26956819 Sigma Receptors

7/29/2019 26956819 Sigma Receptors

1/14

87:2867-2879, 2002.JNHongling Zhang and Javier CuevasParasympathetic NeuronsCalcium Channels in Rat Sympathetic andSigma Receptors Inhibit High-Voltage-Activated

You might find this additional information useful...

51 articles, 20 of which you can access free at:This article cites

http://jn.physiology.org/cgi/content/full/87/6/2867#BIBL

4 other HighWire hosted articles:This article has been cited by

[PDF][Full Text][Abstract]

, October 1,2003; 64(4): 857-864.Mol. Pharmacol.Z. Mtchedlishvili and J. KapurTransmissionA Presynaptic Action of the Neurosteroid Pregnenolone Sulfate on GABAergic Synaptic

[PDF][Full Text][Abstract], August 1,2004; 64(15): 5029-5035.Cancer Res.

E. Aydar, C. P. Palmer and M. B. A. DjamgozSigma Receptors and Cancer: Possible Involvement of Ion Channels

[PDF][Full Text][Abstract], September 1,2004; 66(3): 420-429.Mol. Pharmacol.

Reed and J. Cuevas

E. G. Severance, H. Zhang, Y. Cruz, S. Pakhlevaniants, S. H. Hadley, J. Amin, L. Wecker, C.Contribute to Functional Ligand-Gated Ion Channels

The {alpha}7 Nicotinic Acetylcholine Receptor Subunit Exists in Two Isoforms that

[PDF][Full Text][Abstract], June 1,2005; 313(3): 1387-1396.J. Pharmacol. Exp. Ther.

H. Zhang and J. Cuevasin Rat Intracardiac Neurons{sigma} Receptor Activation Blocks Potassium Channels and Depresses Neuroexcitability

on the following topics:http://highwire.stanford.edu/lists/artbytopic.dtlcan be found atMedline items on this article's topics

Neuroscience .. GangliaPhysiology .. RatsOncology .. Salt Stress SignalingBiochemistry .. Channel InactivationBiochemistry .. Calcium ChannelBiochemistry .. Opioid Receptors

including high-resolution figures, can be found at:Updated information and services

http://jn.physiology.org/cgi/content/full/87/6/2867

can be found at:Journal of NeurophysiologyaboutAdditional material and information

http://www.the-aps.org/publications/jn

This information is current as of April 27, 2006 .

http://www.the-aps.org/.American Physiological Society. ISSN: 0022-3077, ESSN: 1522-1598. Visit our website at(monthly) by the American Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright 2005 by the

publishes original articles on the function of the nervous system. It is published 12 times a yearJournal of Neurophysiology
http://jn.physiology.org/cgi/content/full/87/6/2867#BIBLhttp://molpharm.aspetjournals.org/cgi/reprint/64/4/857http://molpharm.aspetjournals.org/cgi/content/full/64/4/857http://molpharm.aspetjournals.org/cgi/content/full/64/4/857http://molpharm.aspetjournals.org/cgi/content/abstract/64/4/857http://molpharm.aspetjournals.org/cgi/content/full/64/4/857http://molpharm.aspetjournals.org/cgi/reprint/64/4/857http://molpharm.aspetjournals.org/cgi/content/abstract/64/4/857http://molpharm.aspetjournals.org/cgi/content/full/64/4/857http://cancerres.aacrjournals.org/cgi/reprint/64/15/5029http://cancerres.aacrjournals.org/cgi/content/full/64/15/5029http://cancerres.aacrjournals.org/cgi/content/full/64/15/5029http://cancerres.aacrjournals.org/cgi/content/abstract/64/15/5029http://cancerres.aacrjournals.org/cgi/content/full/64/15/5029http://cancerres.aacrjournals.org/cgi/reprint/64/15/5029http://cancerres.aacrjournals.org/cgi/content/abstract/64/15/5029http://cancerres.aacrjournals.org/cgi/content/full/64/15/5029http://www.molpharm.org/cgi/reprint/66/3/420http://www.molpharm.org/cgi/content/full/66/3/420http://www.molpharm.org/cgi/content/full/66/3/420http://www.molpharm.org/cgi/content/abstract/66/3/420http://www.jpet.org/cgi/reprint/313/3/1387http://www.jpet.org/cgi/content/full/313/3/1387http://www.jpet.org/cgi/content/full/313/3/1387http://www.jpet.org/cgi/content/abstract/313/3/1387http://highwire.stanford.edu/lists/artbytopic.dtlhttp://highwire.stanford.edu/lists/artbytopic.dtlhttp://jn.physiology.org/cgi/content/full/87/6/2867http://www.the-aps.org/publications/jnhttp://www.the-aps.org/http://www.the-aps.org/http://www.the-aps.org/http://www.the-aps.org/http://www.the-aps.org/publications/jnhttp://jn.physiology.org/cgi/content/full/87/6/2867http://highwire.stanford.edu/lists/artbytopic.dtlhttp://molpharm.aspetjournals.org/cgi/reprint/64/4/857http://molpharm.aspetjournals.org/cgi/content/full/64/4/857http://molpharm.aspetjournals.org/cgi/content/abstract/64/4/857http://cancerres.aacrjournals.org/cgi/reprint/64/15/5029http://cancerres.aacrjournals.org/cgi/content/full/64/15/5029http://cancerres.aacrjournals.org/cgi/content/abstract/64/15/5029http://www.molpharm.org/cgi/reprint/66/3/420http://www.molpharm.org/cgi/content/full/66/3/420http://www.molpharm.org/cgi/content/abstract/66/3/420http://www.jpet.org/cgi/reprint/313/3/1387http://www.jpet.org/cgi/content/full/313/3/1387http://www.jpet.org/cgi/content/abstract/313/3/1387http://jn.physiology.org/cgi/content/full/87/6/2867#BIBL


2/14

Sigma Receptors Inhibit High-VoltageActivated Calcium Channels

in Rat Sympathetic and Parasympathetic Neurons

HONGLING ZHANG AND JAVIER CUEVASDepartment of Pharmacology and Therapeutics, University of South Florida College of Medicine, Tampa, Florida 33612

Received 7 December 2001; accepted in final form 7 February 2002

Zhang, Hongling and Javier Cuevas. Sigma receptors inhibit high-voltageactivated calcium channels in rat sympathetic and para-sympatheticneurons.J Neurop hysiol 87:28672879, 2002;10.1152/

jn.00998.2001. Studies on the expression and cellular function ofsigma receptors in autonomic neurons were conducted in neonatal ratintracardiac and superior cervical (SCG) ganglia. Individual neuronsfrom SCG and intracardiac ganglia were shown to express transcriptsencoding the sigma-1 receptor using single-cell RT-PCR techniques.The relationship between sigma receptors and calcium channels was

studied in isolated neurons of these ganglia under voltage-clamp modeusing the perforated-patch configuration of the whole cell patch-clamprecording technique. Bath application of sigma receptor agonists wasshown to rapidly depress peak calcium channel currents in a reversiblemanner in both SCG and intracardiac ganglion neurons. The inhibitionof barium (I

Ba) currents was dose-dependent, and half-maximal in-

hibitory concentration (IC50) values for haloperidol, ibogaine, ()-pentazocine, and 1,3-Di-O-tolylguanidin (DTG) were 6, 31, 61, and133 M, respectively. The rank order potency of haloperidol ibogaine ()-pentazocine DTG is consistent with the effects oncalcium channels being mediated by a sigma-2 receptor. Preincuba-tion of neurons with the irreversible sigma receptor antagonist,metaphit, blocked DTG-mediated inhibition of Ca2 channel currents.Maximum inhibition of calcium channel currents was 95%, sug-gesting that sigma receptors block all calcium channel subtypes found

on the cell body of these neurons, which includes N-, L-, P/Q-, andR-type calcium channels. In addition to depressing peak Ca2 channelcurrent, sigma receptors altered the biophysical properties of thesechannels. Following sigma receptor activation, Ca2 channel inacti-vation rate was accelerated, and the voltage dependence of bothsteady-state inactivation and activation shifted toward more negativepotentials. Experiments on the signal transduction cascade couplingsigma receptors and Ca2 channels demonstrated that neither celldialysis nor intracellular application of 100 M guanosine 5-O-(2-thiodiphosphate) trilithium salt (GDP--S) abolished the modulationof I

Baby sigma receptor agonists. These data suggest that neither a

diffusible cytosolic second messenger nor a G protein is involved inthis pathway. Activation of sigma receptors on sympathetic and para-sympathetic neurons is likely to modulate cell-to-cell signaling inautonomic ganglia and thus the regulation of cardiac function by the

peripheral nervous system.

