ORIGINAL PAPER

A Full-Length Dof1 Transcription Factor of Finger Milletand its Response to a Circadian Cycle

Anil Kumar & Pooja Kanwal & Alok Kumar Gupta &

B. R. Singh & Vikram Singh Gaur

Published online: 1 October 2013# Springer Science+Business Media New York 2013

Abstract DOF1 (DNA binding with one finger) plays animportant role in regulating C/N metabolism in cereals. Inorder to validate its role in the regulation of nitrogen useefficiency (NUE) and photosynthetic efficiency in finger mil-let, 5′–3′RACE PCRwas performed to obtain and characterizefull-length Dof1 genes of high and low grain protein fingermillet genotypes. The full-length DOF1 ORFs were both 1,284 nt long and were 98.8 % similar over 427 amino acidscontaining the characteristic Dof domain. Comparison of boththe EcDof1 protein sequences with the Dof1 of other cerealsrevealed high sequence similarity to the Dof1 of rice. Southernhybridization carried out using the probe developed from theregion encoding the highly variable C-terminal region ofEcDof1 showed the presence of four copies of theDOF1 genein finger millet, which might explain the high NUE and pho-tosynthetic performance of finger millet. Since the genes in-volved in C/N metabolism are regulated diurnally and playcrucial roles in determining grain protein content during grainfilling, the diurnal expression of EcDOF1 was assessed in twofinger millet genotypes (GE 3885 and GE 1437) with differinggrain protein content (13.8 % and 6.15 % respectively). It wasfound that EcDOF1 exhibited diurnal regulation and peakdifferential pattern expression with early phasing in GE3885and late phasing in GE1437. Differential expression of DOF1might alter the regulation of genes involved in C/Nmetabolismaffecting grain protein composition of finger millet genotypes.

Keywords Finger millet . Dof transcription factor . Southernblotting . Real time PCR

AbbreviationsEcCaM Eleusine coracana calmodulinRACE Rapid amplification of cDNA endsORF Open reading frameDof DNA binding with one finger

Introduction

The Dof (DNA bindingwith one finger) family of transcriptionfactors are plant-specific transcription factors that are definedby the presence of a characteristic C2C2-type zinc fingerDNA-binding domain. The first Dof transcription factor wasisolated from maize by Yanagisawa and Schmidt (1999) andsince then many Dof transcription factor genes from differentplants have been isolated and functionally characterized. Dof isinvolved in regulating the expression of genes associated withcarbon assimilation (Yanagisawa and Sheen 1998; Yanagisawa2000), phytochrome signalling (Ward et al. 2005), seed matu-ration and germination (Gualberti et al. 2002; Washio 2003),the responses to auxin (Baumann and Gualberti 1999) andsalicylic acid (Kang et al. 2003), the function of stomata guardcells (Plesch et al. 2001), photoperiodic flowering and biosyn-thesis of glucosinolates (Skirycz et al. 2006), floral organabscission (Wei et al. 2010), secondary wall deposition andcarbon partitioning in poplar (Gerhardt et al. 2011), as atranscriptional repressor in the nutrient condition-dependentgrowth (Sugiyama et al. 2012) and germination in non-after-ripened seeds (Rueda-Romero et al. 2012). Since the abovelisted examples are plant specific phenomena, it was suggestedthat members of the Dof transcription factor family are in-volved in regulating processes that are specific only to plants.

Electronic supplementary material The online version of this article(doi:10.1007/s11105-013-0653-5) contains supplementary material,which is available to authorized users.

A. Kumar (*) : P. Kanwal :A. K. Gupta : B. R. Singh :V. S. GaurDepartment of Molecular Biology and Genetic Engineering, Collegeof Basic Sciences and Humanities, GB Pant University ofAgriculture and Technology, Pantnagar, Uttarakhand 263 145, Indiae-mail: ak_gupta2k@rediffmail.com

Plant Mol Biol Rep (2014) 32:419–427DOI 10.1007/s11105-013-0653-5

All known Dof transcription factors have a single copy ofthe highly conserved DNA binding Dof domain, which ingeneral is located within the N-terminal regions of the respec-tive proteins. Binding site experiments have revealed that theDNA binding domains of all Dof proteins bind specifically tothe 5′-AAAG-3′ sequence motif present in the promoters ofthe genes regulated by Dof transcription factors (Yanagisawaand Schmidt 1999).The highly divergent C-terminal region ofthe Dof protein interacts with RNA polymerase to initiate orrepress transcription (Martínez et al. 2005; Yamamoto et al.2006). Furthermore, some Dof domains have been shown tobe involved not only in DNA recognition but also in specificprotein–protein interactions (Washio 2003). Hence, Dof tran-scription factors show versatility and, regardless of their verysimilar DNA recognition properties, are thought to be capableof regulating particular gene promoters via specific protein–protein interactions (Rubio-Somoza et al. 2006). Specificmembers of the Dof transcription gene family commonlyknown as Dof1 have remarkably been shown to act like masterregulators by simultaneously regulating the genes involved incarbon (PEPC , PK , CyPPDK ) and nitrogen (NR , GS ,GOGAT etc.) metabolism. This important finding led to thegeneration of transgenic Arabidopsis lines carrying overexpressed maize Dof1 that showed improved nitrogen useefficiency (NUE) under low nitrogen conditions. This showedthat, since single transcription factors frequently regulate coor-dinated expression of a set of key genes of metabolic pathways,modification of transcription factors might be a powerful ap-proach for the generation of crops with superior characteristics.

