports administra� on.

A na� ve of San Diego, Calif., Judlin is a 2014 graduate of James Madison High School and hopes

to work with a minor league baseball team upon gradua� on.



��

��

��

!�� "#� �� $ �� %� $� �� & �� $" � � " ��& � $ �#� "� � � �� &

�� !!"�#�� $�%��& ��& �& �� & �& � % & '� �$��%�% � % � % �$�%�� % � � �$��'��

��()#�)�"�� $��% ��% �� ' � � %& �$�%�&�& � �� $�%�� &�' && � % �$��&�

��*!+�"�� $��&�� %� � &� �� % � � �$�&�� $�%�� % �� && &� �$��&��

�� $�� %�� ' �� %& � � � � & �$�%�� % �� % �$��&�� & ' �� ' �$��&��

%��(�"�� $�� &%�%� ��% � � �& � �� %% �� $�&�� ' &� � �$�%�� ' �� % �$��'��

�� ,)�("�-��. �$�� %��& ��% �% � � �% %� �$�� % � � �$�%�� % �& � � � �$��

&��/)� "�0�1� �$�� &'�&' ��' %% ' �' % & �� $�%�� %% � �$��'�% � �� % & �$��&�'

�2�*#)�"��3�4� �$�� &'�&� ��' %% � � � �& �$�%�&�� % � �$�%��% � �� %� �� $��'�

�� $��%� &�&� �� % � � � �& %% �$��%�� & � �� $��' � � ��% �� %� �� $��&�&

��5�� "��4�1 �$�� %��%% �� $��&�� % % � % �$�� % �� & & �$��'�

�� $��' '��% '� ' �� ' �� $��%�� $�� % &�� $�'��

�� !��"# �$��% �� ' � � � � % �$��% � � �� $�� $��

�&�+* ��"�6�74� �$�� %�� %� �' �� ' � & � &% �$��'� � ' � �$��' � � �� ' � � �$��&

�&�8�*)�"�0�� $�� % ' ' �% � � �� $��' � � �� $��%�� & �% & �$��

�� $"�� $��'�' �� % ' �� ' �$��'�� $��& � � �� & �$��

��)�( *�)"��0 �$�� $�� $��'� � � �� $��

��()((�"��33 �$�� & � � � � � �$�� $��' � � �� % � � �$��

/��3 �$�� &' �� &�� & � ��& '� �$�%��% ��% %� � �� $�� % � %��% �& &&� �� $��

)99��3 �$�� &' �� &� ' � � �%% ��& �$��&�� ' %� %�� $�� &� �&�� %� ' �$��

!)#��/��:%%;"�)99�:%�;$�(83��/��:�;"�)99�:�;$��*��/��:%;"�5�� "��$�"�8�*)�"�0$��$�*##��/��:�;"

��(�"��$��"�< (��)"�0$��"�)99�:�;$�84�1��< (��)"�0$�"�� !!"�#$��"�()#�)�"��$��"��/)� "�0$��$

�� '�� (��

!�� )#� �"" � �� $� � �" $ � �� %� $� �*�� )" $" �+ �� $�

��#)��/"�/4� ��$�� ' � � �=� ' &�$� %� �� &� � � �$�� & � � &

��%��"�&��' � ��$�� % �& �& �=� � ��%$� ' �& � ��' �% � �$�� '

'�� "�<��1 ��$�� =� � �%$� �� ' � � % � � �$��

(��"$$� ��$�� & �& � �=� � ��$� �' � % �� ' �% � �$��&�� ' % � � &

%&�! "�(�� $�%�& �� =� %�$� %� �� ' �& %% � % �$�� %

()� *��*��+,�� $�� & � �=� � &$� � � �& �& %� � � �$�� % � � %

(-��!��*��"�& � �%�$�&�% %�� =� % �$� %� �' �� %� ' � �$��

��.!��!�� ##�# �&�$��& �� =� � $� %� � �� % �� ' � � �$�� & � � �

%��*��"��.�� $�%�� =� � %$� %� �& �& �� % �� $��% % � � �

��!!*+��"�� $�'�' �� ' � � �=� � '$� �� & �� $��

//�0�� ##� �'�$��% �� =� � ��$� � �� ' � �� $��

�1��%�!�%�%�*��2� + ��$&� �� =� � �$� � & & � � � � �$�&�'� � � � � �

/��3 ��$�� &' &' % =� �� &��$� &� �� ' %�� ' � � �$�� &� %� � ��

)99��3 �%�$��& �� &' &' � �=� �� &�'$� &�� ' ��% � �� & � �$�� &� %� ' �% �

8#��/��:��;"�5�� "��$��"�8�*)�"�0$�%"�)99�:��;$�84�1��3��/��:';"�/ )<��"��$�"�! "�($��"��*��"��$��"�!�<# �/"�0$

�"�5*!!*�<�"�#$��"�)99�:�;$��#�=�//��5�� "��$�:��;"�8�*)�"�0$�:��&;"��<*� -"��$�:��;"�#)��/"�/$�:%��;"�2)�-�! -"� $

:&��;"�!�<# �/"�0$�:%�;"�/ )<��"��$�:%�;"��*��"��$�:��%;"�� "�<$�:%�%;"�5*!!*�<�"�#$�:��;"�+�� !!"�6$�:��;"�! "�($

:��;$

2016 OVERALL SEASON STATISTICS



2016 MW CONFERENCE STATISTICS��

��

��

�� !"� �� # �� $� #� �� % �� #! � ��! ��% � # �"� !� � � ��%

�� ! " � � # �" ��!��" � � ��#��" �! #� ��!�

�$%��%&�� !� �! � # # ��#�� # � �� # ��

��'�(��)) ��" �� # ��#� � ! � ��! � � ! � � ��#�

#��*%&��+�,� �� " ��#�� " # �� #" � ��"

� ��$�� "�� # � " � �# ��" � # � �� ! # � ��!�#

�� -%�$��.��/ �� " �� " � ��!� � �

�� !�� " � ��! � � ! �� # �� # #� � ��#�

��0�'�%��12)3� �� # �� #! � ��!��

�4��&��&3�, �� !�# "� � � � �� "" � ��

�� ! " � ! �� # !# � ��#��

�� #� !� ! ��#� ��

�� ! �� #�! # # # �� ! �

��"# �$!� ��!�� ! � " ! �� "��

�#�('��5�63� ��#�� " #� � � � ! � �� " �� !��

#�7�'%��+�� ! ��# " # � � ��"� � �� " � # # ��

�"�$%$$��22 ��

*�)�82 �� " !� �" ## � # " ��# �� " �! ��! ! � �# ��"�

%99��)2 ��"� � � � !� �� #� �� !� � �� ! �� # � #�� ! � �� # ��"�

�%��*��:�;��%99�:��;��$72�)1��*��:�;��%99�:�;��'��*��:;��4��&��&��'��*��:;��<�$��&%��+��

��$��%99�:!;��73�,��<�$��&%��+��*%&��+��

�� &��'��

�� ("� �!! � �� #� � �! # � �� $� #� �)�� (! #! �* �� #�

��'(�&�� = � ��#�

%&��'��"( � � ��# � = � � � ��!� � �

�"��%��*��*3� ��!� � � = � �� " # " # ��"��

��)��"(��* � �� = "� �� " ��" � � "

��'��)/�� # � � = "� � � � ��

%�� # !� = �!� �# � # ## # ��" �

�!��<��, ��# � � = �� # � ��

�#��$�8�� = � �� ! � ��#�

%+��'��'��,- � ��# � � � = �� " ! # # ��

��.�� "��#�� = �� # � " # ��

//�0�� #� � � = �� " # # � ��!

*�)�82 �� = "�� !� � � !� �� "� " � # �

%99��)2 �#�� = # �!� �" !� # �� ## � # �� !

7��*��:�;��4��&��&��7�'%��+��%99�:;��73�,��2��*��:�;��<��*��+��* %<��4'��'�<��$�

��%99�:�;��=�**��4��&��&��:!��;��7�'%��+��:"��;��%��*��*��:�#;��<'��.��:�#;��* %<��:��#;��0%&.��.��

:��#;��<��*��+��:��;��'��:��;��4'��'�<��:�;�



2016 SEASON RESULTSGame Results for Fresno State (as of Dec 13, 2016)

(All games)

Date Opponent Score Inns Overall MW Pitcher of record Attend Time

Feb 19, 2016 CREIGHTON W 2-1 9 1-0-0 0-0-0 THOMAS, R. (W 1-0) 1 6 6 3 2:53

Feb 20, 2016 CREIGHTON W 2-1 9 2-0-0 0-0-0 LAMBERT, J. (W 1-0) 1 1 4 1 2:25

Feb 21, 2016 CREIGHTON W 7-3 9 3-0-0 0-0-0 ARIAS, A. (W 1-0) 1 3 0 3 2:39

Feb 23, 2016 OAKLAND W 11-10 9 4-0-0 0-0-0 RAMIREZ, R. (W 1-0) 1 1 1 3 3:27

Feb 26, 2016 YOUNGSTOWN STATE W 8-3 9 5-0-0 0-0-0 THOMAS, R. (W 2-0) 1 2 6 1 2:37

Feb 27, 2016 YOUNGSTOWN STATE-1 W 11-0 9 6-0-0 0-0-0 LAMBERT, J. (W 2-0) - 2:31

Feb 27, 2016 YOUNGSTOWN STATE-2 W 6-5 9 7-0-0 0-0-0 RAMIREZ, R. (W 2-0) 1 5 1 2 2:57

Feb 28, 2016 YOUNGSTOWN STATE W 6-1 9 8-0-0 0-0-0 ARIAS, A. (W 2-0) 1 2 1 5 2:55

Mar 01, 2016 CSU BAKERSFIELD W 6-4 9 9-0-0 0-0-0 GONZALEZ, E. (W 1-0) 1 0 3 6 2:53

* Mar 04, 2016 at San Diego State W 3-2 (10) 10-0-0 1-0-0 LEE, D. (W 1-0) 5 1 5 2:59

* Mar 05, 2016 at San Diego State W 10-5 9 11-0-0 2-0-0 LAMBERT, J. (W 3-0) 6 7 9 2:35

* Mar 06, 2016 at San Diego State L 4-5 9 11-1-0 2-1-0 LEE, D. (L 1-1) 3 6 7 2:45

Mar 07, 2016 at Long Beach State L 3-4 9 11-2-0 2-1-0 REECCE, M. (L 0-1) 9 6 1 3:00

Mar 11, 2016 at #3 Texas A&M L 2-3 9 11-3-0 2-1-0 THOMAS, R. (L 2-1) 4 2 4 4 2:22

Mar 12, 2016 at #3 Texas A&M L 3-4 (10) 11-4-0 2-1-0 BORST, T. (L 0-1) 5 0 2 0 3:02

Mar 13, 2016 at #3 Texas A&M L 1-12 9 11-5-0 2-1-0 ARIAS, A. (L 2-1) 4 6 5 6 2:42

Mar 15, 2016 OKLAHOMA L 2-3 9 11-6-0 2-1-0 ARIAS, A. (L 2-2) 1 2 9 5 2:17

* Mar 18, 2016 UNLV L 2-4 9 11-7-0 2-2-0 THOMAS, R. (L 2-2) 9 2 3 2:20

* Mar 19, 2016 UNLV W 6-2 9 12-7-0 3-2-0 LAMBERT, J. (W 4-0) 1 1 5 7 2:28

* Mar 20, 2016 UNLV W 4-3 9 13-7-0 4-2-0 LEE, D. (W 2-1) 1 3 5 3 2:51

Mar 22, 2016 at Saint Mary's (CA) W 6-4 9 14-7-0 4-2-0 BORST, T. (W 1-1) 7 5 3:02

* Mar 24, 2016 at San Jose State W 13-4 9 15-7-0 5-2-0 THOMAS, R. (W 3-2) 3 7 7 2:49

* Mar 25, 2016 at San Jose State W 9-4 9 16-7-0 6-2-0 LAMBERT, J. (W 5-0) 5 8 0 2:27

* Mar 26, 2016 at San Jose State L 2-3 (10) 16-8-0 6-3-0 LEE, D. (L 2-2) 4 5 6 2:46

Mar 29, 2016 #16 LONG BEACH STATE W 10-5 9 17-8-0 6-3-0 WILLIAMS, B. (W 1-0) 1 1 1 2 3:11

* Apr 01, 2016 AIR FORCE W 14-1 9 18-8-0 7-3-0 THOMAS, R. (W 4-2) 1 2 1 4 2:50

* Apr 02, 2016 AIR FORCE W 6-3 9 19-8-0 8-3-0 LAMBERT, J. (W 6-0) 1 3 7 5 2:30

* Apr 03, 2016 AIR FORCE W 5-1 9 20-8-0 9-3-0 GONZALEZ, E. (W 2-0) 1 2 5 0 2:25

Apr 05, 2016 at Pacific Tigers L 6-15 9 20-9-0 9-3-0 ARIAS, A. (L 2-3) 4 3 0 3:05

Apr 06, 2016 SACRAMENTO STATE W 7-5 9 21-9-0 9-3-0 VARNELL, K. (W 1-0) 1 0 6 8 2:29

* Apr 08, 2016 at New Mexico L 1-2 9 21-10-0 9-4-0 THOMAS, R. (L 4-3) 8 1 9 2:03

* Apr 09, 2016 at New Mexico L 13-14 (12) 21-11-0 9-5-0 REECCE, M. (L 0-2) 5 1 9 4:01

* Apr 10, 2016 at New Mexico L 4-7 9 21-12-0 9-6-0 GONZALEZ, E. (L 2-1) 1 1 8 8 2:28

Apr 12, 2016 PACIFIC TIGERS L 3-7 9 21-13-0 9-6-0 RAMIREZ, R. (L 2-1) 9 4 3 2:52

* Apr 15, 2016 NEVADA W 5-4 9 22-13-0 10-6-0 THOMAS, R. (W 5-3) 1 0 1 1 2:10

* Apr 16, 2016 NEVADA W 8-3 9 23-13-0 11-6-0 LAMBERT, J. (W 7-0) 1 1 6 2 2:54

* Apr 17, 2016 NEVADA W 7-6 9 24-13-0 12-6-0 BORST, T. (W 2-1) 1 2 2 9 3:03

Apr 19, 2016 at Cal Poly L 1-7 9 24-14-0 12-6-0 VARNELL, K. (L 1-1) 8 9 1 2:27

* Apr 22, 2016 SAN JOSE STATE W 6-0 9 25-14-0 13-6-0 THOMAS, R. (W 6-3) 9 4 7 1:55

* Apr 23, 2016 SAN JOSE STATE W 8-6 9 26-14-0 14-6-0 LAMBERT, J. (W 8-0) 1 4 5 6 2:48

* Apr 24, 2016 SAN JOSE STATE L 5-7 (12) 26-15-0 14-7-0 BORST, T. (L 2-2) 1 0 9 1 3:50

Apr 27, 2016 at Sacramento State L 4-5 (11) 26-16-0 14-7-0 REECCE, M. (L 0-3) 6 3 6 3:06

* Apr 30, 2016 at Air Force-1 W 11-6 9 27-16-0 15-7-0 THOMAS, R. (W 7-3) - 2:56

* Apr 30, 2016 at Air Force-2 W 5-1 9 28-16-0 16-7-0 LAMBERT, J. (W 9-0) 1 4 5 2:35

* May 01, 2016 at Air Force W 4-2 9 29-16-0 17-7-0 WILLIAMS, B. (W 2-0) 8 6 2:31

May 03, 2016 SAINT MARY'S (CA) W 3-2 9 30-16-0 17-7-0 RAMIREZ, R. (W 3-1) 9 6 2 2:52

* May 06, 2016 SAN DIEGO STATE L 2-4 9 30-17-0 17-8-0 THOMAS, R. (L 7-4) 9 2 4 2:28

* May 07, 2016 SAN DIEGO STATE W 1-0 (10) 31-17-0 18-8-0 RAMIREZ, R. (W 4-1) 1 8 0 4 3:08

* May 08, 2016 SAN DIEGO STATE W 4-3 9 32-17-0 19-8-0 BORST, T. (W 3-2) 9 5 8 2:35

May 10, 2016 CAL POLY W 9-5 9 33-17-0 19-8-0 REECCE, M. (W 1-3) 9 3 7 2:43

* 05-13-16 at UNLV W 9-1 9 34-17-0 20-8-0 THOMAS, R. (W 8-4) 6 0 6 2:20

* 05-14-16 at UNLV W 7-2 9 35-17-0 21-8-0 LAMBERT, J. (W 10-0) 4 1 6 2:19

* 05-15-16 at UNLV L 5-8 9 35-18-0 21-9-0 GONZALEZ, E. (L 2-2) 3 1 6 2:36

May 19, 2016 SAN FRANCISCO W 10-1 9 36-18-0 21-9-0 THOMAS, R. (W 9-4) 9 9 6 2:44

May 20, 2016 SAN FRANCISCO L 3-7 9 36-19-0 21-9-0 LAMBERT, J. (L 10-1) 1 0 7 1 2:38

May 21, 2016 SAN FRANCISCO L 3-6 9 36-20-0 21-9-0 GONZALEZ, E. (L 2-3) 1 0 8 0 2:45

May 26, 2016 vs Air Force L 7-9 9 36-21-0 21-9-0 BORST, T. (L 3-3) 0 2:43

May 27, 2016 vs Nevada L 6-25 8 36-22-0 21-9-0 LAMBERT, J. (L 10-2) 0 3:17

() extra inning game



Year Coach W L T Pct. 1922 Arthur Jones 2 2 0 .5001923 Arthur Jones 2 4 0 .3331924 Arthur Jones 8 3 0 .7271925 Arthur Jones 7 4 0 .6361926 Arthur Jones 5 0 0 1.000 1930 Stan Borleske 2 3 0 .4001931 Stan Borleske 2 8 0 .2001936 Stan Borleske 5 5 0 .5001937 Stan Borleske 15 0 0 1.0001938 Stan Borleske 11 5 0 .6881939 Stan Borleske 12 7 0 .632

CALIFORNIA COLLEGIATE ATHLETIC ASSOCIATIONYear Coach W L T Pct. 1940 Stan Borleske 14 11 0 .5601941 Stan Borleske 17 5 0 .773 1942 Alvin Pierson 8 7 0 .5331943 Alvin Pierson 15 8 0 .652 1944 Earl Wight 1 4 0 .2001945 Earl Wight 0 6 0 .0001946 Earl Wight 15 7 0 .682 1947 Ken Gleason 9 20 0 .310 1948 Pete Beiden 26 11 0 .7031949 Pete Beiden 29 9 0 .7631950 Pete Beiden 29 13 0 .6911951 Pete Beiden 36 4 0 .9001952 Pete Beiden 33 11 0 .7501953 Pete Beiden 27 11 0 .711 1954 Pete Beiden 26 16 0 .6191955 Pete Beiden 31 14 0 .6891956 Pete Beiden 28 13 0 .6831957 Pete Beiden 20 12 0 .6251958 Pete Beiden 23 9 0 .7191959 Pete Beiden 41 13 0 .7591960 Pete Beiden 25 15 0 .6251961 Pete Beiden 36 9 0 .8001962 Pete Beiden 34 8 0 .8101963 Pete Beiden 29 17 0 .6301964 Pete Beiden 30 13 0 .6831965 Pete Beiden 22 14 0 .6111966 Pete Beiden 32 14 0 .696 1967 Bob Benne! 38 10 0 .792 1968 Pete Beiden 20 23 0 .4651969 Pete Beiden 25 19 0 .577

PACIFIC COAST ATHLETIC ASSOCIATIONYear Coach W L T Pct.1970 Bob Benne! 35 20 0 .6361971 Bob Benne! 35 24 0 .5931972 Bob Benne! 31 26 0 .5441973 Bob Benne! 31 24 0 .5641974 Bob Benne! 38 20 0 .6551975 Bob Benne! 26 33 0 .4411976 Bob Benne! 28 29 0 .491

NORTHERN CALIFORNIA BASEBALL ASSOCIATIONYear Coach W L T Pct.1977 Bob Benne! 39 21 0 .6501978 Bob Benne! 38 20 0 .6551979 Bob Benne! 37 27 0 .5781980 Bob Benne! 43 12 0 .7821981 Bob Benne! 43 22 0 .6621982 Bob Benne! 45 13 0 .7761983 Bob Benne! 45 19 0 .7031984 Bob Benne! 54 12 2 .794

PACIFIC COAST ATHLETIC ASSOCIATIONYear Coach W L T Pct. 1985 Bob Benne! 43 22 0 .6771986 Bob Benne! 29 27 1 .5181987 Bob Benne! 34 26 0 .5671988 Bob Benne! 56 12 0 .824

BIG WEST CONFERENCEYear Coach W L T Pct. 1989 Bob Benne! 44 19 0 .6981990 Bob Benne! 38 24 0 .6131991 Bob Benne! 42 23 0 .6461992 Bob Benne! 37 20 0 .649

WESTERN ATHLETIC CONFERENCEYear Coach W L T Pct. 1993 Bob Benne! 41 22 0 .6511994 Bob Benne! 36 27 0 .5711995 Bob Benne! 41 22 0 .6511996 Bob Benne! 36 24 0 .6001997 Bob Benne! 40 28 0 .5881998 Bob Benne! 33 28 1 .5411999 Bob Benne! 33 30 0 .5242000 Bob Benne! 40 21 0 .6562001 Bob Benne! 41 25 0 .6212002 Bob Benne! 32 27 0 .571 2003 Mike Batesole 30 29 0 .5082004 Mike Batesole 29 29 0 .5002005 Mike Batesole 30 29 0 .5082006 Mike Batesole 45 18 0 .7142007 Mike Batesole 38 29 0 .5672008 Mike Batesole 47 31 0 .6022009 Mike Batesole 32 30 0 .5162010 Mike Batesole 38 25 0 .6032011 Mike Batesole 40 16 0 .7142012 Mike Batesole 31 28 0 .525

MOUNTAIN WESTYear Coach W L T Pct. 2013 Mike Batesole 23 33 0 .4112014 Mike Batesole 28 29 0 .491 2015 Mike Batesole 31 28 0 .5252016 Mike Batesole 36 22 0 .621

NCAA CHAMPIONS2008 Na" onal Champions

YEAR-BY-YEAR RECORDS/CHAMPIONSHIPS

1924 Champions (Conf. N/A) 1941 CCAA Champions1950 CCAA Champions1951 CCAA Champions1954 CCAA Champions1956 CCAA Champions1959 CCAA Champions1961 CCAA Champions1962 CCAA Champions1966 CCAA Champions1967 CCAA Champions1971 PCAA Champions1977 NCBA Champions1979 NCBA Champions1980 NCBA Champions1981 NCBA Champions1982 NCBA Champions1983 NCBA Champions1984 NCBA Champions1985 PCAA Champions

1988 PCAA Champions1989 Big West League1990 Big West League1991 Big West League1993 WAC West Champs WAC Tournament1994 WAC West Champs1995 WAC Tournament1998 WAC West Champs2006 WAC League Title WAC Tournament2007 WAC League Title WAC Tournament2008 WAC League Title WAC Tournament2009 WAC Tournament2010 WAC League Title2011 WAC League Title WAC Tournament2012 WAC Tournament2016 MW League Title

CONFERENCE CHAMPIONS



T�� W L T Air Force 22 7 0Arizona 4 7 0Arizona State 7 12 0Arkansas 0 1 0Binghamton 1 0 0Bowling Green 2 1 0Brigham Young 21 12 0Bucknell 3 0 0Buff alo 4 0 0Butler 3 1 0California 62 69 0Cal Poly Pomona 10 8 0Cal Poly 93 56 0CS Dominguez Hills 3 2 0Chapman 3 1 0Chicago State 6 0 0Chico State 3 1 0Clemson 4 2 0Colorado State 1 0 0Creighton 5 4 0CS Fullerton 38 55 0CS Hayward 17 5 0CS Los Angeles 44 20 0CS Northridge 52 25 0CS Stanislaus 6 6 0CSU Bakersfi eld 13 14 0Dallas Bap� st 7 7 0Eastern Michigan 3 0 0Evansville 1 0 0Florida 0 1 0Florida State 1 0 0Fordham 1 0 0George Washington 2 0 0Georgia 2 1 0Gonzaga 27 1 0Grand Canyon 4 0 0Hawai‘i 80 52 1Hawai‘i-Hilo 14 2 0Hawai’i-Pacifi c 1 0 0Houston 0 1 0Humboldt State 2 0 0Illinois 1 0 0Illinois State 3 0 0Indiana 2 1 0Indiana State 3 1 0Iona 3 1 0Iowa 3 1 0Iowa State 1 1 0Kansas 1 1 0Kansas State 2 0 0Kent State 2 0 0Kentucky 1 0 0Lafaye� e 1 0 0Liberty 1 0 0Lipscomb 3 1 0Long Beach State 59 51 0Louisiana Lafaye� e 5 1 0Louisiana State 0 2 0Louisiana Tech 32 23 0Loyola Marymount 28 16 0Maine 2 0 0Miami (Fla.) 0 1 0Miami (Ohio) 2 1 0Michigan 3 1 0Michigan State 1 0 0Minnesota 4 1 0Missouri 1 1 0Monmouth 1 0 0 Navy 1 0 0Nebraska 10 9 0

T�� W L T Nevada 100 60 0New Mexico 14 23 0New Mexico State 30 9 1North Carolina 4 3 0North Carolina State 1 0 0Northern Arizona 1 0 0Northwestern 0 1 0Notre Dame 4 1 0Oakland (MI) 1 0 0Ohio State 1 0 0Oklahoma 0 1 0Oklahoma State 0 2 0Old Dominion 3 0 0Oral Roberts 2 0 0Oregon 5 9 0Oregon State 28 13 0Pacifi c 96 46 0Pennsylvania 4 0 0Penn State 3 0 0Pepperdine 40 27 0Portland 10 5 0Portland State 4 0 0Purdue 1 0 0Rhode Island 1 0 0Rice 17 29 0Sacramento State 116 32 1St. John’s 2 0 0Saint Mary’s 70 22 0San Diego 20 7 0San Diego State 94 93 0San Francisco 76 19 0San Francisco State 29 7 0San Jose State 160 84 0Santa Clara 71 45 0Sea� le 2 0 0Seton Hall 1 0 0Southern Illinois 2 1 0Southern Utah 3 0 0Stanford 50 86 0Stetson 0 1 0Temple 1 0 0Tennessee 1 0 0Texas A&M 6 3 0TCU 12 8 0Texas Tech 2 1 0Toledo 1 0 0Tulane 0 1 0UC Davis 39 17 0UC Irvine 34 10 0UC Riverside 1 1 0UCLA 28 30 0UC Santa Barbara 51 39 0UNLV 50 33 0USC 27 41 0U.S. Interna� onal 5 1 0Utah 6 1 0Utah State 1 0 0Utah Valley State 2 1 0Virginia Tech 1 2 0Wagner 2 0 0Washington 9 8 0Washington State 20 9 0Western Michigan 1 0 0Western Oregon State 2 0 0Westmont 4 1 0Wichita State 0 1 0Willame� e 1 0 0Winthrop 0 1 0Wyoming 6 1 0Youngstown State 4 0 0

ALL-TIME SERIES RECORDS (1950-Present)

Arizona 4 7 0 New Mexico 14 23 0

Georgia 2 1 0 Santa Clara 71 45 0

Clemson 4 2 0 Pennsylvania 4 0 0

Kansas State 2 0 0 UC Riverside 1 1 0

Butler 3 1 0 Ohio State 1 0 0

Illinois 1 0 0 Tennessee 1 0 0

CSU Bakersfi eld 13 14 0 Sacramento State 116 32 1

Louisiana State 0 2 0 Utah Valley State 2 1 0

Bowling Green 2 1 0 Northern Arizona 1 0 0

Hawai‘i-Hilo 14 2 0 Southern Utah 3 0 0

CS Hayward 17 5 0 Portland State 4 0 0

Liberty 1 0 0 USC 27 41 0

CS Dominguez Hills 3 2 0 Oral Roberts 2 0 0

Iona 3 1 0 Toledo 1 0 0

Florida 0 1 0San Diego 20 7 0San Diego State 94 93 0

Miami (Fla.) 0 1 0Washington 9 8 0Washington State 20 9 0

Monmouth 1 0 0 Winthrop 0 1 0

Arkansas 0 1 0 North Carolina 4 3 0

Grand Canyon 4 0 0 Seton Hall 1 0 0

Creighton 5 4 0 Pepperdine 40 27 0

Kentucky 1 0 0 UC Santa Barbara 51 39 0

Cal Poly Pomona 10 8 0 Oklahoma State 0 2 0

Indiana 2 1 0 TCU 12 8 0

Dallas Bap� st 7 7 0Eastern Michigan 3 0 0 Saint Mary’s 70 22 0

Loyola Marymount 28 16 0 Wagner 2 0 0

Minnesota 4 1 0 Wichita State 0 1 0

Bucknell 3 0 0 Notre Dame 4 1 0

Houston 0 1 0 Stetson 0 1 0

CS Northridge 52 25 0 Rhode Island 1 0 0

Long Beach State 59 51 0 Utah 6 1 0

Chicago State 6 0 0 Oregon State 28 13 0

Iowa State 1 1 0 UC Davis 39 17 0

Fordham 1 0 0 San Francisco State 29 7 0

Miami (Ohio) 2 1 0Michigan 3 1 0

Western Michigan 1 0 0Western Oregon State 2 0 0

Nebraska 10 9 0 Youngstown State 4 0 0



A�� F�� (22-7)1997 - 8-9 (11); 7-0; 24-0

1999 - 8-7; 0-2; 7-6

2013 - 7-14; 9-4; 8-5; 7-0; 8-6; 5-3; 6-4

2014 - 2-6; 7-5; 10-8; 8-1; 6-1; 11-1

2015 - 1-2; 1-10; 6-5

2016 - 14-1; 6-3; 5-1; 11-6. 5-1, 4-2;

7-9

A��!�"# (4-7)1955 - 4-2; 2-6

1959 - *1-5; *2-0

1961 - 10-11; 5-4; 9-2

1980 - *4-5

1985 - *0-6; *3-10

1993 - 9-19

A��!�"# S$#$� (7-12)1977 - 4-6; 3-4; 5-9

1978 - 7-5; 0-15; 4-6

1979 - 0-1; 9-13; 4-5

1981 - 7-5

1983 - *2-7

1997 - 2-23; 2-9; 10-8 (10)

1998 - 9-3; 5-3 (10)

2008 - 4-12; 8-6; 12-9

A�%#"&#& (0-1)1990 - 4-6

B�"'*#+$�" (1-0)2006 – 7-6

B�,.�"' G��" (2-1)1998 - 4-5

2000 - 5-1

2003 - 7-3

B/�%"�.. (3-0)2001 - 13-7

2006 – 3-1; 13-1

B/55#.� (4-0)2009 – 6-3; 22-4; 7-5; 20-0

B/$.�� (3-1)2012 - 3-0; 9-12; 6-0; 17-2

BYU (21-12)1981 - 6-0

1983 - 6-7; *13-6

1984 - 1-8; 9-0

1985 - *12-8

1988 - 7-4; 7-3; *9-4

1992 - 4-3; 3-4; 4-3

1993 - 14-20; *9-6; *4-7; *4-1

1994 - *1-2; *6-8

1995 - *18-3; *3-2

1997 - *8-5

1998 - 10-9; 9-2; 6-10

1999 - 3-2 (10); 7-2; 6-8

2001 - 1-4; 4-7; 6-3

2004 - 3-5; 10-9

2014 - 2-1

C#.�5��"�# (62-69)1952 - 1-0; 16-7

1956 - 5-3; 3-6; 7-8

1957 - 5-2; 4-8; 2-3

1958 - 3-1

1959 - 1-2; 4-2; 10-8

1960 - 4-7; 0-4; 7-1

1961 - 3-4; 5-4

1963 - 2-0; 6-0; 4-3

1964 - 0-4; 4-8; 0-2

1965 - 4-3; 4-3; 1-4

1966 - 1-0; 0-1

1967 - 4-1; 9-6

1968 - 2-3; 4-7; 5-8

1969 - 2-3; 1-0

1970 - 2-3; 8-7; 4-3; 4-2

1971 - 9-6; 6-0; 8-0; 0-1; 1-4

1972 - 3-2; 1-3; 3-0; 6-2

1973 - 5-1; 5-7 (12); 7-8

1974 - 2-0; 0-3; 4-7; 13-4

1975 - 0-8; 2-3

1976 - 0-8; 5-9

1977 - 2-7; 1-2; 4-1

1978 - 4-5; 5-11; 8-4

1979 - 11-5; 6-5; 4-5

1980 - 9-8 (10); 7-3

1981 - 2-3

1982 - 11-3

1983 - 10-5; 5-4; 2-1

1984 - 5-3

1985 - 13-7; 12-13 (11); 1-4; *7-6 (10)

1986 - 4-7; 5-15; 3-11

1987 - 14-5; 5-11; 6-3

1988 - 14-12 (13); 12-15; 5-6

1989 - 2-5; 4-6

1990 - 7-1; 13-3; 3-7

1991 - 8-10; 14-15; 17-9

1992 - 10-4; 4-5; 4-14

1993 - 3-2; 5-9; 10-2

1994 - 1-2

1995 - 13-7; 8-1; 7-4

1996 - 4-1; 3-5; 4-13

1999 - 4-6; 6-16

2000 - 10-12 (12); 11-2

2002 - 2-9

2003 - 2-4

2004 - 4-16; 0-2; 18-1

2008 - 4-14; 4-5

2010- 5-8

2012 - 6-7

2013 - 4-5; 1-8; 3-4; 4-8

2014 - 6-0; 7-4

2015 - 7-2; 1-4

C#. P�.8 P�+�"# (10-8)1966 - *5-4

1967 - 6-1; 5-3; 1-0

1968 - 0-1; 1-2; 0-2

1969 - 2-1; 7-3; 6-3

1979 - 1-6

1980 - 4-5

1984 - 0-6; 6-2

1985 - 4-1

1988 - 8-9; 10-5

1990 - 4-8

C#. P�.8 (93-56)1951 - 14-3; 6-5; 14-2

1955 - 8-2; 11-3; 2-4

1957 - 9-2; 12-11; 13-1

1958 - 2-3; 10-7; 2-0

1959 - 8-2; 15-18; 23-1

1960 - 5-0; 3-0; 0-2

1961 - 13-1; 6-0; 6-1

1964 - 7-3; 3-4; 0-1

1965 - 3-2; 4-6; 3-2; 9-4

1966 - 8-1; 11-2; 8-2; 9-1

1967 - 8-0; 17-1; 6-1

1968 - 2-7; 12-11; 5-4

1969 - 8-9; 0-6; 2-1

1970 - 0-3; 5-3; 4-3; 6-2; 5-2; 3-11

1971 - 1-2; 3-1; 1-0; 7-2

1972 - 3-6; 5-2; 3-5

1973 - 10-7

1974 - 4-2

1975 - 3-2; 3-0

1976 - 6-2; 4-5

1977 - 8-4

1978 - 8-6

1980 - 3-0; 4-1

1981 - 3-6

1982 - 0-3; 11-0; 7-6

1983 - 17-6

1984 - 1-0; 8-2

1985 - 12-11 (10); 5-8

1986 - 11-2; 5-4; 4-7

1987 - 6-3; 15-4

1988 - 6-1; 17-7

1989 - 14-4; 3-2; 13-3

1990 - 6-5; 14-3

1991 - 6-5; 7-8

1992 - 2-15; 9-8 (11)

1993 - 8-1; 2-4

1994 - 15-4; 9-7

1995 - 5-6; 9-4; 6-3; 10-0; 5-3; 13-3

1996 - 0-2; 9-6; 3-2; 8-11; 20-10; 5-9

1997 - 9-12; 3-9

1998 - 8-3; 11-6

1999 - 7-1; 8-1

2000 - 6-4; 0-4

2001 - 8-5; 4-9

2002 - 14-7

2003 - 3-13; 3-2 (8)

2004 - 8-2; 5-4

2005 - 3-5; 3-7; 7-9

2006 - 3-6; 1-4; 8-9

2007 - 3-6; 4-6; 9-16; 0-13

2008 - 1-2; 10-9; 13-11; 5-8; 7-10

2009 - 11-13; 16-17

2010- 10-9; 7-5; 3-7

2011 - 4-11; 3-4

2012 - 5-3; 3-2

2015 - 6-7; 6-10

2016 - 1-7; 9-5

C#. S$#$� D�+�"'/�! H�..& (3-2)1980 - 3-1; 12-2

1981 - 1-2

1988 - 4-7; 11-1

C#. S$#$� F/..��$�" (38-55)1967 - 10-3; 4-2; 9-4

1968 - 3-5; 10-2; 8-5

1969 - 2-10; 0-4; 5-3

1975 - 5-6; 6-4; 6-11

1976 - 1-4; 6-11; 6-11

1979 - *3-12

1980 - *2-10

1981 - 6-1; 7-5; 3-2; *8-9; *9-10

1982 - 4-6; 8-4; 9-4

1983 - 2-5; *5-7; 6-3

1984 - 2-4; 2-3; 3-5

1985 - 3-1; 15-7; 4-9; *9-7; *14-6

1986 - 6-13; 8-4; 13-4; 1-8

1987 - 3-4 (10); 11-9; 2-3

1988 - 3-2; 5-3; 15-8

1989 - 6-5 (11); 7-6; 9-8

1990 - 3-6; 2-5; 4-15

1991 - 1-0; 6-4; 5-20

1992 - 1-2; 3-12; 7-6 (12)

1994 - 5-2; 12-6

1995 - 6-3; 3-4; 3-7

1996 - 2-17; 3-5; 5-6

1997 - 2-3; 4-3; *8-7

1998 - 3-6; 4-11; 1-15

1999 - 7-15; 3-4; 4-8

2002 – 0-3; 11-17; 10-4

2003 - 0-12; 1-10; 4-10

2004 - 7-5; 5-15; 9-12 (10)

2005 - 1-12; 0-9

2006 – 2-9; 3-10

2007 - 4-6; 2-13

2010 – 5-0

2014 - 2-1 (16); 1-8

C#. S$#$� H#8,#�< (17-5)1967 - 10-3; 16-7

1968 - 0-7

1970 - 14-6

1971 - 7-1

1973 - 17-0; 9-0; 7-4; 0-3

1974 - 0-1; 7-4; 9-1; 8-7; 0-2

1975 - 7-6; 3-5; 7-1; 7-6

1976 - 11-4; 6-1; 4-2; 9-7

C#. S$#$� L�& A"'�.�& (44-20)1951 - 13-2; 8-4; 17-7

1955 - 10-2; 6-2; 16-8

1957 - 6-1; 14-5; 12-5

1958 - 6-2; 12-5; 4-2

1959 - 10-1; 6-1; 2-1

1960 - 7-5; 11-9; 6-7

1961 - 5-7; 10-0; 7-4

1964 - 1-2; 2-5; 13-1

1965 - 10-5; 5-9; 3-1

1966 - 7-6; 15-13; 6-3; 2-10

1967 - 7-4; 9-4; 6-5

1968 - 3-2; 13-3; 1-3

1969 - 9-3; 3-1; 2-1

1970 - 4-1; 0-1

1971 - 2-1; 3-4; 5-0

1972 - 3-6; 5-1; 5-6

1973 - 6-7; 5-2; 0-1

1974 - 5-6; 3-4; 1-11

1977 - *7-4; *11-15

1978 - 7-5; 9-0

1986 - 0-2

1987 - 6-8; 6-8

1988 - 7-4; 14-4

1989 - 12-5

C#. S$#$� N��$*��<'� (52-25)1961 - 10-3; 20-1; 15-4

1964 - 10-6; 8-7; 2-1

1965 - 4-5; 1-5; 4-2

1966 - 5-2; 2-1; 1-4; 9-2

1967 - 7-5; 4-0; 6-4

1968 - 2-7; 6-5; 5-2

1969 - 9-4; 1-4; 5-0

1971 - 2-7; 1-6; 11-4

1972 - 4-8; 5-4; 1-0

1974 - 10-9; 12-6

1980 - 2-4; 12-4

1981 - 5-4; 6-11

1983 - 4-7; 12-4

1986 - 5-4

1987 - 11-3; 12-6

1988 - 2-5; 10-3

1989 - 2-4

1990 - 10-1

1991 - 1-4; *7-2; *2-6; *6-5

1992 - 5-10

ALL-TIME SERIES RECORDS (1950-Present) * Indicates Postseason Game



ALL-TIME SERIES RECORDS (1950-Present)1993 - 5-3; 7-6 (10); 10-1; 6-13; 5-13;

11-3

1994 - 2-3; 9-6; 8-9; 12-4; 9-1; 8-7

1995 - 7-1; 12-8; 8-6; 11-7; 12-11 (10);

0-1

1996 - 2-4; 3-29; 11-8; 1-8; 7-2; 6-2

1997 - 9-0

2007 - 8-4; 3-10; 7-6

2014 - 8-2

2015 - 4-3 (16)

