1
A genome-wide CRISPR screen reveals a role for the BRD9-containing non-1
canonical BAF complex in regulatory T cells 2
3
Chin-San Loo1,3,#, Jovylyn Gatchalian2,#, Yuqiong Liang1, Mathias Leblanc1, Mingjun 4
Xie1, Josephine Ho2, Bhargav Venkatraghavan1, Diana C. Hargreaves2*, and Ye 5
Zheng1* 6
7
1. NOMIS Center for Immunobiology and Microbial Pathogenesis, Salk Institute for 8
Biological Studies 9
2. Molecular and Cellular Biology Laboratory, Salk Institute for Biological Studies 10
3. Division of Biological Sciences, University of California, San Diego 11
# Co-first authors 12
* Co-corresponding authors 13
14
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
2
Summary 15
Regulatory T cells (Tregs) play a pivotal role in suppressing auto-reactive T cells 16
and maintaining immune homeostasis. Treg development and function are 17
dependent on the transcription factor Foxp3. Here we performed a genome-wide 18
CRISPR/Cas9 knockout screen to identify the regulators of Foxp3 in mouse 19
primary Tregs. The results showed that Foxp3 regulators are highly enriched in 20
genes encoding SWI/SNF and SAGA complex subunits. Among the three 21
SWI/SNF-related complexes, the non-canonical or ncBAF (also called GBAF or 22
BRD9-containing BAF) complex promoted the expression of Foxp3, whereas the 23
PBAF complex repressed its expression. Gene ablation of BRD9 led to 24
compromised Treg function in inflammatory disease and tumor immunity. 25
Functional genomics revealed that BRD9 is required for Foxp3 binding and 26
expression of a subset of Foxp3 target genes. Thus, we provide an unbiased 27
analysis of genes and networks regulating Foxp3, and reveal ncBAF complex as a 28
novel target that could be exploited to manipulate Treg function. 29
30
Introduction 31
Regulatory T cells (Tregs) play a crucial role in maintaining immune system 32
homeostasis by suppressing over-reactive immune responses(Josefowicz et al., 2012; 33
Sakaguchi et al., 2008). Defects in Tregs lead to autoimmune disorders and 34
immunopathology, while certain tumors are enriched with Tregs that suppress anti-35
tumor immune responses(Tanaka and Sakaguchi, 2017). Foxp3, a member of the 36
Forkhead transcription factor family, is a critical regulator that orchestrates the 37
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
3
molecular processes involved in Treg differentiation and function(Zheng and Rudensky, 38
2007). Therefore, understanding the regulation of Foxp3 expression could reveal novel 39
therapeutic targets to potentially change Treg numbers or alter their function. It has 40
been established that the T cell receptor (TCR) and IL-2 signaling pathways play critical 41
roles in Foxp3 induction(Chinen et al., 2016; Lee et al., 2012). TGF-β signaling is also 42
essential for Foxp3 induction in periphery-derived Tregs and in vitro induced Tregs, 43
although its role in thymus-derived Treg development is still under debate (Chen et al., 44
2003; Liu et al., 2008; Ouyang et al., 2010). Accordingly, a number of downstream 45
transcription factors have been identified that regulate Foxp3 induction in vitro or in vivo, 46
including STAT5a/b, CBF-β/RUNX1/3, NFAT1, SMAD3/4, cRel, and CREB (Burchill et 47
al., 2007; Kim and Leonard, 2007; Kitoh et al., 2009; Long et al., 2009; Rudra et al., 48
2009; Tone et al., 2008; Yang et al., 2008). Compared to the large number of studies 49
focused on the mechanism of Foxp3 induction, relatively less is known about the factors 50
that maintain Foxp3 expression in mature Treg cells. An intronic enhancer in Foxp3 51
named CNS2 (conserved non-coding sequence 2), also known as TSDR (Treg-specific 52
demethylated region), is a key cis-regulatory element required for stable Foxp3 53
expression(Polansky et al., 2008; Zheng et al., 2010). CNS2 is heavily methylated in 54
naive and activated conventional T cells by DNA methyl-transferase 1 (DNMT1), and 55
deletion of Dnmt1 leads to aberrant expression of Foxp3 in conventional T 56
cells(Josefowicz et al., 2009). Once Foxp3 expression is induced during Treg 57
development, the CNS2 region is rapidly demethylated, opening it up for the binding of 58
transcription factors(Polansky et al., 2008). Foxp3 can bind to CNS2, as well as an 59
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
4
additional upstream enhancer named CNS0(Kitagawa et al., 2017), and stabilize its own 60
expression in a positive feedback loop(Feng et al., 2014; Li et al., 2014b). 61
62
Post-translational modifications (PTM) of the Foxp3 protein, including phosphorylation, 63
acetylation, and ubiquitination, are also a crucial part of the regulatory circuit that 64
controls Foxp3 function and stability (van Loosdregt and Coffer, 2014). Among the 65
regulators of Foxp3 PTMs, a pair of enzymes, ubiquitin ligase STUB1 and ubiquitin 66
hydrolase USP7, were reported to promote or inhibit degradation of Foxp3 via 67
ubiquitination, respectively (Chen et al., 2013; van Loosdregt et al., 2013). Finally, 68
intracellular metabolism, and specifically the metabolic regulator mTOR (mammalian 69
target of Rapamycin), has emerged as a key regulator of Foxp3 expression and Treg 70
function. Early studies showed that weakened mTOR signaling leads to increased 71
Foxp3 expression in iTregs in vitro (Delgoffe et al., 2009). However, recent studies 72
using genetic models showed that complete ablation of mTOR in Tregs leads to 73
compromised homeostasis and function of effector Tregs (Chapman et al., 2018; Sun et 74
al., 2018). Despite these and other significant advances in understanding the molecular 75
mechanisms regulating Foxp3, we lack a comprehensive picture of the regulatory 76
networks that control Foxp3 expression. 77
78
In this study, we performed a genome-wide CRISPR/Cas9 knockout screen to identify 79
the regulators of Foxp3 in mouse primary natural Treg cells. The screen results not only 80
confirmed a number of known Foxp3 regulators but also revealed many novel factors 81
that control Foxp3 expression. Gene ontology analysis showed that Foxp3 regulators 82
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
5
are highly enriched in genes encoding subunits of the SAGA and SWI/SNF complexes, 83
which we further validated by single gRNA knockout and flow cytometry analysis. The 84
mammalian SWI/SNF complex is a multi-subunit complex with a core ATPase protein, 85
either SMARCA4 (BRG1) or SMARCA2 (BRM), that uses energy derived from ATP 86
hydrolysis to remodel nucleosomes on chromatin. Mouse genetic studies have 87
demonstrated that conditional knockout of Smarca4 leads to impaired differentiation of T 88
lymphocytes (Gebuhr et al., 2003; Zhao et al., 1998). In addition, a previous report 89
demonstrated that genetic deletion of Smarca4 in Tregs using the Foxp3-Cre driver 90
results in the development of a fatal inflammatory disorder reminiscent of Foxp3 mutant 91
scurfy mice (Chaiyachati et al., 2013). The authors showed that while Treg development 92
and Foxp3 expression was normal in Smarca4 deficient Tregs, Treg function was 93
nevertheless compromised due to impaired activation of TCR target genes, for example 94
chemokine receptor genes in Tregs. This is consistent with the rapid association of 95
SMARCA4-containing SWI/SNF complexes with chromatin following TCR activation in T 96
cells (Zhao et al., 1998). 97
98
Biochemical studies have demonstrated that SMARCA4 is associated with both the 99
canonical BAF complex (BAF) and Polybromo1-associated BAF complex (PBAF) (Xue 100
et al., 2000; Yan et al., 2005). In addition, recent studies in embryonic stem cells 101
(ESCs)(Gatchalian et al., 2018) and cancer cell lines (Alpsoy and Dykhuizen, 2018; 102
Michel et al., 2018; Wang et al., 2019) have identified a BRD9-containing non-canonical 103
complex or ncBAF complex (also referred to as GBAF or BRD9-containing BAF), which 104