The NUE of cereals crops/major food crops is far less than50 %, indicating that excessive application of nitrogenousfertilizers goes to waste or is not utilized. Moreover, it hasalso now been realized that this wasted nitrogen is becomingan environmental threat. Therefore, research endeavors needto focus on developing new crop varieties that have high NUEunder low nitrogen inputs. Since common cereals genomeshave a limited gene pool for this trait (high NUE), research onunderstanding the mechanism of the highNUE of fingermillet(Eleusine coracana L.) would seem appropriate. Finger milletthrives on almost no nitrogen input, has a high NUE andaccumulates high amounts of proteins in its grains. It appearsthat the finger millet crop has devised unique regulatorycontrols to achieve high NUE under limiting nitrogen condi-tions. To understand the mechanisms of high NUE in fingermillet we earlier isolated and cloned a partial fragment of thefinger millet DOF1 gene (EcDOF1 ) and investigated its rolein three finger millet genotypes differing in grain proteincontent. It was found that EcDOF1 was expressed maximallyin leaves—the main photosynthetic part of plants—suggestingits role in regulating photosynthesis-related genes and carbonskeleton synthesis (Gupta et al. 2011). To gain more insightinto its role as a master regulator, the present study wasundertaken to further characterize the EcDOF1 gene by

isolating the full length gene sequence of EcDOF1 and deter-mining its copy number in the finger millet genome followedby studying its expression pattern in 24 h diurnal cycle in twofinger millet genotypes with differing grain protein content.

Materials and Methods

Plant Material and Growth Conditions

A partial sequence of Dof1 was earlier isolated in our labora-tory from the finger millet genotype PRM1 (Kushwaha et al.2008). Therefore, the same genotype was taken in the presentstudy to isolate the full-length gene of DOF1 and determina-tion of its copy number. For Southern hybridization, the seedswere sown in the dark and genomic DNAwas isolated from 10-day-old etiolated seedlings. To study the diurnal expression ofEcDOF1 , two genotypes of finger millet, namely GE 3885 andGE 1437, differing in grain protein content (13.76 % and6.15 %, respectively) but having almost similar grain carbohy-drate content (64.83 % and 75.57 %, respectively) were select-ed and grown in Murashige and Skoog (MS) culture mediumas described by Wang et al. (2005) for 15 days under 16 h(0600 h to 2200 h) light and 8 h (2200 h to 0600 h) darkconditions with 70% −75% relative humidity, 300μMm−2 s−1

light intensity, and 25 °C temperature. On the 16th day, leafsamples (3rd leaf) were taken for RNA isolation at the follow-ing time intervals: 0630 hours, 0800 hours, 1200 hours,1600 hours, 1800 hours, and 2400 hours.

3′ and 5′ RACE to Isolate the Full-Length DOF1 Gene

Plants of finger millet PRM-1 genotype were raised in potsunder greenhouse conditions. SinceDOF1 is highly expressedin vegetative tissues, leaf samples were harvested at the vege-tative stage for total RNA isolation. Total RNA was isolatedusing the total RNA isolation iRIS system (GeneI, Bangalore,India) and was subjected to DNaseI (Fermentas, St. Leon Rot,Germany) digestion according to the manufacturer’s instruc-tions. The primer set used for first strand cDNA synthesis andgene specific primers for the amplification of 5′ and 3′ cDNAdesigned from the previously isolated partial sequence ofEcDof1 (accession no. GQ260456) are given in Table 1.Both 3′ and 5′ RACE were performed using the 3′ and 5′RACE Kit (Roche, Mannheim, Germany) according to themanufacturer’s instructions. Briefly, for both 3′ and 5′ RACE,2 μg total RNAwas used to synthesize first strand cDNA. For5′ RACE cDNA synthesis, the gene specific primer 5′GSP1was used, whereas for 3′RACE cDNA synthesis, the oligo(dT)anchor primer was used. The cDNA hence prepared for 5′RACE was purified using a High pure PCR product purifica-tion kit (Roche) and was poly-A tailed using dATP and termi-nal transferase (Roche) according to the manufacturer’s

420 Plant Mol Biol Rep (2014) 32:419–427

instructions. For PCR, the cDNA was diluted ten times andamplified using the internal gene specific primers given inTable 1. After a first round of PCR amplification, a series ofnested PCRs was performed using the PCR product of eachstep diluted 100 times as template, and gene specific primers.The first round of cDNA amplification and subsequent roundsof nested PCRs for both 5′ and 3′ RACE PCR were performedin a 25 μl PCR reaction volume containing 1 × KCl buffer(Fermentas) containing 0.2 mM dNTPs, 30 ng each primer,1.5 mM MgCl2, 0.8 U Taq DNA polymerase (Promega,Madison, WI) and 1 μl template. Amplification was carriedout according to the following temperature profile: 5 min initialdenaturation at 95 °C; 40 cycles of 94 °C for 1 min, annealingtemperature (according to Tm of primers) for 1 min, 72 °C for2 min; final extension of 10 min at 72 °C; and final hold at4 °C. The nested PCR products of both 3′ and 5′ RACE wereeluted from the gel using a Qiagen gel elution kit (Qiagen,Hilden, Germany) and subsequently cloned in the pGEMTcloning vector (Promega) and sequenced.

