9/14/2015 BCHB524 - 2015 - Edwards

Introduction to Python

BCHB5242015

Lecture 4

9/14/2015 BCHB524 - 2015 - Edwards

Outline

Review Homework #1 Notes Control flow: if statement Control flow: for statement Exercises

2

9/14/2015 BCHB524 - 2015 - Edwards

Review

Printing and execution Variables and basic data-types:

integers, floats, strings Arithmetic with, conversion between String characters and chunks, string methods

Functions, using/calling and defining: Use in any expression Parameters as input, return for output Functions calling other functions (oh my!)

If statements – conditional execution

3

Homework #1 Notes

Python programs: Upload .py files Don't paste into comment box Don't paste into your writeup

Writeup: Upload .txt files, Don't paste into comment box Text document preferred

9/14/2015 BCHB524 - 2015 - Edwards 4

Homework #1 Notes

Multiple submissions: OK, but… …I'll ignore all except the last one Make each (re-)submission complete

Grading: Random grading order Comments Grading "curve"

9/14/2015 BCHB524 - 2015 - Edwards 5

Control Flow: if statement

Execution path depends on string in seq. Make sure you change seq to different

values.9/14/2015 BCHB524 - 2015 - Edwards

# The input DNA sequenceseq = 'atggcatgacgttattacgactctgtgtggcgtctgctggg'

# Remove the initial Met codon if it is thereif seq.startswith('atg'): print "Sequence without initial Met:",seq[3:]else: print "Sequence (no initial Met):",seq

6

Control Flow: if statement

9/14/2015 BCHB524 - 2015 - Edwards

# The input DNA sequenceseq = 'atggcatgacgttattacgactctgtgtggcgtctgctggg'

# Remove the initial Met codon if it is thereif seq.startswith('atg'): initMet = True newseq = seq[3:]else: initMet = False newseq = seq

# Output the resultsprint "Original sequence:",seqprint "Sequence starts with Met:",initMetprint "Sequence without initial Met:",newseq

7

Control Flow: if statement

9/14/2015 BCHB524 - 2015 - Edwards

# The input DNA sequenceseq = 'atggcatgacgttattacgactctgtgtggcgtctgctggg'

# Remove the initial Met codon if it is thereinitMet = seq.startswith('atg'):if initMet: newseq = seq[3:]else: newseq = seq

# Output the resultsprint "Original sequence:",seqprint "Sequence starts with Met:",initMetprint "Sequence without initial Met:",newseq

8

Control Flow: if statement

9/14/2015 BCHB524 - 2015 - Edwards

# The input DNA sequenceseq = 'atggcatgacgttattacgactctgtgtggcgtctgctggg'

# Remove the initial Met codon if it is thereinitMet = seq.startswith('atg')if initMet: seq = seq[3:]

# Output the resultsprint "Sequence starts with Met:",initMetprint "Sequence without initial Met:",seq

9

Serial if statement

9/14/2015 BCHB524 - 2015 - Edwards

# Determine the complementary nucleotidedef complement(nuc): if nuc == 'A': comp = 'T' if nuc == 'T': comp = 'A' if nuc == 'C': comp = 'G' if nuc == 'G': comp = 'C' return comp

# Use the complement functionprint "The complement of A is",complement('A')print "The complement of T is",complement('T')print "The complement of C is",complement('C')print "The complement of G is",complement('G')

10

Compound if statement

9/14/2015 BCHB524 - 2015 - Edwards

# Determine the complementary nucleotidedef complement(nuc):    if nuc == 'A':        comp = 'T'    elif nuc == 'T':        comp = 'A'    elif nuc == 'C':        comp = 'G'    elif nuc == 'G':        comp = 'C'    else:        comp = nuc    return comp

# Use the complement functionprint "The complement of A is",complement('A')print "The complement of T is",complement('T')print "The complement of C is",complement('C')print "The complement of G is",complement('G')

11

If statement conditions

Any expression (variable, arithmetic, function call, etc.) that evaluates to True or False

Any expression tested against another expression using: == (equality), != (inequality) < (less than), <= (less than or equal) > (greater than), >= (greater than or equal) in (an element of)

Conditions can be combined using: and, or, not, and parentheses

9/14/2015 BCHB524 - 2015 - Edwards 12

Sequential/Iterative execution

Note use of indentation to define a block!

9/14/2015 BCHB524 - 2015 - Edwards 13

For (each) statements

# Print the numbers 0 through 4for i in range(0,5): print i

# Print the nucleotides in seqseq = 'ATGGCAT'for nuc in seq: print nuc

9/14/2015 BCHB524 - 2015 - Edwards 14

For (each) statements

# Input to programseq = 'AGTAGTTCGCGTAGCTAGCTAGCTATGCG'

# Examine each symbol in seq and count the A'scount = 0for nuc in seq: if nuc == 'A': count = count + 1

# Output the resultprint "Sequence",seq,"contains",count,"A symbols"

9/14/2015 BCHB524 - 2015 - Edwards 15

For (each) statements

# Examine each symbol in seq and count the A'sdef countAs(seq): count = 0 for nuc in seq: if nuc == 'A': count = count + 1 return count

# Input to programinseq = 'AGTAGTTCGCGTAGCTAGCTAGCTATGCG'

# Compute countaCount = countAs(inseq)

# Output the resultprint "Sequence",inseq,"contains",aCount,"A symbols"

9/14/2015 BCHB524 - 2015 - Edwards 16

For (each) statements

# Examine each symbol in seq and count those that match symdef countSym(seq,sym): count = 0 for nuc in seq: if nuc == sym: count = count + 1 return count

# Input to programinseq = 'AGTAGTTCGCGTAGCTAGCTAGCTATGCG'

# Compute countaCount = countSym(inseq,'A')

# Output the resultprint "Sequence",inseq,"contains",aCount,"A symbols"

Exercise 1 Write a Python program to compute the

reverse complement of a codon Use my solution to Homework #1 Exercise #1 as a

starting point Add the “complement” function of this lecture

(slide 12) as provided. Modularize! Place the reverse complement

code in a new function. Call the new function with a variety of codons

Change the complement function to handle upper and lower-case nucleotide symbols. Test your code with upper and lower-case codons.

9/14/2015 BCHB524 - 2015 - Edwards 17

9/14/2015 BCHB524 - 2015 - Edwards 18

Exercise 2 Write a Python program to determine whether or not

a DNA sequence consists of a (integer) number of (perfect) "tandem" repeats. Test it on sequences:

AAAAAAAAAAAAAAAA CACACACACACACAC ATTCGATTCGATTCG GTAGTAGTAGTAGTA TCAGTCACTCACTCAG

Hint: Is the sequence the same as many repetitions of its first character?

Hint: Is the first half of the sequence the same as the second half of the sequence?