contains several shared subunits including SMARCA4, but is distinct from the BAF and 105
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
6
PBAF complexes. Apart from uniquely incorporating BRD9, the ncBAF complex also 106
contains GLTSCR1 or the paralog GLTSCR1L and lacks BAF- and PBAF-specific 107
subunits ARID1A, ARID1B, ARID2, SMARCE1, SMARCB1, SMARCD2, SMARCD3, 108
DPF1-3, PBRM1, BRD7, and PHF10. The distinct biochemical compositions of these 109
three SWI/SNF complex assemblies suggest functional diversity. However, it is not 110
known which SWI/SNF complex assemblies are expressed in Tregs and the potential 111
roles of specific SWI/SNF variants in regulating Foxp3 expression and Treg 112
development have not been studied in depth. 113
114
Here, we find that the BRD9-containing ncBAF complex promotes the expression of 115
Foxp3, whereas the PBAF complex represses its expression. Furthermore, deletion of 116
Brd9 or PBAF component Pbrm1 in Tregs results in reduced or enhanced suppressor 117
activity, respectively, suggesting divergent regulatory roles of ncBAF and PBAF 118
complexes in controlling Foxp3 expression and Treg function. Consistent with this 119
model, we find that chemically-induced degradation of BRD9 by dBRD9 leads to 120
reduced Foxp3 expression and compromised Treg function. Genome-wide binding 121
studies revealed that BRD9 co-localizes with Foxp3, including at the CNS0 and CNS2 122
enhancers at the Foxp3 locus. Furthermore, targeting BRD9 by sgRNA or dBRD9 123
reduces Foxp3 binding at the Foxp3 locus and a subset of Foxp3 binding sites genome-124
wide, which results in differential expression of many Foxp3-dependent genes, 125
indicating that BRD9 participates in the regulation of the Foxp3-dependent 126
transcriptional program. Finally, we show that deletion of Brd9 in Tregs reduced 127
suppressor activity in an in vivo model of T cell transfer induced colitis, and improved 128
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
7
anti-tumor immune responses in an MC38 colorectal cancer cell induced cancer model. 129
In summary, we perform an unbiased genome-wide screen to identify genes and 130
networks regulating Foxp3, and reveal ncBAF complex as a novel target that could be 131
exploited to manipulate Treg function in vitro and in vivo. 132
133
Results 134
Genome-wide CRISPR screen in natural regulatory T cells identifies regulators of 135
Foxp3 136
To screen for genes that regulate Foxp3 expression, we developed a pooled retroviral 137
CRISPR sgRNA library by subcloning an optimized mouse genome-wide lentiviral 138
CRISPR sgRNA library (lentiCRISPRv2-Brie) (Doench et al., 2016) into a newly 139
engineered retroviral vector pSIRG-NGFR, which allowed us to efficiently transduce 140
mouse primary T cells and to perform intracellular staining for Foxp3 without losing the 141
transduction marker NGFR after cell permeabilization (Figure S1). Using this library, we 142
performed CRISPR knockout screens on Tregs to identify genes that regulate Foxp3 143
expression. We activated CD4+Foxp3+ Tregs isolated from Rosa-Cas9/Foxp3Thy1.1 144
knock-in mice (Liston et al., 2008; Platt et al., 2014) with CD3 and CD28 antibodies and 145
IL-2 (Figure 1A). Treg cells were transduced 24 hours post-activation with the pooled 146
retroviral sgRNA library at multiplicity of infection of less than 0.2 to ensure only one 147
sgRNA was transduced per cell. NGFR+ transduced Treg cells were collected on day 3 148
and day 6 to identify genes that are essential for cell proliferation and survival. In 149
addition, the bottom quintile (NGFR+Foxp3Low) and top quintile (NGFR+Foxp3High) 150
populations were collected on day 6 to identify genes that regulate Foxp3 expression. 151
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
8
We validated the screen conditions by transducing Tregs with sgRNAs targeting Foxp3 152
itself, as well as previously reported positive (Cbfb) (Rudra et al., 2009) and negative 153
(Dnmt1) (Lal et al., 2009) regulators of Foxp3 (Figure 1B-D). Guide RNA sequences 154
integrated within the genomic DNA of sorted cells were recovered by PCR amplification, 155
constructed into amplicon libraries, and sequenced with a NextSeq sequencer. 156
157
The relative enrichment of sgRNAs between samples and hit identification were 158
computed by MAGeCK, which generates a normalized sgRNA read count table for each 159
sample, calculates the fold change of sgRNA read counts between two cell populations, 160
and further aggregates information of four sgRNAs targeting each gene to generate a 161
ranked gene list (Li et al., 2014a). Prior to hit calling, we evaluated the quality of screen 162
samples by measuring the percentage of mapped reads to the sgRNA library and total 163
read coverage, which showed a high mapping rate (79.8-83.4%) with an average of 164
236X coverage and a low number of missing sgRNAs (0.625-2.5%) (Figure S2). With 165
the cutoff criteria of log2 fold change (LFC) >±0.5 and p-value less than 0.01, we 166
identified 254 potential positive Foxp3 regulators enriched in the Foxp3Low population 167
and 490 potential negative Foxp3 regulators enriched in the Foxp3High population 168
(Figure 2A, 2B, and Table S1). In a parallel analysis, we also identified 22 and 1497 169
genes that affect cell expansion and contraction, respectively (p-value < 0.002, LFC>1, 170
Figure S3 and Table S2). As expected, we identified genes belonging to pathways 171
known to regulate Foxp3 expression both transcriptionally (Cbfb, Runx3) (Rudra et al., 172
2009) and post-transcriptionally through the regulation of Foxp3 protein stability (Usp7, 173
Stub1) (Chen et al., 2013; van Loosdregt et al., 2013) (Figure 2C). 174
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
9
175
We next compared the potential positive and negative regulators with genes involved in 176
cell contraction and expansion to exclude hits that might affect Foxp3 expression 177
indirectly by affecting cellular fitness in general, leaving 197 positive Foxp3 regulators 178
and 327 negative Foxp3 regulators (Figure 2D and Table S3). Gene ontology analysis 179
of positive Foxp3 regulators revealed a number of notable functional clusters including 180
SAGA-type complex, negative regulation of T cell activation, RNA Polymerase II 181
holoenzyme, positive regulation of histone modification, and SWI/SNF complex (Figure 182
2E, Table S4). Among negative Foxp3 regulators, genes are highly enriched in clusters 183
related to negative regulation of TOR signaling, transcriptional repressor complex, 184
mRNA decay and metabolism, and hypusine synthesis from eIF5A-lysine (Figure 2F, 185
Table S4). Several of these pathways, including mTOR signaling, Foxp3 186
ubiquitination/deubiquitination, and transcriptional regulation, have been implicated in 187
Foxp3 regulation previously, suggesting that our screen is robust for the validation of 188
known pathways and the discovery of novel regulators of Foxp3. Among novel 189
regulators, we identified many genes encoding subunits of the SAGA (Ccdc101, Tada2b, 190
Tada3, Usp22, Tada1, Taf6l, Supt5, Supt20) and SWI/SNF (Arid1a, Brd9, Smarcd1) 191
complexes (Table S4), strongly suggesting that these complexes could have 192
indispensable roles for Foxp3 expression. We thus further validated and characterized 193
the SAGA and SWI/SNF related complexes to understand their roles in Foxp3 194
expression and Treg function. 195
196
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
10
Validation of the SAGA complex as a novel regulator of Foxp3 expression and 197
Treg suppressor activity 198
The SAGA complex possesses histone acetyltransferase (HAT) and histone 199
deubiquitinase (DUB) activity, and functions as a transcriptional co-activator through 200