I N T R O D U C T I O N

Sigma receptors are widely distributed in mammalian brainand peripheral systems and organs. These receptors have beenpharmacologically defined into two subclasses of receptors,

sigma-1 and sigma-2 (Hellewell and Bowen 1990; Quirion etal. 1992), with a major difference being the higher affinity ofsigma-1 receptors for () pentazocine (Quirion et al. 1992)and the greater affinity of sigma-2 receptors for ibogaine (Bo-wen et al. 1995). While only the sigma-1 receptor has beencloned, studies using photolabeling techniques with sigma li-gands on guinea pig brain and PC12 cell membranes suggestthat distinct molecular entities exist that correspond to the two

sigma receptor subtypes (Hellewell and Bowen 1990). Thefunction of these receptors is not well understood; however,sigma receptors have been implicated in the modulation ofvarious biochemical, behavioral, and physiological processes(Walker et al. 1990).

It has been suggested that sigma receptors may regulate thecardiovascular system (Ela et al. 1994). Sigma ligand bindingsites have been detected in cardiac myocytes, and sigma li-gands, including ()-pentazocine and haloperidol, have beenshown to alter contractility, Ca2 influx, and contraction rate incultured cardiac myocytes (Ela et al. 1994; Novakova et al.1995). However, while direct effects of sigma ligands oncardiac muscle have been documented, very little is knownabout sigma receptors in autonomic neurons, and in particularsympathetic or parasympathetic neurons that innervate theheart. The presence of putative endogenous ligands of sigmareceptors, including neuropeptide Y (Roman et al. 1989) andsubstance P (Larson and Sun 1993), in these ganglia (Hassalland Burnstock 1984; Karhula 1995; Kessler and Black 1982;Papka et al. 1981) suggests that sigma receptors may be acti-vated under physiological conditions, affecting cell-to-cell sig-naling in the ganglia, and ultimately the regulation of cardiacfunction by the autonomic nervous system.

Some evidence does exist that suggests that sigma receptorsmay play an important role in the function of peripheral neu-rons. In the guinea pig ileum, for example, sigma receptorshave been shown to block contractions of longitudinal muscle

elicited by both electrical stimulus or by exogenous serotoninvia inhibition of acetylcholine release from myenteric neurons(Campbell et al. 1989). Conversely, sigma receptors potentiateneurogenic twitch contraction in the mouse vas deferens byinhibiting K channels in sympathetic neurons of the hypo-gastric ganglion, which increases norepinephrine release fromthese cells (Campbell et al. 1987; Kennedy and Henderson1990). In neurons of the CNS, sigma receptors have been

Address for reprint requests: J. Cuevas, Dept. of Pharmacology and Ther-apeutics, University of South Florida College of Medicine; 12901 Bruce B.Downs Blvd., MDC 9, Tampa, FL 33612-4799 (E-mail: [email protected]).

The costs of publication of this article were defrayed in part by the paymentof page charges. The article must therefore be hereby marked advertisementin accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

J Neurophysiol

87: 28672879, 2002; 10.1152/jn.00998.2001.

28670022-3077/02 $5.00 Copyright 2002 The American Physiological Societywww.jn.org


3/14

shown to produce various cellular effects including inhibitionof intracellular Ca2 mobilization by N-methyl-D-aspartate(NMDA) in rat frontal cortical neurons (Hayashi et al. 1995)and depression of action potential firing in guinea pig hypo-glossal neurons (Morin-Surun et al. 1999).

A process frequently targeted by sigma receptor modulationis intracellular calcium homeostasis. In the human neuroblas-toma cell line, SK-NSH, sigma-2 receptors have been shown to

evoke release of Ca

2

from intracellular stores (Vilner andBowen 2000). Studies have also suggested that sigma ligandsmay block Ca2 channels in hippocampal neurons and vascularsmooth muscle (Church and Fletcher 1995; Flaim et al. 1985),although these effects were attributed to direct modulation ofCa2 channels by the sigma ligands. The effect of sigmareceptor activation on calcium channels, and in particular cal-cium channels of autonomic neurons, remains to be elucidated.Regulation of calcium channel function is a means by whichvarious neurotransmitters exert their effects on autonomic neu-rons (Jeong et al. 1999). For example, both neuropeptide Y andnorepinephrine depress calcium channel currents in rat intra-cardiac neurons (Jeong et al. 1999; Xu and Adams 1993). Thisinhibition of calcium channels is believed to be a mechanism

by which the sympathetic nervous system modulates the ac-tivity of the parasympathetic nervous system. Similarly, ace-tylcholine, acting via M4 muscarinic receptors, blocks calciumchannel currents in intrinsic cardiac neurons (Cuevas and Ad-ams 1997). This phenomenon is likely to represent a feedbackmechanism in cholinergic parasympathetic neurons.

Experiments were undertaken to determine whether sigmareceptors are present in autonomic neurons of the sympatheticsuperior cervical ganglion and the parasympathetic intracardiacganglion, and whether activation of these receptors modulatesthe biophysical properties of calcium channels in these cells.Results indicate that sigma-1 receptor transcripts are expressedby individual autonomic neurons. Furthermore, sigma receptorswere shown to depress peak Ca2 channel currents, increase the

rate of Ca2 channel inactivation, and shift the voltage depen-dence of both steady-state inactivation and activation toward morenegative potentials. Pharmacological experiments suggest thatsigma-2 receptors modulate Ca2 channels in these cells and thatthese receptors couple to Ca2 channels via a signal transductioncascade that involves neither a diffusible cytosolic second mes-senger nor a G protein. A preliminary report of some of theseresults has been published (Zhang and Cuevas 2001).

M E T H O D S

Preparation and electrical recording

Modulation of depolarization-activated Ca2 channels by sigmareceptor activation was studied in isolated neurons of neonatal ratintracardiac and superior cervical ganglia. The preparation of culturedneurons of neonatal rats (310 day old) and the electrophysiologicalrecording methods used here have been previously described (Cuevasand Adams 1994; Cuevas et al. 2000). For the superior cervicalganglion preparation, neonatal rats were killed by inhalation of carbondioxide; whereas for isolation of intracardiac neurons, rats were killedby decapitation. All procedures were done in accordance with theregulations of the Institutional Animal Care and Use Committee.

Membrane currents in autonomic neurons, cultured for 24 72 h,were studied under voltage-clamp mode using the whole cell record-ing configuration of the patch-clamp technique (Hamill et al. 1981).

Electrical access was achieved through the use of the amphotericin Bperforated-patch method (Rae et al. 1991) to preserve the intracellularintegrity of the neurons and prevent calcium current rundown (Xu andAdams 1992). For perforated-patch experiments, a stock solution ofamphotericin B (60 mg/ml) in dimethylsulphoxide (DMSO) wasprepared and diluted in pipette solution immediately prior to use toyield a final concentration of 198 g/ml amphotericin B in 0.33%DMSO. Final patch pipette resistance was 1.01.3 M to permitmaximal electrical access under the present recording configuration.

Junction potentials generated by the ions in the pipette and bathsolutions were compensated for via the Pipette Offset control of theAxopatch 200B. To test for amphotericin B incorporation into themembrane patch following gigaseal formation, the neurons were heldat 60 mV, and 20-ms voltage pulses to 65 mV were applied at 1Hz. In successful experiments there was an increase in a fast capac-itive transient, the appearance of a slow capacitive transient, and adecrease in the series resistance (Rs). To minimize voltage errorproduced by Rs, Rs was monitored throughout the experiment, andonly cells in which Rs was consistently 3 M following 50% Rscompensation were used. Also, to minimize space-clamp artifact, onlycells with no large visible processes were selected for the experiments.

Depolarization-activated Ca2 channel currents were evoked usingvoltage jumps from 90 mV to more positive potentials. Capacitiveand leak currents were subtracted using the P/4 protocol, which

assumes a linear relationship for these currents at voltages less than60 mV (Xu and Adams 1992). Membrane currents were amplifiedusing an Axopatch 200B patch-clamp amplifier (Axon Instruments,Union City, CA), filtered at 5 kHz (3 dB; 4-pole Bessel filter), anddigitized at 20 kHz (Digidata 1200B).

Ca2 currents elicited by long (2 s) depolarizations were fit usingsingle or double exponential functions and the Clamp fit 6.0.5 program(Axon Instruments). Activation and steady-state inactivation kineticswere described using Boltzmann distributions, and dose-responsecurves were fit using the Hill equation. Analysis of these data wereconducted using the SigmaPlot 2000 program (SPSS Science, Chi-cago, IL). Data points represent means SE. Statistical differencewas determined using paired t-test for within-group experiments, andunpaired t-test for between groups experiments, and was consideredsignificant if P 0.05.