C�� S�� S��!��"! (6-6)1972 - 16-4; 6-3

1973 - 1-2

1974 - 3-1; 3-4; 1-0

1975 - 3-4

1976 - 6-2; 6-2; 5-6

1977 - 2-5; 4-5

C#�$%�� (3-1)1992 - 6-8

1993 - 4-3; 12-0; 21-4

C#�&�'* S�� (6-0)1997 - 12-5

2004 - 12-0

2005 – 12-3; 15-4; 3-0; 26-0

C#�&* S�� (3-1)1952 - 2-1; 5-0

1976 - 9-12

1984 - 6-5

C��%!*� (4-2)1988 - 13-10

1990 - 5-2

1993 - *3-10; 11-4

1994 - 11-5; 8-13 (10)

C*�*+�,* S�� (1-0)1959 - *6-5

C+��'#�*� (5-4)1992 - 9-10 (10); 13-3

2000 – 3-12; 5-1 (12)

2014 - 1-2; 2-6

2016 - 2-1; 2-1; 7-3

CSU B�.�+!/��, (13-14)2009 – 16-1; 3-2; 9-8; 3-4; 9-2; 12-17;

2-3

2010- 10-4, 13-9, 13-9; 2-12

2011 - 9-2; 0-6; 2-5; 4-7

2012 - 0-4; 2-1; 5-0; 1-8

2013 - 3-5; 5-8; 0-2; 7-4

2014 - 3-6; 8-4

2016 - 6-4

D��! B�$��!� (7-7)2004 - 2-6; 0-13; 5-4; 7-9

2005 - 13-5

2006 – 3-10; 7-9; 13-4; 6-3

2007 - 9-5; 10-12

2010- 9-13, 14-7, 15-7

E�!��+� M�&#�'�� (3-0)1990 - 14-3

2001 – 11-3; 8-2

E8��!8�� (1-0)1998 - 5-3

F�*+�,� (0-1)1991 - *1-2

F�*+�,� S�� (1-0)1991 - *6-3

F*+,#�% (1-0)2002 - 18-8

G�*+'� W�!#��'�*� (2-0)1988 - 17-2

1990 - 4-2

G�*+'�� (2-1)2008 - *6-7; *19-10; *6-1

G*�9�'� (27-1)1970 - 6-0

1971 - 3-2; 7-4

1972 - 9-1; 9-4

1973 - 12-4

1981 - *10-8

1986 - 4-0; 5-3; 4-2

1987 - 8-2; 8-3; 12-4

1988 - 11-5; 8-7; 15-5

1990 - 9-8; 6-3; 9-3

1995 - 13-3

1997 - 8-6

1999 - 1-9

2002 - 9-5

2003 - 4-3 (11)

2005 - 6-3

2006 – 5-1

2008 - 10-1

2011 - 10-4

G+��, C��:*� (4-0)1997 - 11-1; 4-2; 6-3

2014 - 10-1

H�;��‘� (80-52)1960 - 1-4

1983 - 10-8; 3-2; 5-3; 1-6

1985 - 2-6; 7-8; 9-3; 7-12

1986 - 8-6; 3-10; 4-5

1989 - 8-5; 3-1; 6-5

1991 - 8-9; 4-5; 17-8

1993 - 6-7; 8-6; 4-5; 3-2; 5-4; 4-3

1994 - 5-0; 7-3; 2-4; 5-2; 3-2; 9-7

1995 - 5-1; 6-7 (10); 10-7; 6-12; 14-5;

3-5

1996 - 7-4; 11-5; 18-3; 13-3; 12-3; 7-2

1997 - 9-3; 4-5; 6-13; 6-4; 4-6; 16-11

1998 - 1-5; 7-3; 5-6; 1-4; 24-9; 15-10

1999 - 5-11; 3-7; 6-4; 5-12; 3-5

2000 - 4-9; 6-2; 0-7; 7-8; 9-2; 7-4

2001 - 6-2; 6-5 (11); 8-4; 10-3;

4-5 (10); 13-3

2002 - 2-6, 5-4, 6-1; 5-3, 6-2, 6-5

2003 - 6-3; 8-13; 5-4; 0-3; 5-7; 0-2

2004 - 2-4; 2-0; 13-8; 7-2; 8-4

2005 - 6-3; 6-3; 5-3; 1-4; 8-4; 7-3

2006 – 3-5; 6-1; 13-2; 8-4

2007 - 8-9; 4-3; 6-5; 7-5; 6-7; 0-1

2008 - 0-4; 0-2; 5-0; 4-2; 11-4

2009 - 17-9; 14-11; 10-15; 6-15; 10-3

2010- 8-6, 8-5, 1-0, 0-4;3-11; 14-5; 6-9

2011 - 5-6; 2-6; 4-2; 12-2; 11-5; 15-4

2012 - 2-8; 5-3; 2-3; 8-2

2013 - 8-6

H�;��‘�-H��* (14-2)

1994 - 8-2; 6-3

1995 - 1-3

1999 - 15-2

2000 - 5-3; 6-4; 7-3; 15-3; 8-0; 4-5 (11)

2001 - 11-1; 15-2; 7-5 (10); 10-3; 4-3;

12-3

H�;��’�-P�&�/�& (1-0)1999 - 6-1

H*"!�*� (0-1)2002 – 0-11

H"%=*�,� S�� (2-0)1955 - 10-4; 9-4

I��*�! (1-0)2001 - 14-4

I��*�! S�� (3-0)1994 - 17-1

2002 - 10-7

2003 - 15-6

I�,�� (2-1)2008- 6-2; 9-4; 1-11

I�,�� S�� (3-1)1991 - 9-5

1997 - 10-2

1998 - 1-7

2000 - 13-5

I*�� (3-1)2005 – 2-3; 9-1; 18-5; 4-1

I*;� (3-1)2007 - 13-10; 14-6; 4-2; 8-10

I*;� S�� (1-1)1991 - 4-5; 4-2 (11)

K��!�! (1-1)1993 - *7-4; *2-3 (10)

K��!�! S�� (2-0)1993 - 16-6; 10-1

K�� S�� (2-0)2012 - 14-2; 5-2

K��"&.: (1-0)1994 - 8-3

L�/�:�� (1-0)2006 – 10-9

L�=�+�: (1-0)1989 - 18-3

L�$!&*%= (3-1)2009 - 6-10; 13-11; 10-0; 7-6

L*�' B��&# S�� (59-51)1957 - 4-1; 6-7; 1-0

1958 - 3-4; 8-5; 17-1

1959 - 2-1; 9-3; 14-4

1960 - 8-2; 7-8; 5-3; 8-2; 7-8

1961 - 3-0; 21-5; 10-0

1964 - 1-6; 4-5; 1-11

1965 - 0-2; 4-6; 9-13

1966 - 4-5; 6-3; 9-4; 3-6

1967 - 5-3; 8-1; 4-1

1968 - 4-7; 5-2; 4-3

1969 - 2-15; 4-5; 3-4

1970 - 4-5; 2-5; 0-1

1971 - 6-1; 3-7; 5-1

1972 - 3-9; 6-7; 3-2

1973 - 0-1; 6-2; 18-5

1974 - 6-7; 12-1; 7-2

1975 - 5-2; 4-7; 1-4

1976 - 1-2; 0-6; 1-5

1981 - 7-10; 6-3

1982 - 3-2

1983 - 7-0

1984 - 2-10; 8-9; 5-4; 12-11; 15-5

1985 - 10-2; 8-4; 17-2; 2-3; 6-3

1986 - 14-1; 8-6; 6-2

1987 - 5-9; 8-10; 10-9

1988 - 19-0; 15-0; 14-3

1989 - 3-1; 8-9; 14-1

1990 - 7-5; 8-4; 7-9

1991 - 2-1; 2-6; 2-6

1992 - 3-12; 7-12; 2-18

1994 - 5-12; 3-8; 5-1

1995 - 5-1; 4-9; 4-5

1996 - 2-3; 6-4

1997 - 7-2; 3-6; 7-6

1998 - 1-9; 7-7 (12)

2002 - 10-1

2003 - 5-3 (11)

2008 - 7-6; 1-2; 7-3

2016 - 3-4; 10-5

L*"�!�� L�/�:�� (5-1)1982 - 9-5; 6-0

1984 - 5-3

1991 - 8-6; 3-9; 10-1

L*"�!�� S�� (0-2)1991 - *3-15

1994 - *2-6

L*"�!�� T�&# (32-23)2002 - 14-1, 2-0, 3-2; 1-0, 3-2, 6-5

2003 - 9-5; 8-5 (11); 8-4; 8-9 (13); 7-3

(10); 7-12

2004 - 8-11; 11-3; 12-4; 12-10; 5-6;

12-13

2005 - 1-2; 2-5; 7-10; 12-1; 13-9; 12-8

2006 – 4-5; 4-5; 0-1

2007 - 11-8; 3-5; 6-8; 5-10; 3-1; 8-2;

4-2

2008 - 14-5; 9-8; 11-1; 8-0

2009 - 9-11; 5-17; 12-14; 6-14

2010- 7-13, 5-13, 14-4, 12-2

2011 - 9-4; 6-8; 7-4; 4-8; 13-1

2012 - 12-2; 4-0; 2-5; 6-4

L*:*�� M�+:%*"�� (28-16)1979 - 10-2; 0-1

1980 - 2-3; 6-3

1982 - 15-1; 9-3

1983 - 1-0; 4-1

1984 - 21-5; 6-5; 13-8

1985 - 7-2; 1-0; 1-0

1986 - 5-6

1987 - 3-5; 7-6; 10-1; 4-7; 9-10

1988 - 6-1; 18-6

1989 - 5-6; 7-8 (10)

1991 - 4-3 (12)

1992 - 5-2; 10-8

1993 - 9-8; 6-1; 15-3

2000 - 8-5

2004 - 2-14

* Indicates Postseason Game



2005 – 14-1

2007 - 15-4; 5-3; 5-4

2009 - 7-8; 6-7; 3-7; 7-11

2010- 5-12, 3-4, 2-5, 16-10

M�� (2-0)1990 - 6-4

1994 - 10-1

M��!�, F"�. (0-1)1988 - *4-8 (12)

M��!�, O#�$ (2-1)2001 - 1-2; 3-2 (10)

2006 – 7-3

M�%#�&�� (3-1)1989 - *3-5

1992 - 12-7; 6-4; 6-0

M�%#�&�� S'�'� (1-0) 2012 - 8-2

M��*$'� (4-1)1988 - *10-8 (10)

2003 - 7-4; 4-2; 1-14

2007 - 11-6

M�**$+/� (1-1)1989 - 5-8

1995 - 6-2

M$�!$+'# (1-0)2004 - 11-3

N�56 (1-0)2001 - 10-2

N�7/�*8� (10-9)1986 - 5-11

1992 - 15-2

1993 - 10-8; 5-14

1994 - 10-4

1996 - 4-1

2000 - 2-3; 6-1; 0-8

2002 - 1-7, 0-9, 6-10

2010- 7-5, 8-2, 10-9, 1-4

2011 - 8-5; 1-0; 4-5

N�5�:� (100-60)1965 - 11-7

1966 - 9-1

1967 - 4-8; 14-6

1977 - 4-0; 6-1; 8-1; 0-5; 1-9; 1-5

1978 - 9-0; 3-4; 8-9; 8-12; 2-4

1979 - 8-4; 11-4; 1-2; 6-3; 4-2; 4-5

1980 - 14-4; 3-0; 1-0; 13-9; 7-5; 4-8

1981 - 2-3; 3-1; 7-10; 9-5; 18-12;

3-5; *10-4; *7-1

1982 - 5-2; 18-0; 0-1; 16-8; 29-5; 12-10

1983 - 10-5; 6-7; 10-5; 10-3; 7-1

1984 - 26-7; 12-6; 12-5; 5-0; 9-3

1985 - 5-6; 13-14; 10-11 (9)

1986 - 7-2

1987 - 7-6; 19-4

1988 - 18-1; 9-1; 15-1

1989 - 9-8 (11)

1990 - 6-1

1991 - 4-7; 11-6

1994 - 4-3

1996 - 3-5 (12); 2-14; 8-4

1998 - 3-6

2000 - *5-13

2001 – 19-7; 3-4 (10); 2-6; 9-4; 7-10; 4-5

2002 - 1-0, 4-2, 16-4; 5-1, 8-5, 7-3

2003 - 2-6; 5-21; 12-7; 11-7; 5-7; 9-8

2004 - 2-20; 8-10; 12-8; 12-5; 8-7; 12-1

2005 - 3-1; 10-7; 2-8; 5-6; 1-5; 7-20

2006 – 13-2; 19-3; 12-6; 15-3

2007 - 7-6; 0-2; 10-4; 17-4

2008 - 12-4; 1-4; 11-1; 13-3;9-3; 1-4;

3-7; 11-12; 6-4

2009 - 11-15; 4-16; 8-6; 12-5

2010- 8-3, 6-17, 4-14, 9-3

2011 - 8-3; 8-1; 4-2; 7-1

2012 - 2-8; 14-2; 0-1

2013 - 3-5; 4-0; 6-7; 2-1; 10-4; 6-4;

3-4; 10-1

2014 - 4-1; 5-3; 11-9; 20-10; 8-9 (12);

8-9; 4-3; 2-10

2015 - 8-9 (10); 7-12; 4-7; 4-5; 14-10;

3-1

2016 - 5-4; 8-3; 7-6; 6-25

N�< M�=�%$ (14-23)1960 - 9-2

1972 - 9-2; 7-3

1992 - 9-4

1998 - 7-4; 7-1; 12-6; *3-2 (10)

1999 - 26-27; 10-11; 11-19

2001 - 9-3

2012 - 3-9; 1-7; 4-3

2013 - 4-11; 3-14; 3-4; 0-9; 2-7; 9-8

2014 - 7-9; 2-6; 4-6; 4-5; 6-11; 1-4

2015 - 7-12; 8-1; 1-5; 4-3; 0-4; 11-2,

1-9

2016 - 1-2; 13-14 (12); 4-7

N�< M�=�%$ S'�'� (30-9-1)1991 - 4-0; 5-4

1992 - 12-6; 12-7; 4-6

2006 – 6-3; 10-7; 8-9

2007 - 7-0; 14-3; 9-1

2008 - 8-13; 13-10; 9-5; 13-1; 24-6;

11-8; 2-9; 7-12; 6-4

2009 - 5-4; 0-2; 6-5; 6-10; 4-7; 9-7; 5-3

2010- 21-11, 16-10, 12-4, 8-6

2011 - 17-4; 15-7; 17-2; 6-3

2012 - 12-2; 1-2; 14-7; 15-8

N$/'# C�/$"�� (4-3)1989 - 9-4

1990 - 3-5

1999 - 11-7; 5-8

2008 - 5-3; 3-4; 6-1

N$/'# C�/$"�� S'�'� (1-0)1990 - 11-8 (10)

N$/'#�/� A/�>$�� (1-0)1961 - 11-0

N$/'#<�*'�/� (0-1)1999 - 10-13

N$'/� D�!� (4-1)1961 - 13-9; 8-2

1989 - *9-8; *11-4

2001 - 4-5 (10)

O�8"��: (1-0)2016 - 11-10

O#�$ S'�'� (1-0)

2011 - 3-2

O8"�#$!� (0-1)2016 - 2-3

O8"�#$!� S'�'� (0-2)1959 - 0-4

1996 - *5-12

O": D$!��$� (3-0)1994 - 5-4; 4-3; 4-3 (15)

O/�" R$7�/'* (2-0)2001 - *2-1

2002 - 9-3

O/�&$� (5-9)1959 - 10-7; 3-2

1964 - 6-4

1969 - 4-5

1975 - 2-10; 5-6; 7-2

2009 - 0-1; 1-7; 10-3

2010- 2-7, 4-8, 2-5, 3-8

O/�&$� S'�'� (28-13)1952 - *1-2; *4-8

1953 - 5-3; 3-4

1955 - 8-1; 9-7

1961 - 11-4; 16-0

1969 - 8-2

1970 - 3-2

1978 - 11-6; 11-1

1979 - 6-2; 9-1

1980 - 12-7

1981 - 8-5

1984 - 9-1

1986 - 7-8 (10); 13-2; 9-2

1987 - 0-1

1988 - 12-10

1989 - 5-2; 6-8; 2-1

1990 - 7-6; 14-5; 1-2

1991 - 3-1; 3-9; 2-5

1996 - 7-4

2000 - 4-1; 9-4; 8-0

2011 - 2-1; 5-4

2015 - 1-2 (11); 2-5; 2-12; 1-2

P�%�B�% (96-46)1951 - 9-2; 6-0; 6-5; 8-2

1952 - 1-0; 16-7; 5-1; 15-5

1955 - 12-10

1964 - 4-1; 9-2

1965 - 3-2; 3-2

1966 - 3-0; 8-0

1967 - 2-1; 1-2

1968 - 0-2; 1-2

1969 - 0-7; 1-2

1970 - 1-0; 1-2

1971 - 1-5; 8-0

1972 - 1-3; 2-6; 1-2

1973 - 2-0; 4-6; 10-4; 15-1; 15-14; 8-4

1974 - 4-1; 5-6; 1-0; 5-3; 13-5;

4-1; 5-6 (12)

1975 - 2-4; 5-4; 2-1; 1-10; 0-2;

1-6; 8-13; 3-2

1976 - 3-5; 5-8; 3-4; 1-6; 6-2; 7-6

1977 - 4-2; 6-4; 4-2; 1-3; 5-2; 1-2

1978 - 0-1; 6-3; 1-2; 7-1; 10-0; 7-3

1979 - 22-9; 6-2; 1-3; 5-0; 3-0; 5-0

1980 - 5-2; 11-6; 2-0; 2-1

1981 - 6-5; 5-1; 10-4; 1-2; 3-2; 6-5

1982 - 4-3; 1-3; 8-3; 6-5; 14-5; 9-5

1983 - 13-2; 21-4; 7-8; 2-3; 2-4

1984 - 11-4; 5-4; 3-4; 18-3; 2-1

1985 - 2-3; 7-2; 15-0; 3-2; 8-0; 4-5 (9)

1986 - 3-4; 13-3; 9-0

1987 - 9-1; 2-0; 8-4

1988 - 4-1; 8-1; 14-6

1989 - 6-0; 2-3; 5-2

1990 - 11-1; 3-1; 2-1 (10)

1991 - 6-1; 6-3; 18-2

1992 - 6-1; 4-0; 5-1

1993 - 10-5

1994 - 1-5

1995 - 3-2; 11-2

1997 - 4-7

1998 - 2-4; 3-14

2000 - 12-5

2001 - 8-2

2002 - 9-2

2013 - 4-11; 4-3

2014 - 3-7; 4-6

2016 - 6-15; 3-7

P��*6"5�� (4-0)1997 - 10-1

1999 - 20-2

2003 - 8-4

2004 - 6-1

P�� S'�'� (3-0)2003 - 7-2

2014 - 13-3; 12-3

P�EE�/:�� (40-27)1951 - 30-12; 14-3; 4-2

1955 - 8-4; 2-3; 8-11; *8-7

1960 - 4-6; 11-8; 5-3

1961 - 4-3; 5-0

1964 - 5-1; 2-1

1965 - 11-9

1966 - 9-5; 3-5 (11), 6-2

1967 - 9-2

1968 - 9-1; 6-4; 10-1

1969 - 8-2; 7-3; 11-3

1979 - 4-10

1980 - 2-8; 5-3; 4-2

1982 - *14-5; *8-11

1990 - 2-3; 0-15; 11-5

1992 - *4-5 (10)

1995 - *5-9

1997 - 9-10; 7-5

1998 - 5-1; 5-6; 8-3

1999 - 4-5; 5-3; 7-8

2000 - 14-2; 7-6; 6-2

2001 - 0-4; 8-6

2003 - 0-3; 3-4; 1-3

2006 – 2-7; 9-8; 8-3

2007 - 0-4; 2-3; 4-10

2011 - 7-3; 7-5; 8-1

2012 - 2-3; 8-4; 0-6; 5-8

P$/'"��: (10-5)1979 - *10-8

1989 - 3-4 (13); 2-6

1990 - 6-5

1995 - 12-11 (13)

1999 - 10-3

2001 - 3-9

2004 - 12-2

2006 – 7-2; 3-0; 16-5

2008 - 12-3; 2-3

2009 - 7-0; 2-4

P$/'"��: S'�'� (4-0)




1978 - 14-6; 9-0

1996 - 5-3; 5-0

P�� (1-0)1998 - 13-3

R!"�� I#$%&� (1-0)1997 - 12-2

R'*� (17-29)1994 - 13-8

1997 - 2-1; 6-3; 2-1

1998 - *4-5 (10); *2-15

1999 - 4-10; 5-8; 2-8

2000 - 5-2; 9-5; 0-8; 15-1; 6-3; 2-5

2001 - 6-13; 1-8; 6-8; 1-0; 11-5; 5-8

2002 - 2-9, 5-12, 4-16; 1-4, 9-17, 1-12

2003 - 7-3; 2-9; 2-3; 2-1; 2-13; 1-5

2004 - 1-6; 5-6; 2-7; 4-9; 9-7 (10); 11-4

2005 – 2-8; 0-8; 2-1; 4-6; 8-7; 2-10

2008 - 17-5

S%*�%+�&," S,%,� (116-32)1951 - 5-0; 8-4; 1-0; 5-3

1952 - 1-4; 5-1; 15-5; 3-2; 4-0

1957 - 5-4; 6-1

1959 - 5-3; 9-0; 9-5; 8-4

1960 - 6-8; 9-2; 8-4; 4-2

1961 - 8-5; 3-0; 4-7; 3-0

1964 - 16-7; 12-2; 6-5; 2-0

1965 - 4-1; 7-6

1966 - 6-3; 4-2; 4-3; 2-0; 8-9

1967 - 4-3; 6-1; 2-3; 4-1

1968 - 6-3; 3-2; 3-2; 2-1

1969 - 3-1; 2-1; 7-3; 9-3

1970 - 6-0; 5-7; 5-1; 2-0

1971 - 2-3; 9-0; 2-5

1972 - 5-4; 3-1; 9-8; 7-6

1973 - 9-7; 8-0; 2-4

1974 - 6-3; 4-3; 10-11; 3-5

1975 - 10-7; 6-5; 2-4; 4-3

1976 - 7-1; 8-2; 3-0

1985 - 8-6

1986 - 5-4

1993 - 5-3; 14-1; 9-13 (10); 12-7; 9-5;

5-8

1994 - 7-6; 6-2; 0-9; 3-4 (10); 7-2;

13-21

1995 - 3-4; 5-1; 4-1; 2-3; 2-3; 8-7 (10);

4-6

1996 - 6-2; 9-1; 9-4; 10-0; 4-2; 5-3

1998 - 10-3; 6-5 (10)

1999 - 4-1; 14-7

2000 - 3-1; 15-2

2001 - 3-4

2002 - 11-1, 3-8, 5-8

2006 – 5-1; 13-6; 12-11; 10-7; 14-3;

7-4; 10-2

2007 - 16-7; 8-1; 5-2; 10-2

2008 - 8-9; 0-4; 6-4; 13-6; 3-2

2009 -5-7; 4-3; 11-8; 7-6

2010- 2-12, 7-6, 10-1, 8-4

2011 - 2-0; 7-3; 1-2; 12-4

2012 - 7-9; 10-6; 8-6; 3-8; 9-6; 4-3

2013 - 3-2

2014 - 4-6; 1-2 (10)

2015 - 6-2; 8-0

2016 - 7-5; 4-5 (11)

S,. J"!&’# (2-0)1991 - 5-3

1996 - 13-7

S%'&, M%�/’# (70-22)1969 - 13-3; 4-8

1970 - 7-1; 11-1; 8-6; 5-0

1974 - 9-2; 1-2

1976 - 0-9; 9-7

1977 - 2-1; 2-0; 1-2; 4-3; 7-8; 6-5

1978 - 7-6; 6-4; 2-1; 10-9; 10-5; 1-2

1979 - 6-10; 10-1; 1-9; 10-7; 9-5; 2-3

1980 - 5-1; 7-1; 3-2; 6-4; 16-3; 5-4

1981 - 3-1; 7-2; 2-4; 2-3; 6-5; 18-7

1982 - 2-11; 7-1; 12-5; 5-8; 11-3; 8-4

1983 - 2-1; 7-6; 0-1; 0-1; 2-1

1984 - 9-1; 3-2; 4-1; 5-1; 6-3

1985 - 1-0; 12-5

1986 - 7-0; 8-9; 7-5; 3-4

1987 - 21-6; 8-7; 10-5

1988 - 11-4; 3-0; 8-0

1989 - 10-3; 8-5; 5-6

1990 - 2-5

1991 - 5-0; 9-13; 10-4

1992 - 12-1; 11-5; 6-5

1993 - 6-9; 9-1

1994 - 13-9; 2-1

1995 - 3-6; 14-4

1996 - 16-2; 10-3

1999 - 5-2; 8-2

2001 - 5-1; 12-2

2016 - 6-4; 3-2

S%& D'�4" (20-7)1968 - 10-5

1983 - 4-1; 3-1; 3-4

1984 - 12-1; 13-10; 3-7

1986 - 3-1

1988 - 14-2; 7-1; 4-9

1991 - 5-2; 12-2

2006 – 9-8; 9-8

2007 - 12-4; 3-8; 6-2; 6-2

2008 - 2-5; 6-0; 1-15;5-1

2010- 7-10

2011 - 6-0; 3-2; 7-4

S%& D'�4" S,%,� (94-93)1939 - 13-5; 4-5

1940 - 2-1; 5-7; 3-8; 2-6

1941 - 7-3; 0-1; 1-6; 9-5; 2-1; 1-9; 6-1

1942 - 4-9; 3-10; 4-9; 4-13

1946 - 13-15; 15-20 (10); 2-3; 4-7

1947 - 4-7; 0-7; 3-10; 1-8

1948 - 4-5; 10-6; 1-8

1949 - 14-0; 5-7; 7-3

1950 - 7-16; 10-8

1951 - 4-6; 2-0; 12-0

1955 - 4-2

1957 - 4-6; 0-4; 6-0

1958 - 6-2; 3-5; 5-6

1959 - 10-9; 10-6; 3-5; 6-4; 4-8

1960 - 2-1; 3-4; 2-3; 2-1

1961 - 7-4

1964 - 7-1; 5-3; 5-3

1965 - 7-1; 4-1; 2-3

1966 - 3-7; 7-3 (14); 8-7; 7-5

1967 - 6-1; 0-3

1968 - 3-9; 5-6; 3-4

1969 - 7-3; 6-7; 2-12

1970 - 3-1; 10-4; 6-11

1971 - 2-5; 5-4 (16); 6-1

1972 - 9-1; 1-3; 2-7

1973 - 9-3; 8-3; 6-3

1974 - 9-2; 4-2; 0-5

1975 - 1-5; 11-8; 5-6

1976 - 2-4; 2-1; 0-3

1983 - 5-6; 20-26

1984 - *6-10; *7-10

1986 - 4-16

1987 - 4-3

1989 - 13-10

1990 - *4-8

1993 - 6-5; 9-11; 1-8; 2-1

1994 - 5-9; 4-3; 3-4; 3-2; 5-4; 1-3 (10)

1995 - 2-3; 3-2; 4-11; 10-4; 8-3; 6-5

1996 - 2-1; 5-9; 3-2; 4-9; 2-6; 2-5

1997 - 7-3; 1-10; 7-6; 3-6; 2-4; 9-7

(12); *4-7; *2-7

1998 - 7-6; 2-3; 11-2; 11-3; 2-9; 10-5;

*18-2

1999 - 11-2; 1-2; 7-5

2008 - 9-2

2009 - 1-4

2010- 10-3

2013 - 1-0; 6-11; 2-4; 7-5; 8-10; 2-4; 0-4

2014 - 1-2; 6-4; 0-1; 2-9; 4-3; 8-11

2015 - 5-4 (10), 3-15, 4-9, 15-7, 6-7

(10)

2016 - 3-2 (10); 10-5; 4-5; 2-4; 1-0

(10); 4-3

S%& F�%&*'#*" (76-19)1957 - 12-0

1958 - 8-1

1970 - 11-2; 5-1; 2-3; 6-1

1971 - 4-5; 6-0; 8-2

1977 - 11-9; 9-2; 11-5; 16-1; 12-0; 2-0

1978 - 12-4; 9-5; 22-0; 5-2; 23-0; 18-2

1979 - 5-4; 9-5; 14-2; 4-1; 4-1; 5-2

1980 - 4-5; 7-0; 13-1; 8-1; 8-5; 15-5

1981 - 5-3; 7-2; 2-4; 17-6; 14-7; 17-1

1982 - 7-0; 4-2; 1-2; 7-6; 9-0; 6-1

1983 - 13-0; 6-3; 11-1; 9-1; 12-5

1984 - 8-3; 6-7; 15-5; 14-9; 4-1

1985 - 5-0; 16-4

1987 - 5-3; 11-13

1988 - 10-7

1989 - 10-8; 11-3

1990 - 5-4

1991 - 10-6

1992 - 3-2 (10); 12-3

1993 - 11-1; 10-4

1995 - 10-1; 11-7

2000 - 6-5

2001 - 4-1

2003 - 1-8; 6-5; 9-7

2005 - 5-8; 0-13

2006 – 4-3; 5-2

2007 - 2-6; 3-4; 5-4

2008 - 8-13; 5-4; 6-7

2010- 5-2

2011 - 5-3; 4-3; 3-4

2012 - 2-1; 6-2; 3-6; 1-6

2016 - 10-1; 3-7; 3-6

S%& F�%&*'#*" S,%,� (29-7)1964 - 8-3

1966 - 4-3; 0-5; 8-1

1967 - 9-0; 2-1; 2-9

1968 - 1-0; 2-3

1969 - 7-4

1972 - 6-5; 2-3; 3-7

1973 - 19-1; 6-3; 4-0; 6-0

1974 - 16-0; 5-1; 4-3; 5-1

1975 - 10-6; 9-1; 3-2; 2-5

1976 - 6-5; 2-3; 11-4; 8-3

1977 - 16-3; 9-2; 11-7; 7-2

1978 - 8-1; 10-1; 6-2

S%& J"#� S,%,� (160-84)1951 - 8-3; 7-0; 6-0

1952 - 7-0; 8-0; 6-0

1955 - 9-0; 8-1; 4-3; *9-4; *1-3; *5-1

1957 - 3-2; 1-5

1958 - 3-4; 2-1; 12-0; 4-1; 8-2; 10-3

1959 - 1-4; 9-8; 6-0; 1-0; 11-8; 13-7

1960 - 7-8; 2-0; 7-5

1961 - 5-4; 12-1

1964 - 6-3; 3-1

1970 - 3-4; 3-2; 2-4

1971 - 10-1; 0-2; 4-8; 1-7; 6-10; 6-4

1972 - 4-1; 7-5; 9-3

1973 - 8-19; 6-17; 4-7

1974 - 0-9; 8-6; 4-3; 3-2, 1-0

1975 - 3-4; 3-4; 2-0; 5-9; 10-9; 5-2

1976 - 14-3; 9-8; 7-6; 4-0; 2-6; 2-3

1977 - 10-1; 5-4; 5-9; 4-2; 4-7; 1-2

1978 - 7-3; 15-2; 7-11; 1-2; 4-6; 15-8

1979 - 6-7; 0-1; 2-6; 6-5; 6-10;

10-3; *4-5; *4-0; *4-0

1980 - 4-1; 4-2; 2-0; 4-0; 12-7; 8-3

1981 - 6-11; 2-1; 6-15; 13-8; 6-1; 5-7

1982 - 13-5; 6-3; 5-2; 19-1; 13-1; 6-5

1983 - 13-4; 7-4; 13-0; 8-0; 5-1

1984 - 6-5 (10); 10-1; 4-3 (8); 6-3; 4-3

1985 - 7-0; 6-2; 4-0; 9-2; 9-1; 0-5

1986 - 2-7; 11-3; 6-1

1987 - 5-6; 9-4; 3-10

1988 - 17-3; 10-1; 7-1

1989 - 8-7 (11); 4-1; 2-4

1990 - 8-7 (10); 5-3; 12-2

1991 - 4-0; 0-1; 9-1

1992 - 9-7 (10); 6-2; 4-3 (10)

1995 - 2-0; 2-3

1996 - 14-15; 11-10

1997 - 8-3; 1-4; 3-4; 1-0; 0-2; 10-1

1998 - 6-2; 6-5; 1-11; 6-4; 1-3; 5-10

1999 - 10-3; 11-5; 7-6

2000 - 3-7; 4-5 (11); 0-5; 2-4; 2-7; 8-5

2001 - 3-2; 5-3; 4-7; 7-4; 9-2; 3-7

2002 - 3-8, 7-6, 5-2; 5-6 (10), 4-6, 5-7

2003 - 9-3; 3-4; 0-3; 7-5; 1-10; 3-2

2004 - 4-2; 3-5; 5-2; 10-1; 14-4; 3-6

2005 – 4-3; 1-3; 5-6 (10); 10-4; 5-4; 7-6

2006 – 5-3; 5-7; 4-0; 10-4; 9-8; 9-8; 3-2

2007 - 15-9; 9-4; 12-9; 6-2

2008 - 11-3; 9-8; 5-3; 1-2; 7-3

2009 - 1-0; 8-2; 0-2; 5-6; 6-3

2010- 3-9, 4-3, 10-0, 3-4; 12-10; 13-1

2011 - 1-3; 5-1; 3-4; 5-3

2012 - 0-4; 3-4; 2-11

2013 - 3-10

2014 - 2-3; 8-0; 2-5

2015 - 6-4; 9-2; 6-3; 4-0; 3-7; 3-0

2016 - 13-4; 9-4; 2-3 (10); 6-0; 8-6;

5-7 (12)

S%&,% C$%�% (71-45)1957 - 5-0; 9-8

1959 - *23-11; *15-3

1964 - 2-3; 4-3

1965 - 4-6; 0-2

1966 - 5-4

1967 - 0-4; 7-3

1968 - 2-3; 4-7

1969 - 1-6; 5-0

1970 - 2-1; 0-1

1971 - 1-7; 2-5

1972 - 2-14; 9-0 (FF)




1973 - 0-5; 4-12

1974 - 5-10

1975 - 4-11

1976 - 2-12

1977 - 3-2; 10-1; 7-6; 3-1; 5-0; 2-0

1978 - 7-12; 5-7; 7-4; 2-4; 7-4; 6-7

1979 - 6-3; 0-3; 3-0; 4-2; 1-11; 6-7

1980 - 6-2; 2-3; 7-2; 7-5; 4-1; 5-3

1981 - 11-1; 7-6; 9-2; 6-5; 9-0; 1-0

1982 - 10-4; 2-5; 10-9; 9-2; 4-3;

19-7; *11-5; *4-2

1983 - 6-5; 6-2; 6-7; 13-3; 4-1

1984 - 9-2; 6-5; 21-4; 3-2; 3-0

1986 - 8-6

1987 - 13-1; 12-4

1988 - 9-10; 3-4

1989 - 6-4; 11-2; 9-10

1992 - 6-5

1993 - 9-3

1994 - 6-7; 3-7

1995 - 4-3; 1-2 (11)

1996 - 3-1 (13); 10-9

1997 - 13-8; 18-26; *1-8; *10-7

1998 - 8-9

1999 - 3-9; 3-2; 5-4 (12)

2000 - 5-3; 16-3; 10-8

2001 - 8-5; 11-10 (16); 10-7

2002 - 8-5, 4-8, 1-2

2007 - 2-3; 8-7; 1-4; 4-8; 1-9

2008 - 5-6; 8-10

2010- 10-9

2012 - 5-9

S�� (2-0)1952 - *6-2; *20-4

S��!" H�� (1-0)1999 - 6-4

S!#�$�%" I��&"!&' (2-1)1990 - *3-2; *1-3

2000 - 12-0

S!#�$�%" U��$ (3-0)1999 - 6-3; 4-3

2005 – 5-3

S��"*!%+ (50-86)1952 - 11-10; 10-5; 3-5

1957 - 6-5

1958 - 4-5; 3-4

1959 - 2-1

1961 - 5-9

1967 - *7-3; *3-6; *4-6

1968 - 0-4; 0-2; 2-1; 1-7

1970 - 6-0

1971 - 2-0; 0-1 (11); 0-3; 0-6

1972 - 2-4; 2-0; 2-6; 2-3

1973 - 1-3; 1-2; 1-2 (10); 7-1

1974 - 19-11; 5-4; 2-1

1975 - 1-2; 4-0; 1-9; 0-7; 3-11

1976 - 7-13; 6-3; 4-3; 0-7; 1-12

1978 - 4-2; 9-8; 5-8

1979 - 2-1; 3-7; 3-5

1980 - 10-1 (10)

1981 - 2-3; 5-4

1982 - 2-4; 6-3; *10-17

1983 - 8-9

1984 - 3-2; 2-1

1985 - 4-8; 7-2; 3-9; 6-10

1986 - 5-3; 1-5 (10)

1987 - 0-2; 4-2; 12-4

1988 - 13-3; 6-5 (10); *3-10

1989 - 1-2; 8-2

1990 - 2-9; 4-3; 3-5

1991 - 7-1; 5-4; 3-6; *4-2; *7-5

1992 - 11-3; 5-10; 0-3

1993 - 6-7; 1-4; 1-12

1994 - 5-7; 2-9; 4-7

1995 - 3-2; 6-0; 2-4

1996 - 16-1; 0-6; 5-9

1997 - 1-6; 1-0; 2-14; *2-5

1998 - 10-12 (11); 9-16; 0-4 (5)

1999 - 0-1; 8-6; 5-3

2000 - 2-10; 1-7; *1-5

2001 - 9-11; 3-2 (10); 5-9

2002 - 2-6, 7-5, 3-8

2003 - 1-4; 2-5; 2-7

2004 - 3-1; 4-13; 3-10

2005 - 1-12; 0-7; 4-8

2006 – 2-3; 7-5; 3-6

2007 - 2-9; 4-6; 2-7

2012 - 7-4; 0-16; 2-9; 1-9

2013 - 1-3; 4-7; 4-7

S��'!" (0-1)1986 - 4-5

T�,.�� (1-0)2000 – 5-3

T�""�''�� (1-0)1993 - *6-2

T�/�' A4M (6-0)1988 - 6-5 (13); 4-0

1997 - *2-1

2014 - 5-0; 6-5; 1-0

2016 - 2-3; 3-4 (10); 1-12

TCU (12-8)1987 - 2-3; 6-3

1997 - 19-12; 10-5; 7-11

1999 - 7-1; 6-7; 8-14

2000 - 9-7; 8-3; 1-10; 9-6; 7-6; 6-5

2001 - 5-6; 5-6; 7-5; 3-4; 11-5; 6-5

T�/�' T�7$ (2-1)1993 - 4-2

1996 - *12-5; *2-13

T!��+! (1-0)1998 - 9-3

T#��"� (0-1)1994 - *5-7

UC D�9&' (39-17)1951 - 9-1; 5-3

1952 - 5-2; 8-2

1964 - 7-6

1970 - 0-1; 4-3; 1-0; 8-7

1971 - 12-13; 5-2; 19-6; 4-3

1972 - 3-5; 7-3; 5-4; 14-4

1973 - 3-5; 13-0; 4-0; 3-1

1974 - 1-2; 6-7; 5-3; 11-5

1975 - 10-9; 14-1; 2-3; 9-5

1976 - 12-8; 11-7; 4-3; 2-4

1977 - 8-2; 2-3; 10-6; 19-6

2007 - 8-2; 4-3

2008 - 2-4; 1-3; 7-0; 6-3

2009 - 3-11; 4-2

2010- 9-2, 7-6, 2-7

2011 - 12-4; 3-1

2012 - 11-4

2015 - 5-4; 3-4; 0-1

UC I%9&"� (34-10)1983 - 9-0; 5-2; 3-4

1984 - 6-0; 5-4; 5-0

1985 - 4-3 (10); 13-2; 13-1

1986 - 11-3; 2-5; 6-4 (11)

1987 - 3-7; 4-1; 9-16

1988 - 4-2; 16-2; 4-0

1989 - 8-5 (11); 24-4; 9-8

1990 - 8-3; 2-1; 5-1

1991 - 4-1; 8-2; 6-3

1992 - 10-4; 6-0; 10-3

2002 - 3-8

2003 - 1-0; 9-5; 4-3

2004 - 3-5; 1-5

2009 - 2-4

2011 - 6-12

2014 - 2-0 (10); 8-7 (13); 0-1

2015 - 5-4; 7-5; 7-5

UCLA (28-30)1952 - 3-1; 6-5; 4-2

1957 - 3-9; 5-2

1959 - 8-0; 9-10

1960 - 2-1; 3-2; 11-12

1961 - 2-0; 4-10

1964 - 8-7; 2-13; 8-4

1965 - 5-8; 2-8

1966 - 7-2; 7-9; 4-9

1967 - 19-3; 12-5; 1-8

1969 - 0-4;