Isolation of Full Length DOF1 mRNA from High and LowProtein Genotype and In Silico Analysis

The 5′ and 3′ nucleotide sequences recovered from RACE andalready available partial sequence of Dof1 were assembled toobtain the full-length mRNA sequence. Using the assembledfull lengthDOF1 gene, a gene specific primer set was designedto amplify full length Dof1 ORF from the high and low grainprotein genotype (Table 1). Amplified PCR product was clonedand sequenced as described above. The ORF of both the fulllength Dof1 was translated using a translation tool (http://www.expasy.org/tools/dna.html) to obtain the amino acid sequence.The Dof1 sequences reported in other crops were downloadedfrom NCBI and aligned using ClustalW (Thompson et al.1994) and a phylogenetic tree constructed using the neighbor-hood joining method was inferred by running 10,000 bootstrapreplications using the software MEGA Ver. 4.0.02 (Tamuraet al. 2007) (Fig. 2). GenBank accession numbers of Dof1protein sequences used to construct the phylogenetic tree were

as follows: NP_001049101.1 (Oryza sativa), NP_001105709.1 (Zea mays), DAA34030.1 (Sorghum bicolor), AAX54942.2(Triticun aestivum), CAJ29307.1 (Hordeum vulgare). To iden-tify conservedmotifs, the protein sequence of six Dof1 genes ofdifferent crops were analyzed using the online tool MEME ver.4.4.0 (http://meme.nbcr.net/meme/cgi-bin/meme.cgi) (Baileyet al. 2006). The maximum number of motifs was set to 10with minimum and maximum width 6 and 60, respectively,while the other factors were of default selections. The deducedamino acid sequence of EcDof1 mRNA sequence isolatedfrom both high and low grain protein finger millet geno-types along with 5 DOF1 genes of different cereals wereanalyzed for putative phosphorylation sites using NetPhos2.0 (Blom et al. 1999).

Genomic Southern Hybridization

Genomic DNA was extracted from etiolated seedlings usingthe standard method described by Murray and Thompson(1980) and purified using the phenol chloroform extractionmethod.

Fifteen micrograms of DNAwas digested with six restric-tion enzymes: BamHI, EcoRI, HindIII, Pst I and Kpn I(Fermentas). Each digestion mix contained 20 μl of the ap-propriate 10× enzyme reaction buffer and 50 U restrictionenzyme in a final volume of 200 μl. The reactions wereinitially incubated at 37 °C for 4 h. After 4 h, an additional50 U restriction enzyme was added and the reaction mix wasincubated overnight. Southern blotting was carried outaccording to Sambrook et al. (1989). For probe preparation,the full-length Dof1 gene obtained after 5′ and 3′ RACE wasused to design specific primers amplifying a region 231 bpclose to the 3′ end of the Dof1 mRNA. The primers used wereDof1Fwd:CCCAACTCCCAGTCTGAAT and Dof1Rev:ATCTTTGCCCACCTTGTCAC and the amplification pro-gram was as follows: 5 min initial denaturation at 95 °C; 40cycles of 94 °C for 1 min, 60 °C for 30 s, 72 °C for 1 min; finalextension of 10 min at 72 °C; and final hold 4 °C. The PCRproduct was purified using high pure PCR product purification

Table 1 Gene-specific primersused for 5′ and 3′ RACE PCR forrecovering the full lengthEcDOF1 gene and the DOF1gene specific primers for isolatingthe full length Dof1 ORF from theLow and High Grain proteinFinger millet genotypes

Sample no. Primer code Primer sequence 5′ to 3′ Tm(°C)

1 5′RACE GSP1 GAAACACAGAGAGGATCGACGGGCAGAG 70.0

2 5′RACE GSP2 AGCCCGGACCCTCTGAAGGAAGTGAG 68.0

3 5′RACE GSP3 TGTCCAGTACCTCTGGCAGTTC 65.0

6 3′RACE GSP1 AAGAGTGCATCTGCTGCTTC 62.0

7 3′RACE GSP2 AGTACTCAGCTTTGGCTCTGA 60.0

8 OligodT adaptor GACTCGAGTCGACATCGA(T)17 60.6

9 Adapter primer GACTCGAGTCGACATCG 53.0

10 Dof1F CGGGATCCCGGAGACATGGCGGAGTGCAGA 58.0

11 Dof1R CGGAATTCCGTCAAGATCCTTCCTGGAAGG 58.0

Plant Mol Biol Rep (2014) 32:419–427 421

kit (Roche) and was labeled with Biotin-11-dUTP using BiotinDecaLabelTM DNA labeling kit (Fermentas) according to pro-cedure outlined by the supplier. Hybridization was performedusing Church Hybridization method as described in Sambrooket al. (1989). Detection was performed using the Biotindetection kit (Fermentas) according to the manufacturer’sinstructions.