interactions with transcription factors and the general transcriptional 201
machinery(Helmlinger and Tora, 2017; Koutelou et al., 2010). We identified Ccdc101, 202
Tada2b, and Tada3 in the HAT module, Usp22 in the DUB module, and Tada1, Taf6l, 203
Supt5, and Supt20 from the core structural module among positive Foxp3 regulators 204
that do not affect cell expansion or contraction (Figure S4A). We sought to validate the 205
potential regulatory function of SAGA complex subunits by using sgRNAs to knock out 206
individual subunits in Tregs and measure Foxp3 expression (Figure S4B, S4C). We 207
found that deletion of every subunit tested resulted in a significant and 19-29% 208
reduction in Foxp3 mean fluorescence intensity (MFI). We then further tested the 209
function of SAGA subunit Usp22 in an in vitro suppression assay, which measures the 210
suppression of T cell proliferation when conventional T cells are co-cultured with Tregs 211
at increasing ratios. We found that Tregs transduced with sgRNAs targeting Usp22 had 212
compromised Treg suppressor activity compared with Tregs transduced with a non-213
targeting control sgRNA, with significantly more proliferation of T effector cells (Teff) at 214
every ratio of Treg to Teff ratio tested (Figure S4D). These results provide independent 215
validation of our genome-wide screen analyses for this class of chromatin regulators 216
and demonstrate that the SAGA complex is essential for normal Foxp3 expression and 217
that disrupting the SAGA complex by sgUsp22 reduces Treg suppressor function. 218
219
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
11
Identification of the BRD9-containing ncBAF complex as a specific regulator of 220
Foxp3 expression 221
We next wanted to characterize the role of SWI/SNF complex variants (BAF, ncBAF, 222
and PBAF complexes) in Foxp3 expression. While these complexes share certain core 223
subunits, such as the ATPase SMARCA4, each complex also contains specific subunits, 224
for example the selective incorporation of the bromodomain containing protein BRD9 in 225
ncBAF complexes (Figure 3A). Since the tissue-specific distribution and functional 226
requirement for ncBAF complexes in primary T cells is not known, we performed co-227
immunoprecipitation assays to probe the composition of SWI/SNF-related complexes in 228
Tregs. As expected, immunoprecipitation of SMARCA4, a core component of all three 229
SWI/SNF complexes, revealed association of common subunits SMARCC1 and 230
SMARCB1, as well as specific subunits ARID1A, BRD9, and PBRM1. 231
Immunoprecipitations against ARID1A, BRD9, and PHF10 revealed the specific 232
association of these subunits with BAF, ncBAF, and PBAF complexes, respectively 233
(Figure 3A). These results established that all three SWI/SNF complexes are present 234
with the expected composition in Tregs. 235
236
In our screen, we identified Brd9, Smarcd1, Arid1a and Actl6a among positive 237
regulators of Foxp3, whereas SWI/SNF shared subunits Smarca4, Smarcb1, Smarce1, 238
and Actl6a were identified in cell contraction (Table S3). This suggests a potential 239
regulatory role for ncBAF and/or BAF complexes. To explore the specific function of 240
BAF, ncBAF, and PBAF complexes in Foxp3 expression, we cloned independent 241
sgRNAs to knockout unique subunits for each complex, and measured Foxp3 MFI in 242
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
12
sgRNA transduced Tregs. We observed an essential role for the ncBAF complex in 243
Foxp3 expression in Tregs. Specifically, knockdown of ncBAF specific subunits, 244
including Brd9 and Smarcd1, significantly diminished Foxp3 expression by nearly 40% 245
in Tregs (Figure 3B, 3C). Knockdown of ncBAF-specific paralogs Gltscr1 and Gltscr1l 246
individually resulted in a slight reduction in Foxp3 expression, which was further 247
reduced in the Gltscr1/Gltscr1l double knockout, suggesting that these two paralogs can 248
compensate in the regulation of Foxp3 expression (Figure 3C). In contrast, knockdown 249
of PBAF specific subunits, including Pbrm1, Arid2, Brd7, and Phf10, significantly 250
enhanced Foxp3 expression by as much as 17% (Figure 3C, green). Knockdown of 251
BAF specific subunits Arid1a, Arid1b, Dpf1, or Dpf2 did not significantly affect Foxp3 252
expression (Figure 3C, blue). To determine if ARID1A and ARID1B could be 253
compensating for one another, we performed Arid1a/Arid1b double deletion and found 254
that deletion of either or both ARID paralogs resulted in slight, but non-significant 255
reduction in Foxp3 MFI (Figure 3C, blue). These data suggest that ncBAF and PBAF 256
have opposing roles in the regulation of Foxp3 expression. To further explore the role of 257
different SWI/SNF complexes in Treg genome-wide transcription, we performed RNA 258
sequencing from Tregs with knockdown of variant-specific subunits with one or two 259
independent guide RNAs and conducted principal component analysis, which showed 260
that the ncBAF, PBAF, and BAF also have distinct effects at whole transcriptome level 261
in Tregs (Figure 3D). 262
263
We then made use of a recently developed chemical BRD9 protein degrader 264
(dBRD9)(Remillard et al., 2017) as an orthogonal method to probe BRD9 function. 265
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
13
dBRD9 is a bifunctional molecule that links a small molecule that specifically binds to 266
the bromodomain of BRD9 and another ligand that recruits the cereblon E3 ubiquitin 267
ligase. We confirmed that treatment of Tregs with dBRD9 resulted in reduced BRD9 268
protein levels (Figure S5A). Similar to sgRNA depletion of Brd9, dBRD9 treatment 269
significantly decreased Foxp3 expression in Treg cells in a concentration-dependent 270
manner, without affecting cell viability or proliferation (Figure 3E, Figure S5B). These 271
data demonstrate the requirement for BRD9 in maintenance of Foxp3 expression using 272
both genetic and chemically-induced proteolysis methods. 273
274
BRD9 regulates Foxp3 binding at the CNS0 and CNS2 enhancers and a subset of 275
Foxp3 target sites 276
To dissect the molecular mechanism of how ncBAF and PBAF complexes regulate 277
Foxp3 expression in Treg cells, we performed chromatin immunoprecipitation followed 278
by genome-wide sequencing (ChIP-seq) in Tregs using antibodies against the ncBAF-279
specific subunit BRD9, the PBAF-specific subunit PHF10 and the shared enzymatic 280
subunit SMARCA4. Data generated from these ChIP-seq experiments revealed that 281
BRD9, SMARCA4, and PHF10 co-localize at CNS2 in the Foxp3 gene locus and at 282
CNS0 found within the Ppp1r3f gene immediately upstream of Foxp3 (Figure 4A). Since 283
CNS2 was previously shown to regulate stable Foxp3 expression through a positive 284
feedback loop involving Foxp3 binding(Feng et al., 2014; Li et al., 2014b), and Foxp3 is 285
additionally bound at CNS0 in Tregs(Kitagawa et al., 2017), we rationalized that ncBAF 286
and/or PBAF complexes might affect Foxp3 expression by regulating Foxp3 binding at 287
CNS2/CNS0. We therefore performed Foxp3 ChIP-seq in Tregs transduced with sgNT, 288
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
14
sgFoxp3, sgBrd9 or sgPbrm1. We observed a dramatic reduction in Foxp3 binding at 289
CNS2/CNS0 in sgFoxp3 transduced cells, as expected, and there was also marked 290
reduction of Foxp3 binding at CNS2/CNS0 in Brd9-depleted Tregs (Figure 4A). In 291
contrast, we observed a subtle increase in Foxp3 binding at CNS2/CNS0 in Pbrm1 292
sgRNA transduced Tregs, which could explain why Pbrm1 emerged as a negative 293
regulator of Foxp3 expression in our validation studies (Figure 4A). These data suggest 294
that BRD9 positively regulates Foxp3 expression by promoting Foxp3 binding to its own 295
enhancers. 296
297
We then extended this analysis to examine the cooperation between BRD9 and Foxp3 298