1970 - 1-0; 7-4; 4-5

1971 - 10-3; 3-9; 4-3

1972 - 7-2; 4-3; 0-11

1973 - 1-2; 6-3; 2-1

1974 - 5-2

1975 - 7-9; 2-5; 0-2

1976 - 3-12; 2-6; 7-0

1979 - *4-5

1986 - 0-6; 3-6; 6-13

2004 - 2-6; 11-13; 3-2 (10)

2005 - 4-7; 8-4; 5-6

2006 – 11-9; 5-0; 2-12

2011 - 1-3

UC S�"�� B�%=�%� (51-39)1951 - 9-0; 6-3; 10-4

1952 - *9-5; *19-1

1955 - 10-4; 6-2; 0-2

1957 - 13-1; 2-4; 10-3

1958 - 13-0; 2-0; 6-2

1959 - 6-4; 4-11; 13-9

1960 - 9-3; 7-5

1961 - 5-4; 4-0; 18-2

1964 - 3-0

1965 - 11-7

1970 - 11-3; 3-7; 1-8

1971 - 1-4; 6-5; 5-1; 3-0; 8-2; 2-1

1972 - 0-1; 5-9; 3-10

1973 - 9-4; 2-3

1974 - 3-5; 3-2; 2-1

1981 - 5-2; 0-4

1982 - 0-8; 9-11

1985 - 2-8; 7-4; 6-0; 1-13; 11-3; 7-6

1986 - 8-9; 6-8; 6-7 (10)

1987 - 3-6; 3-4; 7-6 (11); 13-15; 2-6

1988 - 4-2; 8-5; 10-3

1989 - 8-6; 7-3; 7-5

1990 - 12-7; 1-6; 4-6

1991 - 10-6; 13-14; 3-8

1992 - 10-2; 5-3; 1-11

2002 - 10-3

2004 - 7-6; 9-22; 3-8

2005 – 5-7; 3-5; 5-4

2012 - 1-7; 3-2

2013 - 8-1; 1-8; 3-11

2014 - 4-5 (10)

2015 - 5-6; 1-2; 2-7

UC R&9�%'&+� (1-1)2012 - 1-5; 2-1

UNLV (50-33)1977 - 10-8; 5-1; 3-1

1978 - 12-11; 4-2; 4-9

1979 - 11-1; 6-4; 7-8; 12-5

1980 - 2-5; 0-4; 3-5

1981 - 3-13; 27-10; 9-14

1982 - 4-2

1983 - 17-5; 8-1

1984 - 2-1; 6-1; 8-1

1985 - 12-9; 6-3; 0-2; 16-3; 4-2

1986 - 9-5; 4-5; 2-4

1987 - 4-6; 8-9; 5-3

1988 - 8-12; 9-4; 11-6

1989 - 1-2; 5-2; 6-3

1990 - 0-9; 10-7; 0-10

1991 - 6-1; 8-5; 11-7

1992 - 7-10; 7-2; 3-0

1994 - 2-4; 2-10

1995 - 7-0; 11-0

1996 - 9-6; 6-8

1998 - 7-3; 4-5; 5-6

1999 - 1-8; 6-3; 3-6

2013 - 8-9; 8-9; 5-3; 1-4; 2-9; 9-4

2014 - 0-6; 2-0; 0-7; 3-5

2015 - 10-5; 2-1; 4-0; 6-1; 8-3; 6-2; 6-5

2016 - 2-4; 6-2; 4-3; 9-1; 7-2; 5-8

USC (27-41)1952 - 1-2; 9-6

1954 - 7-4; 9-3

1955 - *1-8; *2-15

1956 - 6-9; 1-9

1957 - 5-6

1959 - 2-6

1960 - 2-5; 1-3; 3-5; 6-3

1961 - *1-4; *6-4; *6-10

1963 - 3-4 (12); 2-4

1964 - 7-14; 7-3

1965 - 3-9

1969 - 3-6; 3-2; 3-4

1970 - 2-6; 6-13; 7-6

1972 - 5-8; 5-4; 4-12

1973 - 0-5; 4-6 (10); 0-2

1976 - 7-8

1977 - *3-7

1984 - *15-12 (10)

1988 - *17-18; *17-12; *14-3

1995 - *17-22

2001 - *0-8

2003 - 6-5

2013 - 1-9; 5-1; 14-3

2014 - 2-3 (10); 14-7

U.S. I"��%"��&!"�� (5-1)1986 - 5-1

1987 - 5-4 (18)

1990 - 7-12; 12-3

1991 - 5-3; 7-1

U��$ (6-1)1997 - *6-3




1998 - 9-0; 5-2; 9-7

1999 - 14-6; 16-8; 2-4

2008- 10-0

U�� S�� (1-0)1959 - 7-0

U�� V�!!�" S�� (2-1)2006 - 13-9; 8-0; 4-5

V#$%#&#� T�'� (1-2)1989 - 14-2

1991- 0-4

1995 - 0-8

WAGNER (2-0)2015 - 4-2; 10-1

W�*�#&%�+& (9-8)1959 - *3-2; *4-5; *10-5

1984 - 12-5

1992 - *3-4

1997 - 4-7; 6-8; 4-2

2002 - 1-5; 13-9; 7-10

2009 -4-11; 3-1

2010- 9-10, 11-10, 3-2

W�*�#&%�+& S�� (20-9)1966 - 4-0; *2-5 (13); *1-2 (14)

1967 - 3-2; 0-1

1973 - 5-1

1977 - 2-4

1978 - 11-4

1979 - 7-2; 6-7

1981 - 11-8; 15-3

1983 - 5-7; 6-5

1986 - 2-4

1988 - *7-6

1989 - 11-0; 9-5

1990 - 15-5; 2-1; 1-4

1992 - 9-8

1994 - 4-7

1997 - 10-2; 9-4

2006 - 6-1

2011 - 7-5; 16-1; 7-2

W�*��$& M#'�#%�& (1-0)1959 - *7-2

W�*��$& O$�%+& S�� (2-0)1971 - 12-4; 5-1

W�*�,+&� (4-1)1964 - 7-2; 2-0

1965 - 7-4

1966 - 8-5; 4-5

W#'�#�� S�� (0-1)1989 - *4-6

W#!!�,�� (1-0)1955 - *6-3

W#&��$+. (0-1)1998 - 1-3

W"+,#&% (6-1)1979 - 1-0

1993 - 6-1; 4-3; 10-3

1994 - 9-2; 5-9; 3-0

ALL-TIME SERIES RECORDS/YEAR-BY-YEAR RESULTS

Y+/&%*�+3& S�� (4-0)2016 - 8-3; 11-0; 6-5; 6-1

1975Overall Record: 26-33

PCAA Record: 7-14

Head Coach: Bob Benne< Date Opponent Result UCLA L, 9-7 UCLA L, 5-2 UCLA L, 2-0 San Francisco State W, 10-6 San Francisco State W, 9-1 CSU Hayward W, 7-6 CSU Hayward L, 5-3 UC Berkeley L, 8-0 Stanford L, 2-1 Stanford W, 4-0 UC Davis W, 10-9 UC Davis W, 14-1 USC W, 10-6 UC Berkeley L, 3-2 Cal Poly W, 3-2 Cal Poly W 3-0 Stanford L, 9-1 Stanford L, 7-0 Stanford L, 11-3 San Francisco State W, 3-2 San Francisco State L, 5-2 USC L, 6-2 USC L, 9-2 Sacramento State W, 10-7 Sacramento State W, 6-5 Oregon L, 10-2 Oregon L, 6-5 CSU Hayward W, 7-1 CSU Hayward W, 7-6 San Jose State* L, 4-3 San Jose State* L, 4-3 San Jose State* W, 2-0 Oregon W, 7-2 Sacramento State L, 4-2 Sacramento State W, 4-3 Paci! c* L, 4-2 Paci! c W, 5-4 Paci! c W, 2-1 Stanislaus State L, 4-3 Long Beach State* W, 5-2 Long Beach State* L, 7-4 Long Beach State* L, 4-1 UC Davis L, 3-2 UC Davis W, 9-5 Paci! c* L, 10-1 Paci! c* L, 2-0 Paci! c* L, 6-1 Santa Clara L, 11-4 Cal State Fullerton* L, 6-5 Cal State Fullerton* W, 6-4 Cal State Fullerton* L, 11-6 San Jose State* L, 9-5 San Jose State* W, 10-9 San Jose State* W, 5-2 San Diego State* L, 5-1 San Diego State* W, 11-8 San Diego State* L, 6-5 Paci! c* L, 13-8 Paci! c* W, 3-2


PCAA Record: 7-14

Head Coach: Bob Benne< Date Opponent Result at Stanislaus W, 6-2 at Stanislaus W, 6-2 at UCLA L, 12-3 at UCLA L, 6-2 at UCLA W, 7-0 at UC Davis W, 12-8 Stanford L, 13-7 Stanford W, 6-3 Stanford W, 4-3 at UC Davis W, 11-7 at California L, 8-0 St. Mary’s L, 9-0 St. Mary’s W, 9-7 at USC W, 10-4 at USC L, 8-7 CSU Hayward W, 11-4 CSU Hayward W, 6-1 San Jose State* W, 14-3 San Jose State* W, 9-8 San Jose State* W, 7-6 San Francisco St. W, 6-5 San Francisco St. L, 3-2 Paci! c* L, 5-3 Paci! c* L, 8-5 Paci! c* L, 4-3 at Sacramento State W, 7-1 at Stanford L, 7-0 at Stanford L, 12-1 at Hayward State W, 4-2 at Hayward State W, 9-7 at Cal Poly W, 6-2 at Cal Poly L, 5-4 at Santa Clara L, 12-2 at San Francisco St. W, 11-4 at San Francisco St. W, 8-3 Chico L, 12-9 Stanislaus State L, 6-5 at Long Beach State* L, 2-1 at Long Beach State* L, 6-0 at Long Beach State* L, 5-1 Sacramento State W, 8-2 Sacramento State W, 3-0 UC Davis W, 4-3 UC Davis L, 4-2 at Paci! c* L, 6-1 at Paci! c* W, 6-2 at Paci! c* W, 7-6 Cal State Fullerton* L, 4-1 Cal State Fullerton* L, 11-6 Cal State Fullerton* L, 11-6 at UC Berkeley L, 9-5 at San Jose State* W, 4-0 at San Jose State* L, 6-2 at San Jose State* L, 3-2 San Diego State* L, 4-2 San Diego State* W, 2-1 San Diego State* L, 3-0



YEAR-BY-YEAR RESULTS1977Overall Record: 39-21

NCBA Record: N/A

Head Coach: Bob Benne� Date Opponent Result

2/11 at Pacifi c W, 4-2

2/12 Pacifi c W, 6-4

2/12 Pacifi c W, 4-2

2/15 UC Davis W, 8-2

2/15 at UC Davis L, 3-2

2/18 at Santa Clara W, 3-2



2/23 at Cal L, 7-2

2/25 Nevada-Reno W, 4-0



3/1 San Francisco St. W, 16-3


3/4 San Jose St. W, 10-1


3/5 San Jose St. L, 9-5

3/8 Cal L, 2-1

3/11 at Arizona St. L, 6-4



3/15 at Cal State Stanislaus L, 5-2

3/18 at St. Mary’s W, 2-1


3/19 at St. Mary’s L, 2-1

3/25 at San Francisco W, 11-9



3/29 UC Davis W, 10-6

3/29 UC Davis W, 19-6

4/1 Nevada-Reno L, 5-0

4/2 at Nevada-Reno L, 9-1

4/2 at Nevada-Reno L, 5-1

4/4 at Washington St. L, 4-2

4/6 Cal Poly-SLO W, 8-4


4/9 at San Jose St. L, 7-4

4/9 at San Jose St. L, 2-1

4/12 at CS Stanislaus L, 5-4

4/15 at UN-Las Vegas W, 10-8




4/23 at St. Mary’s L, 8-7



4/26 at San Francisco St. W, 7-2




5/6 at Pacifi c L, 3-1

5/7 at Pacifi c W, 5-2

5/7 at Pacifi c L, 2-1


5/14 Santa Clara W, 5-0

5/14 Santa Clara W, 2-0

NCAA WESTERN REGIONALS

(Honolulu, Hawaii)

5/26 CS Los Angeles W, 7-4

5/27 USC L, 7-3

5/28 CS Los Angeles L, 15-11


NCBA Record: N/A


Arizona State W, 7-5

Arizona State L, 15-0

Arizona State L, 6-4

Cal L, 5-4

Cal L, 11-5

Cal W, 8-4

Cal Poly W, 8-6

Cal State LA W, 7-5

Cal State LA W, 9-0

Nevada W, 9-0

Nevada L, 4-3

Nevada L, 9-8

Nevada L, 12-8

Nevada L, 4-2

Oregon State W, 11-6

Oregon State W, 11-1

Pacifi c L, 1-0

Pacifi c W, 6-3

Pacifi c L, 2-1

Pacifi c W, 7-1

Pacifi c W, 10-0

Pacifi c W, 7-3

Portland St. W, 14-6

Portland St. W, 9-0

Saint Mary’s W, 7-6





Saint Mary’s L, 2-1

San Francisco W, 12-4






San Francisco St. W, 8-1



San Jose State W, 7-3


San Jose State L, 11-7




Santa Clara L, 12-7

Santa Clara L, 7-5

Santa Clara W, 7-4

Santa Clara L, 4-2

Santa Clara W, 7-4

Santa Clara L 7-6

Stanford W, 4-2

Stanford W, 9-8

Stanford L, 8-5

UNLV W, 12-11

UNLV W, 4-2

UNLV L, 9-4

Washington State W, 11-4


NCBA Record: 23-13


2/2 Pacifi c* W, 22-9

2/2 Pacifi c* W, 6-2

2/3 Pacifi c* L, 3-1

2/9 at Arizona St. L. 1-0



2/16 at San Francisco* W, 5-4



2/19 Stanford W, 2-1

2/19 Stanford L, 7-3

2/23 Santa Clara* W, 6-3

2/24 Santa Clara* L, 3-0


3/2 at Nevada* W, 8-4


3/3 at Nevada* L, 2-1

3/6 at Stanford L, 5-3

3/9 St. Mary’s* L, 10-6

3/10 St. Mary’s* W, 10-1

3/10 St. Mary’s* L, 9-1

3/17 at San Jose St.* L, 7-6



3/20 Wyoming+ W, 1-0

3/21 Oregon State+ W, 6-2

3/21 UNLV+ W, 11-1

3/22 Pepperdine+ L, 10-4

3/23 Washington St.+ W, 7-2

3/24 Washington St.+ L, 7-6

3/24 Oregon State+ W, 9-1

3/30 San Francisco* W, 4-1



4/6 at Santa Clara* W, 4-2

4/7 at Santa Clara* L, 11-1

4/7 at Santa Clara* L, 7-6

4/10 Loyola W, 10-2

4/10 Loyola L, 1-0

4/13 at UNLV W, 6-4

4/14 at UNLV L, 8-7

4/14 at UNLV W, 12-5

4/17 at Cal Poly Pomona L, 6-1

4/20 Nevada* W, 6-3

4/21 Nevada* W, 4-2

4/21 Nevada* L, 5-4

4/24 Cal W, 11-5

4/24 Cal W, 6-5

4/27 at St. Mary’s* W, 10-7

4/27 at St. Mary’s* L, 3-2

4/29 at St. Mary’s* W, 10-7

5/4 San Jose St.* W, 6-5

5/5 San Jose St.* L, 10-6


5/8 at Cal L, 5-4

5/11 at Pacifi c* W, 5-0



5/18 at San Jose St.# L, 5-4

5/19 San Jose St.# W, 4-0

5/20 San Jose St.# W, 4-0

5/25 Univ. of Portland% W, 10-8

5/26 UCLA% L, 5-4

5/27 CS Fullerton% L, 12-3

*Northern California Baseball Associa-

" on

+Central Valley Baseball Tournament

%District 8 playoff s


WAC Record: 31-3


2/1 at St. Mary’s* W, 5-1







2/13 Cal Poly Pomona L, 5-4

2/22 Nevada* W, 14-4

2/22 Nevada* W, 3-0

2/23 Nevada* W, 1-0

2/29 at San Francisco* L, 5-4




3/8 Santa Clara* L, 3-2


3/11 at CS Northridge L, 4-2

3/11 at CS Northridge W, 12-4

3/15 Dominguez Hills W, 3-1

3/15 Dominguez Hills W, 12-2

3/21 at San Jose St.* W, 4-0



3/23 Oregon State W, 12-7

3/28 Pacifi c* W, 5-2

3/29 Pacifi c* W, 11-6

3/29 Pacifi c* W, 2-0

4/3 at Loyola L, 3-2

4/3 at Loyola W, 6-3

4/4 at Pepperdine L, 8-2

4/5 at Pepperdine W, 5-3

4/5 at Pepperdine W, 4-2

4/11 at Nevada* W, 13-9


4/12 at Nevada* L, 8-4

4/15 Pacifi c* W, 2-1




4/22 Cal Berkeley# W, 9-8

4/22 Cal Berkeley W, 7-3




4/29 Stanford# W, 10-1

5/2 at UNLV L, 5-2

5/3 at UNLV L, 4-0

5/3 at UNLV L, 5-3

5/9 St. Mary’s* W, 6-4

5/10 St. Mary’s* W, 16-3

5/10 St. Mary’s* W, 5-4

NCAA PLAYOFFS

5/23 at Arizona L, 5-4

5/24 CS Fullerton L, 10-2

#Extra Inning

*NCBA League Game




WAC Record: 26-10

Head Coach: Bob Benne� Date Opponent Result1/27 UC Berkeley L, 2-32/6 at Santa Clara* W, 11-12/7 at Santa Clara*+ W, 7-62/7 at Santa Clara* W, 9-22/10 at Cal Poly-SLO L, 6-32/14 UOP* W, 6-52/15 UOP* W, 5-12/15 UOP* W, 10-42/17 at CS Dominguez Hills L, 2-12/18 at CS Long Beach L, 10-72/20 UNR* L, 3-22/21 UNR* W, 3-12/21 UNR* L, 10-72/22 CS Northridge W, 5-42/22 CS Northridge L, 11-62/24 at Stanford L, 3-22/27 San Jose State* L, 11-62/28 San Jose State* W, 2-13/3 CS Long Beach+ W, 6-33/6 CS Fullerton W, 6-13/7 CS Fullerton W, 7-53/7 CS Fullerton W, 3-23/10 Arizona State W, 7-53/14 St. Mary’s* W, 3-13/14 St. Mary’s* W, 7-23/15 St. Mary’s* L, 4-23/20 U. San Francisco* W, 5-33/21 U. San Francisco* W, 9-13/22 U. San Francisco* L, 7-43/25 UC Santa Barbara L, 5-23/26 Washington State W, 11-83/26 Oregon State W,8-53/27 UC Santa Barbara L, 4-03/27 Brigham Young W, 6-03/28 Washington State W, 15-33/28 at UOP* L, 2-13/29 at UOP* W, 3-24/3 at UNR* W, 9-54/4 at UNR* W, 18-124/4 at UNR* L, 5-34/10 at San Jose State* L, 15-64/11 at San Jose State* W, 13-84/11 at San Jose State* W, 6-14/13 USC L, 7-64/14 USC W, 9-44/17 UNLV L, 13-34/18 UNLV W, 27-104/18 UNLV L, 14-94/21 Stanford+ W, 5-44/24 at St. Mary’s* L, 3-24/25 at St. Mary’s* W, 6-54/25 at St. Mary’s W, 18-74/28 at UOP* W, 6-55/1 at U. San Francisco* W, 17-65/2 at U. San Francisco* W, 14-75/2 at U. San Francisco* W, 17-15/5 San Jose State* L, 7-55/8 Santa Clara* W, 6-55/9 Santa Clara* W, 9-05/9 Santa Clara* W, 1-0NCBA Playo"

5/16 UNR W, 10-45/17 UNR W, 7-1NCAA PLAYOFFS

5/22 CS Fullerton L, 9-85/23 Gonzaga W, 10-85/24 CS Fullerton L, 10-9

*indicates PCAA League games+Extra Innings


WAC Record: 30-6

Head Coach: Bob Benne� Date Opponent Result2/2 at Stanford L, 2-42/5 St. Mary’s* L, 2-112/6 St. Mary’s* W, 7-12/6 St. Mary’s* W, 12-52/9 Cal Poly-SLO L, 3-02/12 at U. San Francisco* W, 7-02/19 San Jose State* W, 13-52/20 San Jose State* W, 6-32/20 San Jose State* W, 5-22/23 at Cal W, 11-32/23 at U. San Francisco* W, 4-22/23 at U. San Francisco* L, 1-22/26 at CS Fullerton L, 6-42/27 at CS Fullerton W, 8-42/27 at CS Fullerton W, 9-43/2 at UCSB L, 8-03/5 at Paci! c W, 4-33/6 at Paci! c L, 3-13/6 at Paci! c W, 8-33/12 Nevada-Reno* W, 5-23/13 Nevada-Reno* W, 18-03/13 Nevada-Reno* L, 1-03/19 at Santa Clara* W, 10-43/20 at Santa Clara* L, 5-23/20 at Santa Clara* W, 10-93/22 at UCSB L, 11-93/26 U San Francisco* W, 7-63/27 U San Francisco* W, 9-03/27 U San Francisco* W, 6-14/2 at San Jose State W, 19-14/3 at San Jose State W, 13-14/3 at San Jose State W, 6-54/7 Nevada-Las Vegas# W, 4-24/8 SW Louisiana# W, 9-54/9 SW Louisiana# W, 6-04/10 Long Beach State# W, 3-24/13 Loyola Marymount W, 15-14/13 Loyola Marymount W, 9-34/16 Paci! c* W, 6-54/16 Paci! c* W, 14-54/16 Paci! c* W, 9-54/20 Cal Poly-SLO W, 11-04/20 Cal Poly-SLO W, 7-64/24 at Nevada-Reno* W, 16-84/24 at Nevada-Reno* W, 29-54/24 at Nevada-Reno* W, 12-104/27 Stanford W, 6-34/30 Santa Clara* W, 9-25/1 Santa Clara* W, 4-35/1 Santa Clara* W, 19-75/7 at St. Mary’s* L, 8-55/8 at St. Mary’s* W, 11-35/8 at St. Mary’s W, 8-4

Northern Calif. Championship Playo" s

at Santa Clara** W, 11-5 Santa Clara** W, 4-2 Pepperdine*** W, 14-5District 8 NCAA Playo" s

Stanford*** L, 10-17 Pepperdine*** L, 8-11

*Conference Games**NCBA Playo" s***NCAA West Regionals#Best in the West Classic


NCBA Record: 22-8

Head Coach: Bob Benne� Date Opponent Result2/4 UC Irvine W, 9-02/5 UC Irvine W, 5-22/5 UC Irvine L, 4-32/8 at Stanford L, 9-82/11 U. San Diego W, 4-12/12 U. San Diego W, 3-12/12 U. San Diego W, 13-12/19 Cal W, 10-52/19 Cal W, 5-42/20 Cal W, 2-12/23-26 San Diego State# L, 6-5 CS Northridge# L, 7-4 Nevada-Las Vegas# W, 17-5 San Diego State# L, 26-20 CS Northridge# W, 12-43/4 Loyola-Marymount W, 1-03/5 Loyola-Marymount W, 4-13/8 Cal Poly-SLO W, 17-63/11 at Hawaii W, 10-83/11 at Hawaii W, 3-23/12 at Hawaii W, 5-33/13 at Hawaii L, 6-13/18 Washington St. L, 7-53/19 Washington St. W, 6-53/25 St. Mary’s* W, 2-13/26 St. Mary’s* W, 7-63/26 St. Mary’s* L, 1-03/29-4/2 Nevada-Las Vegas+ W, 8-1 Brigham Young+ L, 7-6 Long Beach State+ W, 7-0 Southern Cal+ W, 7-6 Southern Cal+ W, 6-2 Fullerton State+ L, 5-24/6 San Jose State* W, 13-44/6 San Jose State* W, 7-44/9 at San Jose State* W, 13-04/10 at San Jose State* W, 8-04/10 at San Jose State* W, 5-14/20 Santa Clara* W, 6-54/27 Paci! c* W, 13-24/27 Paci! c* W, 21-44/30 Paci! c* L, 8-75/1 at Paci! c* L, 3-25/1 at Paci! c* L, 4-25/4 Nevada-Reno* L, 8-55/4 Nevada-Reno* L, 7-65/7 at Nevada-Reno* W, 10-55/8 at Nevada-Reno* W, 10-35/8 at Nevada-Reno* W, 7-1 at St. Mary’s* L, 1-0 at St. Mary’s* W, 2-15/11 at USF* W, 13-05/11 at USF* W, 6-35/14 USF* W, 11-15/15 USF* W, 9-15/15 USF* W, 12-5 Santa Clara* W, 6-2 at Santa Clara* L, 7-6 at Santa Clara* W, 13-3 at Santa Clara* W, 4-1NCAA West II Regional Fullerton State% L, 7-5 Brigham Young% W, 13-6 Fullerton State% W, 6-3 Arizona State% L, 7-2

*Indicates NCBC Games#Indicates Desert Classic, Las Vegas+Indicates Best in the West Classic, Fresno%Indicates NCAA West II Regional, Tempe

1984Overall Record: 54-12-2

NCBA Record:

Head Coach: Bob Benne� Date Opponent Result2/3 at Long Beach State L, 2-102/4 at Long Beach State L, 8-92/4 at Long Beach State T, 3-32/6 at Stanford W, 3-22/10 at Loyola Marymount W, 21-52/11 at Loyola Marymount W, 6-52/11 at Loyola Marymount W, 13-82/14 at Cal Poly-SLO W, 1-02/17 Univ. San Diego W, 12-12/18 Univ. San Diego W, 13-102/18 Univ. San Diego L, 3-72/21 at California W, 5-32/24 at Fullerton State L, 2-42/25 at Fullerton State L, 2-32/26 at Fullerton State L, 3-52/28 Cal Poly SLO W, 8-23/1 Chico State W, 6-53/2 UC Irvine W, 6-03/3 UC Irvine W, 5-43/3 UC Irvine W, 5-03/5 Cal Poly Pomona L, 0-63/6 Cal Poly Pomona W, 6-23/9 UNLV W, 2-13/10 UNLV W, 6-13/11 UNLV W, 8-13/16 Long Beach State W, 5-4 3/17 Long Beach State W, 12-113/17 Long Beach State W, 15-53/20 Oregon State+ W, 9-13/21 UC Santa Barbara+ T, 4-43/22 Washington+ W, 12-53/23 SW Louisiana+ W, 5-33/24 Brigham Young+ L, 1-83/24 Brigham Young+ W, 9-03/28 at Santa Clara* W, 9-23/28 at Santa Clara* W, 6-53/31 at Paci! c* W, 11-44/1 at Paci! c* W, 5-44/1 at Paci! c* L, 1-84/4 at Nevada-Reno* W, 26-74/4 at Nevada-Reno* W, 12-64/7 at USF* W, 8-34/8 at USF* L, 6-74/8 at USF* W, 15-54/11 St. Mary’s* W, 9-14/11 St. Mary’s* W, 3-24/14 San Jose State* W, 6-5 (10)4/15 San Jose State* W, 10-14/15 San Jose State* W, 4-3 (8)4/23 Stanford W, 2-14/25 Paci! c* W, 18-34/25 Paci! c* W, 2-14/28 Nevada-Reno* W, 12-54/29 Nevada-Reno* W, 5-04/29 Nevada-Reno* W, 9-35/2 USF* W, 14-95/2 USF* W, 10-35/5 at St. Mary’s* W, 4-15/6 at St. Mary’s* W, 5-15/6 at St. Mary’s* W, 6-35/9 at San Jose State* W, 6-35/9 at San Jose State* W, 4-3 Santa Clara* W, 21-4 Santa Clara* W, 3-2 Santa Clara* W, 2-0 San Diego State# L, 6-10 USC# W, 15-12 (10)

*Indicates Northern California Baseball Assn. Game+Indicates Me-n-Ed’s/Pepsi Best in the West Classic#Indicates NCAA West I Regional at Fresno, CA




WAC Record: 23-7

Head Coach: Bob Benne� Date Opponent Result2/1 California W, 13-72/2 California L, 12-132/3 California L, 1-42/5 St. Mary’s W, 1-02/6 St. Mary’s W, 12-52/8 Loyola Marymount W, 7-22/9 Loyola Marymount W, 1-02/10 Loyola Marymount W, 1-02/12 Cal Poly- SLO W, 12-112/15 Stanford L, 4-82/16 Stanford W, 7-22/17 at Stanford L, 3-92/18 at Stanford L, 6-102/19 Sacramento State W, 8-62/22 at Hawaii L, 2-62/23 at Hawaii L, 7-82/23 at Hawaii W, 9-32/24 at Hawaii L, 7-123/1 at UC Santa Barbara* L, 2-83/2 at UC Santa Barbara* W, 7-43/2 at UC Santa Barbara* W, 6-03/6 Cal Poly- SLO L, 5-83/9 UNLV* W, 12-93/10 UNLV* W, 6-33/10 UNLV* L, 0-23/15 Paci! c* L, 3-23/16 Paci! c* W, 7-23/16 Paci! c* W, 15-03/23 at Long Beach State* W, 10-23/24 at Long Beach State* W, 8-43/24 at Long Beach State* W, 17-23/25 at Cal Poly-Pomona W, 4-13/29 Cal State Fullerton* W, 3-13/30 Cal State Fullerton* W, 15-73/30 Cal State Fullerton L, 4-94/2 UNLV+ W, 16-34/3 Long Beach St.+ L, 2-34/4 Nevada+ L, 5-64/5 UNLV+ W, 4-24/6 Long Beach State+ W, 6-34/12 at San Jose State* W, 7-04/13 at San Jose State* W, 6-24/13 at San Jose State* W, 4-04/19 at Paci! c* W, 3-24/20 at Paci! c* W, 8-04/20 at Paci! c* L, 4-5 (9)4/22 USF W, 5-04/23 USF W, 16-44/27 at UC Irvine* W, 4-3 (10)4/28 at UC Irvine* W, 13-24/28 at UC Irvine* W, 13-15/3 San Jose State* W, 9-25/4 San Jose State* W, 9-15/4 San Jose State* L, 0-55/6 at Nevada L, 13-145/7 at Nevada L, 10-115/10 UC Santa Barbara* L, 1-135/11 UC Santa Barbara* W, 11-35/11 UC Santa Barbara* W, 7-65/18 Cal State Fullerton# W, 9-75/19 Cal State Fullerton# W, 14-65/23 California% W, 7-6 (10)5/24 Arizona% L, 0-65/25 Brigham Young% W, 12-85/26 Arizona% L, 3-10

* indicates PCAA game+ indicates Me-N-Ed’s/Pepsi Best in the West Classic# indicates PCAA Championship Series at Fresno% indicates NCAA West II Regional at Fresno


WAC Record: 12-9

Head Coach: Bob Benne� Date Opponent Result2/7 at California L, 4-72/8 at California L, 5-132/9 at California L, 3-112/11 Cal State LA L, 0-22/14 at Loyola Marymount L, 5-6 (11)2/15 at San Diego W, 3-12/22 UCLA L, 0-62/23 UCLA L, 3-62/23 UCLA L, 6-132/25 Cal Poly-SLO W, 11-22/25 Cal Poly- SLO W, 5-43/1 St. Mary’s W, 7-03/2 St. Mary’s L, 8-93/2 St. Mary’s W, 7-53/3 Oregon State L, 7-8 (10)3/4 Oregon State W, 13-23/4 Oregon State W, 9-23/7 Gonzaga W, 4-03/8 Gonzaga W, 5-33/9 Gonzaga W, 4-23/12 Stanford W, 5-33/13 Brigham Young T, 4-43/15 Washington State+ L, 2-43/17 Nebraska+ L, 5-113/18 San Diego State+ L, 4-163/19 CS Fullerton+ L, 6-133/20 Stetson+ L, 4-53/21 Nevada-Reno+ W, 7-23/24 CS Northridge W, 5-43/25 Southern Cal W, 10-03/27 San Jose State* L, 2-73/28 San Jose State* W, 11-33/29 San Jose State* W, 6-14/4 at UC Santa Barbara* L, 8-94/5 at UC Santa Barbara* L, 6-84/6 at UC Santa Barbara* L, 6-7 (10)4/8 at St. Mary’s L, 1-34/11 Paci! c* L, 3-44/12 Paci! c* W, 13-34/13 Paci! c* W, 9-04/15 Santa Clara W, 8-64/18 at CS Fullerton* W, 8-44/19 at CS Fullerton* W, 13-44/20 at CS Fullerton* L, 1-84/22 Stanford L, 1-5 (10)4/23 U.S. International W, 5-14/25 at Nevada-Las Vegas W, 9-54/26 at Nevada-Las Vegas L, 4-54/27 at Nevada-Las Vegas L, 2-44/29 Cal Poly-SLO L, 4-75/2 CSU Long Beach* W, 14-15/3 CSU Long Beach* W, 8-65/4 CSU Long Beach* W, 6-25/6 Sacramento State W, 5-45/9 UC Irvine* W, 11-35/10 UC Irvine* L, 2-55/11 UC Irvine* W, 6-4 (11)

* indicates PCAA games+ indicates Me-N-Ed’s/Pepsi Best in the West Classic


PCAA Record: 9-12

Head Coach: Bob Benne� Date Opponent Result2/6 California W, 14-52/7 California L, 5-112/8 California W, 6-32/10 USF W, 5-32/11 USF L, 11-132/14 at Stanford L, 0-22/15 at Stanford W, 4-22/16 at Stanford W, 12-42/20 at Hawaii W, 8-62/21 at Hawaii L, 3-102/22 at Hawaii L, 4-52/27 Loyola Marymount L, 3-52/28 Loyola Marymount W, 7-63/1 Loyola Marymount W, 10-13/3 Cal State Northridge W, 11-33/4 Cal State Northridge W, 12-63/6 Gonzaga W, 8-23/7 Gonzaga W, 8-33/8 Gonzaga W, 12-43/10 TCU L, 2-33/11 TCU W, 6-33/13 St. Mary’s W, 21-63/14 St. Mary’s W, 8-73/16 Oregon State+ L, 0-13/17 U.S.I.U.+ W, 5-4 (14)3/18 San Diego State+ W, 4-33/19 UC Santa Barbara+ L, 3-63/20 UC Santa Barbara+ L, 3-43/24 Cal State LA L, 6-83/25 Cal State LA L, 6-83/27 at UC Irvine* L, 3-73/28 at UC Irvine* W, 4-13/29 at UC Irvine* L, 9-163/31 Cal Poly SLO W, 6-34/1 Cal Poly SLO W, 15-44/3 at San Jose State* L, 5-64/4 at San Jose State* W, 9-44/5 at San Jose State* L, 3-104/7 at Loyola Marymount L, 4-74/8 at Loyola Marymount L, 9-104/10 UC Santa Barbara* W, 7-6 (11)4/11 UC Santa Barbara* L, 13-154/12 UC Santa Barbara* L, 2-64/14 at St. Mary’s W, 10-54/16 at Paci! c* W, 11-54/17 at Paci! c* W, 2-04/18 at Paci! c* W, 8-44/21 Santa Clara W, 13-14/22 Santa Clara W, 12-44/24 CS Fullerton* L, 3-4 (10)4/25 CS Fullerton* W, 11-94/26 CS Fullerton* L, 2-34/28 at Nevada-Reno W, 7-64/29 at Nevada-Reno W, 19-45/1 UNLV* L, 4-65/2 UNLV* L, 8-95/3 UNLV* W, 5-35/8 at Long Beach State* L, 5-95/9 at Long Beach State* L, 8-105/10 at Long Beach State* W, 10-9

* indicates PCAA games# indicates Me-N-Ed’s/ Pepsi Best in the West Classic

1988Overall Record:56-12

PCAA Record: 20-1

Head Coach: Bob Benne� Date Opponent Result2/2 Cal Poly-Pomona L, 8-92/3 Cal Poly-Pomona W, 10-52/5 at California W, 14-122/6 at California L, 12-152/7 at California L, 5-62/13 at Univ. of San Diego W, 14-122/14 at Univ. of San Diego W, 7-12/15 at Univ. of San Diego L, 4-92/17 Cal Poly-SLO W, 6-12/19 St. Mary’s W, 11-42/20 St. Mary’s W, 3-02/21 St. Mary’s W, 8-02/23 CS Dominguez Hills L, 4-72/24 CS Dominguez Hills W, 11-12/26 Nevada-Reno W, 18-12/27 Nevada-Reno W, 9-12/28 Nevada-Reno W, 15-13/1 Cal State LA W, 7-43/2 Cal State LA W, 14-43/4 Gonzaga W, 11-53/5 Gonzaga W, 8-73/6 Gonzaga W, 15-53/8 CS Northridge L, 2-53/9 CS Northridge W, 10-33/12 USF W, 10-73/14 Texas A&M+ W, 6-53/15 George Washington+ W, 17-23/16 Oregon State+ W, 12-103/17 Clemson+ W, 13-103/18 Brigham Young+ W, 7-43/19 Texas A&M+ W, 4-03/22 Stanford W, 13-33/25 Long Beach State* W, 19-03/26 Long Beach State* W, 15-03/27 Long Beach State* W, 14-33/31 UC Irvine* W, 4-24/1 UC Irvine* W, 16-24/2 UC Irvine* W, 4-04/5 Loyola Marymount W, 6-14/6 Loyola Marymount W, 18-64/6 San Jose State* W, 17-34/9 San Jose State* W, 10-14/10 San Jose State* W, 7-14/12 Cal Poly-SLO W, 17-74/16 at UC Santa Barbara* W, 4-24/17 at UC Santa Barbara* W, 8-54/18 at UC Santa Barbara* W, 10-34/23 Brigham Young W, 7-34/24 Paci! c* W, 4-14/25 Paci! c* W, 18-14/26 Paci! c* W, 14-64/27 Stanford W, 6-5 (10)4/29 at CS Fullerton* W, 3-24/30 at CS Fullerton* W, 5-35/1 at CS Fullerton* W, 15-85/3 at Santa Clara L, 9-105/4 at Santa Clara L, 3-45/6 at UNLV* L, 8-125/7 at UNLV* W, 9-45/8 at UNLV* W, 11-65/26 Minnesota# W, 10-85/27 Brigham Young# W, 7-65/28 USC# L, 17-185/29 Washington State# W, 7-65/30 USC# W, 17-125/30 USC# W, 14-36/2 Stanford% L, 3-106/3 Miami, Fla.% L, 4-8* indicates conference games# indicates Pepsi/Me-N-Ed’s Clasic (Champion)# indicates NCAA West Regional at Fresno% indicates college World Series at

Omaha




Big West Record: 17-4

Head Coach: Bob Benne� Date Opponent Result2/5 California L, 2-52/5 California L, 4-62/10 Southern Cal W, 4-32/11 Southern Cal L, 5-102/11 Southern Cal L, 5-112/15 Stanford L, 1-22/17 Santa Clara W, 6-42/18 Santa Clara W, 11-22/18 Santa Clara L, 9-102/19 San Diego State W, 13-102/21 Cal State LA W, 12-52/24 Hawaii W, 8-52/25 Hawaii W, 3-12/26 Hawaii W, 6-53/2 Oregon State W, 5-23/3 Oregon State L, 6-83/4 Oregon State W, 2-13/7 USF W, 10-83/8 USF W, 11-33/10 Portland L, 3-43/11 Portland L, 2-63/13 Virginia Tech+ W, 14-23/14 Liberty+ W, 18-33/15 Missouri+ L, 5-83/16 North Carolina+ W, 9-43/17 Washington St.+ W, 11-03/18 Washington St.+ W, 9-53/23 St. Mary’s W, 10-33/24 St. Mary’s W, 8-53/25 St. Mary’s W, 6-13/28 Loyola Marymount L, 5-63/31 Long Beach State* W, 3-14/1 Long Beach State* L, 8-94/2 Long Beach State* W, 14-14/4 Cal Poly-SLO W, 14-44/5 Cal Poly-SLO W, 3-24/7 UC Irvine* W, 8-54/8 UC Irvine* W, 24-44/9 UC Irvine* W, 9-84/12 CS Northridge L, 2-44/14 UC Santa Barbara* W, 8-64/15 UC Santa Barbara* W, 7-34/16 UC Santa Barbara* W, 7-54/19 Loyola Marymount L, 7-84/21 Paci! c* W, 6-04/22 Paci! c* L, 2-34/26 Stanford W, 8-24/28 UNLV* L,1-24/29 UNLV* W, 5-24/30 UNLV* W, 6-35/2 Cal Poly-SLO W, 13-35/5 San Jose State* W, 8-75/6 San Jose State* W, 4-15/7 San Jose State* L, 2-45/10 Nevada-Reno W, 9-85/12 CS Fullerton* W, 6-55/13 CS Fullerton* W, 7-65/14 CS Fullerton* W, 9-85/17 Paci! c* W, 5-25/26 Notre Dame# W, 9-85/27 Michigan# L, 3-55/28 Notre Dame# W, 11-45/28 Wichita State# L, 4-6