Expression Analysis of DOF1 Gene

Real time PCR was performed using the 5 Prime Real MasterMix SYBR ROX (Eppendorf India Private Limited) accordingto the manufacturer’s instructions. The thermocycler used wasEppendorf ep real plex-4. Total RNAwas isolated from at leastthree independent leaf samples of the selected genotypes(GE3885 and GE1437) at the time intervals mentioned inMaterials and methods; cDNAs were synthesized as describedfor RACE. The tubulin gene was selected as the endogenousinternal standard and primers (Fwd: TGGTACGTGGGTGAGGGTAT and Rev: AGCAGGAAGCGGTAGATTCA)for detection of its expression were designed from the se-quence accession no. CX265249. The primers used fordetecting Dof1 gene expression were the same as those usedfor preparing the probe for Southern hybridization. Real timePCR was performed in a reaction volume of 20 μl containing2.5 × Real Master Mix SYBR ROX /20 × SYBR solution,100 nM of each forward and reverse primers and 100 ngcDNA. The real time PCR amplification program was set asfollows: 95 °C for 2 min, 40 cycles at 95 °C for 30 s, 60 °C for30 s and 72 °C for 30 s and last cycle at 60 °C for 15 s and95 °C for 15 s. All samples were amplified in triplicate and themean and SE values were calculated. Relative expression ofDof1 was calculated the by ΔΔCT method (Livak andSchmittgen 2001).

Results

Isolation of Full Length EcDOF1 Gene and In SilicoCharacterization

In the present study, 3′ and 5′RACEwas performed in order toobtain full length sequence of the DOF1 gene in a series ofnested PCR reactions. 5′ RACE produced smeared PCR prod-ucts in the first two rounds of nested PCR. However, anintense amplicon corresponding to the true 5′ region wasobtained in the third nested PCR (Fig. 1a). 3′ RACE gaveclear PCR products in the first amplification and the nestedPCR produced the desired 3′ region (Fig. 1b). 353 and 959nucleotides were recovered through 5′ and 3′ RACE PCR,respectively. The assembled sequence showed that EcDof1mRNA contains an ORF of 1,284 bp encoding 427 aminoacids containing the characteristic Dof domain (Fig. 2, and

Supplementary Fig. S1). Using the assembled full length Dof1mRNA sequence information, primers were designed to iso-late the full length Dof1 ORF of the high and low grain proteingenotypes used in the present study. On comparing the nucle-otide and the translated protein sequence of both full lengthDof1 ORFs, it was found that the sequences were 98.8 % and98.4 % identical, respectively (Fig. 3). Phylogenetic analysisof the protein sequences of the isolated Finger millet DOF1genes with the DOF1 genes of other cereals such as Oryzasativa , Sorghum bicolor, Hordeum vulgare , Tritium aestivumand Zea mays showed that both the Dof1 genes of fingermillet shared the highest degree of sequence similarity withDof1 of Oryza sativa compared to Zea mays Dof1, while theother Dof1 fell into a distinct group (Fig. 4, SupplementaryFig. S2). Protein sequences of different cereal DOF1 genesalong with the isolated EcDOF1 gene were further analyzedto find conserved motifs in the coding region using the onlinelocal alignment tool MEME ver. 4.4.0 (Bailey et al. 2006).According to the parameters set as described in the Materialsand methods, a total of nine motifs were detected in the Dof1sequences of the selected crops. The distribution of the con-served motifs in different Dof1 accessions is shown in Fig. 5.The Dof1 of finger millet contained all the motifs except motifnumber 8, which was present only inOryza sativa (one copy)and in Hordeum vulgare (five copies). Motif 1, representingthe Dof domain was present in all the proteins, forms a singlezinc finger and is critical for DNA binding. Further analysis ofthe identified domains in the Dof1 protein sequences revealedthat Dof1 of finger millet and its Oryza sativa homologcontained common motifs at similar positions. However, theabsence of motif number 8 in finger millet Dof1 indicates

Fig. 1 a , b 5′-3′ RACE PCR products of the DOF1 gene of Eleusinecoracana . The 5′ and 3′ regions were amplified from cDNA derived fromvegetative leaf tissue using sets of gene specific primers for nested PCRreactions (diluted PCR products of one PCR reaction was used as tem-plate for the second nested PCR reaction using inner primers. a 5′-RACEfrom the first PCR (Lane1) and nested PCR (Lane2). b 3′ RACE fromfirst PCR (Lane1), and subsequent nested PCRs (Lanes 2, 3). Bands of thefinal nested PCR products were eluted from the gel, cloned in the pGEMTeasy vector and subsequently sequenced. M 100 bp DNA ladder

422 Plant Mol Biol Rep (2014) 32:419–427

differential activity of Dof1 in finger millet and rice. Analysisof full length proteins of Dof1 for putative phosphorylationsites using NetPhos 2.0 (Blom et al. 1999) revealed the pres-ence of 35 and 31 phosphorylation sites in the Dof1 of low andhigh grain protein finger millet genotypes, respectively, while33, 30, 24, 22 and 17 phosphorylation sites were found to bepresent in the Dof1 protein sequence of Triticum aestivum ,Oryza sativa , Hordeum vulgare , Zea mays , and Sorghumbicolor, respectively.