genome-wide. Notably, we find co-binding of BRD9, SMARCA4, and PHF10 with Foxp3 299
at a subset of Foxp3-bound sites (Figure 4B, 4C). All four factors localize to promoters, 300
intronic, and intergenic regions of the genome and their binding correlates well with 301
chromatin accessibility as measured by assay of transposase-accessible chromatin with 302
sequencing (ATAC-seq) (Figure 4B, S6A). Motif analysis of Foxp3-bound sites revealed 303
an enrichment for motifs recognized by ETS and RUNX transcription factors consistent 304
with what has been previously shown(Samstein et al., 2012). ETS and RUNX motifs 305
were also among the most significant motifs at both BRD9-bound sites, along with an 306
enrichment of the CTCF motif as we and others previously reported(Gatchalian et al., 307
2018; Michel et al., 2018) (Figure S6B). These results demonstrate that ncBAF and 308
PBAF complexes are co-localized with Foxp3 at Foxp3 binding sites genome-wide. 309
310
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
15
To assess the requirement for BRD9 or PBRM1 in Foxp3 targeting genome-wide, we 311
analyzed Foxp3 binding in Tregs transduced with sgNT, sgFoxp3, sgBrd9, or sgPbrm1 312
at all Foxp3 binding sites (Figure 4D). As expected, we find that Foxp3 binding is lost at 313
over 85% of its binding sites in sgFoxp3-transduced Treg cells (Figure 4E). Foxp3 314
binding at a subset of these sites is also significantly reduced in sgBrd9-transduced 315
Tregs (FC 1.5, Poisson p < 0.0001), suggesting that BRD9 is required for Foxp3 binding 316
at a subset of its target sites (Figure 4E). This is a specific function of BRD9, as Foxp3 317
binding does not change in Pbrm1-depleted Tregs at these BRD9-dependent sites 318
(Figure 4F). ChIP-seq for the active histone mark H3 lysine27 acetylation (H3K27ac) 319
revealed that BRD9 and Foxp3 cooperate to maintain H3K27ac at over 1,800 shared 320
sites (Figure 4G). At BRD9-dependent Foxp3 sites, for example, we observed a 321
reduction in H3K27ac in sgFoxp3 and sgBrd9-transduced Tregs, but not in sgPbrm1-322
transduced Tregs (Figure 4H). Using dBRD9, we confirmed that BRD9 binding to 323
chromatin is reduced (Figure S6C). We further recapitulated our observation that BRD9 324
loss results in diminished Foxp3 binding to chromatin at a subset of Foxp3 target sites 325
(Figure 4I, 4J, S6D), including at CNS2 and CNS0 (Figure 4A). These data demonstrate 326
that BRD9 co-binds with Foxp3 at the Foxp3 locus to positively reinforce its expression. 327
BRD9 additionally promotes Foxp3 binding and H3K27ac levels at a subset of Foxp3 328
target sites both by potentiating Foxp3 expression and through direct epigenetic 329
regulation at BRD9/Foxp3 co-bound sites. 330
331
BRD9 co-regulates the expression of Foxp3 and a subset of Foxp3 target genes 332
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
16
Based on co-binding of BRD9 and Foxp3 at Foxp3 target sites, we assessed the effects 333
of BRD9 ablation on the transcription of Foxp3 target genes. We performed RNA-seq in 334
Tregs transduced with sgFoxp3, sgBrd9, or sgNT. Consistent with Foxp3's role as both 335
transcriptional activator and repressor, we observed down-regulation and up-regulation 336
of 793 and 532 genes, respectively, in Foxp3 sgRNA transduced Tregs, which are 337
enriched in ‘cytokine production’, ‘regulation of defense response’, and ‘regulation of cell 338
adhesion’ (Figure 5A, 5B). Of these, 67% are directly bound by Foxp3 in our ChIP-seq 339
dataset and 60% are co-bound by Foxp3 and BRD9 (Figure 5C). Deletion of BRD9 340
resulted in transcriptional changes that strongly correlated with the transcriptional 341
changes in sgFoxp3 transduced Tregs (r2 = 0.534, Linear regression analysis; Figure 342
5D). Indeed, gene set enrichment analysis (GSEA) demonstrated that the sgBrd9 up-343
regulated genes are significantly enriched among genes that increase upon Foxp3 344
knockdown, while the sgBrd9 down-regulated genes are enriched among genes that 345
decrease in sgFoxp3 Tregs (Figure 5E). We also performed RNA-seq for Tregs treated 346
with either vehicle or the dBRD9 degrader and observed a similar significant enrichment 347
for dBRD9 affected genes among the Foxp3 up- and down-regulated genes (Figure 5F). 348
Notably, the BRD9-dependent target gene sets generated from our RNA-seq data were 349
among the most significantly enriched dataset of 9,229 immunological, gene ontology 350
and curated gene sets when analyzed against the sgFoxp3 transduced Treg expression 351
data (Figure 5G). In addition, both datasets were significantly enriched for genes that 352
are differentially expressed between Tregs and conventional T cells(Feuerer et al., 353
2010), and between Foxp3 mutant Tregs from scurfy mice and wild-type Tregs(Hill et al., 354
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
17
2007). These data define a role for BRD9 in Tregs through specifically regulating the 355
expression of Foxp3 itself and a subset of Foxp3 target genes. 356
357
ncBAF complex is required for normal Treg suppressor activity in vitro and in 358
vivo. 359
The divergent roles of ncBAF and PBAF complexes in regulating Foxp3 expression 360
suggested that these complexes might also differentially affect Treg suppressor function. 361
We performed sgRNA knockdown of ncBAF-specific Brd9 and Smarcd1 or PBAF-362
specific Pbrm1 and Phf10 in Tregs and measured their function by conducting an in 363
vitro suppression assay. Tregs depleted of Brd9 or Smarcd1 exhibited significantly 364
reduced suppressor function, whereas depletion of Pbrm1 or Phf10 resulted in 365
significantly enhanced suppressor function (Figure 6A, S7A). These data demonstrate 366
that the opposing regulation of Foxp3 expression by ncBAF and PBAF complexes 367
results in decreased/increased Treg suppressor activity upon ncBAF or PBAF subunit 368
deletion, respectively. Similar to sgRNA depletion of Brd9, Tregs treated with dBRD9 369
also showed significantly and specifically compromised Treg suppressor function in vitro 370
(Figure S7B). These results underscore the requirement for BRD9 in Foxp3 expression 371
maintenance and Treg suppressor activity, and further demonstrate that dBRD9 372
reduces Treg suppressor activity without impairing T effector responses in vitro. 373
374
To test if BRD9 also affects Treg function in vivo, we utilized a T cell transfer-induced 375
colitis model. In this model, Rag1 knockout mice were either transferred with CD45.1+ 376
CD4+ CD25-CD45RBHigh effector T cell (Teff) only, or co-transferred with Teff along with 377
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
18
CD45.2+ Tregs transduced with Brd9 sgRNA (sgBrd9) or control sgRNA (sgNT) (Figure 378
6B). Mice transferred with Teff cells alone lost body weight progressively due to 379
development of colitis. Co-transfer of Tregs transduced with sgNT protected recipient 380
mice from weight loss, whereas co-transfer of sgBrd9 transduced Tregs failed to protect 381
recipients from losing weight (Figure 6C). The mice transferred with Brd9-depleted 382
Tregs showed significant colitis pathology at seven weeks compared to mice that 383
received control Tregs (Figure 6D). Furthermore, Brd9 depletion also led to 384
compromised Treg stability after transfer, manifested by reduced Foxp3+ cell 385
frequencies within the CD45.2+CD4+ transferred Treg population (Figure 6E). These 386
results demonstrate that BRD9 is an essential regulator of normal Foxp3 expression 387
and Treg function in a model of inflammatory bowel disease in vivo. 388
389
In addition to their beneficial role in preventing autoimmune diseases, Tregs have also 390
been shown to be a barrier to anti-tumor immunity. We therefore wondered whether we 391
could exploit the compromised suppressor function shown in Brd9 deficient Tregs to 392