+ Pepsi/ Me-N-Ed’s Classic* Big West Conference

#NCAA West II Regional


Big West Record: 13-8

Head Coach: Bob Benne� Date Opponent Result2/2 California W, 7-12/4 California W, 13-32/4 California L, 3-72/7 Cal Poly-SLO W, 6-52/8 USC L, 4-162/9 USC W, 6-52/10 USC L, 3-42/17 Washington St. W, 15-52/17 Washington St. W, 2-12/18 Washington St. L, 1-42/23 Pepperdine L, 2-32/24 Pepperdine L, 0-152/25 Pepperdine W, 11-53/1 Oregon State W, 7-63/3 Oregon State W, 14-53/3 Oregon State L, 1-23/9 Gonzaga W, 9-83/10 Gonzaga W, 6-33/12 Maine+ W, 6-43/13 E. Michigan+ W, 14-33/14 Portland+ W, 6-53/15 G. Washington+ W, 4-23/16 Gonzaga+ W, 9-33/17 Arkansas+ L, 4-63/20 U.S. International L, 7-123/21 U.S. International W, 12-33/22 USF W, 5-43/24 Stanford L, 2-93/25 Stanford W, 4-33/26 Stanford L, 3-53/30 Paci! c* W, 11-13/31 Paci! c* W, 3-14/1 Paci! c* W, 2-14/3 CS Northridge W, 10-14/6 UC Irvine* W, 8-34/7 UC Irvine* W, 2-14/8 UC Irvine* W, 5-14/10 Nevada-Reno W, 6-14/12 CS Fullerton* L, 3-64/13 CS Fullerton* L, 2-54/14 CS Fullerton* L, 4-154/17 Cal Poly-SLO W, 14-34/20 San Jose State* W, 8-74/21 San Jose State* W, 5-34/22 San Jose State* W, 12-24/25 Cal Poly-Pomona L, 4-84/27 UNLV* L, 0-94/28 UNLV* W, 10-74/29 UNLV* L, 0-105/4 Long Beach State* W, 7-55/5 Long Beach State* W, 8-45/6 Long Beach State* L, 7-95/8 St. Mary’s L, 2-55/11 UC Santa Barbara* W, 12-75/12 UC Santa Barbara* L, 1-65/13 UC Santa Barbara* L, 4-65/18 North Carolina # L, 3-55/19 Clemson # W, 5-25/20 N. Carolina State # W, 11-85/24 S. Illinois % W, 3-25/25 San Diego St.% L, 4-85/26 S. Illinois% L, 1-3

* Big West Conference+ Pepsi/Me-N-Ed’s Classic# Carolina Invitational% NCAA West II Regional


WAC Record: 15-6

Head Coach: Bob Benne� Date Opponent Result2/3 Univ. of San Diego W, 5-22/3 Univ. of San Diego W, 12-22/5 USF W, 10-62/8 at Stanford W, 7-12/9 at Stanford W, 5-42/10 at Stanford L, 3-62/12 U.S. International W, 5-32/13 U.S. International W, 7-12/15 California L, 8-102/16 California L, 14-152/17 California W, 17-92/19 Cal Poly-SLO W, 6-52/22 at Hawaii L, 8-92/23 at Hawaii L, 4-52/24 at Hawaii W, 17-83/2 New Mexico State W, 4-03/2 New Mexico State W, 5-43/7 St. Mary’s W, 5-03/8 St. Mary’s L, 9-133/9 St. Mary’s W, 10-43/11 St. John’s^ W, 5-33/12 Indiana State^ W, 9-53/13 Iowa State^ L, 4-53/15 Virginia Tech^ L, 0-43/15 Cal State Northridge^ L, 1-43/16 Iowa State^ W, 4-23/21 Oregon State W, 3-13/22 Oregon State L, 3-93/23 Oregon State L, 2-53/28 at Paci! c* W, 6-13/29 at Paci! c* W, 6-33/30 at Paci! c* W, 18-24/5 at UC Irvine* W, 4-14/6 at UC Irvine* W, 8-24/7 at UC Irvine* W, 6-34/9 Cal Poly-SLO L, 7-84/12 Cal State Fullerton* W, 1-04/13 Cal State Fullerton* W, 6-44/14 Cal State Fullerton* L, 5-204/16 Loyola Marymount W, 4-34/19 at San Jose State* W, 4-04/20 at San Jose State* L, 0-14/21 at San Jose State* W, 9-14/22 at Nevada L, 4-74/23 at Nevada W, 11-64/26 UNLV* W, 6-14/27 UNLV* W, 8-54/28 UNLV* W, 11-75/3 at Long Beach State* W, 2-15/4 at Long Beach State* L, 2-65/5 at Long Beach State* L, 2-65/10 UC Santa Barbara* W, 10-65/11 UC Santa Barbara* L, 13-145/12 UC Santa Barbara* L, 3-85/16 SW Louisiana W, 8-65/17 SW Louisiana L, 3-95/18 SW Louisiana W, 10-15/23 CS Northridge # W, 7-25/24 Stanford # W, 4-25/25 Stanford# W, 7-25/26 CS Northridge # L, 2-65/26 CS Northridge # W, 6-55/31 Florida State $ W, 6-36/2 LSU $ L, 3-156/4 Florida $ L, 1-2* Big West Conference^ Pepsi/Johnny Quik Clasic# - NCAA West II Regional$ - College World Series


WAC Record: 16-8

Head Coach: Bob Benne� Date Opponent Result1/31 Stanford W, 11-32/1 Stanford L, 5-102/2 Stanford L, 0-32/7 at California W, 10-42/8 at California L, 4-52/9 at California L, 4-142/13 USC W, 5-22/14 USC L, 2-6 (12)2/16 USF W, 3-2 (10)2/17 USF W, 12-32/19 Chapman L, 6-82/21 St. Mary’s W, 12-12/22 St. Mary’s W, 11-52/23 St. Mary’s W, 6-52/27 BYU W, 4-32/28 BYU L, 3-42/29 BYU W, 4-33/3 Cal Poly-SLO L, 2-153/6 at UC Santa Barbara* W, 10-23/7 at UC Santa Barbara* W, 5-33/8 at UC Santa Barbara* L, 1-113/12 Michigan W, 12-73/13 Michigan W, 6-43/14 Michigan W, 6-03/16 Washington State % W, 9-83/17 Nebraska % W, 15-23/18 New Mexico % W, 9-43/19 Creighton % L, 9-10 (10)3/20 Creighton % W, 13-33/21 CS Northridge % L, 5-103/27 UC Irvine* W, 10-43/28 UC Irvine* W, 6-03/29 UC Irvine* W, 10-33/31 Loyola Marymount W, 5-24/3 at CS Fullerton* L, 1-24/4 at CS Fullerton* L, 3-124/5 at CS Fullerton* W, 7-6 (12)4/7 at Loyola Marymount W, 10-84/10 Paci! c* W, 6-14/11 Paci! c* W, 4-04/12 Paci! c* W, 5-14/16 San Jose State* W, 9-7 (10)4/17 San Jose State* W, 6-24/18 San Jose State* W, 4-3 (10)4/21 Cal Poly-SLO W, 9-8 (11)4/24 at New Mexico State* W, 12-64/25 at New Mexico State* W, 12-74/26 at New Mexico State* L, 4-64/28 Santa Clara W, 6-55/1 at UNLV* L, 7-105/2 at UNLV* W, 7-25/3 at UNLV* W, 3-05/8 Long Beach State* L, 3-125/9 Long Beach State* L, 7-125/10 Long Beach State* L, 2-185/22 Pepperdine^ L, 4-5 (10)5/23 Washington ^ L, 3-4

* Big West Conference Game% Pepsi/Johnny Quik Classic ^ NCAA West Regional (Tuscon, Ariz.)




WAC Record: 14-8

Head Coach: Bob Benne� Date Opponent Result2/5 Loyola Marymount W, 9-82/6 Loyola Marymount W, 6-12/7 Loyola Marymount W, 15-32/10 Cal Poly-SLO W, 8-12/13 at Stanford L, 6-72/14 at Stanford L, 1-122/16 Paci! c W, 10-52/19 California W, 3-22/20 California L, 5-92/21 California W, 10-22/25 at USC L, 4-52/26 at USC W, 7-62/27 at USC L, 3-43/2 at Hawaii* L, 6-73/3 at Hawaii* W, 8-63/4 at Hawaii L, 4-53/6 Wyoming W, 6-13/7 Wyoming W, 4-33/8 Wyoming W, 10-33/10 at Saint Mary’s L, 6-93/15 Arizona % L, 9-193/16 Texas Tech % W, 4-23/17 Kansas State % W, 10-13/18 Nebraska % W, 10-83/19 Nebraska % L, 5-143/20 Kansas State% W, 16-63/27 at San Diego State* W, 6-53/30 Santa Clara W, 9-34/2 Sacramento State* W, 5-34/3 Sacramento State* W, 14-14/4 Sacramento State* L, 9-13 (10)4/6 USF W, 11-14/7 USF W, 10-44/8 Chapman W, 4-34/9 Chapman W, 12-04/10 Chapman W, 21-44/13 Cal Poly-SLO L, 2-44/16 Hawaii* W, 3-24/17 Hawaii* W, 5-44/18 Hawaii* W, 4-34/23 Cal State Northridge* W, 5-34/24 Cal State Northridge* W, 7-6 (10)4/25 Cal State Northridge* W, 10-14/27 Saint Mary’s W, 9-14/30 at Sacramento State* W, 12-75/1 at Sacramento State* W, 9-55/2 at Sacramento State* L, 5-85/4 at BYU L, 14-205/7 San Diego State* L, 9-11 (10)5/8 San Diego State* L, 1-85/9 San Diego State* W, 2-15/14 at Cal State Northridge* L, 6-135/15 at Cal State Northridge* L, 5-135/16 at Cal State Northridge* W, 11-35/20 BYU # W, 9-65/21 BYU # L, 4-75/22 BYU # W, 4-15/28 Kansas ^ W, 7-45/29 Clemson ^ L, 3-105/30 Tennessee ^ W, 6-25/30 Clemson ^ W, 11-45/31 Kansas ^ L, 2-3 (10)* Western Athletic Conference Games% Pepsi/Johnny Quik Classic (Fresno, Calf.)# WAC Championship Series (Fresno, Calif.)^ NCAA Mideast Regional (Knoxville,

Tenn.)


WAC Record: 15-9

Head Coach: Bob Benne� Date Opponent Result2/4 Stanford L, 5-72/5 Stanford L, 2-92/6 Stanford L, 4-72/11 Wyoming W, 9-22/12 Wyoming L, 5-92/13 Wyoming W, 3-02/15 Cal Poly-SLO W, 15-42/20 at California L, 1-22/24 vs. Clemson+ W, 11-52/25 vs. Rice+ W, 13-42/25 vs. UNLV+ L, 2-42/26 vs. UNLV+ L, 2-102/27 vs. Clemson+ L, 8-13 (10)3/2 vs. CS Fullerton+ W, 5-23/4 Long Beach State L, 5-123/5 Long Beach State L, 3-83/6 Long Beach State W, 5-13/8 at Paci! c L, 1-53/11 CS Sacramento* W, 7-63/12 CS Sacramento* W, 6-23/13 CS Sacramento* L, 0-93/14 Kentucky % W, 8-33/15 Maine % W, 10-13/16 Illinois State % W, 17-13/17 Nebraska % W, 10-43/18 Nevada% W, 4-33/19 Washington State % L, 4-73/26 at CS Northridge* L, 2-33/27 at CS Northridge* W, 9-63/29 at CS Northridge* L, 8-93/29 Santa Clara L, 6-74/1 at San Diego State* L, 5-94/2 at San Diego State* W, 4-34/3 at San Diego State* L, 3-4 (11)4/8 Hawaii* W, 5-04/9 Hawaii* W, 7-34/10 Hawaii* L, 2-44/12 Cal Poly-SLO W, 9-74/15 at CS Sacramento* L, 3-4 (10)4/16 at CS Sacramento* W, 7-24/17 at CS Sacramento* L, 13-214/18 at Saint Mary’s W, 13-94/19 at Santa Clara L, 3-74/22 Old Dominion W, 5-44/23 Old Dominion W, 4-34/24 Old Dominion W, 4-3 (15)4/26 Saint Mary’s W, 2-14/29 at Hawaii* W, 5-24/30 at Hawaii* W, 3-25/1 at Hawaii* W, 9-25/2 at Hawaii-Hilo W, 8-25/3 at Hawaii-Hilo W, 6-35/7 San Diego State* W, 3-25/8 San Diego State* W, 5-2 (10)5/8 San Diego State* L, 1-35/10 at CS Fullerton W, 12-65/13 CS Northridge W, 12-45/14 CS Northridge W, 9-15/15 CS Northridge W, 8-75/19 Brigham Young # L, 1-25/20 Brigham Young # L, 6-85/26 Tulane ^ L, 5-75/27 Louisiana State ^ W, 6-5

* Western Wester Division Games+ UNLV/ Coors Desert Classic (Las Vegas, Nev.)% Pepsi/ Johnny Quik Classic (Fresno, Calif.)# WAC Chanpionships (Provo, Utah)^ NCAA South Regional (Baton Rouge, La.)


WAC Record: 20-10

Head Coach: Bob Benne� Date Opponent Result1/31 Paci! c W, 3-22/3 California W, 13-72/4 California W, 8-12/5 California W, 7-42/10 at Stanford W, 3-22/11 at Stanford W, 6-22/12 at Stanford L, 2-42/15 San Jose State W, 2-02/17 CS Fullerton W, 6-32/18 CS Fullerton L, 3-42/19 CS Fullerton L, 3-72/21 at Saint Mary’s L, 3-62/24 at Cal Poly-SLO* L, 5-62/25 at Cal Poly-SLO* W, 9-42/26 at Cal Poly-SLO* W, 6-32/28 Santa Clara W, 4-33/3 at Long Beach State W, 5-13/4 at Long Beach State L, 4-93/7 at Long Beach State L, 2-33/11 Hawaii* W, 5-13/12 Hawaii* L, 6-73/12 Hawaii* W, 10-73/13 Portland % W, 12-113/14 Missouri % W, 6-23/15 UNLV % W, 7-03/16 Gonzaga % W, 13-33/17 Virginia Tech % L, 0-83/18 UNLV % W, 11-03/21 San Francisco W, 10-13/25 at San Diego State* L, 2-33/26 at San Diego State* W, 3-23/27 at San Diego State* L, 4-113/31 at CS Sacramento* L, 3-44/1 at CS Sacramento* W, 5-14/2 at CS Sacramento* W, 4-14/4 at San Francisco W, 11-74/7 CS Northridge* W, 7-14/8 CS Northridge* W, 12-84/9 CS Northridge* W, 8-64/11 at Paci! c W, 11-24/13 Cal Poly-SLO* W, 10-04/14 Cal Poly-SLO* W, 5-34/15 Cal Poly-SLO* W, 13-34/18 Saint Mary’s W, 14-44/21 at Hawaii* L, 6-124/22 at Hawaii* W, 14-54/23 at Hawaii* L, 3-54/25 at Hawaii-Hilo* L, 1-34/28 San Diego State* W, 10-44/29 San Diego State* W, 8-34/30 San Diego State* W, 6-55/5 CS Northridge* W, 11-75/6 CS Northridge* W, 12-115/7 CS Northridge* L, 0-15/8 at Long Beach State L, 4-55/9 at Santa Clara L, 1-25/12 CS Sacramento* L, 2-35/13 CS Sacramento* W, 8-75/14 CS Sacramento* L, 4-65/18 Brigham Young # W, 18-35/19 Brigham Young# W, 3-25/25 at Pepperdine ^ L, 5-95/26 at USC* L, 17-22

* WAC Western Division Game% Pepsi/Johnny Quick Classic (Fresno, Calif.)# WAC Championships (Fresno, Calif.)^ NCAA West Regional (Fresno, Calif.)


WAC Record: 20-10

Head Coach: Bob Benne� Date Opponent Result2/2 Nevada L, 3-5 (12)2/3 Nevada L, 2-142/4 Nevada W, 8-42/6 Saint Mary’s W, 16-22/6 Saint Mary’s W, 10-32/9 at CS Fullerton L, 2-172/10 at CS Fullerton L, 3-52/11 at CS Fullerton L, 5-62/12 at UNLV W, 9-62/13 at UNLV L, 6-82/16 Stanford W, 16-12/17 Stanford L, 0-62/18 Stanford L, 5-92/23 at California W, 4-12/24 at California L, 3-52/25 at California L, 4-133/1 at CS Northridge* L, 2-43/2 at CS Northridge* L, 3-293/3 at CS Northridge* W, 11-83/5 at San Jose State L, 14-153/8 Cal Poly-SLO* L, 0-23/9 Cal Poly-SLO* W, 9-63/10 Cal Poly-SLO* W, 3-23/11 St. John’s % W, 13-73/13 Portland State % W, 5-33/14 Nebraska % W, 4-13/15 Oregon State % W, 7-43/16 Portland State % W, 5-03/19 San Jose State W, 11-103/22 at Hawaii * W, 7-43/23 at Hawaii * W, 11-53/24 at Hawaii * W, 18-33/26 at San Diego State* W, 2-13/27 at San Diego State* L, 5-93/29 CS Sacramento* W, 6-23/30 CS Sacramento* W, 9-13/31 CS Sacramento* W, 9-44/2 at Long Beach State L, 2-34/4 San Diego State* W, 3-24/5 San Diego State* L, 4-94/6 San Diego State* L, 2-64/9 at Santa Clara W, 3-1 (13)4/12 Cal Poly-SLO* L, 8-114/13 Cal Poly-SLO* W, 20-104/14 Cal Poly-SLO* L, 5-94/16 at San Diego State* L, 2-54/19 CS Northridge* L, 1-84/20 CS Northridge* W, 7-24/21 CS Northridge* W, 6-24/23 Santa Clara W, 10-94/26 at CS Sacramento* W, 10-04/27 at CS Sacramento* W, 4-24/28 at CS Sacramento* W, 5-34/30 Long Beach State W, 6-45/2 Hawaii* W, 13-25/3 Hawaii* W, 12-35/4 Hawaii* W, 7-25/23 at Texas Tech # W, 12-55/24 Oklahoma State # L, 5-125/25 at Texas Tech # L, 2-13

* WAC Western Division Game% Pepsi/Johnny Quik Classic (Fresno, Calif.)# NCAA Central II Regional (Lubbock, Texas)




WAC Record: 19-11

Head Coach: Bob Benne� Date Opponent Result1/31 Long Beach State W, 7-22/1 Long Beach State L, 3-62/2 Long Beach State W, 7-62/4 Paci! c L, 4-72/7 at Stanford L, 1-62/8 at Stanford W, 1-02/9 at Stanford L, 2-142/11 Cal Poly-SLO L, 9-122/14 Washington L, 4-72/15 Washington L, 6-82/16 Washington W, 4-22/21 at San Jose State* W, 8-32/22 at San Jose State* L, 1-42/23 at San Jose State* L, 3-42/25 CS Fullerton L, 2-32/26 CS Fullerton W, 4-32/28 Grand Canyon* W, 11-13/1 Grand Canyon* W, 4-23/2 Grand Canyon* W, 6-33/4 at Pepperdine L, 9-103/7 San Diego State* W, 7-33/8 San Diego State* L, 1-103/9 San Diego State* W, 7-63/10 Chicago State% W, 12-53/11 Gonzaga% W, 8-63/12 Indiana State% W, 10-23/13 Rhode Island% W, 12-23/14 Pennsylvania% W, 10-13/15 CS Northridge% W, 9-03/18 Washington State W, 10-23/19 Washington State W, 9-23/21 at Hawaii* W, 9-33/22 at Hawaii* L, 4-53/27 at TCU* W, 19-123/28 at TCU* W, 10-53/29 at TCU* L, 7-114/1 at Santa Clara W, 13-84/4 Rice* W, 2-14/5 Rice* W, 6-34/6 Rice* W, 2-14/8 at Cal Poly-SLO L, 3-94/11 San Jose State* W, 1-04/12 San Jose State* L, 0-24/13 San Jose State* W, 10-14/18 at San Diego State L, 3-64/19 at San Diego State L, 2-44/20 at San Diego State W, 9-7 (12)4/22 Santa Clara L, 18-264/25 Hawaii* L, 6-134/26 Hawaii* W, 6-44/27 Hawaii* L, 4-64/27 Hawaii* W, 16-114/29 Pepperdine W, 7-55/2 at Arizona State L, 2-235/3 at Arizona State L, 2-95/4 at Arizona State W, 10-8 (10)5/9 at Air Force* L, 8-9 (11)5/10 at Air Force* W, 7-05/11 at Air Force* W, 24-05/14 vs. Utah$ W, 6-35/15 at San Diego State L, 4-75/16 vs. BYU$ W, 8-55/16 at San Diego State L, 2-75/22 vs. Texas A&M# W, 2-15/23 vs. Santa Clara# L, 1-85/24 vs. CS Fullerton# W, 8-75/24 vs. Santa Clara# W, 10-75/25 at Stanford# L, 2-5

* Western Athletic Conference Game% Pepsi/Johnny Quik Classic (Fresno, Calif.)$ WAC Tournament (San Diego, Calif.)# NCAA West Regional (Palo Alto,

Calif.)


WAC Record: 19-11

Head Coach: Bob Benne� Date Opponent Result1/30 Stanford L, 10-12 (11)1/31 Stanford L, 9-162/1 Stanford L, 0-42/6 at Long Beach State L, 1-92/8 at Long Beach State T, 7-7 (12)2/10 Paci! c L, 2-42/13 CS Fullerton L, 3-62/14 CS Fullerton L, 4-112/15 CS Fullerton L, 1-152/18 Cal Poly-SLO W, 8-32/20 Pepperdine W, 5-12/22 Pepperdine L, 5-62/22 Pepperdine W, 8-32/24 Sacramento State W, 10-32/27 at UNLV* W, 7-32/28 at UNLV* L, 4-53/1 at UNLV* L, 5-63/3 at Paci! c L, 3-143/6 Utah* W, 9-03/7 Utah* W, 5-23/8 Utah* W, 9-73/9 Purdue% W, 13-33/10 Toledo% W, 9-33/11 Evansville% W, 5-33/12 Winthrop% L, 1-33/13 Bowling Green% L, 4-53/14 Indiana State% L, 1-73/17 Arizona State W, 9-33/18 Arizona State W, 6-5 (10)3/20 at Hawaii* L, 1-53/21 at Hawaii* W, 7-33/22 at Hawaii* L, 5-63/27 New Mexico* W, 7-43/29 New Mexico* W, 7-13/29 New Mexico* W, 12-64/1 at Santa Clara L, 8-94/3 San Jose State* W, 6-24/4 San Jose State* W, 6-54/5 San Jose State* L, 1-114/9 at San Diego State* W, 7-64/10 at San Diego State* L, 2-34/14 Cal Poly-SLO W, 11-64/17 at BYU* W, 10-94/18 at BYU* W, 9-24/18 at BYU* L, 6-104/21 at Sacramento State W, 6-5 (10)4/25 Hawaii* L, 1-44/26 Hawaii* W, 24-94/27 Hawaii* W, 15-104/28 at Nevada L, 3-65/1 at San Jose State* W, 6-45/2 at San Jose State* L, 1-35/3 at San Jose State* L, 5-105/6 San Diego State* W, 11-25/7 San Diego State* W, 11-35/8 San Diego State* L, 2-95/9 San Diego State* W, 10-55/13 Grand Canyon$ W, 5-05/14 San Diego State$ W, 18-25/15 Rice$ L, 4-5 (10)5/15 New Mexico$ W, 3-2 (10)5/16 Rice$ L, 2-15

* Western Athletic Conference Game% Pepsi/Johnny Quik Classic (Fresno, Calif.)$ WAC Tournament (San Diego, Calif.)


WAC Record: 14-16

Head Coach: Bob Benne� Date Opponent Result1/29 at Stanford L, 0-11/30 at Stanford W, 8-61/31 at Stanford W, 5-32/2 St. Mary’s W, 5-22/5 Santa Clara L, 3-92/6 Santa Clara W, 3-22/7 Santa Clara W, 5-4 (12)2/10 California L, 4-62/12 at CS Fullerton L, 7-152/13 at CS Fullerton L, 3-42/14 at CS Fullerton L, 4-82/17 Cal Poly-SLO W, 7-12/19 at Pepperdine L, 4-52/20 at Pepperdine W, 5-32/21 at Pepperdine L, 7-82/26 at Rice* L, 4-102/27 at Rice* L, 5-82/28 at Rice* L, 2-83/5 TCU* W, 7-13/6 TCU* L, 6-73/7 TCU* L, 8-143/8 Gonzaga# L, 1-93/9 Pennsylvania# W, 20-23/10 Seton Hall# W, 6-43/11 Portland# W, 10-33/12 North Carolina# W, 11-73/13 North Carolina# L, 5-83/17 California L, 6-163/19 at Hawaii* L, 5-113/20 at Hawaii* L, 3-73/21 at Hawaii* W, 6-43/22 Hawaii! L, 5-123/24 Hawaii Paci! c! W, 6-13/25 Northwestern! L, 10-133/26 Hawaii-Hilo! W, 15-23/28 Hawaii! L, 3-53/30 Sacramento State W, 4-14/1 at New Mexico* L, 26-274/3 at New Mexico* L, 10-114/3 at New Mexico* L, 11-194/6 Southern Utah W, 6-24/7 Southern Utah W, 4-34/10 Air Force* W, 8-74/11 Air Force* L, 0-24/12 Air Force* W, 7-64/13 at Cal Poly W, 8-14/16 San Jose State* W, 10-34/17 San Jose State* W, 11-54/18 San Jose State* W, 9-84/20 St. Mary’s W, 8-24/23 at San Diego State* W, 11-24/24 at San Diego State* L, 1-24/25 at San Diego State* W, 7-54/27 at Sacramento State W, 14-74/29 BYU* W, 3-2 (10)4/30 BYU* W, 7-25/1 BYU* L, 6-85/7 at Utah* W, 14-65/8 at Utah* W, 16-85/9 at Utah* L, 2-45/14 UNLV* L, 1-85/15 UNLV* W, 6-35/16 UNLV* L, 3-6

*Western Athletic Conference Game#Pepsi/Johnny Quick Classic (Fresno, Calif.)

!Hawaii Easter Tournament


WAC Record: 14-16

Head Coach: Bob Benne� Date Opponent Result1/28 vs. Stanford L, 10-21/29 vs. Stanford L, 7-12/4 vs. Pepperdine W, 14-22/5 vs. Pepperdine W, 7-62/6 vs. Pepperdine W, 6-22/12 at Santa Clara W, 5-32/12 at Santa Clara W, 16-32/18 vs. Oregon St. W, 4-12/19 vs. Oregon St. W, 9-42/20 vs. Oregon St. W, 8-02/22 vs. Cal Poly W, 6-42/25 at Rice* W, 5-22/26 at Rice* W, 9-52/27 at Rice* L, 8-02/29 vs. California L, 12-103/2 vs. Hawaii Hilo* W, 5-33/3 vs. Hawaii Hilo* W, 6-43/4 vs. Hawaii Hilo* W, 7-33/6 vs. Temple# W, 5-33/8 vs. Bowling Green# W, 5-13/8 vs. Creighton# L, 12-33/9 vs. Southern Illinois# W, 12-03/10 vs. Indiana St.# W, 13-53/11 vs. Creighton # W, 5-13/17 vs. Hawaii* L, 9-43/18 vs. Hawaii* W, 6-23/19 vs. Hawaii* L ,6-23/21 at Sacramento St. W, 3-13/24 vs. Rice* W, 15-13/25 vs. Rice* W, 6-33/26 vs. Rice* L, 5-23/28 vs. Loyola Marymnt W, 8-54/2 at Santa Clara W, 10-84/4 at Cal Poly L, 4-04/7 at TCU* W, 9-74/8 at TCU* W, 8-34/9 at TCU* L, 10-14/11 vs. Paci! c W, 12-54/15 at Hawaii* L, 8-74/16 at Hawaii* W, 9-24/17 at Hawaii* W, 7-44/20 at Hawaii Hilo* W, 15-34/21 at Hawaii Hilo* W, 8-04/22 at Hawaii Hilo* L, 5-44/25 vs. San Francisco W, 6-54/28 vs. San Jose St.* L, 7-34/29 vs. San Jose St.* L, 5-44/30 vs. San Jose St.* L, 5-05/2 vs. Sacramento St. W, 15-25/4 vs. TCU* W, 9-65/5 vs. TCU* W, 7-65/6 vs. TCU* W, 6-55/9 at California W, 11-25/12 at Nebraska L, 3-25/13 at Nebraska W, 6-15/14 at Nebraska L, 8-05/19 at San Jose St.* L, 4-25/20 at San Jose St.* L, 7-25/21 at San Jose St.* W, 8-5

NCAA Regional(Palo Alto, Calif.)

5/26 at Stanford L, 5-15/27 at Nevada L, 13-5

*Western Athletic Conference Game#Pepsi/Johnny Quik Classic (Fresno, Calif.)




WAC Record: 22-15

Head Coach: Bob Benne� Date Opponent Result1/26 vs. Stanford L, 11-91/27 vs. Stanford W, 3-21/28 vs. Stanford L, 9-52/1 vs. BYU L, 4-12/2 vs. BYU L, 7-42/3 vs. BYU W, 6-32/6 vs. St Mary’s W, 5-12/10 vs. Santa Clara W, 8-52/10 vs. Santa Clara W, 11-102/16 vs. San Jose St W, 3-22/17 vs. San Jose St W, 5-32/18 vs. San Jose St L, 7-42/24 vs. Hawaii W, 6-22/25 vs. Hawaii W, 6-52/26 vs. Hawaii W, 8-42/28 vs. San Francisco W, 4-13/2 at Nevada W, 19-63/3 at Nevada L, 4-33/4 at Nevada L, 6-23/6 vs. Eastern Mich W, 11-33/7 vs. Eastern Mich W, 8-23/10 vs. Miami Ohio L, 2-13/11 vs. Miami Ohio W, 3-23/12 vs. Navy W, 9-33/13 vs. New Mexico W, 9-33/14 vs. Notre Dame L, 5-43/15 vs. Bucknell W, 13-73/16 vs. Portland L, 9-33/17 vs. Illinois W, 14-43/20 at Paci! c W, 8-23/23 at Rice L, 13-63/24 at Rice L, 8-13/25 at Rice L, 8-63/27 vs. Cal Poly W, 8-53/30 vs. Nevada W, 9-43/31 vs. Nevada L, 10-74/1 vs. Nevada L, 5-44/3 vs. St Mary’s W, 12-24/7 at Hawaii W, 10-34/8 at Hawaii L, 5-44/9 at Hawaii W, 13-34/12 at Hawaii Hilo W, 11-14/13 at Hawaii Hilo W, 15-24/14 at Hawaii Hilo W, 7-54/17 at Cal Poly L, 9-44/21 vs. TCU L, 6-54/21 vs. TCU L, 6-54/22 vs. TCU W, 7-54/25 vs. Santa Clara W, 10-74/28 vs. Hawaii Hilo W, 10-34/29 vs. Hawaii Hilo W, 4-34/30 vs. Hawaii Hilo W, 12-35/3 at TCU W, 4-35/4 at TCU W, 11-55/5 at TCU W, 6-55/8 vs. Sacramento St L, 4-35/12 vs. Rice W, 11-55/13 vs. Rice L, 8-55/18 at San Jose St W, 7-45/19 at San Jose St W, 9-25/20 at San Jose St L, 7-35/26 vs. Oral Roberts W, 2-15/26 at Pepperdine W, 8-6


WAC Record: 19-11

Head Coach: Bob Benne� Date Opponent Result2/1 at Santa Clara W, 8-52/2 at Santa Clara L, 8-42/3 at Santa Clara L, 2-12/8 at Cal Fullerton L, 3-02/9 at Cal Fullerton L, 17-112/10 at Cal Fullerton W, 10-42/12 at Cal Poly W, 14-72/15 vs. Stanford L, 6-22/16 vs. Stanford W, 7-52/18 vs. Stanford L, 8-32/22 vs. Washington L, 5-12/23 vs. Washington W, 13-92/24 vs. Washington L, 10-72/26 at Long Beach State W, 10-12/28 vs. Nebraska L, 7-13/1 vs. Nebraska L, 9-03/2 vs. Nebraska L, 10-63/8 vs. San Jose St.* L, 8-33/9 vs. San Jose St.* W, 7-63/10 vs. San Jose St.* W, 5-23/11 vs. Gonzaga# W, 9-53/12 vs. Illinois State# W, 10-73/13 vs. UCSB# W, 10-33/14 vs. Fordham# W, 18-83/15 vs. Oral Roberts# W, 9-33/16 vs. Paci! c# W, 9-23/22 at Louisiana Tech* W, 14-13/23 at Louisiana Tech* W, 2-03/24 at Louisiana Tech* W, 3-23/26 at Houston L, 11-03/29 at Rice* L, 9-23/30 at Rice* L, 12-53/31 at Rice* L, 16-44/5 vs. Louisiana Tech* W, 1-04/6 vs. Louisiana Tech* W, 3-24/7 vs. Louisiana Tech* W, 6-54/12 at San Jose St.* L, 6-5 (10)4/13 at San Jose St.* L, 6-44/14 at San Jose St.* L, 7-54/16 vs. California L, 9-24/19 vs. Nevada* W, 1-04/20 vs. Nevada* W, 4-24/21 vs. Nevada* W, 16-144/24 at UC Irvine L, 8-34/26 at Hawaii* L, 6-24/27 at Hawaii* W, 5-44/28 at Hawaii* W, 6-15/3 vs. Sacramento St W, 11-15/4 vs. Sacramento St L, 8-35/5 vs. Sacramento St L, 8-55/11 at Nevada* W, 5-15/11 at Nevada* W, 8-55/12 at Nevada* W, 7-35/17 vs. Rice* L, 4-15/18 vs. Rice* L, 17-95/19 vs. Rice* L, 12-15/24 vs. Hawaii* W, 5-35/25 vs. Hawaii* W, 6-25/26 vs. Hawaii* W, 6-5

* Western Athletic Conference Game#Pepsi/Johnny Quik Classic (Fresno, Calif.)


WAC Record: 14-16

Head Coach: Mike BatesoleDate Opponent Result2/4 at UC Irvine W, 1-02/7 vs. Cal State Fullerton L, 12-02/8 vs. Cal State Fullerton L, 10-12/9 vs. Cal State Fullerton L, 10-42/14 vs. Stanford L, 4-12/15 vs. Stanford L, 5-22/16 vs. Stanford L, 7-22/18 vs. UC Irvine W, 9-52/21 vs. San Francisco L, 8-12/22 vs. San Francisco W, 6-52/23 vs. San Francisco W, 9-72/28 at Pepperdine L, 3-03/01 at Pepperdine L, 4-33/02 at Pepperdine L, 3-13/04 vs. Cal Poly L, 13-33/07 vs. Hawai’i* W, 6-33/08 vs. Hawai’i* L, 13-83/09 vs. Hawai’i* W, 5-43/10 Pennsylvania# W, 8-43/11 Illinois State# W, 15-63/12 Penn State# W, 7-23/13 Bowling Green# W, 7-33/14 Cal Poly# W, 3-2 (8)3/15 Gonzaga# W, 4-3(11)3/21 vs. Minnesota W, 7-43/22 vs. Minnesota W, 4-23/23 vs. Minnesota L, 14-13/25 at USC W, 11-93/28 vs. Louisiana Tech* W, 9-53/29 vs. Louisiana Tech* W, 8-5(11)3/30 vs. Louisiana Tech* W, 8-44/04 at San Jose State* W, 9-34/05 at San Jose State* L, 4-34/06 at San Jose State* L, 3-04/11 vs. Rice* W, 7-34/12 vs. Rice* L, 9-24/13 vs. Rice* L, 3-24/15 vs. UC Irvine W, 4-34/18 at Hawai’i* L, 3-04/19 at Hawai’i* L, 7-54/20 at Hawai’i* L, 2-04/25 vs. Nevada* L, 6-24/26 vs. Nevada* L, 21-54/27 vs. Nevada* W, 12-74/30 vs. Long Beach State W, 5-3(11)5/02 at Louisiana Tech* L, 9-8 (13)5/03 at Louisiana Tech* W, 7-3 (10)5/04 at Louisiana Tech* L, 12-75/06 vs. California L, 4-25/09 vs. San Jose State* W, 7-55/10 vs. San Jose State* L, 10-15/11 vs. San Jose State* W, 3-25/16 at Nevada* W, 11-75/17 at Nevada* L, 7-55/18 at Nevada* W, 9-85/20 vs. USC W, 6-55/23 at Rice* W, 2-15/24 at Rice* L, 13-25/25 at Rice* L, 5-1

* Western Athletic Conference Game# Pepsi /Johnny Quik Classic (Fresno, Calif.)


WAC Record: 17-12

Head Coach: Mike BatesoleDate Opponent Result1/31 Alumni W, 8-42/6 vs. Stanford W, 3-12/7 vs. Stanford L, 13-42/8 vs. Stanford L, 10-32/10 vs. Cal Poly W, 8-22/13 at UCLA L, 6-22/14 at UCLA L, 13-112/15 at UCLA W, 3-2(10)2/17 vs. UC Irvine L, 5-32/20 vs. California L, 16-42/21 vs. California L, 2-02/22 vs. California W, 18-12/24 vs. Cal Poly W, 5-42/27 at UC Santa Barbara W, 7-62/28 at UC Santa Barbara L, 22-92/29 at UC Santa Barbara L, 8-33/2 vs. Loyola Marymount L, 14-23/4 vs. Dallas Baptist L, 6-23/5 vs. Dallas Baptist L, 13-03/6 vs. Dallas Baptist W, 5-43/8 Chicago State W, 12-03/9 Portland W, 12-23/10 BYU L, 5-33/11 Dallas Baptist L, 9-73/12 Monmouth W, 11-33/13 vs. BYU W, 10-93/19 vs. Cal State Fullerton W, 7-53/20 vs. Cal State Fullerton L, 15-53/21 vs. Cal State FullertonL, 12-9(10)3/26 at Rice* L, 6-13/27 at Rice* L, 6-53/28 at Rice* L, 7-24/2 vs. Louisiana Tech* L, 11-84/3 vs. Louisiana Tech* W, 11-34/4 vs. Louisiana Tech* W, 12-44/6 at UC Irvine L, 5-14/9 at San Jose State* W, 4-24/10 at San Jose State* L, 5-34/11 at San Jose State* W, 5-24/16 at Nevada* L, 20-24/17 at Nevada* L, 10-84/18 at Nevada* W, 12-84/23 vs. Hawai’i* L, 4-24/24 vs. Hawai’i* W, 2-04/25 vs. Hawai’i* W, 13-84/30 at Louisiana Tech* W, 12-105/1 at Louisiana Tech* L, 6-55/2 at Louisiana Tech* L, 13-125/7 vs. San Jose State* W, 10-15/8 vs. San Jose State* W, 14-45/9 vs. San Jose State* L, 6-35/13 at Hawai’i* W, 7-25/14 at Hawai’i* W, 8-45/21 vs. Rice* L, 9-45/22 vs. Rice* W, 9-75/23 vs. Rice* W, 11-45/28 vs. Nevada* W, 12-55/29 vs. Nevada* W, 8-75/30 vs. Nevada* W, 12-1

* Western Athletic Conference Game




WAC Record: 16-14

Head Coach: Mike BatesoleDate Opponent Result1/22 Alumni W, 12-51/29 at Stanford L, 12-11/30 at Stanford L, 7-01/30 at Stanford L, 8-42/4 vs. UCLA L, 7-42/5 vs. UCLA W, 8-42/6 vs. UCLA L, 6-52/12 at Cal State Fullerton L, 12-12/13 at Cal State Fullerton L, 9-02/18 vs. UC Santa Barbara L, 7-52/19 vs. UC Santa Barbara L, 5-32/20 vs. UC Santa Barbara W, 5-42/25 vs. Chicago State W, 12-32/26 vs. Chicago State W, 15-42/26 vs. Chicago State W, 3-02/27 vs. Chicago State W, 26-03/1 vs. Loyola Marymount W, 14-13/4 vs. Cal Poly L, 5-33/5 vs. Cal Poly L, 7-33/6 vs. Cal Poly L, 9-73/7 vs. Southern Utah# W, 5-33/8 vs. Pennsylvania# W, 6-13/9 vs. San Francisco# L, 8-53/10 vs. Dallas Baptist# W, 13-53/11 vs. Gonzaga# W, 6-33/12 vs. San Francisco# L, 13-03/17 vs. Iona L, 3-23/18 vs. Iona W, 9-13/18 vs. Iona W, 18-53/19 vs. Iona W, 4-13/25 vs. Hawai’i* W, 6-33/26 vs. Hawai’i* W, 6-33/27 vs. Hawai’i* W, 5-34/1 vs. Rice* L, 8-24/2 vs. Rice* L, 8-04/3 vs. Rice* W, 2-14/9 at San Jose St.* W, 4-34/9 at San Jose St.* L, 3-14/10 at San Jose St.* L, 6-5 (10)4/15 at Louisiana Tech* L, 2-14/16 at Louisiana Tech* L, 5-24/17 at Louisiana Tech* L, 10-74/22 vs. Nevada* W, 3-14/23 vs. Nevada* W, 10-74/24 vs. Nevada* L, 8-24/29 at Rice* W, 8-74/29 at Rice* L, 6-44/30 at Rice* L, 10-25/6 vs. San Jose St.* W, 10-45/7 vs. San Jose St.* W, 5-45/8 vs. San Jose St.* W, 7-65/12 at Hawai’i* L, 4-15/13 at Hawai’i* W, 8-45/14 at Hawai’i* W, 7-35/20 vs. Louisiana Tech* W, 12-15/21 vs. Louisiana Tech* W, 13-95/22 vs. Louisiana Tech* W, 10-85/27 at Nevada* L, 6-55/28 at Nevada* L, 5-15/29 at Nevada* L, 20-7

* Western Athletic Conference Game# Pepsi/Johnny Quik Classic (Fresno, Calif.)