RT-PCR

RT-PCR techniques, similar to those previously reported (Cuevas etal. 2000), were used for the detection of sigma-1 receptor expressionin autonomic neurons. Total RNA was isolated from intracardiacganglia and associated tissue and from superior cervical ganglia(SCG; RNeasy, Qiagen, Hilden, Germany). RNA was reverse-tran-scribed in a 20-l reaction volume using the SuperScript First-StrandSynthesis System for RT-PCR (Invitrogen, San Diego, CA). As anegative control, a PCR reaction with only water was conducted toeliminate the possibility of false positives due to contaminatingcDNA. Primers specific for sigma-1 receptor transcripts were de-signed to span an intron to discriminate between genomic DNA andcDNA. The sequences of the primers used were: sigma-1(sense)-GTCTTTTGCACGCCTCGCTGTCTGAGTACG, sigma-1

(antisense)-

ACCCTCTCTGGATGGAGGTGAGTGC, which yielded a productsize of 639 base pairs. PCR reactions were conducted using theSuperScript System with Platinum Taq DNA polymerase (Invitrogen).The cycling parameters were one cycle of 94C for 2 min; 30 cyclesof 94C for 30 s, 61C for 45 s, and 72C for 1 min; and 1 cycle of72C for 5 min.

For single-cell RT-PCR experiments, SCG and intracardiac neuronswere dissociated, and cytoplasm was extracted from isolated neuronsas previously described (Poth et al. 1997). Briefly, the cellular contentof individual neurons was harvested using the dialyzing whole cellconfiguration of the patch-clamp technique. The patch pipettes werefilled with 3 l of 1 SuperScript One-Step RT-PCR Reaction Mix

2868 H. ZHANG AND J. CUEVAS

J Neurophysiol VOL 87 JUNE 2002 www.jn.org


4/14

(Invitrogen) containing 1 U/l RNAsin (Promega, Madison, WI).Following extraction of the cytoplasm, the content of the pipette wasexpelled into a microfuge tube and quickly frozen on dry ice. Single-cell RT-PCR experiments were conducted immediately following theextraction using SuperScript One-Step RT-PCR with Platinum Taq(Invitrogen). Negative controls for these experiments involved suc-tioning extracellular solution via a patch pipette located directly abovethe cells. These controls were carried through all subsequent reactionsto rule out the possibility of contamination from cytoplasm from

nearby cells or sigma receptor clones isolated in the laboratory. Thecycling parameters were 1 cycle of 50C for 30 min and 95C for 2min; 40 cycles of 94C for 30 s, 61C for 45 s, and 72C for 1 min;and 1 cycle of 72C for 5 min.

RT-PCR products were gel purified using a QIAEX II Gel Purifi-cation kit (QIAGEN) and sequenced by the Molecular Biology CoreFacility at the H. Lee Moffitt Cancer Center and Research Institute.

Solutions and reagents

The bath solution used in these experiments was a physiological salinesolution (PSS) composed of (in mM) 70 NaCl, 70 tetraethylammoniumchloride (TEA), 5 BaCl2, 1.2 MgCl2, 7.7 glucose, 0.0005 tetrodotoxin(TTX), and 10 HEPES (pH to 7.2 with NaOH). Barium was used as thecharge carrier to maximize Ca2 channel current amplitude, and tominimize any intracellular Ca2-dependent current rundown (Xu andAdams 1992). All drugs, including sigma ligands, were bath applied atroom temperature at a rate of2 ml/min into a 0.3-ml recording cham-ber, which permitted rapid exchange of bath solution. The pipette solutionused for perforated-patch experiments contained (in mM) 75 Cs2SO4, 55CsCl, 5 MgSO4, and 10 HEPES (pH to 7.2 with N-methyl-d-glucamine).Block of ionic current through Ca2 channels was achieved via bathapplication of 100 M CdCl2 (Xu and Adams 1992). For studies usingconventional (dialyzing) whole cell recording configuration, the pipettesolution contained (in mM) 140 CsCl, 2 MgCl2, 2 ethylene glycol-bis(-aminoethyl ether)-N,N,N,N-tetraacetic acid (EGTA), 2 Mg2ATP,0.1 GTP lithium salt (GTP), and 10 HEPES-CsOH, pH to 7.2. In someexperiments GTP was replaced with 100 M guanosine 5-O-(2-thiodiphosphate) trilithium salt (GDP--S) to inhibit G protein acti-vation.

All chemical reagents used were of analytical grade. Ibogainehydrochloride, ()-pentazocine, haloperidol, 1,3-Di-O-tolylguanidine(DTG), metaphit, and tetrodotoxin were purchased from SigmaChemical (St. Louis, MO).

R E S U L T S

To determine whether sympathetic and parasympatheticneurons may be the target of sigma receptor ligands, autonomic

neurons were first screened for the expression of transcriptsencoding the sigma-1 receptor using RT-PCR techniques. Oli-gonucleotide primers were designed to span introns 2 and 3 ofthe sigma-1 gene to differentiate between cDNA and genomicDNA. RT-PCR of total RNA extracts from SCG and intracar-diac ganglia and associated tissue (e.g., cardiac myocytes,Schwann cells, and fibroblasts) showed that sigma-1 receptortranscripts are expressed in these cells (Fig. 1A). However,

since sigma-1 receptors have been found in nonneuronal cells,it seemed prudent to test for the presence of sigma-receptortranscripts at the single-cell level. Using single-cell RT-PCRtechniques, transcripts encoding the sigma-1 receptor wereshown to be expressed in individual intracardiac and SCGneurons (Fig. 1B). Sigma-1 receptor transcripts were detectedin 57% of intracardiac neurons (4 of 7) and 67% of SCGneurons (4 of 6). Sequencing of the products obtained fromindividual autonomic neurons indicated exact sequence homol-ogy to the known rat brain sigma-1 receptor (Seth et al. 1998).Splice variants of the sigma-1 receptor have been reported inthe rat and mouse as submissions to GenBank (accessionnumbers AF087827 and AF226605, respectively). The oligo-nucleotide primers used here were specifically designed to

detect conventional sigma-1 transcripts and both of these se-quence variants, but no such isoforms were detected in thesecells.

Sigma receptormediated attenuation of Ca2

channel currents

Sigma receptors have been shown to modulate calciumhomeostasis in various cell types. One of the mechanisms bywhich sigma receptors appear to modulate cellular calcium isthrough attenuation of calcium influx through the cell mem-brane. However, the effects of sigma receptor activation oncalcium channel function have not been determined.

Ca

2

channel currents were isolated by inhibiting Na

cur-rents with extracellular TTX, and K channels with intracel-lular Cs and extracellular TEA and Ba2. Ba2 was used asthe charge carrier through open calcium channels in mostexperiments for reasons discussed in METHODS. The effect ofsigma ligands on the Ba2 current-voltage (I-V) relationshipwas examined using brief (250 ms) step depolarizations of10-mV increments (50 to 90 mV) from a holding potential

FIG. 1. Detection of sigma-1 receptor transcripts in rat intracardiac and superior cervical ganglia. A: RNA from rat intracardiacand superior cervical ganglia were reverse transcribed and amplified via PCR using oligonucleotide primers specific for the sigma-1receptor (sense, GTCTTTTGCACGCCTCGCTGTCTGAGTACG; antisense, ACCCTCTCTGGATGGAGGTGAGT GC). B: RT-PCR reaction results for 2 isolated neurons from rat intracardiac (ICG) and superior cervical (SCG) ganglia using the sigma-1primers. A and B: arrows indicate predicted size for the sigma-1 receptor product (639 bp), and standards are 100 bp ladder.

2869SIGMA RECEPTOR MODULATION OF CALCIUM CHANNELS



5/14

of 90 mV. Figure 2A shows a family of depolarization-activated Ba2 currents (IBa) recorded from a single SCGneuron in the absence (Control) and presence of the sigmareceptor ligand, haloperidol (10 M). Bath application of hal-operidol depressed peakIBa amplitude at all potentials positiveto 10 mV within 3 min of drug application. Figure 2B showsthe average I-V relationship obtained for six neurons before(Control) and after bath application of 10 M haloperidol.

Under control conditions, IBa was activated at approximately30 mV and the I-Vrelation was maximal at 0 mV, reversingat approximately 50 mV. In the presence of haloperidol, theI-Vrelationship exhibited a similar voltage dependence, but thepeak IBa amplitude was reduced at all voltages. At 0 mV, IBadecreased from a control value of1,565 76 pA to 969 222 pA in the presence of 10 M haloperidol, (n 6).Inhibition of Ca2 channel currents occurred to a similardegree when Ca2 was the charge carrier (data not shown).