Southern Hybridization

Southern blot hybridization revealed four intense bands withBamHI, Pst I, HindIII, Kpn I (Fig. 6) indicating the presenceof four copies of the DOF1 gene in the tetraploid (AABB)genome of finger millet. However, only a single copy ofDOF1 gene has been reported in the genomes of other cereal

crops. Genomic DNA digested with EcoR1 showed no mea-surable bands, which might be due to degradation or shearingof genomic DNA.

Differential Expression of DOF1 Gene in a 24-h DiurnalCycle

DOF1 expression in GE 3885 increased during the first 2 h ofthe light period, reaching a maximum of 1.76 fold at0800 hours and then remaining almost constant until1200 hours before decreasing over the next 4 h reaching aminimum of 0.294 fold at 1600 hours (Fig. 7). Similar to GE3885, DOF1 expression in GE 1437 reached 1.62 fold at0800 hours and remained nearly constant until 1200 hoursbefore declining to 0.290 fold at 1600 hours. However, itsexpression again increased and peaked to a maximum of 2.19fold at 1800 hours before declining to 0.375 fold at 2400 hours

Fig. 2 Comparison of thededuced amino acid sequence ofthe Dof1mRNAs of high (HP-GE3885) and low (LP-GE 1437)grain protein genotype used in thepresent study. The ORF of bothHP and LP EcDof1 is 1,284 bplong, encoding an EcDof1 proteinof 427 amino acids. The aminoacid substitutions between thetwo proteins are highlighted inbold. The characteristic fourcysteines (C) involved incoordinating zinc are markedwith asterisks

Fig. 3 A pictorial representation of the full-length DOF1 gene of fingermillet recovered through 5′ and 3′ RACE. Gene specific primers weredesigned from the previously isolated partial Dof1 sequence (Gupta et al.2011). The region recovered through 5′ RACE was 353-bp long

containing 204-bp UTR while the region recovered through 3′ RACEwas 953-bp long containing 244-bp UTR. The full length finger milletDof1 mRNA contained an ORF of 1,284 bp encoding 427 amino acidlong Dof1 protein

Plant Mol Biol Rep (2014) 32:419–427 423

(Fig. 7). Thus, the time of peak expression of DOF1 differedin the two genotypes. DOF1 in GE 3885 showed early phas-ing while in GE 1437 it peaked in the evenings. However, oncomparing expression of DOF1 between the two genotypes,expression was found to be higher in GE3885 at all measuredtime intervals.

Discussion

Earlier we isolated the partial sequence of finger millet Dof1and designated it asEcDOF1 . Expression studies carried out indifferent tissues of contrasting finger millet genotypes differingin protein content revealed that EcDOF1 is expressed through-out the plant and has highest expression in the vegetative leaftissues.EcDOF1 was also found to have a higher expression inthe developing grains of high grain protein genotype comparedto the low grain protein genotype, indicating its role in higheractivation of genes involved in protein accumulation in thedeveloping grain (Gupta et al. 2011). These results encouragedus to further understand and characterize this important

transcription factor gene, which might help reveal how thefinger millet plant achieves high NUE and quality proteincontent in grains despite growing under harsh and nitrogen-limiting conditions. Hence, the full-length sequence of theDOF1 gene was isolated by performing RACE followed byisolation of the full-length DOF1 gene of low and high grainprotein content genotype. Phylogenetic and motif analysisshowed that both full length EcDOF1 genes are closer to theDOF1 of rice in sequence, differing only in motif 8 (which ispresent in rice) indicating that, even though they have differentphysiology (finger millet is C4 while rice is C3), finger milletand rice might share common regulatory mechanisms to con-trol the expression of genes involved in carbon and nitrogenmetabolism. However, the NUEs of the two cereals differ,indicating other possible reasons for the high NUE of fingermillet, which may be due to structural variation in gene copynumber. Since finger millet and rice have different ploidylevels (finger millet is tetraploid whereas rice is diploid), thecopy number ofDOF1 in these genomes might influence theirregulatory roles. The availability of the complete rice genomesequence has shown that it contains only a single copy of the

LP EcDof1

HP EcDof1

NP 001049101.1 OsDof1

NP 001105709.1 ZmDof1 (MNB1A)

DAA34030.1 SbDof1

AAX54942.2 TaDof1

CAJ29307.1 HvDof1

100

100

99

65

0.1

Fig. 4 Phylogenetic relationship of the isolated Finger millet DOF1genes with the Dof1 genes of five members of the poacea family. Thefull-length DOF1 gene sequences of both high and low grain proteinfinger millet genotypes used in the present study along with five otherDOF1 genes of other cereals were subjected to phylogenetic tree

construction by neighborhood joining method using the software MEGAVer. 5.10. A high degree of sequence identity between Dof1 of both thefinger millet genotypes andOryza sativa is evident from the phylogenetictree. LP Low Protein Genotype, GE 1437; HP High Protein Genotype,GE 3885

Fig. 5 Detection of conserved motifs in Dof1 proteins of different cereals using online local alignment tool MEME ver. 4.4.0. Dof1 proteins of fingermillet and Oryza sativa share common motifs

424 Plant Mol Biol Rep (2014) 32:419–427

DOF1 gene; since the finger millet genome sequence is notavailable at present, Southern hybridization was carried out to

determine the copy number of EcDOF1 gene in the fingermillet genome.