WAC Record: 18-6

Head Coach: Mike BatesoleDate Opponent Result1/27 at Cal Poly L, 6-31/28 at Cal Poly L, 4-11/29 at Cal Poly L, 9-82/3 at UCLA W, 11-92/4 at UCLA W, 5-02/5 at UCLA L, 12-22/10 vs. Pepperdine L, 7-22/11 vs. Pepperdine W, 9-82/12 vs. Pepperdine W, 8-32/17 vs. Utah Valley State W, 13-92/18 vs. Utah Valley State W, 8-02/19 vs. Utah Valley State L, 5-42/24 vs. Stanford L, 3-22/25 vs. Stanford W, 7-52/26 vs. Stanford L, 6-33/1 vs. San Francisco W, 4-33/4 vs. Portland W, 7-23/4 vs. Portland W, 3-03/5 vs. Portland W, 16-53/8 vs. San Francisco W, 5-23/12 vs. Bucknell# W, 3-13/13 vs. Miami (OH)# W, 7-33/14 vs. Gonzaga# W, 5-13/15 Binghamton# W, 7-6 (12)3/16 vs. Washington State# W, 6-13/17 vs. Bucknell# W, 13-13/18 vs. Lafayette# W, 10-93/24 vs. Sacramento State* W, 5-13/25 vs. Sacramento State* W, 13-63/26 vs. Sacramento State* W, 12-113/31 at New Mexico State* W, 6-34/1 at New Mexico State* W, 10-74/2 at New Mexico State* L, 9-84/7 vs. Hawai’i* L, 5-34/8 vs. Hawai’i* W, 6-14/9 vs. Hawai’i* W, 13-24/13 at Louisiana Tech* L, 5-4 (12)4/14 at Louisiana Tech* L, 5-4 (10)4/15 at Louisiana Tech* L, 1-04/21 at San Jose State* W, 5-34/22 at San Jose State* L, 7-54/23 at San Jose State* W, 4-04/27 vs. Dallas Baptist L, 10-34/28 vs. Dallas Baptist L, 9-74/29 vs. Dallas Baptist W, 13-44/29 vs. Dallas Baptist W, 6-35/5 vs. Nevada* W, 13-25/6 vs. Nevada* W, 19-35/7 vs. Nevada* W, 12-65/12 vs. San Jose State* W, 10-45/13 vs. San Jose State* W, 9-85/14 vs. San Jose State* W, 9-8 (12)5/19 at Sacramento State* W, 10-75/20 at Sacramento State* W, 14-35/21 at Sacramento State* W, 7-4

WAC Tournament(Fresno, Calif.)

5/25 vs. Sacramento State W, 10-25/26 vs. San Jose State W, 3-25/27 vs. Nevada W, 15-35/28 vs. Hawai’i W, 8-4

NCAA Regional(Fullerton, Calif.)

6/2 at San Diego W, 9-86/3 at Cal St Fullerton L, 9-26/4 vs. San Diego W, 9-86/4 vs. Cal State Fullerton L, 10-3

* Western Athletic Conferenec Games# Pepsi/Johnny Quik Classic (Fresno, Calif.)

2007 Overall Record: 38-29

WAC Record: 17-7

WAC Regular Season Champions

WAC Tournament Champions

Head Coach: Mike BatesoleDate Opponent Result2/2 San Francisco L, 6-22/3 San Francisco L, 4-32/4 San Francisco W, 5-42/6 at Cal Poly L, 6-32/10 at Stanford L, 9-22/11 at Stanford L, 6-42/13 CS Northridge W, 8-42/14 CS Northridge L, 10-32/16 Loyola Marymount W, 15-42/17 Loyola Marymount W, 5-32/18 Loyola Marymount W, 5-4 (10)2/23 at Pepperdine L, 4-02/24 at Pepperdine L, 3-22/25 at Pepperdine L, 10-42/28 at Santa Clara L, 3-23/2 San Diego W, 12-43/3 San Diego L, 8-33/4 San Diego W, 6-23/9 Santa Clara W, 8-7 (10)3/10 Santa Clara L, 4-13/11 Santa Clara L, 8-4 (10)3/12 Iowa W, 13-103/13 Iowa W, 14-63/14 Iowa% W, 4-23/15 Dallas Baptist% W, 9-53/16 Iowa% L, 10-83/17 Dallas Baptist% L, 12-10 (10)3/23 at Louisiana Tech* W, 11-83/24 at Louisiana Tech* L, 5-33/25 at Louisiana Tech* L, 8-63/27 UC Davis W, 8-23/30 Sacramento State* W, 16-73/31 Sacramento State* W, 8-14/1 Sacramento State* W, 5-24/3 at CS Northridge W, 7-64/5 at Nevada* W, 7-64/6 at Nevada* L, 2-04/7 at Nevada* W, 10-44/10 at UC Davis W, 4-34/13 Hawai’i* L, 9-84/15 Hawai’i-1* W, 4-34/15 Hawai’i-2* W, 6-54/20 New Mexico State* W, 7-04/21 New Mexico State* W, 14-34/22 New Mexico State* W, 9-14/24 at Santa Clara L, 9-14/25 at Stanford L, 7-24/27 Cal Poly L, 6-44/28 Cal Poly L, 16-94/29 Cal Poly L, 13-05/4 at San Jose State* W, 15-95/5 at San Jose State* W, 9-45/6 at San Jose State* W, 12-95/11 Louisiana Tech* L, 10-55/12 Louisiana Tech* W, 3-15/13 Louisiana Tech* W, 8-25/19 at Hawai’i* W, 7-5 (10)5/20 at Hawai’i* L, 7-65/21 at Hawai’i* L, 1-0

WAC Tournament(Reno, Nev.)

5/24 vs. Sacramento State W, 10-25/25 vs. Louisiana Tech W, 4-25/26 vs. San Jose State W, 6-25/27 vs. Nevada W, 17-4

NCAA Regional(San Diego, Calif.)

6/1 vs. San Diego W, 6-26/2 vs. Cal State Fullerton L, 6-46/3 vs. Minnesota W, 11-66/3 vs. Cal State Fullerton L, 13-2


WAC Record: 21-11

NATIONAL CHAMPIONS

Head Coach: Mike BatesoleDate Opponent Result2/22 UC Davis L, 4-22/23 UC Davis L, 3-12/23 UC Davis W, 7-02/24 UC Davis W, 6-32/28 Cal L, 14-42/29 at San Diego L, 5-23/1 Cal Poly L, 2-13/2 at San Diego State W, 9-23/4 at Santa Clara L, 6-5(10)3/8 Indiana W, 6-23/9 Indiana W, 9-43/10 New Mexico State L, 13-83/11 Portland L, 3-23/12 Indiana L, 11-13/13 Gonzaga W, 10-13/14 Utah W, 10-03/15 Portland W, 12-33/18 at San Francisco L, 13-83/20 at Hawai’i* L, 4-0 3/21 at Hawai’i* L, 2-03/22 at Hawai’i* W, 5-0 3/22 at Hawai’i* W, 4-2(10)3/25 Cal Poly W, 10-93/26 Cal Poly W, 13-113/28 Nevada* W, 12-43/29 Nevada* W, 11-1(7)3/29 Nevada* L, 4-13/30 Nevada* W, 13-3(7)4/1 Long Beach State W, 7-6 4/2 at Cal L, 5-44/9 at Cal Poly L, 8-54/11 Louisiana Tech* W, 14-54/12 Louisiana Tech* W, 9-84/12 Louisiana Tech* W, 11-1(7)4/13 Louisiana Tech* W, 8-04/15 at Cal Poly L, 10-74/18 at New Mexico State* W, 13-104/19 at New Mexico State* W, 9-54/19 at New Mexico State* W, 13-1(7)4/20 at New Mexico State* W, 24-6(7)4/22 Santa Clara L, 10-84/23 San Francisco W, 5-44/25 at Nevada* W, 9-34/26 at Nevada* L, 4-14/26 at Nevada* L, 7-34/27 at Nevada* L, 12-114/30 at San Francisco L, 7-65/2 New Mexico State* W, 11-85/3 New Mexico State * L, 9-25/3 New Mexico State* L, 12-75/4 New Mexico State * W, 6-45/6 at Long Beach State L, 2-15/9 San Jose State* W, 11-35/10 San Jose State* W, 9-85/10 San Jose State* W, 5-35/11 San Jose State* L, 2-15/16 at Sacramento State* L, 9-85/17 at Sacramento State* L, 4-05/17 at Sacramento State* W, 6-45/18 at Sacramento State* W, 13-6

WAC Tournament(Ruston, La.)

5/22 vs. Sacramento State W, 3-25/23 vs. San Jose State W, 7-35/24 vs. Hawai’i W, 11-45/25 vs. Nevada W, 6-4

NCAA Regional(Long Beach, Calif.)

5/30 vs. Long Beach State W, 7-35/31 vs. San Diego W, 6-06/1 vs. San Diego L, 15-16/2 vs. San Diego W, 5-1

NCAA Super Regional(Tempe, Ariz.)

6/7 at Arizona State L, 12-46/8 at Arizona State W, 8-66/9 at Arizona State W, 12-9

NCAA College World Series(Omaha, Neb.)

6/15 vs. Rice W, 17-56/17 vs. North Carolina W, 5-36/21 vs. North Carolina L, 4-36/22 vs. North Carolina W, 6-16/23 vs. Georgia L, 7-66/24 vs. Georgia W, 19-106/25 vs. Georgia W, 6-1

YEAR-BY-YEAR RESULTS



YEAR-BY-YEAR RESULTS2009 Overall Record: 32-30

WAC Record: 12-12

Head Coach: Mike BatesoleDate Opponent Result2/20 Washington W, 5-42/21 Washington L, 11-42/22 Washington W, 3-12/24 Cal Poly L, 13-112/27 at Oregon L, 1-02/28 at Oregon L, 7-13/1 at Oregon W, 10-33/7 Bu! alo W, 6-33/8 Bu! alo W, 22-43/9 Portland# W, 7-03/10 Cal State Bakers" eld# W, 16-13/11 Bu! alo# W, 7-53/12 Portland L, 4-23/13 Cal State Bakers" eld# W, 3-23/14 Bu! alo# W, 20-0 3/20 at Loyola Marymount L, 8-73/21 at Loyola Marymount L, 7-63/21 at Loyola Marymount L, 7-33/22 at Loyola Marymount L, 11-73/27 Lipscomb L, 10-63/28 Lipscomb W, 13-113/28 Lipscomb W, 10-03/29 Lipscomb W, 7-63/31 at UC Davis L, 11-34/1 UC Davis W, 4-2 4/3 Cal State Bakers" eld W, 9-84/4 Cal State Bakers" eld L, 4-34/5 Cal State Bakers" eld W, 9-24/7 at Cal State Bakers" eld L, 17-124/8 at Cal State Bakers" eld L, 3-24/10 New Mexico State * W, 5-4(10) 4/11 New Mexico State* L, 2-04/12 New Mexico State* W,6-5 4/13 New Mexico State* L, 10-64/18 at Louisiana Tech * L, 11-94/18 at Louisiana Tech * L, 17-54/19 at Louisiana Tech * L, 14-124/19 at Louisiana Tech * L, 14-64/24 at San Jose State * W, 1-04/25 at San Jose State* W, 8-24/25 at San Jose State* L, 2-04/26 at San Jose State* L, 6-54/28 at Cal Poly L, 17-16(10)5/2 Nevada* L, 15-115/2 Nevada* L, 16-4(8)5/3 Nevada* W, 8-65/3 Nevada* W, 12-55/7 Hawai’i* W, 17-95/8 Hawai’i* W, 14-115/9 Hawai’i* L, 15-65/9 Hawai’i* L, 15-105/14 at Sacramento State* W, 15-75/15 at Sacramento State* W, 4-35/16 at Sacramento State* W, 11-85/16 at Sacramento State* W, 7-6

WAC Tournament

(Reno, Nev.)5/21 vs. New Mexico State L, 7-45/22 vs. San Jose State W, 6-35/23 vs. Hawai’i W, 10-35/24 vs. New Mexico State W, 9-75/24 vs. New Mexico State W, 5-3

NCAA Regional

(San Diego, Calif.)5/29 vs. UC Irvine L, 3-25/30 vs. San Diego State L, 4-1*Western Athletic Conference Game#Pepsi/Johnny Quik Classic (Fresno, Calif.)


WAC Record: 16-8

Head Coach: Mike BatesoleDate Opponent Result2/19 Nebraska W, 7-52/20 Nebraska W, 8-22/21 Nebraska W, 10-9 (11)2/22 Nebraska L, 4-12/26 at Washington L, 10-92/27 at Washington W, 11-102/28 at Washington W, 3-23/5 Oregon L, 7-23/6 Oregon L, 8-43/6 Oregon L, 5-23/7 Oregon L, 8-33/9 Santa Clara W, 10-93/11 Cal State Fullerton# W, 5-03/12 San Francisco# W, 5-23/13 San Diego State# W, 10-33/14 San Diego# L, 10-73/19 Loyola Marymount L, 12-53/20 Loyola Marymount L, 4-3 (10)3/20 Loyola Marymount L, 5-2 (8)3/21 Loyola Marymount W, 16-103/23 at Cal Poly W, 10-93/26 UC Davis W, 9-23/27 UC Davis W, 7-63/28 UC Davis L, 7-23/30 at California L, 8-54/01 Cal State Bakers" eld W, 10-44/02 at Cal State Bakers. W, 13-9 (10)4/03 at Cal State Bakers" eld W, 13-94/06 Cal Poly W, 7-54/09 at Hawai’i* W, 8-64/10 at Hawai’i* W, 8-54/10 at Hawai’i* W, 1-04/11 at Hawai’i* L, 4-04/13 vs. Cal State Bakers" eld L, 12-24/16 vs. Louisiana Tech* L, 13-74/17 vs. Louisiana Tech* L, 13-5 4/17 vs. Louisiana Tech* W, 14-44/18 vs. Louisiana Tech* W, 12-2 (8)4/23 at Nevada* W, 8-34/24 at Nevada* L, 17-6 4/24 at Nevada* L, 14-44/25 at Nevada* W, 9-34/29 vs. Dallas Baptist L, 13-9 (10)4/30 vs. Dallas Baptist W, 14-75/1 vs. Dallas Baptist W, 15-75/4 vs. Cal Poly L, 7-35/7 at New Mexico State* W, 21-115/8 at New Mexico State* W, 16-105/8 at New Mexico State* W, 12-45/9 at New Mexico State* W, 8-65/14 vs. San Jose State* W, 10-05/15 vs. San Jose State* L, 9-35/15 vs. San Jose State* L, 4-35/16 vs. San Jose State* W, 4-35/21/ vs. Sacramento State* L, 12-25/22 vs. Sacramento State* W, 7-65/22 vs. Sacramento State* W, 10-15/23 vs. Sacramento State* W, 8-4

WAC Tournament

(Mesa, Ariz.)5/27 vs. San Jose State W, 12-105/28 vs. Hawai’i L, 11-35/29 San Jose State W, 13-15/29 vs. Hawai’i W, 14-55/30 Hawai’i L, 9-6

*Western Athletic Conference Game#Aztec Invitational (San Diego, Calif.)


WAC Record: 17-7

WAC Regular Season Champions


Head Coach: Mike BatesoleDate Opponent Result2/19 Gonzaga W, 10-42/20 Oregon State W, 2-12/21 Oregon State W, 5-42/26 Pepperdine W, 7-32/27 Pepperdine-1 W, 7-52/27 Pepperdine-2 W, 8-13/1 Cal Poly L, 11-43/4 at UC Davis W, 12-43/5 at UC Davis W, 3-13/8 Bakers" eld W, 9-23/11 at Nebraska W, 8-53/12 at Nebraska W, 1-03/13 at Nebraska L, 5-43/17 Washington State W, 7-53/18 Washington State W, 16-1 (6)3/19 Washington State W, 7-23/22 Ohio State W, 3-23/25 San Diego W, 6-03/26 San Diego W, 3-2 (22)3/27 San Diego W, 7-44/1 San Francisco W, 5-34/2 San Francisco W, 4-34/3 San Francisco L, 4-34/8 at San Jose State* L, 3-14/9 at San Jose State-1* W, 5-1 (7)4/9 at San Jose State-2* L, 4-34/10 at San Jose State* W, 5-34/15 Nevada* W, 8-34/16 Nevada-1* W, 8-1 (7)4/16 Nevada-2* W, 4-24/19 at Cal Poly L, 5-44/21 at Sacramento State* W, 2-04/22 at Sacramento State* W, 7-34/23 at Sacramento State-1* L, 2-1 (7)4/23 at Sacramento State-2* W, 12-44/29 Hawai’i* L, 6-5 (10)4/30 Hawai’i* L, 6-25/1 Hawai’i* W, 4-25/2 Hawai’i* W, 12-2 (7)5/6 at Louisiana Tech* W, 9-45/7 at Louisiana Tech-1* L, 8-6 (7)5/7 at Louisiana Tech-2* W, 7-45/8 at Louisiana Tech* L, 8-45/12 New Mexico State* W, 17-4 (7)5/13 New Mexico State* W, 15-75/14 New Mexico State* W, 17-2 (7)5/15 New Mexico State* W, 6-3 5/19 Nevada* W, 7-15/20 Bakers" eld L, 6-05/21 at Bakers" eld L, 5-25/22 at Bakers" eld L, 7-4

WAC Tournament

(Mesa, Ariz.)5/26 vs. Louisiana Tech W, 13-1 (7)5/27 vs. Hawai’i W, 11-55/28 vs. Hawai’i W, 15-4

NCAA Regional

(Los Angeles, Calif.)6/3 vs. UC Irvine L, 12-66/4 vs. UCLA L, 3-1

*Western Athletic Conference game


WAC Record: 8-10


Head Coach: Mike BatesoleDate Opponent Result2/17 Butler W, 3-02/18 Butler-1 L, 12-9 (10)2/18 Butler-2 W, 6-02/19 Butler W, 17-22/22 at Bakers" eld L, 4-02/24 at Pepperdine L, 3-22/25 at Pepperdine W, 8-42/26 at Pepperdine L, 6-02/28 UC Santa Barbara L, 7-13/2 Stanford W, 7-43/3 Stanford L, 16-03/4 Stanford L, 9-23/8 San Francisco W, 2-13/9 San Francisco W, 6-23/10 San Francisco L, 6-33/11 San Francisco L, 6-13/13 at UC Santa Barbara W, 3-23/16 Bakers" eld W, 2-13/18 Bakers" eld W, 5-03/20 Kent State W, 14-23/21 Kent State W, 5-23/23 UC Riverside L, 5-13/24 UC Riverside W, 2-13/27 California L, 7-63/30 New Mexico L, 9-33/31 New Mexico L, 7-14/1 New Mexico W, 4-34/3 at Santa Clara L, 9-54/5 at Hawai’i* L, 8-24/6 at Hawai’i* W, 5-34/7 at Hawai’i* L, 3-2 (10)4/14 San Jose State-1* L, 4-04/14 San Jose State-2* L, 4-34/15 San Jose State* L, 11-24/17 at Cal Poly W, 5-34/21 Bakers" eld L, 8-14/24 Cal Poly W, 3-24/27 at Nevada* L, 8-24/28 at Nevada* W, 14-24/29 at Nevada* L, 1-05/2 UC Davis W, 11-45/4 Sacramento State* L, 9-75/5 Sacramento State* W, 10-65/6 Sacramento State* W, 8-65/11 at New Mexico State-1* W, 12-25/11 at New Mexico State-2* L, 2-1 (12)5/12 at New Mexico State* W, 14-7 5/18 Louisiana Tech* W, 12-25/19 Louisiana Tech* W, 4-05/20 Louisiana Tech* L, 5-2

WAC Tournament

(Mesa, Ariz.)5/23 vs. Hawai’i W, 8-25/24 vs. New Mexico State W, 15-85/25 vs. Sacramento State L, 8-35/26 vs. Louisiana Tech W, 6-45/26 vs. Sacramento State W, 9-65/27 vs. Sacramento State W, 4-3 (12)

NCAA Regional

(Stanford, Calif.)6/1 vs. Stanford L, 9-16/2 vs. Michigan State W, 8-26/3 vs. Pepperdine L, 8-5

*Western Ahtletic Conference Game




Mountain West Record: 14-16

Head Coach: Mike BatesoleDate Opponent Result2/15 UC Santa Barbara W, 8-12/16 UC Santa Barbara L, 8-12/17 UC Santa Barbara L, 11-32/22 at Stanford L, 3-12/23 at Stanford L, 7-4 (10)2/24 at Stanford L, 7-42/26 at Bakers! eld L, 5-33/1 USC L, 9-13/2 USC W, 5-13/3 USC W, 14-33/5 San Jose State L, 10-33/7 at California L, 5-4 (10)3/8 at California L, 8-13/9 at California L, 4-33/10 at California L, 8-43/15 San Diego State* W, 1-03/16 San Diego State* L, 11-63/17 San Diego State* L, 4-23/19 at Paci! c L, 11-43/22 at Air Force* L, 14-73/26 at Sacramento State W, 3-23/28 at Nevada* L, 5-33/29 at Nevada* W, 4-03/30 at Nevada* L, 7-64/2 Paci! c W, 4-34/5 UNLV* L, 9-84/6 UNLV* L, 9-84/7 UNLV* W, 5-34/12 at New Mexico* L, 11-44/13 at New Mexico* L, 14-34/14 at New Mexico* L, 4-34/17 Bakers! eld L, 8-54/19 Air Force-1* W, 9-44/19 Air Force-2* W, 8-54/20 Air Force-1* W, 7-04/20 Air Force-2* W, 8-64/21 Air Force* W, 5-34/23 at Bakers! eld L, 2-04/26 at San Diego State* W, 7-54/27 at San Diego State* L, 10-84/28 at San Diego State* L, 4-24/30 Bakers! eld W, 7-45/3 at UNLV* L, 4-15/4 at UNLV* L, 9-25/5 at UNLV* W, 9-45/7 Hawai’i W, 8-65/10 New Mexico* L, 9-0 5/11 New Mexico* L, 7-25/12 New Mexico* W, 9-85/16 Nevada* W, 2-1 (10)5/17 Nevada* W, 10-45/18 Nevada* W, 6-4

Mountain West Tournament(Fresno, Calif.)

5/22 vs. Nevada L, 4-3 (12)5/23 vs. UNLV W, 6-45/24 vs. Nevada W, 10-15/24 vs. San Diego State L, 4-0

* Mountain West Conference Game



Head Coach: Mike BatesoleDate Opponent Result2/14 at UC Irvine W, 10-0 (10)2/15 at UC Irvine W, 8-7 (13)2/16 at UC Irvine L, 1-02/18 Grand Canyon W, 10-12/19 Sacramento State L, 6-42/21 Nevada* W, 4-12/22 Nevada* W, 5-32/23 Nevada* W, 11-93/1 Texas A&M W, 5-03/1 Texas A&M W, 6-53/2 Texas A&M W, 1-03/5 at Sacramento State L, 2-1 (10)3/8 at Air Force-1* L, 6-23/8 at Air Force-2* W, 7-53/9 at Air Force* W, 10-83/11 Penn State W, 13-33/12 Penn State W, 12-33/14 New Mexico* L, 9-73/15 New Mexico* L, 6-23/16 New Mexico* L, 6-43/18 California W, 6-03/19 BYU W, 2-13/21 at Creighton L, 2-13/23 at Creighton L, 6-23/25 UC Santa Barbara L, 5-43/28 at San Diego State* L, 2-13/29 at San Diego State* W, 6-43/30 at San Diego State* L, 1-04/1 Paci! c L, 7-34/4 UNLV* L, 6-04/5 UNLV* W, 2-04/6 UNLV* L, 7-04/8 Cal State Northridge W, 8-24/11 at New Mexico* L, 5-44/12 at New Mexico* L, 11-64/13 at New Mexico* L, 4-14/15 at Paci! c L, 6-44/17 at Nevada* W, 20-104/18 at Nevada* L, 9-8 (12)4/19 at Nevada* L, 9-84/22 California W, 7-44/23 Cal State Fullerton W, 2-1 (16)4/26 Air Force-1* W, 8-14/26 Air Force-2* W, 6-14/27 Air Force* W, 11-14/30 at Cal State Fullerton L, 8-15/2 at San Jose State* L, 3-2 5/3 at San Jose State* W, 8-05/4 at San Jose State* L, 5-25/7 at Bakers! eld L, 6-35/13 Bakers! eld W, 8-45/15 San Diego State* L, 9-25/16 San Diego State* W, 4-35/17 San Diego State* L, 11-8

Mountain West Tournament(Las Vegas, Nev.)

5/21 vs. Nevada W, 4-35/22 vs. UNLV L, 5-35/23 vs. Nevada L, 10-2

*Mountain West Conference Game



Head Coach: Mike BatesoleDate Opponent Result2/13 UC Irvine W, 5-42/14 UC Irvine W, 7-52/15 UC Irvine W, 7-52/17 Cal Poly L, 7-62/20 at Nevada* L, 9-8 (10)2/21 at Nevada* L, 12-72/22 at Nevada* L, 7-42/24 USC L, 3-2 (10)2/27 UNLV* W, 10-52/28 UNLV* W, 2-13/1 UNLV* W, 4-03/3 Sacramento State W, 6-23/6 at Oregon State L, 2-1 (11)3/7 at Oregon State-1 L, 5-23/7 at Oregon State-2 L, 12-23/8 at Oregon State L, 2-13/10 Wagner W, 4-23/11 Wagner W, 10-13/13 UC Davis W, 5-43/14 UC Davis L, 4-33/15 Santa Clara L, 1-03/17 at USC W, 14-73/20 San Jose State* W, 6-43/21 San Jose State* W, 9-23/22 San Jose State* W, 6-33/25 California W, 7-23/27 at New Mexico* L, 12-73/28 at New Mexico* W, 8-13/29 at New Mexico* L, 5-14/1 at UC Santa Barbara L, 6-54/2 at UC Santa Barbara L, 2-14/3 at UC Santa Barbara L, 7-24/4 at UC Santa Barbara L, 9-34/10 Nevada* L, 5-44/11 Nevada* W, 14-104/12 Nevada* W, 3-14/14 at Cal Poly L, 10-64/18 Air Force-1* L, 2-14/18 Air Force-2* L, 10-14/19 Air Force* W, 6-54/22 at Sacramento State W, 8-04/24 San Diego State* W, 5-4 (10)4/25 San Diego State* L, 15-34/26 San Diego State L, 9-44/28 California L, 4-15/1 at San Jose State* W, 4-05/2 at San Jose State* L, 7-35/3 at San Jose State* W, 3-05/5 Cal State Northridge W, 4-3 (16)5/8 at UNLV* W, 6-15/9 at UNLV* W, 8-35/10 at UNLV* W, 6-25/15 New Mexico* L, 7-65/15 New Mexico* L, 1-05/16 New Mexico* W, 11-2

Mountain West Tournament(Reno, Nev.)

5/20 vs. UNLV W, 6-55/21 vs. San Diego State W, 15-75/23 vs. New Mexico L, 9-15/23 vs. San Diego State L, 7-6 (10)

* Mountain West Conference Game



MW Regular Season Champions

Head Coach: Mike BatesoleDate Opponent Result2/19 Creighton W, 2-12/20 Creighton W, 2-12/21 Creighton W, 7-32/23 Oakland (Mich.) W, 11-102/26 Youngstown State W, 8-32/27 Youngstown State W, 11-02/27 Youngstown State W, 6-52/28 Youngstown State W, 6-13/1 CSU Bakers! eld W, 6-43/4 at San Diego State* W, 3-2 (10)3/5 at San Diego State* W, 10-53/6 at San Diego State* L, 4-53/7 at Long Beach State L, 3-43/11 at #3 Texas A&M L, 2-33/12 at #3 Texas A&M L, 3-4 (10)3/13 at #3 Texas A&M L, 1-123/15 Oklahoma L, 2-33/18 UNLV* L, 2-43/19 UNLV* W, 6-23/20 UNLV* W, 4-33/22 at Saint Mary’s W, 6-43/24 at San Jose State* W, 13-43/25 at San Jose State* W, 9-43/26 at San Jose State* L, 2-3 (10)3/29 #16 Long Beach State W, 10-54/1 Air Force* W, 14-14/2 Air Force* W, 6-34/3 Air Force* W, 5-14/5 at Paci! c L, 6-154/6 Sacramento State W, 7-54/8 at New Mexico* L, 1-24/9 at New Mexico* L, 13-14 (12)4/10 at New Mexico* L, 4-74/12 Paci! c L, 3-74/15 Nevada* W, 5-44/16 Nevada* W, 8-34/17 Nevada* W, 7-64/19 at Cal Poly L, 1-74/22 San Jose State* W, 6-04/23 San Jose State* W, 8-64/24 San Jose State* L, 5-7 (12)4/27 at Sacramento State L, 4-5 (11)4/30 at Air Force*% W, 11-64/30 at Air Force*% W, 5-15/1 at Air Force*% W, 4-25/3 Saint Mary’s W, 3-25/6 San Diego State* L, 2-45/7 San Diego State* W, 1-0 (10)5/8 San Diego State* W, 4-35/10 Cal Poly W, 9-55/13 at UNLV* W, 9-15/14 at UNLV* W, 7-25/15 at UNLV* L, 5-85/19 San Francisco W, 10-15/20 San Francisco L, 3-75/21 San Francisco L, 3-6

Mountain West Tournament(Albuquerque, N.M.)

5/26 vs. Air Force L, 7-95/27 vs. Nevada L, 6-25 * Mountain West Conference Game% Games played at Sam Suplizio Field in Grand Junction, Colo.

YEAR-BY-YEAR RESULTS



BULLDOGS’ POSTSEASON HISTORYPOSTSEASON RECORD: 67-74

(34 APPEARANCES)

REGIONAL RECORD: 58-66

CWS RECORD: 9-8

(4 APPEARANCES)

1952District 8, Fresno, Calif.

Fresno State 9, UC Santa Barbara 5

Fresno State 19, UC Santa Barbara 1Fresno State 2, Sea� le 1

Fresno State 20, Sea� le 4

District 8, Corvallis, Ore.

Oregon State 2, Fresno State 1

Oregon State 8, Fresno State 4

1954District 8, Eugene, Ore.

Fresno State 7, USC 4


District 8, Eugene, Ore.

Oregon 9, Fresno State 5

Oregon 1, Fresno State 4


Fresno State 6, Willame� e 3

Fresno State 8, Pepperdine 7

Fresno State 9, San Jose State 4

San Jose State 3, Fresno State 1

Fresno State 5, San Jose State 1

District 8, Los Angeles, Calif.

USC 8, Fresno State 1



Fresno State 23, Santa Clara 11


District 8, Sea! le, Wash.

Fresno State 3, Washington 2

Washington 5, Fresno State 4

Fresno State 10, Washington 5

College World Series, Omaha, Neb.

Fresno State 6, Northern Colorado 5

Arizona 5, Fresno State 1

Fresno State 7, Western Michigan 2

Fresno State 2, Arizona 0

Oklahoma State 4, Fresno State 0

(FS places 3rd in CWS)

1961District 8, Los Angeles, Calif.




1962District 8, Santa Clara, Calif.

Santa Clara 6, Fresno State 1



1966District 8, Los Angeles, Calif.

Washington State 5, Fresno State 2

Fresno State 5, Cal Poly-Pomona 4

Washington State 2, Fresno State 1

1967District 8, Stanford, Calif.

Fresno State 7, Stanford 3

District 8, Fresno, Calif.

Stanford 6, Stanford 3

Stanford 6, Stanford 4

1977West Regional, Honolulu, Hawaii

Fresno State 7, Cal State L.A. 4


Cal State L.A. 15, Fresno State 11

1979West Regional, Tucson, Ariz.

Fresno State 10, Portland State 8

UCLA 5, Fresno State 4

CS Fullerton 12, Fresno State 3

1980West Regional, Tucson, Ariz.

Fresno State 10, Portland State 8


1981West Regional, Tempe, Ariz.


Fresno State 10, Gonzaga 8


1982West Regional, Fresno, Calif.


Stanford 17, Fresno State 10

Pepperdine 11, Fresno State 8

1983West Regional, Honolulu, Hawaii


Fresno State 13, Brigham Young 6

Fresno State 6, CS Fullerton 3

Arizona State 7, Fresno State 2


San Diego State 10, Fresno State 6

Fresno State 15, USC 12 (10)



Fresno State 7, California 6 (10)




1988West I Regional, Fresno, Calif.

Fresno State 10, California 8 (10)



Fresno State 7, Washington State 6





Miami, Fla. 8, Fresno State 4 (12)

(FS places T-7th in CWS)



BULLDOGS’ POSTSEASON HISTORY1989West II Regional, Fresno, Calif.

Fresno State 9, Notre Dame 8

Michigan 5, Fresno State 3

Fresno State 11, Notre Dame 4

Wichita State 6, Fresno State 4

1990West I Regional, Palo Alto, Calif.

Fresno State 3, S. Illinois 2


S. Illinois 3, Fresno State 1

1991West II Regional, Fresno, Calif.

Fresno State 7, CS Northridge 2



CS Northridge 6, Fresno State 2

Fresno State 6, CS Northridge 5


Fresno State 6, Florida State 3

LSU 15, Fresno State 3

Florida 2, Fresno State 1

(FS places T-5th in CWS)

1992 West Regional, Tucson, Ariz.

Pepperdine 5, Fresno State 4 (10)

Washington 4, Fresno State 3

1993Mideast Regional, Knoxville, Tenn.

Fresno State 7, Kansas 4

Clemson 10, Fresno State 3

Fresno State 6, Tennessee 2

Fresno State 11, Clemson 4

Kansas 3, Fresno State 2 (10)

1994South Regional, Baton Rouge, La.

Tulane 7, Fresno State 5

LSU 6, Fresno State 2




1996Central II Regional, Lubbock, Texas

Fresno State 12, Texas Tech 5

Oklahoma State 12, Fresno State 5

Texas Tech 13, Fresno State 2

1997West Regional, Palo Alto, Calif.

Fresno State 2, Texas A&M 1


Fresno State 8, Cal State Fullerton 7

Fresno State 10, Cal State Fullerton 7


2000Stanford Regional, Palo Alto, Calif.


Nevada 13, Fresno State 5

2001USC Regional, Los Angeles, Calif.


Fresno State 2, Oral Roberts 1



2006Fullerton Regional, Fullerton, Calif.

Fresno State 9, San Diego 8

Cal State Fullerton 9, Fresno State 2



2007San Diego Regional, San Diego, Calif.



Fresno State 11, Minnesota 6


2008 - NATIONAL CHAMPIONSLong Beach Regional, Long Beach, Calif.

Fresno State 7, Long Beach State 3


San Diego 15, Fresno State 1


Arizona Super Regional, Tempe, Ariz.

Arizona State 12, Fresno State 4

Fresno State 8, Arizona State 6

Fresno State 12, Arizona State 9


Fresno State 17, Rice 5

Fresno State 5, North Carolina 3

North Carolina 4, Fresno State 3

Fresno State 6, North Carolina 1

Georgia 7, Fresno State 6

Fresno State 19, Georgia 10

Fresno State 6, Georgia 1

2009Irvine Regional, Irvine, Calif.

UC Irvine 4, Fresno State 2


2011UCLA Regional, Los Angeles, Calif.

UC Irvine 12, Arizona State 6

UCLA 3, Fresno State 1

2012Stanford Regional, Stanford, Calif.