Bath application of 100 M Cd2 completely blocked thedepolarization-activated Ba2 current, both in the absence andthe presence of haloperidol (data not shown). The observedCd2 block, coupled with the lack of shift in the reversalpotential for the depolarization-activated currents (Fig. 2B) in

the presence of sigma ligands, suggests that these drugs are notactivating or inhibiting another membrane conductance.

Concentration-dependent inhibition of IBa

by sigma ligands

To determine whether the effect of haloperidol on Ca2

channels is mediated by sigma receptor activation, the abilityof various sigma ligands to elicit a similar response was as-sessed. Figure 3A shows representative currents recorded fromthree different SCG neurons (13) in the absence (Control) andpresence of haloperidol, ()-pentazocine, and DTG. The peak

inward IBa was measured before and after exposure to variousconcentrations of the sigma ligands haloperidol, ()-pentazo-cine, DTG, and ibogaine. For these experiments, each cell wasexposed to a minimum of three drug concentrations. A plot ofthe mean peakIBa as a function of drug concentration is shownin Fig. 3B. Haloperidol had the greatest potency of the ligandstested, and a fit of the data using the Hill equation gave ahalf-maximal inhibitory concentration (IC50) value of 6 M.

Similarly, the IC50 values for ibogaine, ()-pentazocine andDTG were 31, 61, and 133 M, respectively, and the Hillcoefficient was 1.1 for all drugs. Maximum inhibition of IBa byall sigma ligands tested was 95%.

The effect of sigma ligands on Ca2 channel current ampli-tude was reversible on wash out. Figure 4A shows a family ofBa2 currents evoked by step depolarizations from a singleneuron in the absence (Control), presence (DTG), and fol-lowing wash out for the indicated time points of the sigmaligand, DTG. Following inhibition ofIBa, the current recoveredto near control levels within 5 min of wash out (Fig. 4B).Similar reversal of inhibition was observed for all sigma li-gands tested here. No significant rundown ofIBa was observedin recordings 45 min.

Sigma receptor antagonist depresses the effect of DTGon Ca2 channels

To confirm whether the effect of sigma ligands on Ca2

channels was mediated by activation of a sigma receptor, theirreversible sigma receptor antagonist, metaphit, was used.Metaphit is known to rapidly and specifically acetylate sigmareceptors, which results in a block of ligand binding (Bluth etal. 1989). Isolated SCG neurons were preincubated in 50 Mmetaphit (in PSS) for 10 min at room temperature. Following

FIG. 2. Inhibition of Ca2 channel currents in sympathetic neurons by the sigma receptor agonist, haloperidol. A: family ofdepolarization-activated Ba2 currents recorded from a single SCG neuron in the absence (Control) and presence of 10 Mhaloperidol. B: whole cell current-voltage relation obtained in the absence (E) and presence of 10 M haloperidol (). Data points

represent means SE for 6 cells.




6/14

wash out of drug, Ba2 current amplitude was similar to thatrecorded in control experiments (no preincubation; Fig. 5A),suggesting that preincubation in metaphit alone had no effect

on Ca2 channel currents. On application of DTG, Ba2 cur-rent amplitude was depressed under both conditions, but incells preincubated in metaphit the response to DTG was ob-tunded. Figure 5B shows a bar graph of relative mean IBaamplitude recorded in the presence of 100 M DTG in controlneurons (DTG; n 7) or neurons preincubated in metaphit(Metaphit DTG; n 6). DTG decreased mean IBa by 28 4% in cells exposed to metaphit, whereas in control cellsthe decrease was 49 4%. The difference in DTG attenuationof IBa under both conditions was statistically significant(P 0.01).

Sigma receptors inhibit Ca2 channels in

parasympathetic neurons

To determine whether similar modulation of Ca2 channelsalso occurs in parasympathetic intracardiac neurons, the effectof sigma receptor ligands on these channels was studied. Forthese experiments haloperidol, ibogaine, ()-pentazocine, andDTG were used at concentrations near the IC50 value for IBainhibition, as determined in SCG neuron. Figure 6A showscurrents evoked from four different neurons in the absence(Control) and presence of the indicated sigma ligands. A plotof the mean inhibition of IBa evoked by these sigma ligands isshown in Fig. 6B and is consistent with the observations made

in SCG neurons. As in the case of SCG neurons, sigma ligandsmaximally inhibited peak IBa in intrinsic cardiac neurons by95% (data not shown).

Effects of haloperidol on Ca2 channel inactivation

Some receptors that modulate Ca2 channels, such as M4-muscarinic and 2-adrenergic receptors, have been shown todifferentially affect the rapid and slow component of Ca2

channel current decay (Cuevas and Adams 1997; Xu andAdams 1993). To determine whether sigma receptors have asimilar effect on Ca2 channel inactivation kinetics, Ca2

channel currents were evoked by step depolarization (2 s) to 0mV from a holding potential of90 mV in the absence andpresence of 10 M haloperidol. Figure 7A shows representa-tive responses recorded from a single SCG neuron. Undercontrol conditions, the time-dependent inactivation of IBa wasbiphasic, and best fit by the sum of two exponential functionswith time constants of 198 ms (1) and 2.2 s (2). In thepresence of haloperidol, the inward current was also best fit bythe sum of two exponential functions, but both 1 and 2 weredecreased to 117 ms and 1.1 s, respectively. Following washout of haloperidol, 1 and 2 returned to near control levels andwere 171 ms and 1.5 s, respectively. In five similar experi-ments, the time course of IBa decay was best fit by the sum oftwo exponential functions with mean time constants of 100 15 ms (1) and 1.2 0.1 s (2). In all SCG neurons studied,haloperidol decreased both 1 and 2 in a statistically signifi-

FIG. 3. Dose-dependent inhibition of depolarization-activated Ca2 channels by sigma receptor ligands in rat sympatheticneurons. A: whole cell currents evoked from 3 SCG neurons (13) by step depolarizations to 0 mV from a holding potential of90mV in the absence (Control) and presence of haloperidol, ()-pentazocine and 1,3-Di-O-tolylguanidin (DTG) at the indicatedconcentrations. B: peak whole cell IBa amplitude, evoked by depolarizing to 0 mV from 90 mV, normalized to control and plottedas a function of sigma ligand concentration. Data points represent means SE for 57 neurons. The curves represent best fit tothe data using the Hill equation. Half-maximal inhibition was 6 M for haloperidol (s), 31 M for ibogaine ({), 61 M for()-pentazocine (), and 133 M for DTG (), and the Hill coefficient was 1.1 for all compounds.




7/14

cant manner (P 0.01), and mean time constants were 62

11 ms (1) and 711 146 ms (2; n 5). The peak amplitudeof each of the two components of the fit was also depressed,with the amplitude of the first component decreasing by 40 11% and that of the second component by 35 7%. In all cellstested, the effect of haloperidol on the time course of decay ofIBa was reversible on wash out and mimicked by ibogaine (datanot shown).

The effect of haloperidol (10 M) on steady-state inactiva-tion of Ca2 channels in rat SCG neurons was studied using adouble pulse protocol. Neurons were initially held at 90 mV,and 10-s prepulses from 120 to 10 mV were applied in10-mV increments prior to a voltage step to 20 mV (20 ms)to activate (open) the available Ca2 channels. A plot of therelative peak current amplitude [IBa/IBa(max)] as a function of

prepulse voltage is shown in Fig. 7B (n 6). The steady-stateinactivation ofIBa under control conditions exhibited a sigmoi-dal dependence on voltage and was best fit with a singleBoltzmann function according to the equation

IBaIBa max/ 1 exp V Vh /k (1)

A fit of the mean relative I-V relationship exhibited half-maximal steady-state inactivation (Vh) at 27 mV and had aslope parameter (k) of 12. In the presence of haloperidol,however, the voltage dependence of steady-state inactivationwas best fit by a two-component Boltzmann distribution

IBa i1 IBa max/ 1 exp Vh1 V /k1

i2 IBa max/ 1 exp Vh2 V /k2 (2)

where i1 and i2 represent the fraction contributed by eachcomponent to the final function. The values for i1 and i2 were0.21 and 0.78, respectively. The first component was half-maximally activated (Vh1) at 13 mV and had a slope param-eter (k1) of 6.3, whereas the second component was half-maximally activated (Vh2) at 53 mV and had a slopeparameter (k2) of14.9.