Finger Millet Genome Contains at Least 4 Copiesof the EcDOF1 Gene, Possibly Regulated at the Protein Level

Southern blotting showed four prominent bands indicatingthat there are probably four copies of the DOF1 gene in thefinger millet genome, with two copies each probably beingdonated by each of the candidate progenitors: E. indica (AAgenome) and E. floccifolia (BB genome) (Bisht and Mukai2001). It was interesting to observe that the length of thefragments detected with the DOF1 probe was very similarfor all enzymes, indicating the presence of four identicalcopies of the DOF1 gene in finger millet located in differentregions of the genome. SinceDOF1 simultaneously regulatesthe expression of genes involved in nitrogen and carbonmetabolism, multiple copies of the DOF1 gene present inthe finger millet genome might be responsible for conferringhigh NUE under limited nitrogen conditions. This conclusionis drawn from the assumption that all four copies of DOF1gene are expressed at high levels thereby overexpressing itsdownstream target genes involved in carbon and nitrogenmetabolism. However, further work needs to be done tounderstand whether all four copies of the DOF1 gene areexpressed at the same time and rates. Further, the presenceof different numbers of phosphorylation sites in the EcDof1protein of low and high grain protein genotypes (35 and 31sites, respectively) and in other cereals indicates that not onlyDNA binding activity but also protein–protein interactionsmight be affected by the action of the kinases and phospha-tases that play a central role in regulating cellular functions,particularly signal transduction cascades (Kennelly 2002).Transcription factors are often phosphorylated at multiple sitesthat provide overlapping and partially redundant layers ofregulation that function to efficiently control their activity(Komeili and Shea 1999). Phosphorylation of amino acidscan modulate the conformation, activity, localization and sta-bility of proteins, and around one-third of all eukaryoticproteins are thought to be reversibly phosphorylated (Olsenet al. 2006). Identification of such kinases and phosphataseswould further aid our understanding of the signalling processoperational in regulating NUE in crop plants.

Differential Expression of the DOF1 Gene in a 24-h DiurnalCycle

A large range of plant activities are controlled by cyclic alter-ations of day and night, and cycling of genes of a particularpathway in a synchronized manner leads to optimized fitness(Hotta et al. 2007). In the present investigation, EcDOF1 wasfound to be regulated differentially and diurnally by light in

Fig. 6 Determination of copy number of DOF1 gene using Southernhybridization. Genomic DNA (15 μg) was digested with restrictionenzymes:H HindIII,K KpnI,E EcoRI,P PstI,B BamHI. After blotting,the digested DNAwas probed with specific biotin-labelled 231 bp Dof1-specific probe. The Southern blot showed four intense bands in the laneswhere genomic DNAwas digested withHindIII,KpnI, PstI, and BamHI,indicating four copies of the EcDOF1 gene in the tetraploid (4×) fingermillet genome

Fig. 7 Quantitative real time PCR analysis of DOF1 gene expression inseedling leaves of two finger millet genotypes: GE3885 and GE1437.Seedlings were grown under 16 h light (0600–2200 hours)/8 h dark(2200–0600 hours) for 15 days and on the16th day RNA was isolatedat different time points as indicated. While GE 3885 showed earlyphasing, GE1437 showed late phasing

Plant Mol Biol Rep (2014) 32:419–427 425

both genotypes. This is consistent with earlier results thatmaize DOF1 (ZmDOF1), which regulates genes involved incarbon and nitrogen metabolism, and JcDOF1 are regulated ina light-dependent manner and have also been found to be undercircadian oscillation (Yanagisawa and Sheen 1998; Yang et al.2011). Moreover, other members of the DOF gene family indifferent plants have also been reported to be under circadianoscillation (Iwamoto et al. 2009, Fornara et al. 2009; Nogueroet al. 2013; Shan et al. 2013). This might be due to the presenceof a number of light responsive elements (LREs) in the pro-moter region (Gaur et al. 2011). Since DOF1 regulates genesencoding enzymes involved in nitrate reduction, assimilationand organic acid metabolism, and these differ with respect tothe timing of the diurnal change and the sensitivity with whichtheir expression responds to changes in nitrogen metabolism, itwould be an interesting endeavor to understand how a singleDof1 transcription factor regulates the expression of down-stream genes with different diurnal rhythms (Gupta et al. 2013;Stitt et al. 2002). The diurnal pattern of expression ofDOF1 infinger millet might be synchronized with the expression patternwith genes of C/N metabolism in some way, or there might beother, as yet unknown, regulatory factors. The differentialpattern of expression of DOF1 in the two genotypes, alongwith the different number of phosphorylation sites in Dof1protein might be responsible for the differential regulation ofgenes of C/N metabolism and grain protein content. However,further validation through over-expression or knock-out stud-ies along with kinase assays of Dof1 protein are needed toenhance our understanding not only of the regulation of down-stream target genes involved in carbon and nitrogen metabo-lism that may contribute to grain protein accumulation but alsoof its key regulatory proteins.