Fresno State 8, Michigan State 2




FRESNO STATE NCAA POSTSEASON RECORDS VS. OPP.A�� (1-4)1959 - 1-5*; 2-0*

1980 - 4-5

1985 - 0-6; 3-10

A�� S!�!" (2-2)1983 - 2-7*

2008 - 4-12; 8-6; 12-9

BYU (3-0)1983 - 13-6

1985 - 12-8

1988 - 9-4

C�# P�#$-P�%�� (1-0)19666 – 5-4

C�# S!�!" F&##"�!�� (3-9)1979 - 3-12

1980 - 2-10

1981 - 8-9; 9-10

1983 - 5-7; 6-3

1997 - 8-7; 10-7

2006 - 2-9; 3-10

2007 - 4-6; 2-13

C�# S!�!" L.A. (1-1)1977 - 7-4; 11-15

C�# S!�!" N��!'��*+" (2-1)1991 - 7-2; 2-6; 6-5

C�#�,�� (1-0)1985 - 7-6 (10)

C#"%/�� (1-1)1993 - 3-10; 11-4

F#��*� (0-1)1991 - 1-2*

F#��*� S!�!" (1-0)1991 - 6-3*

G"��+�� (2-1)2008 - 6-7*; 19-10*; 6-1*

G��+� (1-0)1981 -10-8

K��/�/ (1-1)1993 - 7-4; 2-3 (10)

L��+ B"�5' S!�!" (1-0)2008 - 7-3

LSU (0-2)1991 - 3-15*

1994 - 2-6

M��%� [F#�.] (0-1)1988 - 4-8 (12)*

M�5'�+�� (0-1)1989 - 3-5

M�5'�+�� S!�!" (1-0)2012 - 8-2

M��"/�!� (2-0)1988 - 10-8

2007 - 11-6

N"6�*� (0-1)2000 - 5-13

N��!' C��#�� (2-1)2008 - 5-3*; 3-4*; 6-1*

N�!�" D�%" (2-0)1989 - 9-8; 11-4

N��!'"�� C�#��*� (1-0)1959 - 6-5*

O7#�'�%� S!�!" (0-2)1959 - 0-4*

1996 - 5-12

O��# R�8"�!/ (1-0)2001 - 2-1

O�"+�� (0-2)1954 - 5-9; 0-1

O�"+�� S!�!" (0-2)1952 - 1-2; 4-8

P"::"�*��" (3-5)1955 - 8-7

1982 - 14-5; 8-11

1992 - 4-5 (10)

1995 - 5-9

2001 - 0-4; 8-6

2012 - 5-8

P��!#��* S!�!" (1-0)1979 - 10-8

R�5" (1-0)2008 - 17-5*

S�� D�"+� (5-1)2006 - 9-8; 9-8

2007 - 6-2

2008 - 9-0; 1-15; 5-1

S�� D�"+� S!�!" (0-4)1984 - 6-10; 7-10

1990 - 4-8

2009 - 1-4

S�� J�/" S!�!" (2-1)1955 - 9-4; 1-3; 5-1

S��!� C#�� (3-3)1959 - 23-11; 15-3

1962 - 1-6; 3-2; 2-4

1997 - 1-8

S"�!!#" (2-0)1952 - 2-1; 20-4

S�&!'"�� I##��/ (1-1)1990 - 3-2; 1-3

S!��,��* (3-7)1967 - 7-3; 3-6; 4-6

1982 - 10-17

1988 - 3-10*

1991 - 4-2; 7-5

1997 - 2-5

2000 - 1-5

2012 - 1-9

T"��"//"" (1-0)1993 - 6-2

T"=�/ A>M (1-0)1997 - 2-1

T"=�/ T"5' (1-1)1996 - 12-5; 2-13

T&#��" (0-1)1994 - 5-7

UC I�6��" (0-2)2009 - 2-4

2011 - 6-12

UC S��!� B��8�� (2-0)1952 - 9-5; 19-1

UCLA (0-2)1979 - 4-5

2011 - 1-3

USC (6-8)1954 - 7-4; 9-3

1955 - 1-8; 2-15

1961 - 1-4; 6-4; 6-10

1977 - 3-7

1984 - 15-12 (10)

1988 - 17-18; 17-12; 14-3

1995 - 17-22

2001 - 0-8

W�/'��+!�� (2-2)1959 - 3-2; 4-5; 10-5

1992 - 3-4

W�/'��+!�� S!�!" (1-2)1966 - 2-5; 1-2

1988 - 7-6

W"/!"�� M�5'�+�� (1-0)1959 - 7-2*

W�##�%"!!" (1-0)1955 - 6-3

W�5'�!� S!�!" (0-1)1989 - 4-6

* indicates World Series Game



BULLDOGS IN THE COLLEGE WORLD SERIES RECORD BOOK

OVERALL COLLEGE WORLD SERIES - INDIVIDUALB�� - S�!��"

Category Name (Team) No. Rank

Most Runs Steve Susdorf (2008) 10 T-3rd

Most Doubles Steve Susdorf (2008) 4 T-1st

Most Home Runs Tom Mendonca (2008) 4 T-1st

Most Total Bases Steve Detwiler (2008) 22 T-6th

Most Runs Ba� ed In Tom Mendonca (2008) 11 T-5th

& Steve Detwiler (2008) 11 T-5th

B�� - S��#� G�$�


Total Bases Steve Detwiler (2008) 11 T-5th

P��%&�� - S�!��"


Most Games Started Jus! n Wilson (2008) 3 T-1st

P��%&�� - S��#� ��$�

Category Name (Team) Opp. Rank

Shutouts Leroy Gregory (1959) def. Arizona 2-0 1 of 105

F��#'�� - S��#� G�$�


Passed Balls Jim Garre� (1959) 3 T-1st

OVERALL COLLEGE WORLD SERIES - TEAMB�� - S�!��"

Category (Team) No. Rank

Most Hits Allowed (2008) 249 T-4th

Most Runs (2008) 62 T-1st

Most Hits (2008) 77 T-2nd

Most Home Runs (2008) 14 T-3rd

Most Total Bases (2008) 136 2nd

Most RBI (2008) 61 T-1st

Hit-by-Pitch (2008) 9 T-5th

B�� - S��#� G�$�

Category (Team) No. Opp. Rank

Triples (1991) 3 LSU T-2nd

B�� - S��#� G�$� (B)�& T��$")


Most Hits (2008) 35 Georgia T-5th

RBI (2008) 28 Georgia 5th

P��%&�� - S�!��"


Most Hits Allowed (2008) 71 3rd

P��%&�� - S��#� G�$�


Passed Balls (1959) 5 Arizona 1st

P��%&�� - S��#� G�$� (B)�& T��$")


Most Earned Runs (2008) 27 Georgia T-4th

F��#'�� - S�!��"


Most Double Plays (2008) 11 T-2nd

CWS CHAMPIONSHIP FINALS RECORDS - INDIVIDUAL

(O�� A++��!��%� - J,�� 23-25, 2008 /". G�)!��)B�� - G�$�

Category Name No. Rank

Most Hits Steve Detwiler 4 - Game 3 T-1st

Most Triples Steve Susdorf 1 - Game 1 T-1st

Danny Muno 1 - Game 2 T-1st

Most Home Runs Steve Detwiler 2 - Game 3 T-1st

Most Extra-Base Hits Steve Detwiler (2 HR, 1 2B) 3 - Game 3 1st

Most Runs Scored Danny Muno 4 - Game 2 1st

Most RBI Steve Detwiler 6 - Game 3 1st

Most Total Bases Steve Detwiler 11 - Game 3 1st

B�� - S�!��"


At-Bats Gavin Hedstrom 15 T-1st

Most Hits Steve Detwiler 8 1st

Most Doubles Steve Detwiler 2 T-1st

Steve Susdorf 2 T-1st

Most Home Runs Steve Detwiler 3 T-1st

Most Extra-Base Hits Steve Detwiler 5 (3 HR, 2 2B) 1st

Most Runs Scored Steve Susdorf 6 1st

Most RBI Steve Detwiler 9 1st

Most Total Bases Steve Detwiler 19 1st

F��#'�� - G�$�


Most Errors Danny Muno 3 - Game 3 T-1st

F��#'�� - S�!��"


Most Errors Danny Muno 3 T-1st

CWS CHAMPIONSHIP FINALS RECORDS - TEAM

(O�� A++��!��%� - J,�� 23-25, 2008 /". G�)!��)B�� - S�!��"

Category No. Rank

Slugging Percentage .591 1st

Most Hits 34 1st

Most Triples 2 T-1st

Most Extra-Base Hits 15 1st

Most Runs 31 1st

Most RBI 30 1st

Most Total Bases 65 1st

At-Bats 110 T-2nd

B�� - G�$�

Category No. Rank

Most Hits 19 - Game 2 1st

Most Extra Base - Hits 6 - Game 1 T-1st

Most Runs 19 - Game 2 1st

Most RBI 18 - Game 2 1st

Most Total Bases 29 - Game 2 1st

At-Bats 41 - Game 2 T-2nd

F��#'�� - S�!��"

Category No. Rank

Most Errors 6 T-1st

F��#'�� - G�$�

Category No. Rank

Most Errors 4 - Game 3 T-1st

P��%&�� - G�$�

Category No. Rank

Fewest Runs Allowed 1 - Game 3 T-2nd

Fewest Strikeouts 1 - Game 1 1st



BULLDOGS IN THE COLLEGE WORLD SERIES RECORD BOOK

B�� - S�!��" (B#�$ T��%")

Category No. Rank

Most Hits 66 1st

Most Triples 3 1st

Most Extra-Base Hits 22 T-1st

Most Runs 49 1st

RBI 48 1st

Most Total Bases 109 1st

B�� - G�%� (B#�$ T��%")

Category No. Rank

Most Hits 35 - Game 2 1st

Most Extra-Base Hits 10 - Game 1 T-1st

Most Runs 29 - Game 2 1st

RBI 28 - Game 2 1st

Most Total Bases 46 - Game 2 1st

CWS CHAMPIONSHIP FINALS RECORDS - INDIVIDUAL

G�%� 3, F!�"�# S�� &". G�#!�� (J'�� 25, 2008)B�� - S�!��" (B#�$ T��%")


Most Hits Steve Detwiler 4 T-2nd

Most Home Runs Steve Detwiler 2 T-1st

Most Total Bases Steve Detwiler 11 1st

Most Runs Ba! ed In Steve Detwiler 6 2nd

F��*+��


Most Errors Danny Muno 3 T-1st

CAREER RECORDS - INDIVIDUALB�� - S�!��" (B#�$ T��%")


Slugging Percentage Steve Susdorf (2008) .733 9th

(min. 30 at bats)

LARGEST MARGIN OVERCOME FOR VICTORY5, Fresno State (19) vs. Georgia (10), June 24, 2008

(Fresno State trailed 5-0 going into the bo! om of the 3rd inning.) - T-1st

CWS TOURNAMENT TEAM MEMBERS2008 Erik Wetzel, 2B

2008 Tom Mendonca, 3B

2008 Steve Susdorf, OF

2008 Steve Detwiler, OF

2008 Jus" n Wilson, RHP

CWS MOST OUTSTANDING PLAYER2008 Tom Mendonca

D�� S�� O//#�� FS-O// N��1#!4April 23, 1988 Fresno, Calif Brigham Young 7-4 ESPN

June 4, 1988 Omaha, Neb. Stanford 3-10 ESPN

June 6, 1988 Omaha, Neb. Miami (Fla.) 3-4 (12) ESPN

Feb. 19, 1989 Fresno, Calif. San Diego State 13-10 ESPN

May 6, 1990 Fresno, Calif. Long Beach State 8-4 ESPN

May 31, 1990 Omaha, Neb. Florida State 6-3 ESPN

June 2, 1991 Omaha, Neb. LSU 3-15 ESPN

June 4, 1991 Omaha, Neb. Florida 1-2 ESPN

April 8, 2006 Fresno, Calif. Hawai’i 6-1 CSTV

June 2, 2006 Fullerton, Calif. San Diego 9-8 ESPNU

June 3, 2006 Fullerton, Calif. Cal State Fullerton 2-9 ESPNU

June 4, 2006 Fullerton, Calif. San Diego 9-8 ESPNU

June 4, 2006 Fullerton, Calif. Cal State Fullerton 3-10 ESPNU

June 7, 2008 Tempe, Ariz. Arizona State 4-12 ESPNU

June 8, 2008 Tempe, Ariz. Arizona State 8-6 ESPN2

June 9, 2008 Tempe, Ariz. Arizona State 12-9 ESPN2

June 15, 2008 Omaha, Neb. Rice 17-5 ESPN

June 17, 2008 Omaha, Neb. North Carolina 5-3 ESPN2

June 21, 2008 Omaha, Neb. North Carolina 3-4 ESPN2

June 22, 2008 Omaha, Neb. North Carolina 6-1 ESPN Classic

June 23, 2008 Omaha, Neb. Georgia 6-7 ESPN



May 29, 2009 Irvine, Calif. UC Irvine 2-3 ESPN2

May 30, 2009 Irvine, Calif. San Diego State 1-4 ESPN2

FRESNO STATE’S NATIONAL TV APPEARANCES



BULLDOGS IN THE PROS (2016 SEASON)Former Bulldogs who played pro baseball (MLB/MILB) in 2016

MLB• Doug FisterHouston Astros• Matt GarzaMilwaukee Brewers• Aaron Judge New York Yankees• Casey McGeheeDetriot Tigers• Justin MilerColorado Rockies• Tanner ScheppersTexas Rangers• Justin WilsonNew York Yankees

MILB• Manny ArgomanizStaten Island Yankees (New York Yankees - Class SS)• Jordan BrinkEugene Emeralds(Chicago Cubs - Class SS)• Justin HaleyPawtucket Red Sox(Boston Red Sox- Class AAA)• Jimmy LambertKannapolis Intimidators(Chicago White Sox - Class A)• Dylan LeeBatavia Muckdogs(Miami Marlins - Class SS)

• Jordan LuplowBradenton Marauders(Pittsburgh Pirates - Class Adv. A)• Chris MariscalClinton Lumberkings(Seattle Mariners - Class A)• Garrett MundellCharleston RiverDogs(New York Yankees - Class A)• Danny MunoJacksonville Suns(Miami Marlins - Class AA)• Jake Shull Western Michigan Whitecaps(Detroit Tigers - Class A)• Derick VelazquezTri-City ValleyCats(Houston Astros - Class SS)• Taylor WardInland Empire 66ers(Los Angeles Angels - Class Adv. A)

• Garrett WeberNew Orleans Zephyrs(Miami Marlins - Class AAA• Trent WoodwardCorpus Christi Hooks(Houston Astros - Class AA)• Austin WynnsNorfolk Tides(Baltimore Orioles - Class AAA)



1965 - June Regular Phase

Rd. Name, Pos. Club

10 Richard Pierini, RHP Astros

13 Buz Stephen, RHP* Astros

23 Robert Schanze, 3B Cardinals

1966 - January Regular Phase

Rd. Name, Pos. Club

3 Mike Griffi th, LHP Mets

1966 - January Secondary Phase

Rd. Name, Pos. Club

2 Buz Stephen, RHP* Twins


Rd. Name, Pos. Club

5 Wayne McGhee, C Red Soxs

23 Earl Vickers, OF* Phillies

29 Dan Pollard, 1B Angels

35 David Nitschke, C* Dodgers

1966 - June Secondary Phase

Rd. Name, Pos. Club

1 Buz Stephen, RHP Twins (6th overall)


Rd. Name, Pos. Club

26 Donald Peracchi, 1B Angels

37 Larry Gonsalves, RHP* Royals

39 Earl Vickers, OF White Soxs


Rd. Name, Pos. Club

4 Earl Vickers, OF Giants

7 Robert Perruchon, OF Angels

9 David Nitschke, C Mets


Rd. Name, Pos. Club

6 Larry Gonsalves, RHP Red Sox


Rd. Name, Pos. Club

6 William Brown, INF Red Sox


Rd. Name, Pos. Club

9 Ray Strable, RHP Twins


Rd. Name, Pos. Club

35 David Schmidt, SS Twins


Rd. Name, Pos. Club

17 Robert Ulrich, RHP Giants


Rd. Name, Pos. Club

19 Darrell Gambero, RHP Royals

21 Robert Groth, OF Angels


Rd. Name, Pos. Club

5 Richard Mahlmann, LHP Twins

7 Sco" Wolfe, INF Giants


Rd. Name, Pos. Club

1 Dick Ruthven*, RHP Phillies (8th Ov.)


Rd. Name, Pos. Club

1 Dick Ruthven, RHP Phillies (1st Ov.)


Rd. Name, Pos. Club

4 Mark Hance, 3B Dodgers

19 Daniel Grimm, RHP* Twins

25 Bradley Duncan, RHP Twins

32 Mark Hance, 3B Rangers

33 Warren Brusstar, RHP* Mets


Rd. Name, Pos. Club

3 Daniel Grimm, RHP* Expos

4 Warren Brusstar, RHP Phillies


Rd. Name, Pos. Club

2 Jeff rey Ross, P* Giants


Rd. Name, Pos. Club

4 Andrew Dyes, OF Expos

1976

No players dra� ed


Rd. Name, Pos. Club

6 Dave Rohm, RHP Blue Jays


Rd. Name, Pos. Club

1 Stephen Collins, RHP Red Sox (7th Ov.)


Rd. Name, Pos. Club

10 Bob Stoddard, RHP Mariners

11 Mark Lohuis, RHP* Cubs

24 Ron Johnson, RHP Blue Jays


Rd. Name, Pos. Club

2 Cur$ s Reade, RHP* Cardinals


Rd. Name, Pos. Club

12 Ron Leach, LHP Indians

21 Mark Lohuis, RHP Astros

21 David Holt, C Red Sox


Rd. Name, Pos. Club

3 Rich Bordi, RHP Athle$ cs

4 Jon Reelhorn, RHP Phillies

11 Cur$ s Reade, RHP Dodgers

34 Brad Benne" , OF Yankees

37 Darren Holt, 2B Yankees


Rd. Name, Pos. Club

10 Tony Herron, LHP Athle$ cs

19 Jim Flores, SS Twins

24 Steve Wilcox, RHP Giants

25 Kevin Coughlon, OF Athle$ cs


Rd. Name, Pos. Club

3 Tim Thiessen, SS Expos

7 Terry Pendleton, OF Cardinals

12 Rob Geels, C Red Sox

27 Pete Dalena, 1B Yankees


Rd. Name, Pos. Club

3 Randy Asadoor, 3B Rangers

12 Rob Emerson, RHP Blue Jays

16 Ken Galloway, LHP* Twins

20 John Hoover, RHP* Yankees

23 Greg Funk, 2B Yankees

24 Kurt Walker, RHP White Sox


Rd. Name, Pos. Club

1 John Hoover, RHP Orioles (25th Ov.)

4 Todd Soares, OF Phillies

5 Ken Galloway, LHP Indians

9 Vince Barger, LHP Braves

14 Bob Jacobsen, RHP Dodgers

BULLDOGS IN THE

MLB DRAFT



BULLDOGS IN THE

MLB DRAFT

1984 - June Regular Phase (cont.)

16 Sco� Buss, OF Mariners

17 Mark Gardner, RHP* Indians

21 Eddie Jacobo, OF Dodgers

22 Eric Fox, OF* Blue Jays


Rd. Name, Pos. Club

8 Mark Gardner, RHP Expos

8 Bob Bafi a, 3B Cubs

12 Ken Carew, RHP Royals

13 Joe Xavier, SS Athle" cs

13 Eric Fox, OF* Phillies

22 Cal Cain, OF Reds


Rd. Name, Pos. Club

1 Eric Fox, OF Mariners (5th Ov.)


Rd. Name, Pos. Club

13 Harvey Brumfi eld, OF Phillies

24 Billy Bartels, RHP Dodgers

26 Michael Stewart, OF* Twins

30 Jeff Stark, OF Phillies

30 John Larios, OF Royals

1987

Rd. Name, Pos. Club

3 Mike Goff , RHP Mariners

12 Shawn Gilbert, SS Twins

21 Dennis Springer, RHP Dodgers

22 Derek Stroud, LHP Cubs

29 Steve Bates, OF Phillies

30 Steve Wapnick, RHP Blue Jays

49 Michael Stewart, OF* Blue Jays

1988

Rd. Name, Pos. Club

4 Lance Shebelut, 1B Tigers

4 Steve Buckholz, RHP Pirates

5 John Salles, RHP Cubs

34 Ed Bustamante, OF* Tigers

1989

Rd. Name, Pos. Club

1 Steve Hosey, OF Giants (14th Ov.)

1 Eddie Zosky, SS Blue Jays (19th Ov.)

1 Tom Goodwn, OF Dodgers (22nd Ov.)

8 Jason Brosnan, LHP Dodgers

13 Steve Vondran, 3B-C Reds

17 Mike Burton, 1B Rangers

62 Rich Crane, LHP Dodgers

1990

Rd. Name, Pos. Club

2 Erik Schullstrom, RHP Orioles

5 Rich Lantrip, 1B-DH Yankees

6 Steve Wolf, RHP Tigers

19 Tom Phillips, C Expos

26 Ranbir Grewal, RHP Expos

33 J.P. Pos" ff , 3B Cubs

40 Jeff Borgese, OF Phillies

40 Eric Buechele, C# Angels

1991

Rd. Name, Pos. Club

1 Bobby Jones, RHP+ Mets

11 Jason Wood, SS A’s

23 Robbie Saitz, RHP Angels

28 Vernon Spearman, OF Dodgers

1992

Rd. Name, Pos. Club

3 Brant Brown, 1B Cubs

15 Todd Johnson, C* Mariners

15 Jim Pa� erson, RHP Marlins

24 Terance Frazier, 3B A’s

27 Mike Salazar, LHP* A’s

29 Anthony Bonifazio, OF Marlins

35 Tim Cos" c, OF Twins

39 Bobby Jones, 2B Phillies

1993

Rd. Name, Pos. Club

1 Steve Soderstrom, RHP Giants (6th Ov.)

15 Mike Salazar, LHP Tigers

18 Todd Johnson, C Indians

45 Mark Cruise, RHP Cardinals

1994

Rd. Name, Pos. Club

28 Sco� Warembourg, RHP Rockies

38 Tommy Minor, RHP Cardinals

1995

Rd. Name, Pos. Club

6 Joe Freitas, OF Cardinals

9 Tony Enard, RHP Marlins

61 Shorty Farfan, RHP Angels

66 Robert Donnelly, RHP Cardinals

1996

Rd. Name, Pos. Club

12 Ben Reynoso, SS Padres

26 Ma� Cur" s, C Angels

1997

Rd. Name, Pos. Club

2 Jeff Weaver, RHP* White Sox

5 Giuseppe Chiaramonte, C Giants

13 Derek Feramisco, OF Cardinals

37 Brad Tucker, RHP* Cubs

1998

Rd. Name, Pos. Club

1 Jeff Weaver, RHP Tigers (14th Ov.)

2 Adam Pe� yjohn, LHP Tigers

13 Randy Goodrich, RHP Giants

27 Craig da Luz, 3B Tigers

1999

Rd. Name, Pos. Club

9 Casey Rowe, RHP Tigers

30 Hans Smith, LHP* Diamondbacks

2000

Rd. Name, Pos. Club

11 Hans Smith, LHP Devil Rays

13 Anthony Aceveedo, OF Astros

42 Shawn Hannah, RHP Tigers

2001

Rd. Name, Pos. Club

3 Nick Moran, RHP Indians

6 Josh Labandeira, SS Expos

8 Brandon Gemoll, 1B Brewers

2002

Rd. Name, Pos. Club

1 Ben Fritz, RHP Athle" cs

6 Mike Hernandez, LHP Indians

12 Bob Runyon, RHP Cardinals

25 Zach Minor, RHP Phillies

2003

Rd. Name, Pos. Club

10 Casey McGehee, 3B Cubs

2004

Rd. Name, Pos. Club

1 Richie Robne� , OF Athle" cs

16 Ryan Haag, 2B Yankees

26 Kyle Wilson, 1B Rockies

30 David Griffi n, LHP Reds

30 Brandon Marcelli, C Cardinals

37 Chris Patrick, SS Cardinals



2005

Rd. Name, Pos. Club

1 Ma� Garza, RHP Twins

6 Doug Fister, RHP* Yankees

12 Rudy Quinonez, RHP Braves

17 Michael Cooper, RHP Cardinals

2006

Rd. Name, Pos. Club

3 Nick Moresi, OF Astros

5 Andy Underwood, RHP Padres

7 Doug Fister, RHP Mariners

9 Eddie Romer, LHP Diamondbacks

10 Chris! an Vi� ers, SS Athle! cs

12 Kent Sakamoto, 1B Pirates

2007

Rd. Name, Pos. Club

1 Beau Mills, INF^ Indians

18 Brian Lapin, OF Rockies

21 Ozzie Lewis, OF Twins

24 Brandon Miller, LHP Rockies

27 Steve Susdorf, OF* Tigers

2008

Rd. Name, Pos. Club

2 Tanner Scheppers,RHP* Pirates

5 Jus! n Wilson, RHP Pirates

13 Erik Wetzel, 2B Rockies

16 Jus! n Miller, RHP Rangers

16 Steve Susdorf, OF Phillies

27 Clayton Allison, RHP Dodgers

2009

Rd. Name, Pos. Club

1 Tanner Scheppers,RHP+ Pirates

2 Tom Mendonca, 3B Rangers

11 Alan Ahmady, 1B Cardinals

28 Holden Sprague, RHP Marlins

2010

Rd. Name, Pos. Club

10 Bobby Coyle, OF Dodgers

26 Danny Muno, 2B* Cubs

2011

Rd. Name, Pos. Club

8 Danny Muno, INF Mets

10 Dusty Robinson, OF Athle! cs

15 Greg Gonzalez, P Padres

18 Josh Poytress, P Pirates

21 Jordan Ribera, INF Rockies

22 Garre� Weber, INF Diamondbacks

22 Brennan Gowens, OF Angels

27 Taylor Garrison, RHP* Dodgers

27 Charlie Robertson, RHP Braves

50 Trent Garrison, C* Angels

2012

Rd. Name, Pos. Club

6 Jus! n Haley, RHP Mets

7 Taylor Garrison, RHP Yankees

8 Cody Kendall, RHP Rangers

13 Thomas Harlan, LHP Pirates

23 Gene Escat, RHP Orioles

29 Patrick Hutcheson, 2B Rockies

2013

Rd. Name, Pos. Club

1 Aaron Judge, OF Yankees(32nd Ov.)

9 Tyler Linehan, LHP Brewers

10 Aus! n Wynns, C Orioles

21 Tyler S! rewalt, RHP Twins

28 Trent Garrison, C Yankees

2014

Rd. Name, Pos. Club

3 Jordan Luplow, OF Pirates

7 Derick Velazquez, RHP Astros

11 Jordan Brink, RHP Cubs

14 Chris Mariscal, INF Mariners

18 Garre� Mundell, RHP* Diamondbacks

20 Trent Woodward, C Astros

2015

Rd. Name, Pos. Club

1 Taylor Ward, C Angels (26th Ov.)

11 Jake Shull, RHP Tigers

23 Garre� Mundell, RHP Yankees

2016

Rd. Name, Pos. Club

5 Jimmy Lambert, RHP White Sox

10 Dylan Lee, LHP Tigers

*Did not sign

^Beau Mills (2005-06) transferred and was

subsequently dra" ed in the fi rst round

(13th overall) by

Cleveland in 2007.

#Did not play baseball; was a four-year

le� erman on the football team.

+Supplemental choice

Source: Baseball America

BULLDOGS IN THE

MLB DRAFT



TEAM RECORDS SUMMARY

S��Games .................................................... 78 ............................................ 2008

Wins ....................................................... 56 ............................................ 1988

Consecu� ve Wins ................................... 32 ............................................ 1988

Losses ..................................................... 33 (2x) ........................... 1975, 2013

H !! �"Ba! ng Average ..................................... .350 ......................................... 1988

At-Bats .................................................... 2,668 ....................................... 2008

Hits ......................................................... 916 .......................................... 1988

Runs ........................................................ 670 .......................................... 1988

Doubles .................................................. 170 .......................................... 1988

Triples ..................................................... 33 ............................................ 1988

Home Runs ............................................. 120 .......................................... 1988

RBI .......................................................... 606 .......................................... 1988

Game-Winning RBI ................................. 52 ............................................ 1988

Total Bases .............................................. 1,492 ....................................... 1988

Stolen Bases ........................................... 109 .......................................... 1951

Sacrifi ces ................................................. 84 ............................................ 2008

Walks ...................................................... 340 .......................................... 2008

Strikeouts ............................................... 572 .......................................... 2008

Le# on Base ............................................ 630 .......................................... 2008

P !#$ �" ��& F �'& �"Wins ....................................................... 56 ............................................ 1988

Innings Pitched ....................................... 675.2 ....................................... 2008

Lowest ERA ............................................. 1.38 ......................................... 1951

Highest ERA ............................................ 6.08 ......................................... 2004

Complete Games .................................... 36 ............................................ 1988

Walks ...................................................... 298 .......................................... 2008

Fewest Balks ........................................... 0 .............................................. 2011

Strikeouts ............................................... 586 .......................................... 1997

Hit Ba$ ers ............................................... 85 ............................................ 2003

Wild Pitches ............................................ 66 (2x) ........................... 2013, 2014

Saves ....................................................20 ......................................... 2016

Shutouts ................................................. 11 .................................. 1961, 1970

Errors ...................................................... 128 .......................................... 1993

Double Plays Turned ............................... 78 ............................................ 2008

S �"'� G�(� H !! �" H "$�At-Bats ..............................................81 ...................... 3/26/11, vs. San Diego

Runs ..................................................36 ......................4/8/48, vs. San Jose St.

Runs (Both Teams) ............................53 ..............4/1/99, FS (26) at UNM (27)

Runs in one inning ............................13 ...................5/6/06, vs. Nevada (2nd)

Hits ...................................................36 ..................... 4/1/99, at New Mexico

Hits in one inning ..............................10 ................... 3/17/01, vs. Illinois (8th)

Hits (Both Teams) .............................68*# ..........4/1/99, FS (36) at UNM (32)

RBI ....................................................28 .......................... 4/25/82, vs. Nevada

Doubles ..........................................8 (4x) ..... last on 3/24/16 at San Jose State

Triples ...............................................4 .............4/23/52 vs. Sacramento State

Home Runs .......................................6 (6x) ..... last on 5/21/05, vs. Louisiana Tech

Consecu� ve Home Runs ...................3 (3x) .........last on 2/24/02, vs. Washington

Total Bases ........................................54 ........................5/11/97, vs. Air Force

Walks ................................................16 .............................3/8/09, vs. Buff alo

Strikeouts .........................................28 ...................... 3/26/11, vs. San Diego

Sacrifi ce Flies .................................... 4 ................ 2/10/84, vs. Loyola Marymount

Stolen Bases ..................................... 8 ............................5/18/51, vs. Cal Poly

Le# on Base ......................................23 .................... 2/10/01, vs. Santa Clara

S �"'� G�(� P !#$ �" ��& F �'& �" H "$�Innings pitched .................................22.0 ................... 3/26/11, vs. San Diego

Runs allowed ....................................29 ..................3/2/96, vs. CS Northridge

Walks allowed...................................15 .......................4/28/76, vs. California

Strikeouts .........................................21 .................... 5/22/97, vs. Texas A&M

Hits allowed ......................................32 .................... 4/1/99, vs. New Mexico

Wild Pitches ...................................... 6 (3x) ...... last on 5/7/14, vs. Bakersfi eld

Hit ba$ ers ......................................... 5 (4x) ..... last on 3/5/13, vs. San Jose St.

Errors ................................................10 ..............3/28/50, vs. Sacramento St.

Double plays turned ......................... 5 (4x) ............last on 3/7/10, vs. Oregon

M �#�''��+�Longest game (� me) ... 7 hours, 12 minutes ................ 3/26/11, vs. San Diego

Longest game (innings) ..................... 22 ...................... 3/26/11, vs. San Diego

Win margin ....................................... 28 .......................... 2/7/49, vs. UC Davis

Win margin (by opp.) ........................ 26 ..................3/2/96, vs. CS Northridge

*WAC Record

#NCAA Record

$NCAA Championship Record



INDIVIDUAL RECORDS SUMMARY

S�� B��!�"Average (min. 120 AB) .......................... 440 ...................... Ron Johnson, 1978

At-Bats .................................................. 323 .................... Tom Goodwin, 1988

Hits ....................................................... 112 .........................Erik Wetzel, 2008

......................................................................................... Tom Goodwin, 1988

....................................................................................... Lance Shebelut, 1988

Runs .......................................................99 ..........................Erik Wetzel, 2008

Doubles ................................................ 33 ......................Steve Susdorf, 2008

Triples ....................................................10 ......... Bob Groth, 1970; Eric Fox, 1983

Home Runs ............................................32 ................... Lance Shebelut, 1988

RBI .........................................................94 ................... Lance Shebelut, 1988

Game-Winning RBI ................................11 ................... Lance Shebelut, 1988

Total Bases .............................................226 ................. Lance Shebelut, 1988

Stolen Bases ..........................................62 ..................... Tom Goodwin, 1988

Walks .....................................................64 .......................Danny Muno, 2009

Sacrifi ce Bunts .......................................18 ..................Gavin Hedstrom, 2008

Sacrifi ce Flies ........................................7 .......... Eddie Zosky, 1988 & 1989;

.......................................................... Chris Patrick, 2003; Jake Stone, 2016

Consec. Games Homered In ................... 5 ........Art Holland, Feb. 25-Mar. 4, 1983

Consecu! ve Hits ..................................... 8 (3x) . last Bill Thrasher, May 30-31, 1993

Hi" ng Streak (games) ............................ 38 .. Josh Hannah, Feb. 26-May 25, 1997

S�� P!�$%!�" Appearances ........................................... 38 ...................Brandon Burke, 2008

............................................................................................. Hans Smith, 1999

Starts ...................................................... 23 ......................... John Salles, 1988

Wins ....................................................... 18 .......................John Hoover, 1984

Losses ....................................................... 9 .....................Brad Duncan, 1972,

....................................................................................... Rudy Quinonez, 2004

ERA ......................................................... 1.13 ....................Dennis Pila! , 1966

Complete Games .................................... 19 # ....................John Hoover, 1984

Walks ...................................................... 70 ..................... Dick Ruthven, 1972

Strikeouts ............................................... 205 .....................John Hoover, 1984

Strikeouts Per 9 Innings .......................... 13.7 ................ Greg Gonzalez, 2011

Innings Pitched ....................................... 177.1 .................... John Salles, 1988

Ba$ ers Faced .......................................... 677 ....................... John Salles, 1988

Hits Allowed ........................................... 168 ....................... John Salles, 2988

Runs Allowed .......................................... 82 .......................Robbie Saitz, 1991

Earned Runs Allowed .............................. 71 ......................Tom Graham, 1999

Consecu! ve Scoreless Innings ................ 29 ...................... Bobby Jones, 1991

Shutouts ................................................. 4 ........................ Gene Graves, 1961

........................................................................................... Bobby Jones, 1991

Saves ....................................................... 13 ...................Brandon Burke, 2008

Best Winning Pct. ................................... 1.000 ... Randy Graham (14-0), 1982

Consecu! ve Wins ................................... 16 .......................John Hoover, 1984

Home Runs Allowed ............................... 19 .................Holden Sprague, 2009

Hit Ba$ ers ............................................... 20 ....................... Casey Rowe, 1998

Wild Pitches ............................................ 16 ....................Ranbir Grewal, 1990

............................................................................................ Casey Rowe, 1998

S!�"'� G�(� B��!�"At-Bats ............................11 .............Brennan Gowens vs San Diego, 3/25/11

Runs ................................6 (3x)...................... Brad Benne$ vs. Pacifi c, 2/2/79

..................................................... Chris! an Vi$ ers vs. Chicago state, 2/27/05

.............................................................................Beau Mills vs. Iona, 3/18/05

Hits ................................. 6 (5x) ...most recent: Tom Creighton & Oscar Lopez

..............................................................vs. Santa Clara, 2/10/01 - same game

Doubles ......................... 4 .........................Harvey Hill vs. St. Mary’s, 3/13/87

Triples ............................ 3 .............most recent: Jordan Brink vs. AFA, 4/9/13

Home Runs .................... 3 (7x) .................. most recent: Brian Lapin, 5/27/07

RBI ................................. 9 ............................................ Josh Hannah, 4/26/98

Total Bases ..................... 15 ............... Derek Feramisco vs. Air Force, 5/11/97

Walks ..............................5 ....................................... DeAndre Miller, 2/27/05

Stolen Bases ...................5 (3x).............Fibber Hirayama vs. Cal Poly, 5/18/51

.................................................................. Tom Goodwin vs. Hawai’i, 2/26/89

....................................................................Tom Goodwin vs. Pacifi c, 4/22/89

Consecu! ve Homers ....... 3 (4x) ...most recent: Jordan Ribera vs. Nebraska, 2/19/10 & 2/20

S!�"'� G�(� P!�$%!�"Innings pitched ..................... 14 ........Dan Grimm vs. Sacramento St, 3/14/72

Strikeouts ............................. 21$ ...........Jeff Weaver vs. Texas A&M, 5/22/97

Consecu! ve Strikeouts ......... 10 ........ Adam Pe$ yjohn vs. Winthrop, 3/12/88

Hits Allowed ......................... 21 ..... Randy Graham (9 innings) vs. Nevada, 4/25/82

Walks .................................... 13 .........Dick Ruthven vs. Sacramento State, 4/18/72

Hit ba$ ers ..............................4.......... Doug Fister vs. San Jose State, 4/10/05

Wild pitches ...........................5.................... Tim Borst vs. Bakersfi eld, 5/7/14

N�-H!��)� L!�� (8):Truman Clevenger vs. Pacifi c (7 innings) - 4/22/1952

Truman Clevenger vs. Pacifi c (9 innings) - 3/21/1953

Ed Hite vs. Westmot College (7 innings) - 3/15/1963

Larry Gonsalves vs. Cal Poly (9 innings) - 5/19/1967

Darrell Gambero vs. UC Davis (7 innings) - 5/5/1970

Dick Ruthven vs. Long Beach State (9 innings) - 5/5/1972

Rob Cruess vs. Sacramento State (7 innings) - 4/3/1976

Greg Gonzalez vs. Hawai’i (7 innings) - 4/10/2010

P�)/�$� G�(�� L!�� (1):Larry Gonsalves vs. Cal Poly (9 innings) - 5/19/1967

(one-of-24 players in NCAA history to record a perfect game)

M!�$�''��4�Face Minimum ba$ ers .............................................................................. 27 (twice)

(most recent: Derek Benny vs. Lipscomb, 3/28/2009)

Hit for Cycle .....................................................Danny Muno vs. Hawai’i, 5/29/2010

Last Opponent to Hit for Cycle ............................. Jacob Butler, Nevada, 4/26/2003