disrupt Treg-mediated immune suppression in tumors. We used the MC38 colorectal 393
tumor cell line to induce cancer due to the prominent role Tregs play in this cancer 394
model(Delgoffe et al., 2013). Rag1 knockout mice were used as recipients for adoptive 395
transfer of Treg depleted-CD4 and CD8 T cells (Teff) only, or co-transfer of Teff with 396
Tregs transduced with either sgBrd9 or control sgNT. MC38 tumor cells were implanted 397
subcutaneously on the following day (Figure 7A). Transfer of sgNT Tregs allowed for 398
significantly faster tumor growth compared to mice that received Teff cells only (“No 399
Treg”) due to suppression of the anti-tumor immune response by Tregs (Figure 7B, 7C). 400
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
19
Furthermore, tumor growth in mice that received sgBrd9 transduced Tregs was 401
significantly slower than mice that received sgNT Tregs consistent with our findings that 402
Brd9 knockdown reduces Treg suppressor activity (Figure 7B, 7C). Both CD4 and CD8 403
T cell tumor infiltration significantly increased in mice that received sgBrd9 transduced 404
Tregs compared to sgNT Tregs (Figure 7D, 7E). Additionally, the percent of IFN-γ 405
producing intra-tumor CD4 and CD8 T cells in mice that received sgBrd9 transduced 406
Tregs was significantly greater than the sgNT Treg condition, and comparable to the 407
transfer of Teff alone (“No Treg”) (Figure 7F, 7G). Consistent with our findings that 408
BRD9 is required for Treg persistence in vivo (Figure 6E), the percentage of transferred 409
Treg cells was reduced in mice that received sgBrd9 transduced Tregs relative to sgNT 410
Tregs (Figure 7H). Overall, a 2-3 fold increase in the ratio of CD8 T cells to Tregs in 411
tumor and spleen was observed in the sgBrd9 versus the sgNT condition, consistent 412
with the enhanced anti-tumor immune response in mice that received sgBrd9 413
transduced Tregs (Figure 7I). This experiment demonstrates that BRD9 promotes stable 414
Treg function in MC38 tumors and knockdown of Brd9 in Tregs improves anti-tumor 415
immunity in this context. 416
417
Discussion 418
In this study, we performed a genome-wide CRISPR screen to identify positive and 419
negative regulators of Foxp3 expression in mouse natural Tregs. Among positive 420
regulators, we identified Cbfb and Runx3, consistent with previous reports showing a 421
requirement for CBF-β/Runx3 in Foxp3 expression and Foxp3-dependent target gene 422
expression(Kitoh et al., 2009; Rudra et al., 2009). Among the novel positive regulators, 423
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
20
we discovered subunits from two chromatin remodeling complexes, the BRD9-424
containing ncBAF and SAGA complexes. Independent validation and functional assays 425
demonstrated an essential role for the ncBAF complex and SAGA complex in Foxp3 426
expression and Treg suppressor function. 427
428
Our screens also confirmed several known negative regulators of Foxp3, including DNA 429
methyl-transferase Dnmt1 and the ubiquitin ligase Stub1. Additionally, we identified 430
multiple negative regulators of the mTOR pathway as Foxp3 negative regulators (Tsc2, 431
Flcn, Ddit4, Sesn2, Nprl2), confirming an essential role for mTOR in homeostasis and 432
function of activated Tregs(Chapman et al., 2018; Sun et al., 2018). Among novel 433
negative Foxp3 regulators, we uncovered genes encoding regulators of RNA 434
metabolism, which have no previously reported function in Foxp3 expression. For 435
example, Mettl3 and Mettl14 form a methyltransferase complex that is essential for the 436
m6A methylation of RNA, which is recognized as an important regulatory mechanism for 437
a wide range of biological processes, including RNA stability, protein translation, stem 438
cell self-renewal, cell lineage determination, and oncogenesis(Yue et al., 2015). Our 439
screen suggests a potentially novel role for RNA m6A methylation in post-transcriptional 440
regulation of Foxp3. Together, our genome-wide screens provide the first 441
comprehensive picture of the complex regulatory network controlling Foxp3 expression 442
levels, and reveal previously unknown pathways and factors that warrant further 443
investigation. 444
445
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
21
Following the identification of SWI/SNF subunit genes among Foxp3 regulators, we 446
endeavored to characterize the roles of the three SWI/SNF-related complexes by 447
deleting subunits unique to each of the ncBAF, BAF, and PBAF complexes. We 448
observed specific and divergent roles of ncBAF and PBAF complexes in regulating 449
Foxp3 expression in Tregs. In contrast, deletion of BAF-specific subunits had a slight, 450
but non-significant effect on Foxp3 expression. Nevertheless, several SWI/SNF core 451
subunits were recovered in our screen among genes that regulate Treg cell contraction, 452
suggesting that BAF complexes may regulate Treg activation or proliferation in 453
response to TCR stimulation used to activate and culture Tregs in our screen. This is 454
consistent with a role for Smarca4 in Treg activation and control of autoimmunity in vivo 455
independent of affecting Foxp3 expression, which is not changed in Foxp3-456
Cre:Smarca4f/f Tregs(Chaiyachati et al., 2013). Thus, deletion of Smarca4 or other BAF 457
complex subunits likely results in overall defects in Treg fitness, whereas deletion of 458
ncBAF subunits appears to have a selective effect on Foxp3 expression and its target 459
genes. Mechanistically, we find that the ncBAF complex co-binds and cooperates with 460
Foxp3 to potentiate its binding to the CNS2 and CNS0, enhancers of the Foxp3 locus. 461
In addition to the Foxp3 locus itself, our ChIP-seq analysis revealed that ncBAF also 462
binds to regulatory elements in a subset of Foxp3 target genes to regulate their gene 463
expression. One possibility is that reduced Foxp3 expression results in lowered Foxp3 464
binding at a select group of target genes, but what differentiates the dosage-dependent 465
binding of Foxp3 at these sites compared to other unaffected sites remains unclear. 466
467
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
22
Finally, we tested the vivo relevance of our findings by disrupting the ncBAF subunit 468
Brd9 in Tregs in mouse models of inflammatory bowel disease and cancer. Knockdown 469
of Brd9 in Tregs weakened their suppressor function in a model of T cell induced colitis, 470
leading to exacerbated disease progression. In the context of cancer, we found that 471
transfer of Brd9 deficient Tregs failed to restrict anti-tumor immune responses in the 472
MC38 cell induced cancer model, leading to slower tumor growth. Currently, there is a 473
concerted effort to develop compounds targeting a number of SWI/SNF complex 474
subunits to modulate their function. Our data show that bromodomain-directed 475
degradation of BRD9 by dBRD9 recapitulates the effects of Brd9 genetic deletion, 476
suggesting that the ncBAF complex can be targeted with small molecules to control 477
Foxp3 expression and Treg function. Thus, through the unbiased screen of Foxp3 478
regulators, we have identified novel proteins that can potentially be targeted to 479
manipulate Treg homeostasis and function in autoimmune diseases and cancer. 480
481
482
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
23
References 483
Alpsoy, A., and Dykhuizen, E.C. (2018). Glioma tumor suppressor candidate region 484 gene 1 (GLTSCR1) and its paralog GLTSCR1-like form SWI/SNF chromatin remodeling 485 subcomplexes. The Journal of biological chemistry 293, 3892-3903. 486
Andrews, N.C., and Faller, D.V. (1991). A rapid micropreparation technique for 487 extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic 488 Acids Res 19, 2499. 489