Conclusion

To investigate the mechanism of the high NUE of fingermillet, analysis of the full length mRNA sequence of theFinger millet DOF1 gene (EcDOF1 ) and its genomic copynumber showed that EcDOF1 is closely related in sequence torice Dof1 and is present in at least four copies in the fingermillet genome. The presence of multiple genomic copies ofthe EcDOF1 gene might produce more EcDof1 proteins andoverexpressing downstream genes involved in carbon andnitrogen metabolism, providing an advantage to the fingermillet plant to survive under limiting nitrogen conditions.Further, diurnal oscillation of EcDOF1 gene expression indi-cates its role in regulating the expression of genes involved inphotosynthesis and nitrogen metabolism, which have differentdiurnal patterns of expression. This raises important questionsas to howDOF1 regulates its downstream target genes, whichhave different diurnal patterns of expression in achieving highNUE. The results of this study provide an insight into the role

of DOF1 as a regulator of genes of photosynthesis and graincomposition in finger millet, and are also a step towardsunravelling the role of this regulator in the signal transductionpathway associated with carbon and nitrogen metabolism.

Acknowledgments The authors wish to acknowledge the financial sup-port provided by the Department of Biotechnology, Government of India inthe form of Programmemode support Phase I & II. The financial assistanceprovided by University Grants Commission (UGC) and Department ofBiotechnology (DBT) of the Government of India to P.K. and A.K.G.respectively, is duly acknowledged.

References

Bailey TL, Williams N, Misleh C, Li WW (2006) MEME: discoveringand analyzing DNA and protein sequencemotifs. Nucleic Acids Res34:W369–W373

BaumannK, Gualberti G (1999) The DNA binding site of the Dof proteinNtBBF1 is essential for tissue-specific and auxin-regulated expres-sion of the rolB oncogene in plants. Plant Cell 11:323–333

Bisht MS, Mukai Y (2001) Genomic in situ hybridization identifiesgenome donor of finger millet (Eleusine coracana). Theor ApplGenet 102:825–832

Blom N, Gammeltoft S, Brunak S (1999) Sequence and structure-basedprediction of eukaryotic protein phosphorylation sites. J Mol Biol294(5):1351–1362

Fornara F, Panigrahi KC, Gissot L, Sauerbrunn N, Rühl M, Jarillo JA,Coupland G (2009) Arabidopsis DOF transcription factors act re-dundantly to reduce CONSTANS expression and are essential for aphotoperiodic flowering response. Dev Cell 17(1):75–86

Gaur VS, Singh US, Kumar A (2011) Transcriptional profiling and insilico analysis of Dof transcription factor gene family for under-standing their regulation during seed development. Mol Biol Rep38:2827–2848

Gerhardt IR, Filippi SB, Okura V, Coutinho J, Rizzato AP, Gui K, VessaliN, Pontes JHM, Cordeiro T, Silva SM, Garcia AF, Arruda P (2011)Overexpression of walldof transcription factor increases secondarywall deposition and alters carbon partitioning in poplar. BMC Proc5(Suppl 7):O35

Gualberti G, Papi M, Bellucci L, Ricci I, Bouchez D, Camilleri C,Costantino P, Vittorioso P (2002) Mutations in the Dof zinc fingergenes DAG2 and DAG1 influence with opposite effects the germi-nation of Arabidopsis seeds. Plant Cell 14:1253–1263

Gupta AK, Gaur VS, Gupta S, Kumar A (2013) Nitrate signals determinethe sensing of nitrogen through differential expression of genesinvolved in nitrogen uptake and assimilation in finger millet. FunctIntegr Genomics 13:179–190. doi:10.1007/s10142-013-0311-x

Gupta N, Gupta AK, Kumar A (2011) Spatial distribution pattern analysisof Dof1 transcription factor in different tissues of three Eleusinecoracana genotypes differing in their grain colour, yield and photo-synthetic efficiency. Mol Biol Rep 39:2089–2095

Hotta CT, GardnerMJ, Hubbard KE, Baek SJ, Dalchau N, Suhita D, DoddAN, Webb AA (2007) Modulation of environmental responses ofplants by circadian clocks. Plant Cell Environ 30:333–349

Iwamoto M, Higo K, Takano M (2009) Circadian clock- andphytochrome-regulated Dof-like gene, Rdd1 , is associated withgrain size in rice. Plant Cell Environ 32:592–603

Sugiyama T, Ishida T, Tabei N, Shigyo M, Konishi M, Yoneyama T,Yanagisawa S (2012) Involvement of PpDof1 transcriptional repres-sor in the nutrient condition-dependent growth control of protone-mal filaments in Physcomitrella patens. J Exp Bot 63(8):3185–3197

426 Plant Mol Biol Rep (2014) 32:419–427

Kang HG, Foley RC, Onate-Sanchez L, Lin C, Singh KB (2003) Targetgenes for OBP3, a Dof transcription factor, include novel basichelix–loop–helix domain proteins. Plant J 35:362–372

Kennelly PJ (2002) Protein kinases and protein phosphatases in prokary-otes: a genomic perspective. FEMS Microbiol Lett 206:1–8

Komeili A, O’Shea EK (1999) Roles of phosphorylation sites in regulat-ing activity of the transcription factor Pho4. Science 284(5416):977–980