*WAC Record

#NCAA Record

$NCAA Championship Record



TOP 10 CAREER HITTING LEADERSGAMES 1. 259 Danny Muno 2008-11

2. 247 Todd Johnson 1990-93

3. 245 Ben Reynoso 1993-96

4. 243 Steve Susdorf 2005-08

5. 234 Greg Funk 1980-83

6. 230 Joe Xavier 1982-85

7. 217 Kevin Viers 2013-16

8. 215 Ma! Cur" s 1993-96

9. 209 Trent Garrison 2009-13

10. 207 Philip Romero 1989-92

207 Tom Mendonca 2007-09

AVG. (MIN 260 AB) 1. .389 Ron Johnson 1977-78

2. .383 Terry Pendleton 1981-82

.383 Sco! Buss 1983-84

.383 Augie Garrido 1959-61

5. .380 Lance Shebelut 1988-89

6. .363 Steve Pearse 1987-88

7. .362 Pete Dalena 1981-82

.360 Bobby Coyle 2010

8. .357 Steve Bates 1985-87

9. .351 Brandon Mitchell 1987-88

10. .350 Tom Goodwin 1987-89

AT-BATS 1. 985 Todd Johnson 1990-93

2. 963 Danny Muno 2008-11

3. 903 Ben Reynoso 1993-96


5. 860 Joe Xavier 1982-85

6. 821 Tom Goodwin 1987-89

7. 779 Erik Wetzel 2006-08


9. 770 Tom Mendonca 2007-09

10. 764 Eddie Zosky 1987-89

RUNS 1. 251 Danny Muno 2008-11

2. 207 Tom Goodwin 1987-89

207 Steve Susdorf 2005-08

4. 205 Erik Wetzel 2006-08

5. 192 Joe Xavier 1982-85

6. 183 Greg Funk 1980-83

183 Todd Johnson 1990-93

8. 161 Dusty Robinson 2009-11

9. 160 Eric Fox 1982-83,’85

10. `158 Philip Romero 1989-92

HITS 1. 340 Todd Johnson 1990-93

2. 332 Danny Muno 2008-11


4. 287 Tom Goodwin 1987-89

5. 276 Joe Xavier 1982-85

6. 270 Erik Wetzel 2006-08

7. 253 Eddie Zosky 1987-89

253 Ben Reynoso 1993-96

9. 243 Casey McGehee 2001-03


DOUBLES 1. 70 Steve Susdorf 2005-08

2. 69 Danny Muno 2008-11

69 Joe Xavier 1982-85


5. 52 Ma! Cur" s 1993-96

6. 51 Eddie Zosky 1987-89

7. 46 Nick Garcia 1998-01

8. 45 Jordan Luplow 2012-14

9. 44 Anthony Acevedo 1999-00

10. `43 Dusty Robinson 2009-11

43 Steve Hosey 1987-89

43 Derek Feramisco 1995-97

TRIPLES 1. 18 Eric Fox 1982-85

2. 13 Fred Sommers 1951-53

13 Augie Garrido 1959-61

13 Tom Goodwin 1987-89

5. 12 Bob Groth 1969-70

6. 11 Bob Donkersley 1951-52

11 Greg Funk 1980-83

11 Todd Johnson 1990-93

11 Joe Gerber 1996-99

10. 10 Eddie Zosky 1987-89

10 Ben Reynoso 1993-96

10 Derek Feramisco 1995-97

HOME RUNS 1. 56 Tom Mendonca 2007-09


3. 44 Jordan Ribera 2008-11

4. 43 Giuseppe Chiaramonte 1995-97

5. 39 Lance Shebelut 1987-88

39 Steve Susdorf 2005-08

7. 36 Beau Mills 2005-06

8. 33 Greg Funk 1980-83

9. 32 Pete Dalena 1981-82

10. 30 Derek Feramisco 1995-97

RBI 1. 217 Steve Susdorf 2005-08


3. 185 Tom Mendonca 2007-09

4. 174 Alan Ahmady 2007-09

5. 168 Joe Xavier 1982-85


7. 157 Giuseppe Chiaramonte 1995-97

8. 156 Danny Muno 2008-11

156 Brandon Gemoll 1999-01

9. 152 Greg Funk 1980-83

152 Eddie Zosky 1987-89

STOLEN BASES 1. 164 Tom Goodwin 1987-89

2. 73 Mike Noel 1988-91

3. 71 Fibber Hirayama 1950-52

71 Ryan Wood 1994-95

5. 54 Eric Fox 1982-83, ‘85

6. 47 Danny Muno 2008-11

7. 44 Loren Storey 2006-07

8. 43 Bob Donkersley 1951-52


10. 36 Aaron Judge 2011-13

WALKS 1. 213 Danny Muno 2008-11

2. 145 Greg Funk 1980-83

3. 132 Joe Xavier 1982-85

4. 123 Mike Noel 1988-91

5. 121 Brad Benne! 1978-80

6. 120 Alan Ahmady 2007-09

7. 116 Ma! Cur" s 1993-96

8. 108 Aaron Judge 2011-13


10. `101 Steve Susdorf 2005-08

101 Erik Wetzel 2006-08



TOP 10 CAREER PITCHING LEADERSWINS

1. 44 John Hoover 1981-84

2. 33 Jeff Weaver 1995-98

3. 32 John Salles 1986-88

32 Bobby Jones 1989-91

5. 30 Dan Grimm 1971-74

6. 29 Rich Crane 1987-89

29 Bobby Doig 1954-57

29 Jon Reelhorn 1987-80

29 Erik Schullstrom 1988-90

10. 28 Dick Ruthven 1970-72

28 Rich Bordi 1978-80

SAVES 1. 24 Brandon Burke 1977-78

2. 17 Hans Smith 1981-82

3. 16 Bobby Jones 1983-84

4. 13 Tim Borst 2013-16

13 Bob Jacobsen 1959-61

6. 12 Charlie Robertson 2009-11

7. 11 Jason Breckley 1987-88

8. 10 Shorty Farfan 1985

9. 8 Chad Edwards 2002-05

10. 7 Ben Fritz 2000-02

7 Bryan Wolfenbarger 2003

ERA (100-199 IP) 1. 1.93 Ray Strable 1968-69

2. 2.11 Tom Sharpe 1967-68

3. 2.28 John Moncier 1970-71

4. 2.36 Mike Noonan 1968-69

5. 2.39 Doug Modrell 1965-66

6. 2.68 Warren Brusstar 1973-74

7. 2.72 Ted Ellis 1955-56

8. 2.80 Bob Stoddard 1977-78

9. 2.82 Rob Emerson 1982-83

10. 3.01 Gary Modrell 1957-58

ERA (200+ IP) 1. 1.52 Dick Ruthven 1970-72

2. 1.94 Truman Clevenger 1951-53

3. 2.27 Ed Hite 1961-63

4. 2.37 Larry Gonsalves 1966-68

5. 2.45 Bobby Jones 1989-91

6. 2.61 Dave Rohm 1976-77

7. 2.64 Bobby Doig 1954-57

8. 2.88 John Hoover 1981-84

9. 2.93 Brad Kelley 1974-77

10. 3.03 Jon Reelhorn 1978-80

COMPLETE GAMES 1. 42* John Hoover 1981-83

2. 33 John Salles 1986-88

3. 31$ Jeff Weaver 1995-98

4. 25 Jon Reelhorn 1978-80

5. 23 Bobby Jones 1989-91

6. 22 Rich Bordi 1978-80

22 Erik Schullstrom 1988-90

8. 21 Tony Herron 1979-81

9. 20 Rich Crane 1987-89

10. 19 Mark Gardner 1984-85

STRIKEOUTS 1. 477 Jeff Weaver 1995-97

2. 411 John Hoover 1981-84

3. 382 Erik Schullstrom 1988-90

4. 372 Dick Ruthven 1970-72

5. 342 Bobby Jones 1989-91

6. 338 John Salles 1986-88

7. 322 Adam Pe! yjohn 1996-98


9. 282 Steve Wolf 1988-90

10. 281 Mark Gardner 1984-85

INNINGS PITCHED 1. 494 John Hoover 1981-84

2. 449.1 Dan Grimm 1971-74

3. 430 John Salles 1986-88

4. 412.2 Jeff Weaver 1995-98

5. 373.2 Erik Schullstrom 1988-90

6. 359.1 Jon Reelhorn 1978-80

7. 357 Bobby Jones 1989-91

8. 352.2 Rich Bordi 1978-80

9. 322 Rich Crane 1987-89

10. 321.1 Mike Goff 1985-87

WALKS 1. 161 Dick Ruthven 1970-72

2. 146 Bobby Doig 1954-57

3. 143 George Millhorn 1954-57

143 Jus" n Wilson 2006-08

5. 134 John Wilson 1981-84



8. 120 Mark Lohuis 1978-79

9. 119 Tony Herron 1979-81

10. 117 Steve Wolf 1988-90

HITS ALLOWED 1. 467 John Hoover 1981-84

2. 437 John Sallas 1986-88


4. 359 Mike Salazar 1990-93

5. 351 Jeff Weaver 1995-98

6. 350 Tom Graham 1997-00

7. 327 Zach Minor 1999-02

8. 319 Mike Goff 1985-87

9. 318 Rich Crane 1987-89

10. 307 Jon Reelhorn 1978-80

+Minimum two seasons

*Indicates NCAA Record

$ WAC Record



TOP 10 SINGLE SEASON HITTING LEADERSGAMES 1. 78 Alan Ahmady 2008

78 Steve Susdorf 2008

78 Danny Muno 2008

78 Tom Mendonca 2008

5. 77 Steve Detwiler 2008

77 Erik Wetzel 2008

7. 71 Gavin Hedstrom 2008

8. 68 Joe Xavier 1984

68 Carlos Vega 1988

68 Tom Goodwin 1988

68 Steve Hosey 1988

68 Brandon Mitchell 1988

68 Jeff Mo� 1988

68 Steve Pearse 1988

68 Lance Shebelut 1988

68 Giuseppe Chiaramonte 1997

68 Derrick Levingston 1997

AVG. (MINIMUM 120 AB) 1. .440 Ron Johnson 1978

2. .430 Augie Garrido 1961

3. .422 Mark Hance 1973

4. .415 Brody Russell 2016

5. .408 Andrew Dyes 1973

6. .404 Sco� Buss 1984

7. .401 Lance Shebelut 1988

8. .397 Terry Pendleton 1982

9. .388 Steve Vondran 1989

10. .387 Garre� Weber 2010

AT-BATS 1. 323 Tom Goodwin 1988

2. 311 Erik Wetzel 2008

3. 306 Eddie Zosky 1988

4. 302 Steve Susdorf 2008

5. 296 Joe Hosey 1988

6. 295 Tom Mendonca 2008

295 Tom Goodwin 1989

8. 291 Steve Pearse 1988

9. 279 Lance Shebelut 1988

10. 288 Alan Ahmady 2008

288 Danny Muno 2008

RUNS 1. 99 Erik Wetzel 2008

2. 97 Lance Shebelut 1988

3. 87 Tom Goodwin 1988

4. 85 Brandon Mitchell 1988


6. 78 Steve Hosey 1988

7. 74 Danny Muno 2009

8. 72 Giuseppe Chiaramonte 1997

9. 71 Jim Flores 1981

10. 68 Sco� Buss 1984

68 Tom Goodwin 1989

68 Danny Muno 2010

HITS 1. 112 Erik Wetzel 2008

112 Tom Goodwin 1988


4. 111 Steve Pearse 1988




104 Steven Susdorf 2008


10. 99 Sco� Buss 1984

DOUBLES 1. 33 Steve Susdorf 2008

2. 28 Derek Feramisco 1997

27 Richie Robne� 2004




24 Derrick Levingston 1997

24 Anthony Acevedo 1999


23 Joe Xavier 1985

TRIPLES 1. 10 Bob Groth 1970

10 Eric Fox 1983

3. 9 Brant Brown 1992

4. 8 Walt Napier 1956

8 Tom Goodwin 1989

6. 7 Bob Donkersley 1952

7 Eric Fox 1985

8. Many with 6

HOME RUNS 1. 32 Lance Shebelut 1988


27 Jordan Ribera 2010

4. 26 Giuseppe Chiaramonte 1997

5. 22 Beau Mills 2005

6. 20 Jim Rothford 1978

7. 19 Randy Asadoor 1983

19 Tom Mendonca 2008

9. 17 Pete Dalena 1982

10. 16 Dusty Robinson 2011

16 Dusty Robinson 2010

16 Dusty Robinson 2009

16 Simon Tafoya 1998

16 Mike Burton 1988

16 Steve Vondran 1988

RBI 1. 94 Lance Shebelut 1988






7. 72 Pete Dalena 1982

72 Giuseppe Chiaramonte 1997


10. 69 Bobby Coyle 2010

69 Jordan Ribera 2010

STOLEN BASES 1. 62 Tom Goodwin 1989



4. 38 Ryan Wood 1994

5. 37 Mike Noel 1991

6. 36 Fibber Hirayama 1951

7. 33 Ryan Wood 1995

8. 32 Fibber Hirayama 1952

9. 31 Eric Fox 1983

10. 27 Vernon Spearman 1991

WALKS 1. 64 Danny Muno 2009

2. 56 Ray Reyes 1978



54 Mike Noel 1991

6. 53 Jim Flores 1981

7. 52 Greg Funk 1982



50 Mike Burton 1989



TOP 10 SINGLE SEASON PITCHING LEADERSWINS 1. 18 John Hoover 1984

2. 16 Larry Gonsalves 1967

16 Bobby Jones 1991

16 Mark Gardner 1985

5. 15 John Salles 1988

15 Rich Crane 1988

7. 14 Randy Graham 1982

14 Erik Schullstrom 1988

9. 13 Dick Ruthven 1971

13 Mike Salazar 1993

13 Eddie Romero 2006

SAVES 1. 13 Brandon Burke 2008

2. 12 Charlie Robertson 2011

12 Charlie Robertson 2010

4. 11 Bobby Jones 1989

5. 10 Shorty Farfan 1995

6. 9 Hans Smith 2000

7. 8 Tim Borst 2016

8 Bob Jacobsen 1984

9. 7 Hans Smith 1999

7 Ben Fritz 2001

7 Bryan Wolfenbarger 2003

10. 6 Dylan Lee 2016

6 Jake Shull 2015

6 Jason Breckley 2007

ERA (40-99 IP) 1. 1.13 Dennis Pila! 1966

2. 1.19 Moun! e Bedford 1958

3. 1.21 Frank Warren 1958

4. 1.37 Truman Clevenger 1953

5. 1.51 Dick Ruthven 1970

6. 1.54 Brad Kelley 1974

7. 1.58 Garre" Mundell 2014

8. 1.72 Tim Borst 2016

9. 1.74 Ray Strable 1969

10. 1.85 Virgil DeGeorge 1962

ERA (100+ IP) 1. 1.50 Dick Ruthven 1971

2. 1.53 Dick Ruthven 1972

3. 1.59 Larry Gonsalves 1967

4. 1.76 Darrell Gambero 1970

5. 1.79 Greg Gonzalez 2011

6. 1.88 Bobby Jones 1991

7. 2.09 John Hoover 1984

8. 2.16 Ricky Tyler Thomas 2016

9. 2.29 Dave Rohm 1977

10. 2.40 Erik Schullstrom 1988

COMPLETE GAMES 1. 19 John Hoover* 1984


3. 15 Mark Gardner 1985

15 John Salles 1988

5. 14 Larry Gonsalves 1967

6. 13 Rob Emerson 1983

7. 12 Tom Minor 1994

12 Rich Bordi 1979

12 Randy Graham 1982

12 Jeff Weaver 1996

STRIKEOUTS 1. 205 John Hoover 1984


3. 181 Jeff Weaver 1997


171 Steve Wolf 1990





INNINGS PITCHED 1. 177.1 John Salles 1988

2. 176.2 John Hoover 1984

3. 172.0 Bobby Jones 1991

4. 168.1 Mark Gardner 1985

5. 160.2 Rich Crane 1988

6. 155.1 Tommy Minor 1994

7. 154.0 Steve Wolf 1990

8. 152.2 Rob Emerson 1983

9. 149.1 Rich Crane 1989

10. 148.0 Jon Reelhorn 1979

BATTERS FACED 1. 677 John Salles 1988

2. 655 Mike Salazar 1993

3. 652 John Hoover 1984

4. 641 Tommy Minor 1994


6. 623 Rich Crane 1988


8. 593 Steve Wolf 1990


10. 574 Rich Crane 1989

HITS ALLOWED 1. 168 John Salles 1988

2. 159 Mike Salazar 1993

3. 156 Steve Wolf 1990

4. 155 Rich Crane 1988

155 Kevin Gunther 1995


7. 149 Tom Graham 1999

8. 148 Tom Minor 1994

148 Jared Fernandez 1994


147 Bob Runyon 2002

*Indicates NCAA Record



YEARLY STATISTICS LEADERSBATTING AVERAGE

Year Player Avg.

2016 Russell .415

2015 Tempel .362

2014 Luplow .377

2013 Judge .369

2012 Garrison .333

2011 Judge .381

2010 Weber .387

2009 Muno .379

2008 Ahmady .382

2007 Wetzel .346

2006 Mills .355

2005 Moresi .352

2004 Robne� .384

2003 Beshears .351

2002 McGehee .367

2001 Labandeira .367

2000 Gemoll .367

1999 Acevedo .383

1998 da Luz .355

1997 Fermaisco .344

1996 Fermaisco .344

1995 Jo.Freitas .340

1994 Wood .320

1993 Thrasher .364

1992 Brown .355

1991 Wood .343

1990 Johnson .367

1989 Vondran .388

1988 Shebelut .401

1987 Bates .373

1986 Bates .368

1985 Cain .357

1984 Buss .404

1983 Fox .363

1982 Pendleton .397

1981 Dalena .371

1980 Bagley .349

1979 Garcia .306

1978 Johnson .440

1977 Johnson .333

1976 Garcia .369

1975 Dinges .287

1974 Moore .324

1973 Hance .422

1972 Prieto .340

1971 Jones .325

1970 Groth .302

1969 Harrington .333

1968 Robison .338

1967 Peracchi .365

1966 Peracchi .364

1965 Miyamoto .321

1964 Mastagni .375

1963 Hashimoto .344

1962 Banderas .398

1961 Garrido .430

1960 Paull .346

1959 Garrido .336

1958 Cameron .388

1957 White .342

1956 McMahon .372

1955 Zivanich .346

1954 Petersen .357

1953 Petersen .376

1952 Bartels .340

1951 George .333

HOME RUNSYear Player No.

2016 Arruda 11

2015 Ward 7

Viers 7

2014 Luplow 9

2013 Judge 12

2012 Hutcheson 5

2011 Robinson 16

2010 Ribera 27

2009 Mendonca 27

2008 Mendonca 19

2007 Susdorf 12

2006 Mills 14

Susdorf 14

2005 Mills 22

2004 Robne� 13

2003 Beshears 9

2002 Fritz 10

2001 Labandeira 15

2000 Acevedo 9

1999 Prieto 7

1998 Tafoya 16

1997 Chiaramonte 26

1996 Feramisco 15

1995 Chiaramonte 11

1994 Judice 9

1993 Dandridge 14

1992 Brown 10

1991 Falco 11

1990 Borgese 10

1989 Burton 12

1988 Shebelut 32

1987 Shebelut 7

1986 Stark 10

1985 Bafi a 11

1984 Soares 9

Cantelmo 9

1983 Asadoor 19

1982 Dalena 17

1981 Dalena 15

1980 Westmoreland 10

1979 Gladden 11

1978 Rothford 20

1977 Johnson 10

1976 Frazer 5

1975 Prieto 5

1974 Burton 5

1973 LaBare 6

1972 Wolfe 12

1971 Wolfe 6

1970 Harrington 5

1969 Harrington 5

1968 Brown 9

1967 Peracchi 7

Perruchon 7

1966 Pollard 5

1965 Pierini 3

1964 Mastagni 1

1963 Hashimoto 3

Williams 3

Wolfsberger 3

Jacobsen 3

1962 Dollar 3

Bledsoe 3

Schiller 3

1961 Schiller 11

1960 Busch 3

Murphy 3

1959 Fischer 5

1958 Murphy 3

1957 Tsuhako 2

HOME RUNS (cont.)Year Player Avg.

1957 Lester 2

Levaggi 2

1956 Napier 3

Read 3

1955 Benne� 2

1954 Phair 3

1953 Tucker 7

1952 Donkersley 6

1951 Bartels 4

RBI Year Player No.

2016 Arruda 44

2015 Ward 42

2014 Luplow 48

2013 Judge 36

2012 Wise 40

2011 Robinson 55

2010 Ribera 69

Coyle 69

2009 Mendonca 78

2008 Ahmady 92

2007 Susdorf 68

2006 Mills 58

Vi� ers 58

2005 Mills 63

2004 Robne� 51

2003 Beshears 38

2002 Fritz 54

2001 Labandeira 68

2000 Acevedo 56

1999 Acevedo 61

1998 Hannah 51

1997 Chiaramonte 72

1996 Feramisco 60

1995 Chiaramonte 55

1994 Renteria 45

1993 Dandridge 59

1992 Brown 52

1991 Wood 56

1990 Johnson 56

1989 Vondran 67

1988 Shebelut 94

1987 Bates 55

1986 Bates 42

Stark 42

1985 Xavier 56

1984 Buss 54

1983 Asadoor 68

1982 Dalena 72

1981 Dalena 64

1980 Bagley 41

1979 Gladden 53

1978 Rothford 67

1977 Johnson 42

1976 Garcia 35

1975 Prieto 27

1974 Burton 37

1973 Hance 46

1972 Wolfe 31

1971 Wolfe 35

1970 Groth 32

1969 Mello 23

1968 Brown 33

1967 Suckut 31

1966 Pollard 25

1965 Mastagni 19

Schanze 19

1964 Williams 22

1963 Bledsoe 26

1962 Schiller 26

1961 Garrido 37

1960 Paull 29

1959 White 32

1958 Mar" n 31

1957 Lester 21

1956 Read 33

1955 Benne� 21

1954 Petersen 27

1953 Tucker 34

1952 Donkersley 41

1951 George 45



YEARLY STATISTICS LEADERSWINS

Year Player No.

2016 Lambert 10

2015 Shull 5

2014 Brink 5

2013 Brink 4

Velazquez 4

2012 Harlan 7

Harley 7

2011 Gonzalez 11

2010 Gonzalez 8

2009 Sprague 7

2008 Wilson 9

2007 Allison 10

2006 Romero 13

2005 Fister 7

2004 Garza 6

2003 Smith 8

2002 Runyon 10

2001 Runyon 10

2000 Smith 8

1999 Graham 8

1998 Weaver 10

1997 Weaver 11

1996 Weaver 12

1995 Gunther 12

1994 Minor 11

Fernandez 11

1993 Salazar 13

1992 Pa� erson 12

1991 Jones 16

1990 Grewal 10

1989 Crane 12

1988 Salles 15

Crane 15

1987 Salles 10

1986 Goff 11

1985 Gardner 16

1984 Hoover 18

1983 Emerson 12

1982 Graham 14

1981 Hoover 12

1980 Herron 12

1979 Bordi 12

1978 Lohuis 11

1977 Rohm 9

1976 Rohm 8

1975 Starling 8

1974 Grimm 10

1973 Duncan 8

Grimm 8

1972 Ruthven 10

1971 Ruthven 13

1970 Gambero 9

1969 Harkness 5

1968 Noonan 7

1967 Gonsalves 16

1966 Stephen 9

1965 Pierini 6

1964 Shaves 7

1963 Hite 8

Hoover 8

1962 Hoover 5

DeGeorge 5

1961 Graves 10

1960 Vegely 6

1959 Gregory 12

1958 Warren 6

1957 Doig 9

1956 Doig 10

WINS (cont.)Year Player No.

1955 Hannah 7

1954 Doig 5

1953 Clevenger 10

1952 Bolger 11

1951 Barne� 11

EARNED RUN AVGYear Player ERA

(min. 1 IP per team game)

2016 Thomas 2.16

2015 Shull 1.90

2014 Brink 2.87

2013 Brink 3.92

2012 Harlan 2.78

2011 S! glich 1.79

(sorted by top ERA at the end of season)

2010 Bonesteele 3.58

2009 Sprague 4.20

2008 Scheppers 2.93

2007 Hower 3.05

2006 Underwood 3.40

2005 Garza 3.07

2004 Garza 4.90

2003 Smith 4.26

2002 Fritz 3.24

2001 Moran 3.09

2000 Smith 2.56

1999 Smith 4.48

1998 Weaver 2.98

1997 Rowe 3.57

1996 Weaver 2.51

1995 Donnelly 2.98

1994 Behn 2.87

1993 Fernandez 3.54

1992 Soderstrom 3.07

1991 Jones 1.88

1990 Grewal 3.08

1989 Jones 2.15

1988 Schullstrom 2.40

1987 Salles 3.98

1986 Goff 3.38

1985 Crew 2.86

1984 Hoover 2.09

1983 Emerson 2.77

1982 Jacobsen 2.77

1981 Hoover 2.90

1980 Gladden 2.49

1979 Herron 2.43

1978 Stoddard 3.42

1977 Abney 1.38

1976 Rohm 2.69

1975 Miller 2.25

1974 Kelley 1.54

1973 Brusstar 2.44

1972 Ruthven 1.53

1971 Ruthven 1.50

1970 Ruthven 1.51

1969 Strable 1.74

1968 Noonan 2.41

1967 Gonsalves 1.59

1966 Pila! 1.13

1965 Modrell 1.94

1964 Doyle 1.35

1963 Hite 2.12

1962 DeGeorge 1.84

1961 Graves 2.44

1960 Casey 2.83

1959 N/A

1958 Bedford 1.19

1957 Doig 2.21

1956 Doig 2.54

1955 Hannah 1.91

1954 Doig 2.88

1953 Clevenger 1.37

1952 Bolger 2.25

1951 Abbo� 2.21

STRIKEOUTSYear Player No.

2016 Thomas 108

2015 Mundell 53

2014 Borst 65

2013 Brink 65

2012 Haley 94

2011 Gonzalez 124

2010 Gonzalez 73

2009 Sprague 67

2008 Scheppers 109

2007 Wilson 105

2006 Underwood 110

2005 Garza 120

2004 Garza 77

2003 Wol" arger 54 Smith 542002 Runyon 1192001 Runyon 932000 Graham 761999 Graham 1021998 Weaver 1561997 Weaver 1811996 Weaver 1361995 Behn 1161994 Minor 1051993 Salazar 1311992 Pa� erson 122

1991 Jones 166

1990 Wolf 171

1989 Crane 128

1988 Salles 152

1987 Salles 113

1986 Goff 98

1985 Gardner 187

1984 Hoover 205

1983 Emerson 116

1982 Graham 82

1981 Herron 79

1980 Bordi 107

1979 Reelhorn 116

1978 Lohuis 118

1977 Collins 74

1976 Rohm 54

1975 Starling 86

1974 Grimm 95

1973 Grimm 96

1972 Ruthven 153

1971 Ruthven 171

1970 Gambero 97

1969 Strable 56

1968 Noonan 62

1967 Gonsalves 104

1966 Stephen 128

1965 Pierini 93

1964 Sinno� 74

1963 Hite 130

1962 Hite 53

1961 Graves 83

1960 Vegely 51

1959 N/A --

1958 Warren 63

1957 Millhorn 75

1956 Doig 93

1955 Hannah 62

1954 Wills 76

1953 Clevenger 158

1952 Bolger 84

1951 Barne� 140



BULLDOGS IN THE NCAA RECORD BOOK

INDIVIDUAL RECORDS

BATTING - SINGLE GAME

Category Player No. Date Opponent Rank

At-Bats Brennan Gowens 11 3/26/11 San Diego 1st

BATTING - SINGLE SEASON

Category Player No. Date Rank

Strikeouts Tom Mendonca 99 2008 1st

Doubles Steve Susdorf 33 2008 T-9th

Home Runs Lance Shebelut 32 1988 T-13th

PITCHING - SINGLE SEASON


Games Started John Salles 23 1988 T-2nd

Complete Games John Hoover 19 1984 1st

Complete Games Bobby Jones 18 1991 2nd

Innings Pitched John Salles 177.1 1988 3rd

Innings Pitched John Hoover 176.2 1984 4th

Innings Pitched Bobby Jones 172.0 1991 8th

Strikeouts John Hoover 205 1984 10th

BATTING - CAREER


Stolen Bases Tom Goodwin 164 1987-89 T-9th

PITCHING - CAREER


Games Started John Hoover 64 1981-84 T-15th

Complete Games John Hoover 42 1981-84 1st

Innings John Hoover 494.0 1981-84 4th

FIELDING - CAREER


Putouts Todd Johnson 1,648 1990-93 20th

Assists Ben Reynoso 783 1993-96 2nd

OTHER

Category Player Games Length Rank

Hi! ng Streak Josh Hannah 38 2/26-5/25/97 T-13th

Perfect Game Larry Gonsalves vs. Cal Poly 1967 **

** 24 perfect games have been recorded by an NCAA D1 player

since 1957, Gonsalves is one of 24.

END OF SEASON INDIVIDUAL

NCAA CHAMPIONS

ANNUAL INDIVIDUAL CHAMPIONS

Category Player No. Date

Hits Tom Goodwin 112 1988

Lance Shebelut 112 1988

Runs Erik Wetzel 99 2008

Doubles Steve Susdorf 33 2008

Triples Bob Groth 10 1970

Eric Fox 10 1983

Home Runs Jordan Ribera 27 2010

Total Bases Lance Shebelut 226 1988

Stolen Bases Tom Goodwin 62 1988

Tom Goodwin 61 1989

Strikeouts Dick Ruthven 171 1971

John Hoover 205 1984

Steve Wolf 171 1990

Bobby Jones 166 1991

Jeff Weaver 181 1997

Wins Leroy Gregory 12 1959

John Hoover 18 1984



SINGLE-GAME TEAM RECORDS

BATTING - HITS

Team/Opponent No. Date Rank

Fresno State (vs. New Mexico) 36 4/1/1999 T-5th

BATTING - HITS, BOTH TEAMS


Fresno State (36), New Mexico (32) 68 4/1/1999 1st

Fresno State (32), Nevada (21) 53 4/25/1982 5th

BATTING - CONSECUTIVE HITS


Fresno State (vs. Cal Poly - 1st inn.) 9 4/15/1995 T-3rd

BATTING - AT-BATS


Fresno State (vs. San Diego) 81 3/26/2011 T-2nd

BATTING - AT-BATS, BOTH TEAMS


Fresno State (81) vs. San Diego (81) 186 3/26/2011 2nd

BATTING - PLATE APPEARANCES


Fresno State (vs. San Diego) 93 3/26/11 T-2nd

BATTING - PLATE APPEARANCES, BOTH TEAMS


Fresno State (93) vs. San Diego (93) 186 3/26/2011 2nd

BATTING - DOUBLES, BOTH TEAMS


New Mexico (8), Fresno State (6) 14 4/1/1999 T-6th

BATTING - HOME RUNS, BOTH TEAMS


Cal State Northridge (13) 14 3/2/1996 T-7th

Fresno State (1)

BATTING - RUNS, LOSING TEAM


Fresno State (vs. New Mexico) 26 4/1/1999 T-2nd

FIELDING - TOTAL CHANCES


Fresno State (vs. San Diego) 101 3/26/2011 T-3rd

FIELDING - TOTAL CHANCES, BOTH TEAMS


Fresno State (vs. San Diego) 187 3/26/2011 T-4th

FIELDING - PUTOUTS


Fresno State (vs. San Diego) 66 3/26/2011 T-3rd

FIELDING - ASSISTS


Fresno State (vs. San Diego) 33 3/26/11 T-4th

FIELDING - ASSISTS, BOTH TEAMS


Fresno State (vs. San Diego) 51 3/26/11 10th

PITCHING - STRIKEOUTS


Fresno State (vs. Louisiana Tech) 23 5/2/2003 T-7th

MISCELLANEOUS

Category No. Date Rank

Longest Game, Innings 22 3/26/2011 vs. SD T-3rd

Longest Winning Streak 32 3/9/88-5/3/88 T-4th

END OF SEASON ANNUAL NCAA TEAM CHAMPIONS

Ba! ng Average .350 1988

Total Bases 1,492 1988

Double Plays 76 2008

BULLDOGS IN THE NCAA RECORD BOOK



AMERICAN BASEBALL COACHES ASSOCIATION Year Player Team

1951 Don Barne� , P 1st

1967 Larry Gonsalves, P 1st

1972 Dick Ruthven, P 1st

1978 Ron Johnson, 1B 1st

1981 Pete Dalena, DH 3rd

1982 Randy Graham, P 1st

Terry Pendleton, OF 3rd

1983 Eric Fox, OF 2nd

1984 John Hoover, P 1st

Sco� Buss, OF 3rd

1985 Mark Gardner, P 2nd

1988 Tom Goodwin, OF 1st

John Salles, P 1st

Lance Shebelut, 1B 1st

Steve Pearse, 2B 3rd


Eddie Zosky, SS 1st

1991 Bobby Jones, P 1st

Jason Wood, SS 3rd

1992 Brant Brown, 1B 2nd

1996 Jeff Weaver, P 3rd

1997 Giuseppe Chiaramonte, C 1st

1998 Jeff Weaver, P 2nd

2004 Richie Robne� , OF 2nd

2009 Tom Mendonca, 3B 3rd

2010 Jordan Ribera, 1B 2nd

2011 Dusty Robinson, OF 3rd

2013 Aaron Judge, OF 3rd

2014 Jordan Luplow, OF 2nd

COLLEGIATE BASEBALL NEWSPAPER

Year Player Team


Eddie Zosky, SS 1st



1998 Jeff Weaver, P 1st

2001 Josh Labandeira, SS 3rd

2002 Ben Fritz, P 2nd


2008 Tanner Scheppers, P 3rd

Steve Susdorf, OF 2nd

2009 Tom Mendonca, 3B 2nd


2011 Greg Gonzalez, P 1st

Dusty Robinson, OF 3rd

2014 Jordan Luplow, OF 3rd

BASEBALL AMERICA MAGAZINE Year Player Team

1981 John Hoover, P HM

1982 Randy Graham, P 1st

Terry Pendleton, OF 3rd

1984 John Hoover, P 1st

1985 Mark Gardner, P 2nd


Lance Shebelut, 1B 1st

John Salles, P 2nd

Rich Crane, P 3rd

Steve Hosey, OF 3rd


Eddie Zosky, SS 1st

Rich Crane, P 2nd




Giuseppe Chiaramonte, C 2nd


2002 Ben Fritz, P 2nd


2009 Tom Mendonca, 3B 3rd

2011 Greg Gonzalez, P 2nd

Dusty Robinson, OF 3rd


NATIONAL COLLEGIATE BASEBALL WRITERS ASSOCIATION

Year Player Team

1993 Todd Johnson, C 2nd

1994 Tommy Minor, P 3rd



Giuseppe Chiaramonte, C 1st


1999 Anthony Acevedo, OF HM

2000 Hans Smith, P 2nd

2008 Steve Susdorf, OF 3rd

2009 Tom Mendonca, 3B 1st



2013 Aaron Judge, OF 3rd

THE SPORTING NEWS Year Player Team

1972 Dick Ruthven, P 1st


Eddie Zosky, SS 1st

COLLEGIATE BASEBALL INSIDER Year Player Team


Dusty Robinson, OF HM

PERFECT GAME Year Player Team


FRESHMAN ALL-AMERICAN -BASEBALL AMERICA MAGAZINE

Year Player Team

1986 John Salles, P 2nd

1987 Tom Goodwin, OF 2nd

1988 Erik Schullstrom, P 1st


1990 Todd Johnson, C 1st


1997 Casey Rowe, P 1st

2001 Casey McGehee, OF HM

2005 Beau Mills, 3B 1st

2009 Dusty Robinson, OF 2nd

FRESHMAN ALL-AMERICAN -COLLEGIATE BASEBALL NEWSPAPERYear Player Team




1997 Casey Rowe, P 1st

1999 Tom Creighton, 2B HM

2000 Mike Hernandez, P HM

2004 Nick Moresi, OF 1st

Chrisian Vi� ers, 3B 1st

2005 Beau Mills, 3B 1st

2006 Erik Wetzel, 2B 1st

2011 Aaron Judge, OF 1st

2013 Blake Quinn, RHP 1st

ALL-AMERICAN SELECTIONS



NCAA COACH OF THE YEAR (Selected by The Spor� ng News)

1988 Bob Benne�

NATIONAL COLLEGIATE BASEBALL WRITERS ASSOCIATION COACH OF THE YEAR

2008 Mike Batesole

COLLEGIATE BASEBALL MAGAZINE COACH OF THE YEAR 2008 Mike Batesole

NCAA PLAYER OF THE YEAR (Selected by Collegiate Baseball)

1991 Bobby Jones, P

NCAA PITCHER OF THE YEAR (Selected by Baseball America)

1984 John Hoover, P

NATIONAL COLLEGEIATE BASEBALL WRITERS ASSOCIATION PLAYER OF THE WEEK March 30, 2008 Alan Ahmady

April 13, 2010 Greg Gonzalez

COLLEGEBASEBALL360.COMNATIONAL PLAYER OF THE WEEK Feb. 24, 2010 Jordan Ribera

LOUISVILLE SLUGGER NATIONAL PLAYER OF THE WEEK April 13, 2010 Greg Gonzalez

Feb. 24, 2010 Dusty Robinson

Feb. 24, 2010 Tyler Linehan

GOLDEN SPIKES AWARD FINALISTS 1984 John Hoover, P

1989 Tom Goodwin, OF

1991 Bobby Jones, P

GREG OLSON AWARD FINALIST 2014 Jordan Luplow, OF

ACADEMIC ALL-AMERICAN OF THE YEAR (Selected by CoSIDA)

1994 Tommy Minor, P

ACADEMIC ALL-AMERICAN (Selected by CoSIDA)

1984 Jim Davis, C, HM

1992 Philip Romero, 2B, 3rd

1993 Tommy Minor, IF/P, 1st

1994 Tommy Minor, P, 1st

1998 Joe Gerber, OF, 2nd

2008 Steve Susdorf, OF, 2nd

ALL-WEST REGION (First-Team Selec� ons)

1951 Don Barne� , P

1952 Franny Oneto, 2B

1959 Leroy Gregory, P

Augie Garrido, OF

1962 Terry Banderas, OF

1967 Larry Gonsalves, P

Don Peracchi, 1B

1972 Dick Ruthven, P

Larry Prieto, 2B

1978 Ron Johnson, 1B

Jim Rothford, C

1979 Brad Benne� , OF


Rich Bordi, P

1981 Pete Dalena, DH

John Hoover, P

1982 Randy Graham, P

Terry Pendleton, OF

Greg Funk, 2B

Tim Thiessen, SS

1983 Randy Asadoor, 3B

Rob Emerson, P

Eric Fox, OF

1984 John Hoover, P

Sco� Buss, OF

1985 Mark Gardner, P


Steve Pearse, 2B

John Salles, P

Lance Shebelut, 1B

Eddie Zosky, SS


Eddie Zosky, SS

1990 Bobby Jones, P

1991 Bobby Jones, P

Jason Wood, SS

1992 Brant Brown, 1B

1995 Kevin Gunther, P

1996 Jeff Weaver, P

1997 Jeff Weaver, P

Giuseppe Chiaramonte, C

1998 Jeff Weaver, P

2004 Richie Robne� , OF

2005 Beau Mills. 3B

Nick Moresi, OF

2011 Greg Gonzalez, P

2014 Jordan Luplow, OF

NATIONAL HONORS



ALL-CONFERENCE SELECTIONSALL-CCAA (First-Team Selec� ons)

1941 Stewart Bachetelle, P

Angelo Petropulos, P

Chester Steinhauer, 2B

Findley Upton, OF

1942 Jack Kelley, OF

Leonard Masini, UT

Chester Schmidt, P

1946 George Abo, P

Ollie Bidwell, OF

Marty Kreig, UT

Angelo Petropulos, 3B

Adolph Pierini, 3B

Mervin Salwasser, 1B

1947 Bill Hansen, 1B

Earl Smith, P

1948 Bill Hansen, 1B

1949 Galen Bowman, OF

1950 Don Abbo� , C

Don Barne� , P

Fibber Hirayama, UT

Art Shahzade, OF

1951 Fred Bartels, 1B

Don Barne� , P

Bob Donkersley, SS

Fibber Hirayama, OF

Franny Oneto, 2B

1952 Fibber Hirayama, OF

1953 Bob Benne� , C

Truman Clevenger, P

Fred Sommers, SS

Len Tucker, OF

Ted Willis, Jr., P

1954 Bob Benne� , C

Ted Willis, Jr., P

1955 Ted Ellis, P

Don Farris, P

Jack Hannah, P

Jim Knerr, 3B-SS

Tony Levaggi, OF

J.D. Petersen, UT

Roy Zivanich, OF

1956 Bob Doig, P

Ted Ellis, P

Jim Knerr, 3B-SS

Walt Napier, OF

Joe Pedrazzini, 1B

George Read, OF

1957 Bob Doig, P

Jim Kneer, SS

Joe Pedrazzini, 1B

1958 Mark Cameron, C

Dorman Mar� n, OF

Gary Modrell, P

1959 Leroy Gregory, P

Jim Lester, 3B

Mike Mathiesen, SS

Jerry White, 2B

1960 James Garre� , C

Augie Garrido, OF

Ed Vegely, P

1961 Bob Bonomini, 2B

Stan Busch, OF

Bert Dollar, C

Augie Garrido, OF

Gene Graves, P

Bob Paull, SS

Terry Tacke� , P

1962 Terry Banderas, OF

Bob Bonomini, 2B

Ron Schiller, 1B

1963 Frank Hashimoto, OF

Ed Hite, P

Jim Williams, SS

1964 Phil Mastagni, OF

Jim Williams, SS

1965 Rick Pierini, P

Katsu Shitanishi, 2B

1966 Wayne McGhee, C

Buz Stephens, P

1967 Larry Gonsalves, P

Buzz Nitschke, C

Don Peracchi, OF/INF

Tom Sharpe, P

Al Suckut, OF

1968 Jerry Robison, 2B

1969 Dave Schmidt, SS

ALL-PCAA (First-Team Selec� ons)

1970 Darrell Gambero, P

Bob Groth, OF

1971 Allen Jones, OF

Dick Ruthven, P

Sco� Wolfe, 2B

1972 Larry Prieto, 2B

Dick Ruthven, P

1973 Andrew Dyes, OF

Dan Grimm, P

Mark Hance, 3B

1974 Bob Felts, 2B

Dan Grimm, P

1976 Fernando Garcia, 1B

Ron Myers, OF

ALL-NBCA (First-Team Selec� ons)