Buenrostro, J.D., Giresi, P.G., Zaba, L.C., Chang, H.Y., and Greenleaf, W.J. (2013). 490 Transposition of native chromatin for fast and sensitive epigenomic profiling of open 491 chromatin, DNA-binding proteins and nucleosome position. Nat Methods 10, 1213-1218. 492
Burchill, M.A., Yang, J., Vogtenhuber, C., Blazar, B.R., and Farrar, M.A. (2007). IL-2 493 receptor beta-dependent STAT5 activation is required for the development of Foxp3+ 494 regulatory T cells. Journal of immunology 178, 280-290. 495
Chaiyachati, B.H., Jani, A., Wan, Y., Huang, H., Flavell, R., and Chi, T. (2013). BRG1-496 mediated immune tolerance: facilitation of Treg activation and partial independence of 497 chromatin remodelling. EMBO J 32, 395-408. 498
Chapman, N.M., Zeng, H., Nguyen, T.M., Wang, Y., Vogel, P., Dhungana, Y., Liu, X., 499 Neale, G., Locasale, J.W., and Chi, H. (2018). mTOR coordinates transcriptional 500 programs and mitochondrial metabolism of activated Treg subsets to protect tissue 501 homeostasis. Nature communications 9, 2095. 502
Chen, W., Jin, W., Hardegen, N., Lei, K.J., Li, L., Marinos, N., McGrady, G., and Wahl, 503 S.M. (2003). Conversion of peripheral CD4+CD25- naive T cells to CD4+CD25+ 504 regulatory T cells by TGF-beta induction of transcription factor Foxp3. The Journal of 505 experimental medicine 198, 1875-1886. 506
Chen, Z., Barbi, J., Bu, S., Yang, H.Y., Li, Z., Gao, Y., Jinasena, D., Fu, J., Lin, F., Chen, 507 C., et al. (2013). The ubiquitin ligase Stub1 negatively modulates regulatory T cell 508 suppressive activity by promoting degradation of the transcription factor Foxp3. 509 Immunity 39, 272-285. 510
Chinen, T., Kannan, A.K., Levine, A.G., Fan, X., Klein, U., Zheng, Y., Gasteiger, G., 511 Feng, Y., Fontenot, J.D., and Rudensky, A.Y. (2016). An essential role for the IL-2 512 receptor in Treg cell function. Nat Immunol 17, 1322-1333. 513
Delgoffe, G.M., Kole, T.P., Zheng, Y., Zarek, P.E., Matthews, K.L., Xiao, B., Worley, 514 P.F., Kozma, S.C., and Powell, J.D. (2009). The mTOR kinase differentially regulates 515 effector and regulatory T cell lineage commitment. Immunity 30, 832-844. 516
Delgoffe, G.M., Woo, S.R., Turnis, M.E., Gravano, D.M., Guy, C., Overacre, A.E., Bettini, 517 M.L., Vogel, P., Finkelstein, D., Bonnevier, J., et al. (2013). Stability and function of 518
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
24
regulatory T cells is maintained by a neuropilin-1-semaphorin-4a axis. Nature 501, 252-519 256. 520
Dobin, A., Davis, C.A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., 521 Chaisson, M., and Gingeras, T.R. (2013). STAR: ultrafast universal RNA-seq aligner. 522 Bioinformatics 29, 15-21. 523
Doench, J.G., Fusi, N., Sullender, M., Hegde, M., Vaimberg, E.W., Donovan, K.F., 524 Smith, I., Tothova, Z., Wilen, C., Orchard, R., et al. (2016). Optimized sgRNA design to 525 maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol 34, 526 184-191. 527
Feng, Y., Arvey, A., Chinen, T., van der Veeken, J., Gasteiger, G., and Rudensky, A.Y. 528 (2014). Control of the inheritance of regulatory T cell identity by a cis element in the 529 Foxp3 locus. Cell 158, 749-763. 530
Feuerer, M., Hill, J.A., Kretschmer, K., von Boehmer, H., Mathis, D., and Benoist, C. 531 (2010). Genomic definition of multiple ex vivo regulatory T cell subphenotypes. 532 Proceedings of the National Academy of Sciences of the United States of America 107, 533 5919-5924. 534
Fujita, T., and Fujii, H. (2014). Identification of proteins associated with an IFNgamma-535 responsive promoter by a retroviral expression system for enChIP using CRISPR. PloS 536 one 9, e103084. 537
Gatchalian, J., Malik, S., Ho, J., Lee, D.S., Kelso, T.W.R., Shokhirev, M.N., Dixon, J.R., 538 and Hargreaves, D.C. (2018). A non-canonical BRD9-containing BAF chromatin 539 remodeling complex regulates naive pluripotency in mouse embryonic stem cells. 540 Nature communications 9, 5139. 541
Gebuhr, T.C., Kovalev, G.I., Bultman, S., Godfrey, V., Su, L., and Magnuson, T. (2003). 542 The role of Brg1, a catalytic subunit of mammalian chromatin-remodeling complexes, in 543 T cell development. The Journal of experimental medicine 198, 1937-1949. 544
Heinz, S., Benner, C., Spann, N., Bertolino, E., Lin, Y.C., Laslo, P., Cheng, J.X., Murre, 545 C., Singh, H., and Glass, C.K. (2010). Simple combinations of lineage-determining 546 transcription factors prime cis-regulatory elements required for macrophage and B cell 547 identities. Mol Cell 38, 576-589. 548
Helmlinger, D., and Tora, L. (2017). Sharing the SAGA. Trends Biochem Sci 42, 850-549 861. 550
Hill, J.A., Feuerer, M., Tash, K., Haxhinasto, S., Perez, J., Melamed, R., Mathis, D., and 551 Benoist, C. (2007). Foxp3 transcription-factor-dependent and -independent regulation of 552 the regulatory T cell transcriptional signature. Immunity 27, 786-800. 553
Josefowicz, S.Z., Lu, L.F., and Rudensky, A.Y. (2012). Regulatory T cells: mechanisms 554 of differentiation and function. Annu Rev Immunol 30, 531-564. 555
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
25
Josefowicz, S.Z., Wilson, C.B., and Rudensky, A.Y. (2009). Cutting edge: TCR 556 stimulation is sufficient for induction of Foxp3 expression in the absence of DNA 557 methyltransferase 1. Journal of immunology 182, 6648-6652. 558
Kim, H.P., and Leonard, W.J. (2007). CREB/ATF-dependent T cell receptor-induced 559 FoxP3 gene expression: a role for DNA methylation. The Journal of experimental 560 medicine 204, 1543-1551. 561
Kitagawa, Y., Ohkura, N., Kidani, Y., Vandenbon, A., Hirota, K., Kawakami, R., Yasuda, 562 K., Motooka, D., Nakamura, S., Kondo, M., et al. (2017). Guidance of regulatory T cell 563 development by Satb1-dependent super-enhancer establishment. Nat Immunol 18, 173-564 183. 565
Kitoh, A., Ono, M., Naoe, Y., Ohkura, N., Yamaguchi, T., Yaguchi, H., Kitabayashi, I., 566 Tsukada, T., Nomura, T., Miyachi, Y., et al. (2009). Indispensable role of the Runx1-567 Cbfbeta transcription complex for in vivo-suppressive function of FoxP3+ regulatory T 568 cells. Immunity 31, 609-620. 569
Koutelou, E., Hirsch, C.L., and Dent, S.Y. (2010). Multiple faces of the SAGA complex. 570 Curr Opin Cell Biol 22, 374-382. 571
Lal, G., Zhang, N., van der Touw, W., Ding, Y., Ju, W., Bottinger, E.P., Reid, S.P., Levy, 572 D.E., and Bromberg, J.S. (2009). Epigenetic regulation of Foxp3 expression in 573 regulatory T cells by DNA methylation. Journal of immunology 182, 259-273. 574
Lee, H.M., Bautista, J.L., Scott-Browne, J., Mohan, J.F., and Hsieh, C.S. (2012). A 575 broad range of self-reactivity drives thymic regulatory T cell selection to limit responses 576 to self. Immunity 37, 475-486. 577
Li, W., Koster, J., Xu, H., Chen, C.H., Xiao, T., Liu, J.S., Brown, M., and Liu, X.S. (2015). 578 Quality control, modeling, and visualization of CRISPR screens with MAGeCK-VISPR. 579 Genome Biol 16, 281. 580
Li, W., Xu, H., Xiao, T., Cong, L., Love, M.I., Zhang, F., Irizarry, R.A., Liu, J.S., Brown, 581 M., and Liu, X.S. (2014a). MAGeCK enables robust identification of essential genes 582 from genome-scale CRISPR/Cas9 knockout screens. Genome Biol 15, 554. 583
Li, X., Liang, Y., LeBlanc, M., Benner, C., and Zheng, Y. (2014b). Function of a Foxp3 584 cis-element in protecting regulatory T cell identity. Cell 158, 734-748. 585
Liston, A., Nutsch, K.M., Farr, A.G., Lund, J.M., Rasmussen, J.P., Koni, P.A., and 586 Rudensky, A.Y. (2008). Differentiation of regulatory Foxp3+ T cells in the thymic cortex. 587 Proceedings of the National Academy of Sciences of the United States of America 105, 588 11903-11908. 589
Liu, Y., Zhang, P., Li, J., Kulkarni, A.B., Perruche, S., and Chen, W. (2008). A critical 590 function for TGF-beta signaling in the development of natural CD4+CD25+Foxp3+ 591 regulatory T cells. Nat Immunol 9, 632-640. 592
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
26