Effects of haloperidol on the voltage dependenceof Ca2 channel activation

The voltage dependence of activation was examined bymeasuring tail current amplitude. Neurons were held at 90mV, and brief steps (20 ms) to various test potentials (50 to100) were applied prior to repolarization to 90 mV. Figure8A shows Ba2 currents obtained in the absence and presenceof haloperidol (10 M) in response to voltage steps to theindicated potentials and the ensuing tail currents elicited onrepolarization to 90 mV. The corresponding I-Vrelationshipobtained for the peak tail current amplitudes of six neurons isshown in Fig. 8B. Haloperidol significantly reduced the peaktail current amplitude at all voltages from 10 to 100 mV ina reversible manner. However, at 0 mV haloperidol decreased

FIG. 4. Reversibility of DTG-induced block of depolarization-activated Ca2 channels. A: family of depolarization-activatedCa2 channel currents recorded from a single rat SCG neuron inthe absence (Control) and presence of bath-applied 1 mM DTG(DTG), and following wash out of drug for the indicated timeperiods. B: peak Ba2 current amplitudes before application (E),during application (), and after removal (E) of 1 mM DTG for

the cell in A. Values are plotted as a function of time. Gaprepresents period during which lower concentrations of DTGwere applied, with 1 mM DTG application commencing at t 13min.




8/14

peakIBa tail current amplitude by 57% but by 73% at 50 mV.This effect does not appear to be a use-dependent phenomenon

since IBa tail current amplitude did not decrease during a train

of brief depolarizations (5 pulses, 20 ms) to 80 mV or byreversing the voltage protocol (data not shown). Also, at volt-

ages where Ca2 channels were maximally activated, inhibi-

tion by haloperidol was comparable (80 mV, 77%; 90 mV,78%; 100 mV, 76%). The reason for greater depression of IBatail current amplitude by haloperidol at higher depolarizations

is a drug-induced shift in Ca2 channel activation.

Figure 8C shows a plot of the mean peak IBa tail current

amplitude normalized to maximum IBa tail current amplitude in

the absence and presence of haloperidol. Ca2 channels exhibit

sigmoidal activation at potentials positive to 40 mV underboth conditions. Data points were best fit using a two-compo-nent Boltzmann distribution (Eq. 2). For control, i1 and i2 were

0.48 and 0.52, respectively, whereas in the presence of halo-

peridol i1 and i2 were 0.70 and 0.20, respectively. Half-maxi-

mal activation of the first component (Vh1) shifted from 4

mV in the absence (control) to 13 mV in the presence ofhaloperidol, while the second component (Vh2) shifted from

38 mV (control) to 22 mV (haloperidol). This sigmareceptor-induced shift in the voltage dependence of activation

results in tail currents of greater amplitude at more negative

potentials and is thus responsible for the difference in percent

inhibition of Ba2 tail currents by haloperidol at low and high

depolarizations. The effects of haloperidol on the voltage de-

pendence of Ca2 channel steady-state inactivation and acti-

vation were reversible on wash out and were mimicked by

ibogaine (data not shown).

Effect of intracellular dialysis with GTP and GDP--S on

sigma receptor inhibition of IBa

In some systems, sigma receptors have been shown to cou-

ple to effector targets via a signal transduction cascade involv-

ing a G protein. To determine whether a G protein is involved

in the sigma receptormediated modulation of Ca2

channelsin autonomic neurons, intrinsic cardiac neurons were dialyzed

with pipette solution containing either 100 M GTP or 100

M GDP--S. In neurons dialyzed with GTP, sigma receptorinduced inhibition of IBa was similar to that observed in neu-

rons electrically accessed using the perforated-patch method.

Figure 9A shows representative currents in response to stepdepolarizations from 90 to 0 mV recorded from two neuronsdialyzed with either GTP (top traces) or GDP--S (bottomtraces) in the absence and presence of 10 M haloperidol. Asummary of the peak IBa amplitudes elicited on depolarizationto 0 mV, normalized to their respective control values, underthe different experimental conditions is presented in Fig. 9B.Haloperidol decreased IBa by 68 8% (n 5) in neuronsdialyzed with pipette solution containing GTP and by 62 3%(n 6) in neurons dialyzed with GDP--S. The differencebetween these two experimental groups was not statisticallysignificant. DTG inhibition of IBa was reversible on wash outof drug when cells were dialyzed with either GTP or GDP--S(data not shown).

To determine whether the dialysis with GDP--S was suf-ficient to block G proteinmediated events, these cells werealso exposed to 100 M ACh to elicit muscarinic receptorevoked inhibition of Ca2 channels. Muscarinic receptors havebeen shown to couple to Ca2 channels via a pertussis toxin

FIG. 5. Attenuation of DTG-mediated inhibition of Ca2 channels by the sigma receptor antagonist, metaphit. A: depolarizationactivated (90 to 0 mV) Ba2 currents recorded from 2 SCG neurons in the absence (Control, Metaphit) and presence of 100 MDTG (DTG, Metaphit DTG). Bottom traces are from a neuron preincubated in metaphit [50 M in physiological saline solution(PSS), 10 min]. B: bar graph of the relative mean peak IBa (SE) obtained by step depolarizations (90 to 0 mV) in control cells(DTG) or cells preincubated in metaphit (50 M, 10 min; Metaphit DTG) following bath application of 100 M DTG. Currentamplitudes were normalized to their respective controls (absence of DTG). Data were collected from 7 neurons for each condition,and asterisk denotes significant difference between the groups (P 0.01).




9/14

sensitive G protein in intrinsic cardiac neurons (Cuevas andAdams 1997). Following cell dialysis with GTP containingpipette solution, ACh depressed IBa by 40 6% (n 3). ThisACh-mediated inhibition was reduced to 17 4 in cellsdialyzed with GDP--S (n 3), which was significantlydifferent from the reduction observed when GTP was used.

D I S C U S S I O N

The results presented here provide the first evidence ofsigma receptors being expressed in mammalian parasympa-thetic and sympathetic neurons. Transcripts encoding sigma-1receptors were detected in individual neurons from intracardiacand superior cervical ganglia in neonatal rats. Sigma receptorswere shown to inhibit all Ca2 channel subtypes present inneurons of both autonomic ganglia with high efficacy. Further-more, sigma receptors were demonstrated to differ from othermodulators of Ca2 in these cells on the basis of their effectson the biophysical properties of the channels and the signaltransduction cascade coupling them to these Ca2 channels.

Two pharmacologically distinct subtypes of sigma receptorshave been identified: sigma-1 and sigma-2 receptors, respec-tively. Photoaffinity labeling experiments with sigma receptorspecific ligands have also revealed the presence of a 25-kDapolypeptide in guinea pig brain corresponding to the sigma-1

receptor and a polypeptide doublet of 18 and 21 kDa that isbelieved to represent the sigma-2 receptor (Hellewell and Bo-wen 1990). The mammalian sigma-1 receptor has been clonedin several species including guinea pig, human, and rat (Hanneret al. 1996; Kekuda et al. 1996; Seth et al. 1998). Thesereceptors are expressed in the brain and in several peripheraltissues and organs (Walker et al. 1990). Because of the pres-ence of sigma-1 receptors in cardiac muscle (Ela et al. 1994),and possibly other tissues associated with intracardiac gangliaor in support cells in the SCG, we used single-cell RT-PCRtechniques to demonstrate that transcripts for this receptor arepresent specifically in autonomic neurons. The sequences ofthe sigma-1 receptor transcripts cloned from both intracardiacand SCG neurons were identical to that reported for the ratbrain sigma-1 receptor (Seth et al. 1998); no splice variationsof the sigma-1 receptor were detected in these neurons. Se-quences for two isoforms of the sigma-1 receptor have beensubmitted previously to GenBank (Mei and Pasternak 1998;Wang et al. 2000). One of these isoforms, sigma-1 receptor,was cloned from mouse and is reported to have sigma-2likebinding activity (Wang et al. 2000). However, transcripts en-coding these truncated forms of the sigma-1 receptor were notobserved, indicating that they do not mediate the cellularresponses to sigma ligands reported in this study.

In the present study, the use of sigma receptor agonists

FIG. 6. Inhibition of Ca2 channel currents in ratintracardiac neurons by sigma receptor ligands. A:Ba2 currents evoked by step depolarizations to 0mV from 90 mV recorded from 4 parasympatheticintracardiac neurons in the absence (Control) andpresence of ibogaine, DTG, ()-pentazocine, andhaloperidol at the indicated concentrations. B: peakwhole cell Ba2 current amplitude normalized tocontrol recorded in the presence of haloperidol(HAL), ibogaine (IBO), ()-pentazocine (PTZ), andDTG. Bars represent means SE for 35 intracar-diac neurons.