Ron Mehlhoff , SS

Ron Myers, OF

Dave Rohm, P


Tim Painton, OF

Jim Rothford, DH


Rich Bordi, P

Jim Flores, SS

Frank Garcia, 3B

Dan Gladden, DH

Jon Reelhorn, P

1980 Kip Bagley, DH

Brad Benne� , OF

Rich Bordi, P

Tony Herron, P

Tom McCormick, 2B

Jon Reelhorn, P

John Westmoreland, C

1981 Ray O’Canto, OF

Kevin Coughlon, OF

Jim Flores, SS

Tim Thiessen, 3B

Pete Dalena, DH

John Hoover, P

1982 Pete Dalena, 1B

Greg Funk, 2B

Randy Graham, P

Terry Pendleton, OF

Tim Thiessen, SS

1983 Randy Asadoor, 3B

Vince Barger, P

Rob Emerson, P

Eric Fox, OF

Kurt Walker, P

1984 Vince Barger, P

Sco� Buss, OF

Tony Cantelmo, OF

Mark Gardner, P

John Hoover, P

Todd Soares, DH

Joe Xavier, SS



ALL-CONFERENCE SELECTIONSALL-BIG WESTYear Name Team

1985 Mike Gardner, P 1st

Ken Crew, P 1st

Robert Bafi a, 3B 2nd

Joe Xavier, SS 2nd

Cal Cain, OF 2nd

Mike Goff , P 2nd

1986 Mike Goff , P 1st

Steve Bates, OF 2nd

1987 Steve Bates, OF 1st

Eddie Zosky, 3B 2nd

Tom Goodwin, DH 2nd

Brandon Mitchell, OF 2nd

1988 Lance Shebelut, 1B 1st

Steve Pearse, 2B 1st

Eddie Zosky, SS 1st

Tom Goodwin, OF 1st

Steve Hose, OF 1st

Rich Crane, SP 1st

John Salles, SP 1st

Erik Schullstrom, SP 1st

Jeff Mo� , OF 2nd

1989 Rich Crane, P 1st

Tom Goodwin, OF 1st

Bobby Jones, P 1st

Eddie Zosky, SS 1st

Steve Vondran, C 2nd

Mike Burton, 1B 2nd

Erik Schullstrom, SP 2nd


Bobby Jones, P 1st

Steve Wolf, P 1st

1991 Todd Johnson, UT 1st

Bobby Jones, P 1st

Jason Wood, SS 1st

Phil Romero, 2B 2nd

Mike Noel, OF 2nd

1992 Brant Brown, 1B 1st

Todd Johnson, C 1st

Gary McNamara, OF 2nd

Jim Pa� erson, SP 2nd

Steve Soderstrom, SP 2nd

ALL-WACYear Name Team


Gary McNamara, OF 1st

Mike Salazar, P 1st

1994 Tommy Minor, P 1st

Jared Fernandez, P 1st

1995 Kevin Gunther, P 1st

Brendan Behn, P 1st

Ma� Cur! s, C 1st

Joe Freitas, OF 1st

1996 Derek Feramisco, OF 1st

Ben Reynoso, SS 1st

Jeff Weaver, P 1st


Jeff Weaver, P 1st

Derek Feramisco, OF 2nd


1999 Anthony Acevedo, OF 1st

2000 Anthony Acevedo, OF 1st

Nick Garcia, 3B 1st

Brandon Gemoll, 1B 1st

Hans Smith, P 1st

Mike Bowlin, OF 2nd

2001 Josh Labandeira, SS 1st

Brad Harper, C 1st

Brandon Gemoll, 1B 2nd

Oscar Lopez, 2B 2nd

Casey McGehee, OF 2nd

Bob Runyon, SP 2nd

2002 Ben Fritz, P/UT 1st

Casey McGehee, 3B 1st

Chris Patrick, SS 2nd

2003 Sco� Beshears, OF 1st

Chris Patrick, SS 1st

Ryan Haag, 2B 2nd

Casey McGehee, 3B 2nd

Cody Smith, SP 2nd

2004 David Gomez, DH 1st

Ryan Haag, 2B 1st

Richie Robne� , OF 1st

Chris! an Vi� ers, 3B 1st

Brandon Marcelli, C 2nd

Chris Patrick, SS 2nd

Nick Moresi, OF 2nd

Ma� Garza, SP 2nd

2005 Nick Moresi, OF 1st

Ma� Garza, P 1st

Beau Mills, 3B 1st

Rudy Quinonez, P 1st

Chase Moore, OF 2nd

2006 Doug Fister, SP 1st

Beau Mills, 3B 1st

Loren Storey, OF 1st

Steve Susdorf, DH 1st

Andy Underwood, P 1st

Chris! an Vi� ers, SS 1st

Erik Wetzel, 2B 1st

Kent Sakamoto, 1B 2nd

Brian Lapin, OF 2nd

Eddie Romero, SP 2nd

2007 Danny Grubb, C 1st

Tanner Scheppers, P 1st

Loren Story, OF 1st

Steve Susdorf, OF 1st

Erik Wetzel, 2B 1st

Jus! n Wilson, P 1st

Clayton Allison, SP 2nd

Brandon Burke, RP 2nd

2008 Steve Susdorf, OF 1st

Alan Ahmady, IF 1st

Erik Wetzel, IF 1st

Tanner Scheppers, P 1st

Brandon Burke, P 1st

2009 Tom Mendonca, 3B 1st

Danny Muno, 2B 1st

Dusty Robinson, OF 1st

Holden Sprague, RHP 1st

2010 Bobby Coyle, DH 1st

Greg Gonzalez, RHP 1st

Jordan Ribera, 1B 1st


Danny Muno, 2B 2nd

Garre� Weber, SS 2nd

Josh Poytress, SP 2nd

2011 Greg Gonzalez, SP 1st

Aaron Judge, OF 1st

Danny Muno, 3B 1st

Jordan Ribera, 1B 1st


Garre� Weber, SS 1st

Aus! n Wynns, C 1st

Brennan Gowens, OF 2nd

Josh Poytress, SP 2nd


Kenny Wise, OF/DH 1st

Trent Garrison, 1B 2nd

Patrick Hutcheson, 2B 2nd

Jake Alvarez, 3B 2nd

Jus! n Haley, RHP 2nd

Thomas Harlen, LHP 2nd

ALL-MOUNTAIN WESTYear Name Team


Chris Mariscal, IF 2nd

Blake Quinn, RHP 2nd

2014 Jordan Luplow, OF 1st

Taylor Ward, C 2nd

2015 Taylor Ward, C 1st

Taylor Tempel, OF 1st

Garre� Mundell, P 1st

Aus! n Guibor, OF 2nd

Jake Shull, P 2nd

2016 Jimmy Lambert, P 1st

Ricky Tyler Thomas, P 1st

Aaron Arruda, INF 1st

Brody Russell, OF 1st

Jake Stone, OF 2nd

Tim Borst, P 2nd

Rickey Ramirez, P 2nd

Sco� Silva, INF 2nd



TOP CONFERENCE HONORSP�� ! "#� Y��

1972 Dick Ruthven, P PCAA

1973 Mark Hance, 3B PCAA

1977 Ron Johnson, 1B NCBA

1978 Ron Johnson, 1B NCBA

1983 Randy Asadoor, 3B NCBA

1984 Sco� Buss, OF NCBA

1985 Mark Gardner, P Big West

1988 Lance Shebelut Big West

1989 Tom Goodwin, OF Big West

2001 Josh Labandeira, SS WAC

2004 Richie Robne� , OF WAC

2006 Chris� an Vi� ers, SS WAC

2008 Stephen Susdorf, OF WAC

2009 Tom Mendonca, 3B WAC

2010 Jordan Ribera, 1B WAC

2011 Dusty Robinson, OF WAC

2014 Jordan Luplow, OF MW

P$"%#�� ! "#� Y��

1979 Rich Bordi NCBA

1980 Rich Bordi NCBA

1983 Rob Emerson NCBA

1984 John Hoover NCBA

1991 Bobby Jones Big West

2002 Ben Fritz WAC

2005 Ma� Garza WAC

2008 Tanner Scheppers WAC

2011 Greg Gonzalez WAC

2016 Jimmy Lambert MW

R��&$� �! "#� Y��

1978 Brad Benne� , OF NCBA

1980 Greg Funk, SS NCBA

1981 John Hoover, P NCBA

1982 Joe Xavier, 3B NCBA

1995 Giuseppe Chiaramonte, DH/C WAC

1996 Jeff Weaver, P WAC

1999 Tom Creighton, 2B WAC

2005 Beau Mills, 3B WAC

2008 Danny Muno, SS WAC

2011 Aaron Judge, OF WAC

C��%# �! "#� Y��

1985 Bob Benne� Big West



2008 Mike Batesole WAC

2010 Mike Batesole WAC

2016 Mike Batesole MW

WAC M�� A"#��"� �! "#� Y��

(Joe Kearney Award)

2008 Steve Susdorf

2009 Tom Mendonca



A Abbo� , Don 1948-50

Abbo� , George 1948

Abbo� , Jake 1951

Abel, Dave 1955-56

Abney, Steve 1977

Abo, George 1946-49

Acevedo, Anthony 1999-00

Ahmady, Alan 2007-09

Ainley, Craig 1984-85

Allen, Dick 1963

Allen, Jody 1985-86

Allison, Clayton 2007-08

Altman, Jack 1956

Alvarez, Jake 2011-14

Amador, Blake 2008

AndeAndreoni, Ned 1968

Argomaniz, Manny 2014-15

Arias, Anthony 2015

Armenta, Frank 1958

Armstrong, Bob 1956

Arruda, Aaron 2015-16

Asadoor, Randy 1981-83

Ashford, Zach 2016

Ashworth, Edward 1965

Ashworth, Jule 1931

Atrat, Kyle 2002

Aukerman, Carlos 1997-98

Aus! n, Erwin 1939-40

B Bachtelle, Stewart 1940-41

Bacome, Leonard 1969

Bafi a, Bob 1983-85

Bagley, Kip 1979-80

Bair, David 2002-03

Bair, Donnie 2002-03

Baird, Bill 1950

Baker, Ken 1988-89

Baldwin, Gary 1966

Ball, Adolph 1948

Ball, Jacob 2004

Ballard, Tim 1980

Ballinger, John 1969

Banderas, Terry 1961-62

Bandy, Bob 1956

Barger, Vince 1982-84

Barnes, Larry 1995

Barne� , Don 1950-51

Barnhill, Douglas 1975-76

Barsom, Charles 1931

Bartels, Bill 1985-86

Bartels, Fred 1951-53

Bates, Steve 1985-87

Batesole, Korby 2015-16

Baxter 1923

Becht, Jason 1996

Becknell, George 1947

Beckstead, Jerry 1971

Bedford, Moun! e 1958-59

Bedrosian, Dave 1975

Beggs, Mike 1968-70

Behlen, Steven 1973-74

Behn, Brendan 1994-95

Bell, Jason 1998

Belli, Dewey 1963-65

Benne� , Brad 1978-80

Benne� , Bob 1952-55

Benne� , Todd 1980-83

Benny, Derek 2009-11

Bergazzi, Roy 1938-40

Bergman, Jack 1971-72

Beshears, Sco� 2000-03

Best, F. 1922

Biama, Richard 1949

Bidwell, Oliver 1940-47

Biggers, Dave 1960

Birkle, Don 1957

Bischoff , Zac 2009

Bishop, Jerry 1951-52

Blaver, Rich 1972

Blechman, Sco� 1986-87

Bledsoe, Stan 1962-63

Boe� ger, Roger 1967

Bolger, Larry 1951-52

Bonesteele, Sean 2007-10

Boney, Bob 1947-52

Bonifazio, Anthony 1991-92

Bonne� , Bruce 1976-77

Bonomini, Bob 1961-62

Bordi, Rich 1978-80

Borgese, Jeff 1990

Borges, James 1994-95

Borst, Tim 2013-16

Bosco, Steve 1990

Bourdet, Len 1948-50

Bowlin, Michael 1999-00

Bowman, Galen 1948-50

Boyd, T.J. 2002

Brauning, Jay 1995-96

Breckley, Jason 2005-08

Brewer, Dennis 1999

Bricker, Don 1951

Bridge, Eric 1988

Brink, Jordan 2012-14

Brodeur, J. 1922-23

Brosnan, Jason 1989

Brown, Bill 1967-68

Brown, Brant 1991-92

Brown, Chad 1994-96

Brown, Clarence 1950

Brown, Kelly 1980

Brown, Zip 1951-52

Brumfi eld, Harvey 1986

Brusstar, Warren 1973-74

Buck, Terry 1969-70

Buckholz, Steve 1987-88

Buckner, Pat 1976-77

Burke, Brandon 2005-08

Burns, L. 1922

Burns, Mike 1948

Burton, Dean 1973-74

Burton, Mike 1988-89

Busch, Stan 1959-61

Buss, Sco� 1983-84

Bustamante, Eddie 1988

C Cain, Cal 1982-85

Cameron, Mark 1957-58

Cano, Al 1949

Cantelmo, Tony 1983-84

Cardwell, Don 1938

Carpenter, Monte 1938

Carter, Mervyn 1958-60

Carter, Suge 1943-49

Casey, Harvey 1958-60

Castro, Pat 1957

Ca� aneo, Chad 1994

Caufaude, Les 1974-75

Cederquist, Clay 2010

Cervantes, Sal 1977

Champlin, Kelly 1990-91

Charles, Jus! n 2010-12

Chiaramonte, Giuseppe 1995-97

Claussen, Kim 1970

Clements, Marc 1942

Clevenger, Bill 1952-54

Clevenger, Truman 1951-53

Collins, Steve 1977

Combs, Mark 1983-84

Cooper, Michael 2004-05

Coppock, Ed 1974

Coronado, Gary 1961

Cos! c, Tim 1990-92

Coughlon, Kevin 1980-81

Cowan, William 1931

Coyle, Bobby 2010

Crane 1923

Crane, Rich 1987-89

Crawford, R. 1922-23

Creamer, Casey 2001-02

Creighton, Ma� 2000

Creighton, Tom 1999-00

Crets, Gary 1962-63

Crew, Ken 1985

Crissman, Vern 1964

Cropsey, Allen 1950

Crough, Garret 1984-85

Cruess, Robert 1977-79

Cruise, Mark 1992-93

Cuadros, Al 1975

Cuellar, Jus! n 1998

Cudd, Don 1960

Cuellar, Jus! n 2000

Cunningham, Ken 1973-74

Curlee, Don 1949-50

Cur! s, Ma� 1993-96

D Dalena, Pete 1981-82

Dallas, Bob 1973

da Luz, Craig 1995-98

Dandridge, Brad 1993

Daniels, Melvin 1931

Daniels, Pete 1942

Danielson, Glenn 1943

DaSilva, John 1992

David, Sco� 2011

Davis, Bret 1985

Davis, Devlon 1998

Davis, Jim 1983-85

Davis, Rod 1982

Davis, Tory 2003

DeCanio, Jason 1997

DeGeorge, Virgil 1962-63

Dela Torre, George 1954

Della, Dan 1942

Detwiler, Steve 2007-10

DeVaurs, Duane 1939

Dibble, Tom 1964

DiBuduo, Moe 1970

DiGrazia, Williams 1968-69

DiFrancia, Ed 1970-71

Dinges, Bob 1975

Ryan Dobson 2014-16

Doepker, Dick 1959

Doig, Bob 1954-57

Dollar, Bert 1960-62

Donatoni, John 1967

Donkersley, Bob 1951-52

Donnelly, Robert 1995

Doyle, Pat 1966

Drake, Max 1999-00

Duckhorn, Jim 1971-72

Due, Floyd 1931

Duke, Dan 1998-99

Duncan, Brad 1972

Durmanich, J.J. 2000

Dvorak, Greg 1968-69

Dyes, Andrew 1973-74

Dyt, Darren 1997

E Edmonds, Michael 1974

Edwards, Chad 2002-03, 05

Edwards, Evin 1986-87

Egelhofer, Ray 1938-40

Elcano, Jason 1980

Elf, Doug 1972-74

Ellis, Ted 1955-56

Elorduy, Mike 1963

ALL-TIME LETTERWINNERS



Emerson, Rob 1982-83

Enard, Tony 1993-95

Escat, Gene 2009-10, 2012

Esparza, Brandon 2002, ‘04

Evans, Mike 1981

Evert, Kevin 1986

F Fagundes, Manuel 1963

Falco, Chris 1989-91

Fanconi, Jason 1998-99

Farfan, David “Shorty” 1995

Farrar, Bill 1949

Farren 1923

Farria, J. 1922

Farris, Don 1953-55

Farsakian, Sam 1949-50

Fellows, Jackie 1943

Felts, Bob 1974-75

Feramisco, Derek 1995-97

Fernandez, Jared 1993-94

Filson 1923

Findley, Bill 1954-57

Fisher, Gary 1954

Fisher, Jim 1994-95

Fisher, Joe 1959-61

Fister, Doug 2005-06

Fitzmaurice, Kevin 1996-97

Fjelstad, Kyle 1993-94

Floethe, Jake 2008

Flores, Jim 1979-81

Flynn, Ed 1941-43

Fox, Eric 1982-85

Fragus, Neal 1971-72

Frazer, Sco! 1976-77

Frazier, Terance 1988-89,92

Freitas, Jeremy 1995

Freitas, Joseph 1994-95

French, Jon 1988

French, William 1938-39

Frey, Darwin 1965

Fritz, Ben 2000-02

Fry, Gary 1985

Funk, Greg 1980-83

Frye, Lane 1959

G Gagnier, Drew 2007

Gagnon, Jim 1987

Gaitan, Joe 1956

Galloway, Ken 1983-84

Gambero, Darrell 1970

Garcia, Bob 1971

Garcia, Eric 1997

Garcia, Fernando 1975-76

Garcia, Frank 1978-79

Garcia, Nick 1998-00

Garcia, Rudy 1953-54

Gardner, Mark 1984-85

Garfoot, Phil 1957

Garner, Lance 1976-77

Garre! , Jim 1958-60

Garrido, Augie 1959-61

Garrison, Mike 1961

Garrison, Taylor 2010-12

Garrison, Trent 2009-10, 12-13

Garver, Dick 1942

Garza, Ma! 2003-05

Garzoni, Mike 1943

Gaspar, Kahou 2010-11

Gaul, Mike 1966

Gavello, Bill 1970

Geels, Rob 1981-82

Gemoll, Brandon 1999-00

George, Don 1951-52

Gerber, Joe 1996-99

Ghimen" , Darin 1990

Gibbons, John 1981

Gilbert, Shawn 1986-87

Giordano, Craig 1971-72

Girazian, Toby 2003-04

Gladden, Dan 1978-79

Gladden, Jeff 1980

Glines, Tim 1977

Glynn, Josh 2003

Goehring, Mar" n 1942

Goff , Mike 1985-87

Goldstein, Torin 2015

Golladay, Don 1955

Gomez, David 2004-05

Gomez, Rueben 1958

Gonsalves, Larry 1966-68

Gonzalez, Chris 1990

Gonzalez, Greg 2010-11

Gonzalez, Edgar 2016

Gonzalez, Ozzie 1999-00

Gonzalez, Raul 1992

Goodrich, Randy 1996-98

Goodwin, Tom 1987-89

Gowens, Brennan 2009-11

Graham, Randy 1982

Graham, Tom 1997-00

Graver, Dick 1942

Graves, Gene 1961

Greely, J. 1922-23

Greene, Eric 1990-93

Greenlee, Jim 1991

Gregory, Leroy 1959

Grewal, Ranbir 1989-90

Griffi n, David 2003-04

Griffi n, Kirk 1997-98

Grigsby, Tac 1996

Grimm, Dan 1971-74

Groth, Ken 1982-83

Groth, Robert 1969-70

Grubb, Danny 2006-09

Guibor, Aus! n 2014-16

Gunther, Kevin 1994-95

Gutknecht, Jason 2001-02

Guzman, Tony 1998-00

H Haag, Ryan 2003-04

Hafi z, Dave 2000

Hager, Richard 1956

Hager, Ron 1953-56

Haley, Jus" n 2011-12

Hall, Russ 1982-84

Hallaian, Chris" an 2001-02

Hamilton, Chuck 1974

Hammock, Ted 1957

Halpert, Jared 2005

Hance, Mark 1973

Hancock, Bill 1942

Haney, Roger 1973

Hannah, Jack 1953-55

Hannah, Josh 1997-98

Hannah, Shawn 1999-00

Hanoian, Larry 1964

Hanoian, Terry 1964

Hansen, Bill 1947-48

Harbour, Bill 1960

Harlan, Tom 2009-12

Harkness, Michael 1968-69

Harper, Brad 1999-02

Harper, Brian 1998-99

Harrington, Tony 1969-70

Harris, Clarence 1931

Harris, Hal 1975

Harris, T.J. 1996

Hartgraves, Dean 1987

Haruta, George 1986-87

Hashimoto, Frank 1962-63

Has" ngs, Ward 1957

Haynes, Joel 1950

Hedstrom, Gavin 2008-09

Heeb, Toby 1938

Heizenrader, Terry 1963-65

Hennecke, Pete 1995-96

Henderson, James 1968-69

Henderson, Mike 1978

Hernandez, David 2007

Hernandez, Jesse 1991-92

Hernandez, Mike 2000-02

Hernandez, Rick 1976

Herron, Tony 1979-81

Hershfi eld, Jason 2007

Higa, Tom 1954-58

Hill, Harvey 1984-87

Hill, Mike 1988

Hill, Nate 1985

Hill, Todd 1988

Hiltel, Ted 1960

Hinchey, Harry 1947

Hintz, Beau 1999-00

Hirayama, Fibber 1950-52

Hite, Ed 1961-63

Hobbs, Gene 1957

Holland, Art 1982-83

Holt, Bert 1956

Holt, Darren 1980

Holt, David 1978-79

Hook, Kevin 1995-97

Hoover, W.T. 1998

Hopelain, M. 1931

Hoover, Dave 1962-63

Hoover, John 1981-84

Hosey, Steve 1987-89

Houck, Jim 1957

Hovespian, Dick 1943

Howard, Keith 1997

Hower, Jake 2007-08

Hoyt, Howard 1972

Hoyt, Kenny 1964

Hudson, Ron 1968-70

Huston, Chris 2005

Hutcheson, Patrick 2011-12

I Infante, Gil 2003-05

Inrker, Robert 1949

J Jacobo, Bob 1975

Jacobo, Ed 1984

Jacobsen, Bob 1982-84

Jacobsen, Tom 1962-63

Jelmini, Rick 1975

Jochner, Tim 1986-87

Johnson, Donn 1972-73

Johnson, Jake 2008-09

Johnson, Jim 1952

Johnson, Ron 1977-78

Johnson, Todd 1990-93

Jones, Allen 1970-71

Jones, Bobby 1989-91

Jones, Ken 1976

Judice, Bryan 1991-94

Judge, Aaron 2011-13

K Kaia, Steve 1975

Kaita, Jeff 1998-99

Kai& ors, Josh 1993-96

Kampcik, Ed 1978-79

Kazmirski, Bobby 1991

Kelley, Brad 1974-77

Kelley, Jack 1942

Kemble, George 1938-39

Kendall, Cody 2009-12

Kepner, Norm 1972

Keyes 1923




Kieling, Ron 1973-75

King, Ed 1946

Knerr, Jim 1955-56

Kourafas, Nick 1947

Krebbs, Norman 1956

Krieg, Marty 1946

L Labandeira, Josh 2000-01

LaBare, Mike 1973-74

Lackey, Steve 1973-74

Ladra, Jack 1953

Lambert, Jimmy 2014-16

Lantrip, Rick 1990

Lapin, Brian 2005-07

Larios, John 1985

Larrieu, Gene 1954

Lawless, Albert 1940

Lawless, Toby 1938-39

Leach, Ron 1979

Lee, Dylan 2015-16

Lee, Nathan 2001-02

Leicht, Bill 1980

Lester, Jim 1957-59

Levaggi, Tony 1954-57

Levingston, Derrick 1996-97

Lewis, Ozzie 2005-07

Linehan, Tyler 2011-13

Lipsey, Carl 2002

Lillard, Mike 1957

Lister, Jim 1956

Li! lejohn, Todd 1988

Liukkonen, Jim 1971

Loafman, Chris 1977

Lockhart, Tim 1988-89

Lohuis, Mark 1978-79

LoNigro, Frank 2006

Lopez, Oscar 1997-00

Lozano, Steve 1988-89

Luplow, Jordan 2012-14

Lurker, Bob 1947-49

Lynch, Ryan 2001

M Maas, Dave 1971-72

MacDonald, Jerry 1960-62

Magatogan, Harold 1931

Magee, T. 1922

Mahlmann, Richard 1970

Mallory, Chris 2011

Mann, Jack 1946-48

Marcelli, Brandon 2003-04

Marquez, Bob 1982

Mariscal, Chris 2012-14

Marsh, Robert 1991-92

Marsoobian, Bryan 1988

Mar" n, Dorman 1957-58

Mar" nez, Pete 1986

Mascaro, Frank 1973

Masini, Leonard 1942

Mason, Shane 2001

Mason, William 1966

Mastagni, Phil 1964-65

Mathiesen, Mike 1958-59

Maxwell, Wade 1991-92

Mazzoni, Marty 1959-60

McCormick, Ken 1971-74

McGehee, Casey 2001-03

McGhee, Wayne 1965-66

McKeighan, Thomas 1931

McMahon, Jim 1955-56

McMeechan, Chuck 1971

McNamara, Gary 1992-93

Meacham, Bud 1954

Medrano, Jesse 2014-16

Meert, John 1984-85

Mehas, Mick 1960-62

Mehlhoff , Ron 1976-77

Mello, David 1968-69

Mendonca, Tom 2007-09

Mercado, Victor 1993-95

Mijano, Jan 1957

Miller, DeAndre 2004-05

Miller, Brandon 2004-07

Miller, John 1975-76

Miller, Jus" n 2008

Millhorn, George 1954-57

Millhorn, Paul 1957

Mills, Beau 2005-06

Minor, Tommy 1991-94

Minor, Zach 1999-02

Mitchell, Brandon 1987-88

Miyamoto, Ed 1965

Modrell, Doug 1965-66

Modrell, Gary 1957-58

Moncier, John 1970-71

Moody, W. 1922

Moore, Chase 2003-06

Moore, Lloyd 1946

Moore, Mark 1974

Moran, Nick 1999-00

Moresi, Nick 2004-06

Morse, John 1949-50

Morse, Ma! 2009-10

Mortensen, Tony 1988

Mosiello, Bill 1986

Mo! , Jeff 1988

Moultrie, Daniel 2012

Mueller, Jeff 1976-77

Mundell, Garre! 2012-15

Muno, Danny 2008-11

Munro, William 2012-15

Murphy, Lee 1957-60

Murphy, Michael 1974-76

Myers, Joey 2000-03

Myers, Ron 1976-77

N Najar, Johnny 1991

Nakamura 1923

Nalbandian, Gene 1957

Napier, Walt 1956

Naster, Jeff 1995

Navarro, Sco! 1995-96

Neal, Evere! 1946

Newman, Eric 1993

Nieves, Francisco 2001-02

Nitschke, Buzz 1966-67

Noel, Mike 1988-91

Noonan, Michael 1968-69

Norcross, Ryan 2001

Notorangelo, Don 1950

O O’Banion, Mike 1971-72

O’Canto, Ray 1980-81

O’Leary, Dan 1982-83

O’Leary, John 1978-79

Oliver, Ron 1964

Oneto, Franny 1950-52

O! erson, Eric 2007

Overland, Ryan 2005-08

Oxandaboure, Frank 1949

P Paetow, Robbie 1998-99

Painton, Tim 1978-79

Pallas, James 1969

Palmer, Tim 1998

Papi, Jason 2000

Papi, Ken 1967-68

Parantala, Mark 1996-97

Patrick, Chris 2001-04

Patrick, Mike 1978

Pa! erson, Jim 1991-92

Paul, Gary 1994-96

Paull, Bob 1960-62

Pavlovich, Eli 1943

Pearse, Joe 1996-97

Pearse, Steve 1987-88

Pearson, Bill 1954

Pearson, Jim 1938

Pedrazzini, Joe 1956-57

Peeler, David 1958-59

Pegues, Daryl 1979-80

Pendleton, Terry 1981-82

Penn, Ryan 2005

Peracchi, Don 1966-67

Peralta, Don 1954

Perez, Ken 1978

Perruchon, Bob 1967

Petersen, J.D. 1953-55

Petropulos, Angelo 1939-46

Pe! yjohn, Adam 1996-98

Phair, Bob 1954-56

Phillips, Emery 1981-83

Phillips, Tom 1988-90

Pierce, Brian 2002-03

Pierce, Mike 2004

Pierini, Adolph 1942-46

Pierini, Rick 1965

Pila" , Dennis 1966

Plump, Dave 1964

Pollard, Dan 1965-66

Polerencio, Mike 1947-48

Poole, Robby 1998-99

Poore, Ernie 1938-41

Pos" ff , J.P. 1990

Powell, Mike 1995-98

Poytress, Josh 2009-11

Prieto, Bob 1974-75

Prieto, Jeff 1997-00

Prieto, Jordan 2002

Prieto, Larry 1972-73

Prior, Joe 2014-16

Pritche! , Jerry 1961-62

Purkiss, Ma! 1994-95

Q Quinn, Blake 2013

Quinonez, Rudy 2004-05

Qualls, Andy 2011

R Ragazzo, Rick 1980-81

Rago, Ralph 1955

Ramirez, Rickey 2015-16

Ramos, Sean 1992-93

Randel 1923

Rathjen, Dennis 1978-79

Read, George 1955-56

Reade, Curt 1978-80

Reece, Mark 2015-16

Reelhorn, Jon 1978-80

Renteria, Javier 1993-94

Reyes, Ray 1977-78

Reynoso, Ben 1993-96

Rhoads, R. 1922-23

Ribera, Jordan 2008-11

Rice 1923

Riday-White, Tobey 2001-02

Riddell, Les 1951

Ring, Jeff ery 1966

Roberts, Noel 1994-96

Roberts, Randy 1975-76

Robertson, Charlie 2010-11

Robinson, Dusty 2009-11

Robinson, William 1946

Robison, Jerry 1967-68




Robne� , Richie 2004

Rodriguez, Casey 2014-15

Rodriguez, George 2001

Roe, Mike 1993

Rogers, Dale 1961

Rogers, Dave 1947

Rohm, Dave 1976-77

Rohm, Don 1978

Rollans, Ken 1984-85

Romero, Eddie 2004-06

Romero, Philip 1989-92

Ross, Rich 1981

Ross, Steve 1977

Rosser, Jerry 1963-64

Rothford, Jim 1978

Rothford, Ryan 2003

Rowe, Casey 1997-99

Rucobo, Vince 1966-67

Rudolph, Charles 1940-41

Ruiz, Larry 1977

Runyon, Bob 2001-02

Rupcich, Larry 1994-97

Russell, Brody 2013-16

Russell, Dave 1973-74

Rus� ngan, L. 1922

Ruth, Dick 1962-63

Ruth, Pat 1988-89

Ruthven, Dick 1970-72

Ruthven, Sean 2002

Ryan, S. 1922

S Sakamoto, Kent 2003-06

Sachse, Ken 1949-50

Saiki, Taro 1931

Saitz, Robbie 1989-91

Salazar, Mike 1991-93

Salles, J.D. 2011-12

Salles, John 1986-88

Salwasser, Mervin 1942-46

Sandell, Todd 2005-08

Santoni, Tim 1998

Saxton, Richard 1966

Scarbery, Rick 1976-77

Scelzi, Mike 1948

Schanze, Robert 1965

Scheppers, Tanner 2006-08

Schiller, Ron 1961-62

Schlichtholz, Fred 2014

Schmidt, Chester 1942

Schmidt, Dave 1967-69

Schullstrom, Erik 1988-90

Schulz, Bill 1956

Scorneianchi, Augie 1958

Sco� 1923

Sco� , Bobby 1977-80

Sco� , Gordon 1943

Sco� , Leland 1946

Sco� , Ma� 2002-05

Seadler, Walter 1942

Seastrom, Greg 1958

Sedoo, Gerald 1954

Seib, Greg 1979-80

Sellner, Sco� 1984-85

Serpa 1923

Shannon, Steve 1969

Shannon, Tom 2004

Sharpe, Tom 1967-68

Shahzade, Art 1947-50

Shaves, Dennis 1963-64

Shebelut, Lance 1987-88

Sheffi eld, Bill 1955

Shepard, Larry 1972

Shigematsu, Bob 1970

Shitanishi, Katsu 1963-65

Shull, Jake 2013-15

Siebert, Ron 1973-74

Silva, Larry 1965

Silva, Mark 1975

Silva, Sco! 2016

Simioli, Anthony 1998-99

Simonian, Steve 1970

Simpson, Travis 1970-71

Sinno� , Brian 1963-64

Sirimarco, James 1966-68

Smallin, K. 1922

Smith, Cody 2003

Smith, Earl 1947-49

Smith, Hans 1997-00

Smith, Larry 1961

Smith, Richie 1973

Smith, Woodrow 1965

Soares, Todd 1982-84

Soares, Trent 2008-09

Soderstrom, Steve 1991-93

Soinila, Olavi 1938

Solberg, Eric 1984-85

Sommers, Fred 1951-53

Sommers, Tom 1962-64

Sorenson, Rich 1984-85

Souders, Ben 1954

Spearman, Vernon 1991

Sprague, Holden 2006-09

Spring, William 1940

Springer, Denis 1986-87

Stacey, Ted 1958

Stanton, E. 1922

Stark, Jeff 1985-86

Starling, Gary 1975

Stay, P. 1922

Steinhauer, Chester 1938-41

Stephen, Buz 1964-66

Stephens, Marion 1950-51

Stephenson, Hal 1962

Stewart, Michael 1986-87

Stoddard, Bob 1977-78

Stone, Jake 2014-16

Stone, Quen� n 1995

Stoner, Mike 1976

Storey, Loren 2006-07

Strable, Ray 1968-69

Stroud, Derek 1987

Studdert, Dave 1984-85

Suckut, Albert 1966-67

Suga, Brendon 2002

Susdorf, Steve 2005-08

T Tacke� , Terry 1961

Tafoya, Simon 1997-00

Taglione, Lance 1993

Tamo, Gaetan 1980-82

Tasjian, Karl 1941

Tatum, McCarthy 2015-16

Taylor, Leroy 1941

Taylor, Loran 1946

Taylor, Ron 1968

Taylor, Roy 1946-47

Tempel, Taylor 2012-15

Tesone, Pete 1939

Thiessen, Tim 1980-82

Thiessen, Ronald 1942

Thomas, Ike 1954

Thomas, Ricky Tyler 2015-16

Thomas, Will 2002, 2005

Thompson, Leon 1957

Thompson, Tom 1958-60

Thrasher, Bill 1992-94

Todd, Roland 1957

Togher, Mar� n 1991-92

Tomasello, Frank 1972

Tombs, Frank 1931

Tomlinson, Kris 2006-08

Topoozian, Dominic 2015

Torre, Darryl 1957

Towery, Rick 1977

Tremblay, Lane 1965

Trower, Jim 1967

Tsuhako, Keiji 1957

Tucker, Brad 1995, 97

Tucker, Len 1953

Tucker, Rashad 2006-07

Turner, Rick 1979

Turner, Rod 1988

U Underwood, Andy 2006

Upton, Findley 1940-41

Urabe, Phil 1976

V VanderLaan, Bill 1953-57

VanLanningham, Sherrill 1940

Vega, Carlos 1983-84

Vegely, Ed 1960

Velazquez, Derick 2013-14

Venn, Robert 1943

Vickers, Earl 1966-67

Viers, Kevin 2013-16

Vigil, Sco� 1993-94

Vitato, Doug 1980

Vi� ers, Chris� an 2004-06

Vivas, Isacc 2009-10

Vogt, Randy 1976

Vondran, Steve 1988-89

W Wagner, Kenneth 1968-69

Walker, A. 1922

Walker, Jared 2001-02

Walker, John 1953

Walker, Kurt 1982-83

Wallace, Harold 1948

Wapnick, Steve 1986-87

Ward, Taylor 2013-15

Warembourg, Sco� 1993-94

Warren, Frank 1952-58

Warren, Nick 2015-16

Watson, Bill 1964-66

Weaver, Jeff 1996-98

Weber, Dave 1980-81

Weber, Garre� 2010-11

Welton, Jack 1949-50

Wendt, Tom 1968

Wenzel, Mark 1983

Westmoreland, John 1979-81

Wetzel, Eric 2006-08

Wheat, Harold 1947-49

Wheaton, James 1990-91

Whinery, James 1969-70

White, Jerry 1957-59

Wiebe, Jonathan 2003

Wiebe, Ken 1978-80

Wilcox, Steve 1981

Wiley, Craig 1984

Williams, Brennon 2015-16

Williams, Jim 1963-64

Williams, Mike 1997-98

Williamson, Russ 1981

Wills, Jr., Ted 1952-54

Wilson, Brian 1989-90

Wilson, Jus� n 2006-08

Wilson, Kyle 2004

Windes, Cary 1988-90

Winn, Skippy 1957

Wise, Kenny 2009-12

Wohlman, Kurt 1988

Wolf, Steve 1988-90

Wolfe, Joey 2000

Wolfe, Kirk 1972

Wolfe, Sco� 1970-71




Wolfenbarger, Bryan 2003

Wolfsberger, Jim 1963

Wood, Jason 1991

Wood, Monte 1973

Wood, Ryan 1994-95

Woodward, Trent 2014

Wynns, Aus� n 2010-13

X Xavier, Joe 1982-85

Y Yost, Tom 1950

Young, Dan 2000

Youngblood, Odell 1960-61

Z Zahnale, Sam 1943

Zavorek, Andy 1993

Zenimura, Harvey 1953

Zenimura, Howard 1949-52

Zimmerman, Ron 1966-68

Zivinich, Roy 1954-55

Zosky, Eddie 1987-89

Note: Due to incomplete

records, the above is not a

complete lis� ng of Fresno State

baseball le! erman . Addi� ons,

dele� ons or correc� ons are

welcome with verifi ca� on.




BULLDOG BASEBALL HALL OF FAMECHARTER INDUCTEES 1991

Don Barne�

John Hoover

Pete Beiden

Bobby Paull

Bob Benne�

Dick Ruthven

Truman Clevenger

Joe Xavier

Fibber Hirayama

1992 INDUCTEES

Pete Dalena

Larry Gonsalves

Bob Doig

Dan Grimm

Bob Donkersley

Paul McGuire - Meritorious Service

Greg Funk

J.D. Petersen

1993 INDUCTEES !SPRING"

Steve Bates

Rich Bordi

Brad Benne�

Franny Oneto

Mark Cameron

Tim Thiessen

Jon Reelhorn

1993 INDUCTEES !FALL"

Ollie Bidwell

Eric Fox

Len Bourdet

Mark Gardner

Sco� Buss

Augie Garrido

1994 INDUCTEES

Frank “Jake” Abbo�

Steve Pearse

Leroy Gregory

Jim Rothford

Mike Mathiesen

Lance Shebelut

1995 INDUCTEES

Dan Gladden

Tom Goodwin

Len Tucker

Jerry White

Eddie Zosky

1996 INDUCTEES

Jack Hannah

Steve Hosey

Don Peracchi

Mike Rupcich

John Salles

1997 INDUCTEES

Bob Bonomini

Rich Crane

Tony Herron

Bobby Jones

Joe Pedrazzini

1998 INDUCTEES

Larry Bolger

Cal Cain

Tim Painton

Earl Smith

Ted Wills, Jr.

Earl Smi� camp-Meritorious Service

1999 INDUCTEES

Todd Johnson

Vince Barger

Ted Gavrilis- Meritorious Service

Philip Romero

Art Shazade

Howard Zenimura

2000 INDUCTEES

Randy Asadoor

Terry Banderas

Brant Brown

Jim Garre�

Kurt Walker

2001 INDUCTEES

Fred Bartels

Bill Hansen

Mike Burton

Brandon Mitchell

Tom Sommers

2002 INDUCTEES

Stan Bledsoe

Merv Carter

Ma� Cur! s

Shawn Gilbert

Ron Schiller

2003 INDUCTEES

Buz Stephen

Dave Hoover

Guiseppe Chiaramonte

Bruce Farris - Meritorious Service

1959 Team

2004 INDUCTEES

Jeff Weaver

Jimy Williams

Don George

1988 Team

2005 INDUCTEES

Derek Feramisco

Randy Graham

Tommy Minor

Ken Papi

Jason Wood

1951 Team

2006 INDUCTEES

Ben Reynoso

Fred Sommers

Jerry MacDonald

1984 Bulldog Team

2007 INDUCTEES

Galen Bowman

Mark Hance

Gene Graves

1961 Bulldog Team

2008 INDUCTEES

Stan Busch

Warren Brusstar

Dennis Springer

Ben Fritz

1991 Team

2009 INDUCTEES

Casey McGehee

Adam Pe� yjohn

Dick Doepker

The 1950 team

Larry & Joyce Buss - Meritorious Service

2011 INDUCTEES

Steve Vondran

Buzz Nitschke

2012 INDUCTEES

Jim Flores

2013 INDUCTEES

Mike Batesole

Doug Fister

Jim Pardini

2014 INDUCTEES

The 2008 Na! onal Championship Team

2016 INDUCTEE

Paul Loeffl er



• Career Record – 1,302-759-4 (.631)- Winningest coach in Bulldog history- One of 11 Division I coaches to reach 1,300 wins in NCAA baseball history- Bennett closed out his career with 26 consecutive winning seasons

• 1988 NCAA Coach of the Year (! e Sporting News)

Conference Championships (17):- CCAA (1967)- PCAA (1971)- NCBA (1977, 1979, 1980, 1981, 1982, 1983, 1984)- Big West (1985, 1988, 1989, 1991)- WAC (1993, 1994, 1995, 1998)

Conference Tournament Titles (3):- Big West (1985)- WAC (1993, 1995)

Conference Coach of the Year Awards (14):- 1967, 1971, 1977, 1980-85, 1988, 1991, 1993, 1995, 2001

NCAA Regional Appearances (21): - 1967, 1977, 1979-85, 1988-97, 2000, 2001

College World Series Appearances (2): - 1988, 1991

Regionals hosted at Fresno State (8):- 1979, 1982, 1984, 1985, 1988, 1989, 1991, 1995

Bennett All Americans (32):Larry Gonsalves, P, 1967; Dick Ruthven, P, 1972; Ron Johnson, 1B, 1978; Pete Dalena, DH, 1981; Randy Graham, P, 1982; Terry Pendleton, OF, 1982; Eric Fox, OF, 1983; John Hoover, P, 1984; Scott Buss, OF, 1984; Mark Gardner, P, 1985; Rich Crane, P, 1988; Tom Goodwin, OF, 1988; Steve Hosey, OF, 1988; Steve Pearse, 2B, 1988; John Salles, P, 1988; Lance Shebelut, 1B, 1988; Rich Crane, P, 1989; Tom Goodwin, OF, 1989; Eddie Zosky, SS, 1989; Bobby Jones, P, 1991; Jason Wood, SS, 1991; Brant Brown, 1B, 1992; Todd Johnson, C, 1993; Tommy Minor, P, 1994; Je" Weaver, P, 1996; Je" Weaver, P, 1997; Giuseppe Chiaramonte, C, 1997; Je" Weaver, P, 1998; Anthony Acevedo, OF, 1999; Hans Smith, RP, 2000; Josh Labandeira, SS, 2001; Ben Fritz, UT, 2002 * 59 Total Selections including those players with multiple selections

Bennett First-Round Dra! Picks (9):

Dick Ruthven, P, 1972; John Hoover, P, 1984; Steve Hosey, OF, 1989; Eddie Zosky, SS, 1989; Bobby Jones, P, 1991; Steve Soderstrom, P, 1993; Je" Weaver, P, 1998; Ben Fritz, RHP, 2002

• Coached 1984 NCAA Pitcher of the Year – John Hoover• Coached 1991 NCAA Player of the Year – Bobby Jones• Led Fresno State to a school-record 32-game winning streak.• Fresno State led the nation in attendance in 1988 and 1989 under Coach Bennett.

As a Player at Fresno State:

Bennett’s success at Fresno State began in the 1950s when he was a catcher for the legendary Pete Beiden. ! e four-year letterman and two-time team captain was twice named California Collegiate Athletic Association all-conference (1954 and 1955). He played on teams that won CCAA titles in 1954 and 1955. Bennett set a school record for # elding percentage by a catcher in 1953 when he went errorless in 224 total chances. With Bennett behind the plate, the Bulldogs compiled a four-year record of 117-52 (.692).

BOB BENNETT Head coach at Fresno State from 1967, 1970-2002

Date post:	07-Jul-2020
Category:	Documents
Upload:	others
View:	0 times
Download:	0 times

2017 Baseball Fact Book - History - Amazon S3€¦ · For graphics or abbrevia ons, we ask that you...

Documents