Long, M., Park, S.G., Strickland, I., Hayden, M.S., and Ghosh, S. (2009). Nuclear factor-593 kappaB modulates regulatory T cell development by directly regulating expression of 594 Foxp3 transcription factor. Immunity 31, 921-931. 595
Michel, B.C., D'Avino, A.R., Cassel, S.H., Mashtalir, N., McKenzie, Z.M., McBride, M.J., 596 Valencia, A.M., Zhou, Q., Bocker, M., Soares, L.M.M., et al. (2018). A non-canonical 597 SWI/SNF complex is a synthetic lethal target in cancers driven by BAF complex 598 perturbation. Nature cell biology 20, 1410-1420. 599
Mootha, V.K., Lindgren, C.M., Eriksson, K.F., Subramanian, A., Sihag, S., Lehar, J., 600 Puigserver, P., Carlsson, E., Ridderstrale, M., Laurila, E., et al. (2003). PGC-1alpha-601 responsive genes involved in oxidative phosphorylation are coordinately downregulated 602 in human diabetes. Nat Genet 34, 267-273. 603
Ouyang, W., Beckett, O., Ma, Q., and Li, M.O. (2010). Transforming growth factor-beta 604 signaling curbs thymic negative selection promoting regulatory T cell development. 605 Immunity 32, 642-653. 606
Platt, R.J., Chen, S., Zhou, Y., Yim, M.J., Swiech, L., Kempton, H.R., Dahlman, J.E., 607 Parnas, O., Eisenhaure, T.M., Jovanovic, M., et al. (2014). CRISPR-Cas9 knockin mice 608 for genome editing and cancer modeling. Cell 159, 440-455. 609
Polansky, J.K., Kretschmer, K., Freyer, J., Floess, S., Garbe, A., Baron, U., Olek, S., 610 Hamann, A., von Boehmer, H., and Huehn, J. (2008). DNA methylation controls Foxp3 611 gene expression. Eur J Immunol 38, 1654-1663. 612
Remillard, D., Buckley, D.L., Paulk, J., Brien, G.L., Sonnett, M., Seo, H.S., Dastjerdi, S., 613 Wuhr, M., Dhe-Paganon, S., Armstrong, S.A., et al. (2017). Degradation of the BAF 614 Complex Factor BRD9 by Heterobifunctional Ligands. Angew Chem Int Ed Engl 56, 615 5738-5743. 616
Rudra, D., Egawa, T., Chong, M.M., Treuting, P., Littman, D.R., and Rudensky, A.Y. 617 (2009). Runx-CBFbeta complexes control expression of the transcription factor Foxp3 in 618 regulatory T cells. Nat Immunol 10, 1170-1177. 619
Sakaguchi, S., Yamaguchi, T., Nomura, T., and Ono, M. (2008). Regulatory T cells and 620 immune tolerance. Cell 133, 775-787. 621
Samstein, R.M., Arvey, A., Josefowicz, S.Z., Peng, X., Reynolds, A., Sandstrom, R., 622 Neph, S., Sabo, P., Kim, J.M., Liao, W., et al. (2012). Foxp3 exploits a pre-existent 623 enhancer landscape for regulatory T cell lineage specification. Cell 151, 153-166. 624
Sanjana, N.E., Shalem, O., and Zhang, F. (2014). Improved vectors and genome-wide 625 libraries for CRISPR screening. Nat Methods 11, 783-784. 626
Shalem, O., Sanjana, N.E., Hartenian, E., Shi, X., Scott, D.A., Mikkelson, T., Heckl, D., 627 Ebert, B.L., Root, D.E., Doench, J.G., et al. (2014). Genome-scale CRISPR-Cas9 628 knockout screening in human cells. Science 343, 84-87. 629
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
27
Shifrut, E., Carnevale, J., Tobin, V., Roth, T.L., Woo, J.M., Bui, C.T., Li, P.J., Diolaiti, 630 M.E., Ashworth, A., and Marson, A. (2018). Genome-wide CRISPR Screens in Primary 631 Human T Cells Reveal Key Regulators of Immune Function. Cell 175, 1958-1971 e1915. 632
Spahn, P.N., Bath, T., Weiss, R.J., Kim, J., Esko, J.D., Lewis, N.E., and Harismendy, O. 633 (2017). PinAPL-Py: A comprehensive web-application for the analysis of CRISPR/Cas9 634 screens. Scientific reports 7, 15854. 635
Subramanian, A., Tamayo, P., Mootha, V.K., Mukherjee, S., Ebert, B.L., Gillette, M.A., 636 Paulovich, A., Pomeroy, S.L., Golub, T.R., Lander, E.S., et al. (2005). Gene set 637 enrichment analysis: a knowledge-based approach for interpreting genome-wide 638 expression profiles. Proceedings of the National Academy of Sciences of the United 639 States of America 102, 15545-15550. 640
Sun, I.H., Oh, M.H., Zhao, L., Patel, C.H., Arwood, M.L., Xu, W., Tam, A.J., Blosser, 641 R.L., Wen, J., and Powell, J.D. (2018). mTOR Complex 1 Signaling Regulates the 642 Generation and Function of Central and Effector Foxp3(+) Regulatory T Cells. Journal 643 of immunology 201, 481-492. 644
Tanaka, A., and Sakaguchi, S. (2017). Regulatory T cells in cancer immunotherapy. 645 Cell research 27, 109-118. 646
Tone, Y., Furuuchi, K., Kojima, Y., Tykocinski, M.L., Greene, M.I., and Tone, M. (2008). 647 Smad3 and NFAT cooperate to induce Foxp3 expression through its enhancer. Nat 648 Immunol 9, 194-202. 649
van Loosdregt, J., and Coffer, P.J. (2014). Post-translational modification networks 650 regulating FOXP3 function. Trends Immunol 35, 368-378. 651
van Loosdregt, J., Fleskens, V., Fu, J., Brenkman, A.B., Bekker, C.P., Pals, C.E., 652 Meerding, J., Berkers, C.R., Barbi, J., Grone, A., et al. (2013). Stabilization of the 653 transcription factor Foxp3 by the deubiquitinase USP7 increases Treg-cell-suppressive 654 capacity. Immunity 39, 259-271. 655
Wang, X., Wang, S., Troisi, E.C., Howard, T.P., Haswell, J.R., Wolf, B.K., Hawk, W.H., 656 Ramos, P., Oberlick, E.M., Tzvetkov, E.P., et al. (2019). BRD9 defines a SWI/SNF sub-657 complex and constitutes a specific vulnerability in malignant rhabdoid tumors. Nature 658 communications 10, 1881. 659
Webster, K.E., Walters, S., Kohler, R.E., Mrkvan, T., Boyman, O., Surh, C.D., Grey, 660 S.T., and Sprent, J. (2009). In vivo expansion of T reg cells with IL-2-mAb complexes: 661 induction of resistance to EAE and long-term acceptance of islet allografts without 662 immunosuppression. The Journal of experimental medicine 206, 751-760. 663
Xue, Y., Canman, J.C., Lee, C.S., Nie, Z., Yang, D., Moreno, G.T., Young, M.K., 664 Salmon, E.D., and Wang, W. (2000). The human SWI/SNF-B chromatin-remodeling 665 complex is related to yeast rsc and localizes at kinetochores of mitotic chromosomes. 666
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
28
Proceedings of the National Academy of Sciences of the United States of America 97, 667 13015-13020. 668
Yan, Z., Cui, K., Murray, D.M., Ling, C., Xue, Y., Gerstein, A., Parsons, R., Zhao, K., 669 and Wang, W. (2005). PBAF chromatin-remodeling complex requires a novel specificity 670 subunit, BAF200, to regulate expression of selective interferon-responsive genes. 671 Genes Dev 19, 1662-1667. 672
Yang, X.O., Nurieva, R., Martinez, G.J., Kang, H.S., Chung, Y., Pappu, B.P., Shah, B., 673 Chang, S.H., Schluns, K.S., Watowich, S.S., et al. (2008). Molecular antagonism and 674 plasticity of regulatory and inflammatory T cell programs. Immunity 29, 44-56. 675
Yue, Y., Liu, J., and He, C. (2015). RNA N6-methyladenosine methylation in post-676 transcriptional gene expression regulation. Genes Dev 29, 1343-1355. 677
Zhao, K., Wang, W., Rando, O.J., Xue, Y., Swiderek, K., Kuo, A., and Crabtree, G.R. 678 (1998). Rapid and phosphoinositol-dependent binding of the SWI/SNF-like BAF 679 complex to chromatin after T lymphocyte receptor signaling. Cell 95, 625-636. 680
Zheng, Y., Josefowicz, S., Chaudhry, A., Peng, X.P., Forbush, K., and Rudensky, A.Y. 681 (2010). Role of conserved non-coding DNA elements in the Foxp3 gene in regulatory T-682 cell fate. Nature 463, 808-812. 683
Zheng, Y., and Rudensky, A.Y. (2007). Foxp3 in control of the regulatory T cell lineage. 684 Nat Immunol 8, 457-462. 685
Zhou, Y., Zhou, B., Pache, L., Chang, M., Khodabakhshi, A.H., Tanaseichuk, O., 686 Benner, C., and Chanda, S.K. (2019). Metascape provides a biologist-oriented resource 687 for the analysis of systems-level datasets. Nature communications 10, 1523. 688
689
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
29
Acknowledgments 690
We would like to thank C. Gordon for mouse colony management, B. Kuo and X. Hu for 691
assistance in plasmid extraction and mouse dissection, N. Hah and G. Chou for 692
assistance in RNA-seq, ChIP-seq, CRISPR screen experiments, E. Shifrut and A. 693
Marson (UCSF) for providing us the R script to generate the sgRNA distribution 694