10/14

suggests that sigma receptors inhibit Ca2 channels in neurons

from parasympathetic intracardiac ganglia and sympatheticsuperior cervical ganglia. These agonists were shown to inhibit

Ca2 channels in over 90% of the cells tested (n 100). Inautonomic neurons, various cell membrane receptors have

been shown to be coupled to Ca2 channels. In mammalian

intracardiac neurons, M4 muscarinic, -adrenergic, neuropep-tide Y, and -opioid receptors have all been shown to depressCa2 channel currents (Adams and Trequattrini 1998; Cuevasand Adams 1997; Jeong and Wurster 1997a; Kennedy et al.1998; Xu and Adams 1993). However, maximum inhibition ofpeak Ca2 by activation of these receptors is 75%, and theirprimary target is N-type calcium channels, which account for70% of the whole cell calcium current in these cells (Cuevasand Adams 1997; Jeong and Wurster 1997a; Xu and Adams1993). In contrast, activation of sigma receptors in these neu-rons inhibits 95% of the peak current, indicating that allCa2 channel types are affected. It has been reported that thesecells express N-, L-, P/Q-, and R-type calcium channels (Cue-vas and Adams 1997; Jeong and Wurster 1997b; Xu andAdams 1993).

The sigma receptor inhibition of heterogeneous populationsof Ca2 may have significant physiological implications. At-tenuation of N-type Ca2 channels by -conotoxin GVIA failsto block synaptic transmission in parasympathetic ganglia, butbroad-spectrum Ca2 channel inhibitors, such as cadmium,

eliminate excitatory postsynaptic potentials (Seabrook and Ad-

ams 1989). Inhibition of multiple classes of Ca2

channelsmay contribute to the reported sigma receptormediated de-crease in guinea pig ileum longitudinal muscle contraction

(Campbell et al. 1989; Kinney et al. 1995). It has been pro-

posed that a decrease in ACh release is responsible for this

attenuation in muscle contraction (Campbell et al. 1989) andblock of presynaptic Ca2 would depress transmitter release.Therefore activation of sigma receptors may block signalingthrough autonomic ganglia and inhibit modulation of effectortargets by peripheral neurons. In the cardiovascular system,inhibition of parasympathetic input to the heart may accountfor the increased heart rate, arrhythmias, and sudden cardiacdeath observed in some patients during therapy with haloper-idol (Mehta et al. 1979; Settle and Ayd 1983; Turbott andCairns 1984). Furthermore, haloperidol evokes a prolongationof the QT interval in the electrocardiogram (Kriwisky et al.1990), which is similar to that induced by atropine-mediatedvagal block (Annila et al. 1993).

In addition to affecting a broader population of Ca2 chan-nel types than other endogenous modulators of autonomicCa2 channels, activators of sigma receptors have profoundlydifferent effects on Ca2 channel biophysics. Whereas AChand norepinephrine (NE), for example, have no effects on thesteady-state inactivation of Ca2 channels (Cuevas and Adams1997; Xu and Adams 1993), sigma ligands shift the steady-

FIG. 7. Sigma receptor modulation of time-dependent andsteady-state inactivation of Ca2 channels in SCG neurons. A:Ba2 currents evoked from a single neuron by 2-s depolarizationsto 0 mV from a holding potential of 90 mV in the absence(Control), presence of 10 M haloperidol (Haloperidol), andfollowing wash out of drug (Wash). Solid lines represent a best fitof the time course of current decay with the sum of 2 exponentialfunctions. B: relative Ba2 current amplitude as a function ofprepulse amplitude in the absence (E) and presence () of 10 M

haloperidol. Data points represent means SE for 6 neurons.Solid lines represent best fit to the data with a single (control) or2-component (haloperidol) Boltzmann distribution.




11/14

state inactivation curve to more negative potentials. The factthat the voltage dependence of inactivation was best fit by aone-component Boltzmann distribution in the absence of sigmareceptor activation but by a two-component Boltzmann distri-bution in the presence of haloperidol suggests that sigmareceptors may not equally modulate steady-state inactivation inall Ca2 channel subtypes.

Activation of sigma receptors also altered the voltage de-pendence of activation of Ca2 channels in a manner distinctfrom other known Ca2 channel inhibitors. In the presence ofsigma receptor agonists, the Ca2 channel activation curve wasshifted toward more negative potentials. Other inhibitors ofCa2 channels, such as -opioid, muscarinic and -adrenergicagonists, shift the activation curve to more positive potentials(Adams and Trequattrini 1998; Cuevas and Adams 1997; Xuand Adams 1993). Thus stronger depolarizations are requiredin the presence of these agents to activate the same number ofCa2 channels. The shift in the Ca2 channel activation curvetoward more positive potentials has been explained by a will-ing-reluctant model first proposed by Bean (Bean 1989).According to this model, Ca2 channels are converted in thepresence of a modulator from a willing state to a reluctantstate that requires stronger depolarization to open the channel.

Such a shift in the voltage dependence of activation is notobserved here. Further evidence for the lack in willing toreluctant shift in the presence of sigma ligands is provided byexperiments in which prolonged depolarizations were appliedto activate Ca2 channels. The fast component of the inwardCa2 current (1), represents channels in the willing state, andthis component was not preferentially inhibited. In contrast,ACh and NE primarily depress the fast inactivating component(1) in long depolarizations and have little effect on the am-plitude of2 (Cuevas and Adams 1997; Xu and Adams 1993).However, ACh also activates voltage-independent mecha-nisms of Ca2 channel inhibition that result in depression ofIBa at all voltages tested (Cuevas and Adams 1997; Mathie etal. 1992), as is observed here. Similarly, NE inhibition of Ca2

channel activation in rat intracardiac neurons exhibits voltage-dependent and -independent components (Xu and Adams1993). One of the outcomes of sigma receptormediated in-crease in the rate of Ca2 channel inactivation and attenuationof the amplitude of both 1 and 2 is a greater decrease in netCa2 entry through the channels compared with other Ca2

channel inhibitors.Previous studies have suggested a possible relationship be-

tween sigma receptors and calcium channels. Dextromethor-

FIG. 8. Sigma receptor evoked shift in voltage dependence of Ca2 channel activation. A: Ca2 channel tail currents evokedfrom a single neuron by repolarization to 90 mV from the indicated potentials in the absence (Control) and presence of 10 Mhaloperidol (Haloperidol). The time scale is increased 5-fold at the start of repolarization. Mean peak tail current amplitude (B) andrelative peak Ba2 tail current amplitude (C) evoked by repolarization to 90 mV following a brief depolarization to the indicated

potentials in the absence (E

) and presence (

) of 10 M haloperidol. Data points represent means SE for 6 neurons. Solid linesin C represent best fit to the data using a 2-component Boltzmann distribution.




12/14

phan, a nonselective sigma receptor agonist, decreased K

depolarization-evoked Ca2 uptake into brain synaptosomes

and PC12 cells (Carpenter et al. 1988). The half-maximalinhibition of Ca2 uptake by dextromethorphan was consistent

with the effect being mediated by a sigma-2 site, and sigma-2

receptors have been reported in brain and PC12 cells

(Hellewell and Bowen 1990; Reid et al. 1990). It has also been

suggested that some sigma ligands, including dextromethor-phan, inhibit Ca2 currents by directly interacting with Ca2

channels (Church and Fletcher 1995; Flaim et al. 1985). Con-versely, in frog melanotrophs, micromolar concentrations of()-pentazocine have been shown to enhance calcium conduc-tances through activation of sigma receptors (Soriani et al.1999). The present study shows that structurally dissimilarsigma ligands are able to modulate the biophysical propertiesof Ca2 channels. Since these ligands have similar effects onthe biophysical properties of the channels, it is unlikely thatthey would be acting on different sites of the channel. Al-though the exact binding site for these drugs on the clonedsigma-1 receptor has not been identified, any single site thatpermits binding to such a broad array of drugs is likely to bequite complex (see Walker et al. 1990) and conserved. Thus thelack of any significant homology between Ca2 channels andthe cloned sigma-1 receptor suggests that the effects of sigmaligands are likely mediated by a sigma receptor and not a directeffect on the Ca2 channel. The argument against a directeffect of sigma ligands on Ca2 channels is significantly

strengthened by the observation that the sigma receptor antag-

onist, metaphit, blocks the DTG-mediated attenuation of Ca2

channels.Consistent with the effects of sigma ligands on Ca2 chan-

nels being mediated by specific binding of the drugs to a sigmareceptor is the finding that the rank order potency and IC50values for the various sigma ligands tested here are in agree-

ment with those reported previously for sigma-2 receptors.Sigma-2 receptors have been shown to modulate Ca2 releasefrom intracellular stores in human SK-N-SH neuroblastomacells (Vilner and Bowen 2000). The rank order potency re-ported in that study, haloperidol ibogaine ()-pentazo-cine DTG, and micromolar EC50 values are in agreementwith our findings. Sigma-2 receptors have also been reported tomediate the inhibition of guinea pig ileum longitudinal musclecontraction (Kinney et al. 1995). In that study, haloperidol wasshown to depress electrically evoked contractions with an IC50nearly identical to that reported here (6 M). In primarycultures of rat frontal cortical neurons, sigma-2 receptor acti-vation blocked N-methyl-D-aspartate (NMDA) mobilization ofintracellular free Ca2 (Hayashi et al. 1995). The IC50 forhaloperidol and ()-pentazocine inhibition of peak free Ca2

were 6 and 40 M, respectively, also in agreement with thevalues reported here for these drugs. One of the strongest linesof evidence for sigma-2 receptors mediating the inhibition ofCa2 channels in autonomic neurons is our observation thatibogaine, a sigma-2selective agonist (Bowen et al. 1995),