Kushwaha H, Gupta N, Singh VK, Kumar A, Yadav D (2008) In silicoanalysis of PCR amplified DOF (DNA binding with one finger)transcription factor domain and cloned genes from cereals andmillets. Online J Bioinformatics 9:130–145

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expressiondata using real-time quantitative PCR and the 2-DDCT method.Methods 25:402–408

Martínez M, Rubio-Somoza I, Fuentes R, Lara P, Carbonero P, Díaz I(2005) The barley cystatin gene (Icy) is regulated by DOF transcrip-tion factors in aleurone cells upon germination. J Exp Bot 56:547–556

Noguero M, Atif RM, Ochatt S, Thompson RD (2013) The role of theDNA-binding One Zinc Finger (DOF) transcription factor family inplants. Plant Sci 209:32–45

Murray MG, Thompson WF (1980) Rapid isolation of high molecularweight plant DNA. Nucleic Acids Res 8:4321–4325

Olsen JV, Blagoev B, Gnad F, Macek B, Kumar C,Mortensen P, MannM(2006) Global, in vivo, and site-specific phosphorylation dynamicsin signaling networks. Cell 127(3):635–648

Rueda-Romero P, Barrero-Sicilia C, Cadenas AG, Carbonero P, SánchezLO (2012) Arabidopsis thaliana DOF6 negatively affects germina-tion in non-after-ripened seeds and interacts with TCP14. J Exp Bot63:1937–1949

Plesch G, Ehrhardt T, Mueller-Roeber B (2001) Involvement of TAAAGelements suggests a role for Dof transcription factors in guard cell-specific gene expression. Plant J 28:455–464

Rubio-Somoza I, Martinez M, Abraham Z, Diaz I, Carbonero P (2006)Ternary complex formation between HvMYBS3 and other factorsinvolved in transcriptional control in barley seeds. Plant J 47:269–281

Sambrook JE, Fritsch F, Maniatis T (1989) Molecular cloning: a labora-tory manual, 2nd edn. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, NY

Skirycz A, Reichelt M, Burow M, Birkemeyer C, Rolcik J (2006) DOFtranscription factor AtDOF1.1 (OBP2) is part of a regulatory net-work controlling glucosinolate biosynthesis in Arabidopsis. Plant J47:10–24

Shan J, Song W, Zhou J, Wang X, Xie C, Gao X, Xie T, Liu J (2013)Transcriptome analysis reveals novel genes potentially involved inphotoperiodic tuberization in potato. Genomics. doi:10.1016/j.ygeno.2013.07.001

Stitt M, Müller C, Matt P, Gibon Y, Carillo P, Morcuende R, Scheible, W,Krapp A (2002) Steps towards an integrated view of nitrogenmetabolism. J Exp Bot (Inorganic Nitrogen Assimilation SpecialIssue) 53:959–970

Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecularevolutionary genetics analysis (MEGA) software version 4.0. MolBiol Evol 24(8):1596–1599

Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTALW: improvingthe sensitivity of progressive multiple sequence alignment throughsequence weighting, positions-specific gap penalties and weightmatrix choice. Nucleic Acids Res 22:4673–4680

Wang H, Jones B, Li Z, Frasse P, Delalande C, Regad F, Chaabouni S,Latché A, Pech JC, Bouzayen M (2005) The tomato Aux/IAAtranscription factor IAA9 is involved in fruit development and leafmorphogenesis. Plant Cell 17:2676–2692

Ward JM, Cufr CA, Denzel MA, Nef MM (2005) The Dof transcriptionfactor OBP3 modulates phytochrome and cryptochrome signallingin Arabidopsis. Plant Cell 17:475–485

Washio K (2003) Functional dissections between GAMYB and Doftranscription factors suggest a role for protein–protein associationsin the gibberellin mediated expression of the RAmy1A gene in therice aleurone. Plant Physiol 133:850–863

Wei PC, Tan F, Gao XQ, Zhang XQ, Wang GQ, Xu H, Li LJ, Chen J,Wang XC (2010) Overexpression of AtDOF4.7, an ArabidopsisDOF family transcription factor, induces floral organ abscissiondeficiency in Arabidopsis. Plant Physiol 153:1031–1045

Yamamoto MP et al (2006) Synergism between RPBF Dof and RISBZ1bZIP activators in the regulation of rice seed expression genes. PlantPhysiol 141:1694–1707

Yanagisawa S (2000) Dof1 and Dof2 transcription factors are associatedwith expression of multiple genes involved in carbon metabolism inmaize. Plant J 21:281–288

Yanagisawa S, Schmidt RJ (1999) Diversity and similarity among recog-nition sequences of Dof transcription factors. Plant J 17(2):209–214

Yanagisawa S, Sheen J (1998) Involvement of maize Dof zinc fingerproteins in tissue-specific and light-regulated gene expression. PlantCell 10:75–89

Yang J, Yang MF, Zhang WP, Chen F, Shen SH (2011) A putativeflowering-time-related Dof transcription factor gene, JcDof3, iscontrolled by the circadian clock in Jatropha curcas . Plant Sci181:667–674

Plant Mol Biol Rep (2014) 32:419–427 427