FIG. 9. Sigma receptor inhibition of Ca2 channels is not blocked by intracellular GDP--S. A: depolarization activate (90to 0 mV) Ba2 currents recorded from neurons dialyzed with pipette solutions containing either 100 M GTP (top traces) orGDP--S (bottom traces) in the absence (Control) or presence of 10 M haloperidol (Haloperidol). B: peak IBa recorded fromneurons dialyzed with either GTP or GDP--S in the presence of 10 M haloperidol or 100 M ACh. Currents are normalized totheir respective controls (absence of drug). Asterisk denotes significant difference between groups of cells exposed to ACh.




13/14

exhibits greater potency than ()-pentazocine. The affinity ofsigma-1 receptors for ()-pentazocine is 2,000-fold greaterthan for ibogaine, whereas the affinity of sigma-2 receptors foribogaine is 6-fold higher than for ()-pentazocine (Vilnerand Bowen 2000). The IC50 for ibogaine inhibition of IBa inthese autonomic neurons is twofold greater than that deter-mined for ()-pentazocine.

The primary mechanism by which other known modulators

of Ca

2

in autonomic neurons depress Ca

2

currents is via theactivation of pertussis toxinsensitive G proteins (Adams andTrequattrini 1998; Cuevas and Adams 1997; Xu and Adams1993). However, no such G protein appears to be implicated inthe signal transduction cascade coupling sigma receptors andCa2 channels in these cells, since intracellular dialysis withGDP--S failed to inhibit the effects of sigma ligands. Fur-thermore, the inability of cell dialysis to block the effects ofsigma receptors suggests that a diffusable cytosolic secondmessenger is likely not involved. Similarly, sigma receptorshave been shown to modulate K channels in rat pituitary cellsthrough a membrane-delimited signaling pathway that does notincorporate a G protein (Lupardus et al. 2000). ()-Pentazo-cine exhibited an IC50 value of50 M for the inhibition of

K

channels in neurohypophysial terminals (Lupardus et al.2000), suggesting that, like Ca2 channel inhibition in auto-nomic neurons, it is mediated specifically by sigma-2 recep-tors.

Taken together, molecular biology studies and pharmaco-logical studies conducted here suggest that both sigma-1 andsigma-2 receptors are expressed in intracardiac and superiorcervical ganglion neurons. However, our experiments indicatethat only the sigma-2 receptor, which remains to be cloned,couples to Ca2 channels in these cells. Given that the sigma-2receptor has been shown to be a distinct molecular entity(Hellewell and Bowen 1990), it is doubtful that the sigmareceptor shown to modulate Ca2 channels here is a modifiedform of the sigma-1 receptor gene product. Thus the cellular

function of the sigma-1 receptors found in these autonomicneurons remains to be determined. One possibility is thatsigma-1 receptors are responsible for the changes in actionpotential firing evoked by sigma receptor activation in thesecells (unpublished observation).

In conclusion, rat intracardiac and SCG neurons expresssigma-1 and sigma-2 receptors, and activation of these recep-tors alters the biophysical properties of Ca2 channels andattenuates whole cell Ca2 channel currents. Pharmacologicalexperiments suggest that the modulation of Ca2 channels ismediated by sigma-2 receptors. Because of the importance ofCa2 channels in the function and regulation of the autonomicnervous system, sigma receptors are likely to have a significantrole in the modulation of autonomic nerve activity and thus onregulation of the cardiovascular system and other effectortargets.

We thank C. Reed for conducting preliminary RT-PCR experiments and C. A.Doupnik, Ph.D. and N. Cuevas, R.Ph. for comments on a draft of this manuscript.

Grant support was provided by National Heart, Lung, and Blood InstituteGrant HL-63247 to J. Cuevas.

REFERENCES

ADAMS DJ AND TREQUATTRINI C. Opioid receptormediated inhibition of-conotoxin GVIA-sensitive calcium channel currents in rat intracardiacneurons. J Neurophysiol 79: 753762, 1998.

ANNILA P, YLI-HANKALA A, AND LINDGREN L. Effect of atropine on the QT

interval and T-wave amplitude in healthy volunteers. Br J Anaesth 71:

736 737, 1993.BEAN BP. Neurotransmitter inhibition of neuronal calcium currents by changes

in channel voltage dependence. Nature 340: 153156, 1989.BLUTH LS, RICE KC, JACOBSON AE, AND BOWEN WD. Acylation of sigma

receptors by Metaphit, an isothiocyanate derivative of phencyclidine. Eur

J Pharmacol 161: 273277, 1989.BOWEN WD, VILNER BJ, WILLIAMS W, BERTHA CM, KUEHNE ME, AND

JACOBSON AE. Ibogaine and its congeners are sigma 2 receptor-selective

ligands with moderate affinity. Eur J Pharmacol 279: R1R3, 1995.CAMPBELL BG, BOBKER DH, LESLIE FM, MEFFORD IN, AND WEBER E. Both the

sigma receptor-specific ligand ()3-PPP and the PCP receptor-specificligand TCP act in the mouse vas deferens via augmentation of electricallyevoked norepinephrine release. Eur J Pharmacol 138: 447 449, 1987.

CAMPBELL BG, SCHERZ MW, KEANA JF, AND WEBER E. Sigma receptorsregulate contractions of the guinea pig ileum longitudinal muscle/myentericplexus preparation elicited by both electrical stimulation and exogenousserotonin. J Neurosci 9: 3380 3391, 1989.

CARPENTER CL, MARKS SS, WATSON DL, AND GREENBERG DA. Dextrometh-orphan and dextrorphan as calcium channel antagonists. Brain Res 439:372375, 1988.

CHURCH J AND FLETCHER EJ. Blockade by sigma site ligands of high voltageactivated Ca2 channels in rat and mouse cultured hippocampal pyramidalneurones. Br J Pharmacol 116: 28012810, 1995.

CUEVAS J AND ADAMS DJ. Local anaesthetic blockade of neuronal nicotinicACh receptor-channels in rat parasympathetic ganglion cells. Br J Pharma-col 111: 663 672, 1994.

CUEVAS J AND ADAMS DJ. M4 muscarinic receptor activation modulatescalcium channel currents in rat intracardiac neurons. J Neurophysiol 78:19031912, 1997.

CUEVAS J, ROTH AL, AND BERG DK. Two distinct classes of functional7-containing nicotinic receptor on rat superior cervical ganglion neurons.

J Physiol (Lond) 525: 735746, 2000.ELA C, BARG J, VOGEL Z, HASIN Y, AND EILAM Y. Sigma receptor ligands

modulate contractility, Ca2 influx and beating rate in cultured cardiacmyocytes. J Pharmacol Exp Ther 269: 1300 1309, 1994.

FLAIM SF, BRANNAN MD, SWIGART SC, GLEASON MM, AND MUSCHEK LD.Neuroleptic drugs attenuate calcium influx and tension development inrabbit thoracic aorta: effects of pimozide, penfluridol, chlorpromazine, andhaloperidol. Proc Natl Acad Sci USA 82: 12371241, 1985.

HAMILL OP, MARTY A, NEHER E, SAKMANN B, AND SIGWORTH FJ. Improvedpatch-clamp techniques for high-resolution current recording from cells and

cell-free membrane patches. Pflugers Arch 391: 85100, 1981.HANNER M, MOEBIUS FF, FLANDORFER A, KNAUS HG, STRIESSNIG J, KEMPNER

E, AND GLOSSMANN H. Purification, molecular cloning, and expression of themammalian sigma1-binding site. Proc Natl Acad Sci USA 93: 8072 8077,1996.

HASSALL CJ AND BURNSTOCK G. Neuropeptide Y-like immunoreactivity incultured intrinsic neurones of the heart. Neurosci Lett 52: 111115, 1984.

HAYASHI T, KAGAYA A, TAKEBAYASHI M, SHIMIZU M, UCHITOMI Y, MO-TOHASHI N, AND YAMAWAKI S. Modulation by sigma ligands of intracellularfree Ca2 mobilization by N-methyl-D-aspartate in primary culture of ratfrontal cortical neurons. J Pharmacol Exp Ther 275: 207214, 1995.

HELLEWELL SB AND BOWEN WD. A sigma-like binding site in rat pheochro-mocytoma (PC12) cells: decreased affinity for ()-benzomorphans andlower molecular weight suggest a different sigma receptor form from that ofguinea pig brain. Brain Res 527: 244 253, 1990.

JEONG SW, IKEDA SR, AND WURSTER RD. Activation of various G-proteincoupled receptors modulates Ca2 channel currents via PTX-sensitive and

voltage-dependent pathways in rat intracardiac neurons. J Auton Nerv Syst76: 68 74, 1999.

JEONG SW AND WURSTER RD. Muscarinic receptor activation modulates Ca2

channels in rat intracardiac neurons via a PTX- and voltage-sensitive path-way. J Neurophysiol 78: 1476 1490, 1997a.

JEONG SW AND WURSTER RD. Calcium channel currents in acutely dissociatedintracardiac neurons from adult rats. J Neurophysiol 77: 1769 1778, 1997b.

KARHULA T. Comparison of immunohistochemical localization of Met-en-kephalin-Arg6-Gly7-Leu8, Met-enkephalin, neuropeptide Y and vasoactiveintestinal polypeptide in the superior cervical ganglion of the rat. J Auton

Nerv Syst 51: 9 18, 1995.KEKUDA R, PRASAD PD, FEI YJ, LEIBACH FH, AND GANAPATHY V. Cloning and

functional expression of the human type 1 sigma receptor (hSigmaR1).Biochem Biophys Res Commun 229: 553558, 1996.




14/14

KENNEDY AL, HARAKALL SA, LYNCH SW, BRAAS KM, HARDWICK JC, MAWE

GM, AND PARSONS RL. Expression and physiological actions of neuropep-

tide Y in guinea pig parasympathetic cardiac ganglia. J Auton Nerv Syst71:

190 195, 1998.KENNEDY C AND HENDERSON G. Inhibition of potassium currents by the sigma

receptor ligand ()-3-(3-hydroxyphenyl)-N-(1-propyl)piperidine in sympa-thetic neurons of the mouse isolated hypogastric ganglion. Neuroscience 35:

725733, 1990.KESSLER JA AND BLACK IB. Regulation of substance P in adult rat sympathetic

ganglia. Brain Res 234: 182187, 1982.

KINNEY GG, HARRIS EW, RAY R, AND HUDZIK TJ. 2 Site-mediated inhibitionof electrically evoked guinea pig ileum longitudinal muscle/myenteric

plexus contractions. Eur J Pharmacol 294: 547553, 1995.KRIWISKY M, PERRY GY, TARCHITSKY D, GUTMAN Y, AND KISHON Y. Halo-

peridol-induced torsades de pointes. Chest 98: 482 484, 1990.LARSON AA AND SUN X. Regulation of sigma activity by the amino-terminus

of substance P in the mouse spinal cord: involvement of phencyclidine

(PCP) sites not linked to N-methyl-D-aspartate (NMDA) activity. Neuro-

pharmacology 32: 909 917, 1993.LUPARDUS PJ, WILKE RA, AYDAR E, PALMER CP, CHEN Y, RUOHO AE, AND

JACKSON MB. Membrane-delimited coupling between sigma receptors andK channels in rat neurohypophysial terminals requires neither G-proteinnor ATP. J Physiol (Lond) 526: 527539, 2000.

MATHIE A, BERNHEIM L, AND HILLE B. Inhibition of N- and L-type calciumchannels by muscarinic receptor activation in rat sympathetic neurons.

Neuron 8: 907914, 1992.

MEHTA D, MEHTA S, PETIT J, AND SHRINER W. Cardiac arrhythmia andhaloperidol. Am J Psychiatry 136: 1468 1469, 1979.

MEI J AND PASTERNAK GW. Molecular cloning and characterization of ratsigma 1 receptor and its splice isoform. GenBank, AF087827, 1998.

MORIN-SURUN MP, COLLIN T, DENAVIT-SAUBIE M, BAULIEU EE, AND MONNETFP. Intracellular sigma1 receptor modulates phospholipase C and proteinkinase C activities in the brainstem. Proc Natl Acad Sci USA 96: 8196 8199, 1999.

NOVAKOVA M, ELA C, BARG J, VOGEL Z, HASIN Y, AND EILAM Y. Inotropicaction of sigma receptor ligands in isolated cardiac myocytes from adult rats.

Eur J Pharmacol 286: 19 30, 1995.PAPKA RE, FURNESS JB, AND DELLA NG, AND COSTA M. Depletion by capsaicin

of substance P-immunoreactivity and acetylcholinesterase activity fromnerve fibres in the guinea-pig heart. Neurosci Lett 27: 4753, 1981.

POTH K, NUTTER TJ, CUEVAS J, PARKER MJ, ADAMS DJ, AND LUETJE CW.Heterogeneity of nicotinic receptor class and subunit mRNA expressionamong individual parasympathetic neurons from rat intracardiac ganglia.

J Neurosci 17: 586 596, 1997.

QUIRION R, BOWEN WD, ITZHAK Y, JUNIEN JL, MUSACCHIO JM, ROTHMAN RB,SU TP, TAM SW, AND TAYLOR DP. A proposal for the classification of sigmabinding sites. Trends Pharmacol Sci 13: 85 86, 1992.

RAE J, COOPER K, GATES P, AND WATSKY M. Low access resistance perforatedpatch recordings using amphotericin B. J Neurosci Methods 37: 1526,1991.

REID AA, KIM CH, THURKAUF A, MONN JA, DE COSTA B, JACOBSON AE, RICEKC, BOWEN WD, AND ROTHMAN RB. Wash-resistant inhibition of phency-clidine- and haloperidol-sensitive sigma receptor sites in guinea pig brain byputative affinity ligands: determination of selectivity. Neuropharmacology

29: 10471053, 1990.ROMAN FJ, PASCAUD X, DUFFY O, VAUCHE D, MARTIN B, AND JUNIEN JL.Neuropeptide Y and peptide YY interact with rat brain sigma and PCPbinding sites. Eur J Pharmacol 174: 301302, 1989.

SEABROOK GR AND ADAMS DJ. Inhibition of neurally-evoked transmitterrelease by calcium channel antagonists in rat parasympathetic ganglia. Br JPharmacol 97: 11251136, 1989.

SETH P, FEI YJ, LI HW, HUANG W, LEIBACH FH, AND GANAPATHY V. Cloningand functional characterization of a sigma receptor from rat brain. J Neu-rochem 70: 922931, 1998.

SETTLE EC JR AND AYD FJ JR. Haloperidol: a quarter century of experience.J Clin Psychiatry 44: 440 448, 1983.

SORIANI O, FOLL FL, ROMAN F, MONNET FP, VAUDRY H, AND CAZIN L.A-Current down-modulated by sigma receptor in frog pituitary melanotropecells through a G protein-dependent pathway. J Pharmacol Exp Ther 289:321328, 1999.

TURBOTT J AND CAIRNS FJ. Sudden death and neuroleptic medication. Am J

Psychiatry 141: 919 920, 1984.VILNER BJ AND BOWEN WD. Modulation of cellular calcium by sigma-2

receptors: release from intracellular stores in human SK-N-SH neuroblas-toma cells. J Pharmacol Exp Ther 292: 900 911, 2000.

WALKER JM, BOWEN WD, WALKER FO, MATSUMOTO RR, DE COSTA B, ANDRICE KC. Sigma receptors: biology and function. Pharmacol Rev 42: 355402, 1990.

WANG L-M, SHELNESS GS, CHILDERS SR, MACH RH, AND WHEELER KT. Sigma1 beta receptor, an alternative splice variant of the sigma 1 receptor.GenBank, AF226605, 2000.

XU ZJ AND ADAMS DJ. Voltage-dependent sodium and calcium currents incultured parasympathetic neurones from rat intracardiac ganglia. J Physiol(Lond) 456: 425 441, 1992.

XU ZJ AND ADAMS DJ. Alpha-adrenergic modulation of ionic currents incultured parasympathetic neurons from rat intracardiac ganglia. J Neuro-

physiol 69: 1060 1070, 1993.ZHANG HL AND CUEVAS J. Sigma receptors modulate electrical properties of

autonomic neurons. FASEB J 15: 202.21, 2001.



Date post:	04-Apr-2018
Category:	Documents
Upload:	paolo-mastroviti
View:	216 times
Download:	0 times

26956819 Sigma Receptors

Documents