histograms, A. Williams and M. Shokhirov for bioinformatic assistance, and M. Downes 695
and R. M. Evans for helpful discussion. C.S.L. was partly supported by the Albert G. 696
and Olive H. Schlink Foundation. J.G. was supported by the Salk Institute T32 Cancer 697
Training Grant T32CA009370 and the NIGMS NRSA F32 GM128377-01. D.C.H. was 698
supported by the National Institutes of Health (GM128943-01, CA184043-03), the V 699
Foundation for Cancer Research V2016-006, and the Leona M. and Harry B. Helmsley 700
Charitable Trust. Y.Z. was supported by the NOMIS Foundation, the Crohn’s and Colitis 701
Foundation, the Leona M. and Harry B. Helmsley Charitable Trust, and National 702
Institute of Health (AI107027 and OD023689). This work was also supported by 703
National Cancer Institute funded Salk Institute Cancer core facilities (CA014195). 704
705
Author Contributions 706
Conceptualization: C.S.L., J.G., D.C.H. and Y.Z. Methodology: C.S.L. Investigation: 707
C.S.L., J.G., Y.L., M.X., J.H., B.V. Resources: D.C.H. and Y.Z. Formal analysis: C.S.L., 708
J.G., M.L. Data Curation: C.S.L., J.G. Supervision: D.C.H. and Y.Z. Funding acquisition: 709
D.C.H. and Y.Z. Writing – original draft preparation: C.S.L., J.G., D.C.H. and Y.Z. 710
Writing – review and editing: C.S.L., J.G., D.C.H. and Y.Z. 711
712
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
30
Figure Legends 713
Figure 1 | A genome-wide CRISPR screen in Treg cells 714
A, Workflow of the CRISPR screen in Tregs. B-D, Validation of the CRISPR screen 715
conditions. B, FACS plots showing Foxp3 expression in Tregs after knocking out Foxp3 716
(sgFoxp3), positive regulator Cbfb (sgCbfb), and negative regulator Dnmt1 (sgDnmt1). 717
Red and green gates were set based on Foxp3 low 20% and high 20% in sgNT Treg, 718
respectively. C, Mean fluorescence intensity (MFI) of Foxp3 and D, Relative Log2FC of 719
cell count comparing Foxp3Low to Foxp3High after deletion of the indicated target gene 720
(n=3 per group). See also Figure S1 and S2. 721
722
Figure 2 | Identification of novel Foxp3 regulators in Treg cells 723
A, B, A scatter plot of the Treg screen result showing positive regulators (A) and 724
negative regulators (B). Genes that have met cutoff criteria (P-value<0.01, and 725
Log2FC >± 0.5) are shown as red dots for positive regulators and green dots for 726
negative regulators. C, Distribution of sgRNA Log2FC comparing Foxp3Low to Foxp3High. 727
Red stripes represent sgRNAs from positive Foxp3 regulators, whereas green stripes 728
represent sgRNAs from negative Foxp3 regulators. D, Venn diagram showing the 729
overlap of Foxp3 regulators with genes involved in cell contraction or expansion. E, F, 730
Gene ontology analysis of positive Foxp3 regulators (E) and negative Foxp3 regulators 731
(F). See also Figures S3 and S4; Tables S1, S2, S3, and S4. 732
733
Figure 3 | The three SWI/SNF complex assemblies have distinct regulatory roles 734
for Foxp3 expression in Tregs 735
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
31
A, A diagram showing three different variants of SWI/SNF complexes: BAF, ncBAF, and 736
PBAF. BAF-specific subunits (ARID1A, DPF1-3) are colored blue, ncBAF-specific 737
subunits (BRD9, SMARCD1, GLTSCR1L, GLTSCR1) colored orange, and PBAF-738
specific subunit (PBRM1, ARID2, BRD7, PHF10) colored green. Shared components 739
among complexes are colored gray. Immunoprecipitation assay of ARID1A, BRD9, and 740
PHF10, and BRG1 in Tregs. The co-precipitated proteins were probed for shared 741
subunits (SMARCA4, SMARCC1, SMARCB1), BAF-specific ARID1A, ncBAF-specific 742
BRD9, and PBAF-specific PBRM1. B, FACS histogram of Foxp3 expression in Tregs 743
after sgRNA knockout of the indicated SWI/SNF subunits. C, Mean fluorescence 744
intensity (MFI) of Foxp3 after sgRNA knockout of the indicated SWI/SNF subunits. Data 745
represents mean and standard deviation of biological replicates (n = 3-21). D, Principal 746
component analysis of RNA-seq data collected from Tregs transduced with guides 747
against the indicated SWI/SNF subunits. In cases where two independent guides were 748
used to knockdown a gene, the second guide for targeting gene indicated as “-2”. E, 749
MFI of Foxp3 expression in Tregs after treatment with either DMSO or 0.16-10 μM 750
dBRD9 for 4 days. Data represent mean ± s.d. Statistical analyses were performed 751
using unpaired two-tailed Student's t test (ns: p≥0.05, *p<0.05, **p<0.01, ***p<0.001, 752
****p<0.0001). 753
754
Figure 4 | BRD9 deletion reduces Foxp3 binding at CNS0, CNS2 enhancers and a 755
subset of Foxp3 target sites 756
A, Genome browser tracks of SMARCA4, BRD9, PHF10 ChIP-seq and ATAC-seq 757
signal, as well as Foxp3 ChIP-seq in sgNT, sgFoxp3, sgBrd9 and sgPbrm1 Tregs and 758
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
32
Foxp3 in DMSO and dBRD9 treated Tregs (2.5 μM dBRD9 for 4 days). Foxp3 locus is 759
shown with CNS0 and CNS2 enhancers indicated in gray ovals. B, Heat map of Foxp3, 760
BRD9, SMARCA4, PHF10 ChIP-seq and ATAC-seq signal ± 3 kb centered on Foxp3-761
bound sites in Tregs, ranked according to Foxp3 read density. C, Venn diagram of the 762
overlap between ChIP-seq peaks in Tregs for BRD9, Foxp3, and PHF10 763
(hypergeometric p value of BRD9:Foxp3 overlap = e-30704, hypergeometric p value of 764
PHF10:Foxp3 overlap = e-13182, hypergeometric p value of BRD9:PHF10 overlap = e-765
12895). D, Heat map of Foxp3 ChIP-seq signal in sgNT, sgFoxp3, sgBrd9 and sgPbrm1 766
Tregs ± 3 kilobases (kb) centered on Foxp3-bound sites in sgNT, ranked according to 767
read density. E, Venn diagram of the overlap (hypergeometric p value = e-11,653) 768
between sites that significantly lose Foxp3 binding (FC 1.5, Poisson p value < 0.0001) in 769
sgFoxp3 and sgBrd9, overlaid on all Foxp3-bound sites in sgNT (in gray). F, Histogram 770
of Foxp3 ChIP read density ± 1 kb surrounding the peak center of sites that significantly 771
lose Foxp3 binding in both sgFoxp3 and sgBrd9 (n=1,699) in sgNT, sgFoxp3, sgBrd9 772
and sgPbrm1. G, As in E, but for sites that lose H3K27ac (FC 1.5, Poisson p value < 773
0.0001, hypergeometric p value of overlap = e-7,938). H, As in F, but for H3K27ac ChIP 774
read density. I, As in E, but for sites that significantly lose Foxp3 binding in dBRD9 775
treated Tregs versus DMSO (FC 1.5, Poisson p value < 0.0001). J, As in F, but for 776
DMSO and dBRD9 treated cells. 777
778
Figure 5 | BRD9 co-regulates the expression of Foxp3 and a subset of Foxp3 779
target genes 780
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
33
A, Volcano plot of log2 fold change RNA expression in sgFoxp3/sgNT Tregs versus 781
adjusted p value (Benjamin-Hochberg). Number of down- and up-regulated genes are 782
indicated, which are colored blue and red, respectively. B, Significance of enrichment of 783
Foxp3-dependent genes in each gene ontology. C, Pie chart of Foxp3 and BRD9 784
binding by ChIP-seq for Foxp3-dependent genes. D, Scatterplot of the mRNA log2 fold 785
changes in sgFoxp3/sgNT and sgBrd9/sgNT for Foxp3-dependent genes. Linear 786
regression analysis was performed to calculate the r2. Best fit is represented as an 787
orange dashed line. E, Gene set enrichment analysis (GSEA) enrichment plot for up- 788
and down-regulated genes in sgBrd9/sgNT compared with RNA-seq data of genes that 789
significantly change in sgFoxp3/sgNT Tregs. ES: Enrichment Score, NES: Normalized 790
Enrichment Score, FWER: Familywise Error Rate. F, As in E, but for up- and down-791
regulated genes in dBRD9/DMSO Tregs. G, GSEA of the sgFoxp3/sgNT RNA-seq data; 792
plot shows the familywise error rate (FWER) p value versus the normalized enrichment 793
score (NES). See also Table S5. 794
795
Figure 6 | The ncBAF complex regulates Treg suppressor function in vitro and in 796
vivo. 797
A. In vitro suppression assay of Tregs with sgRNA knockout of Brd9, Smarcd1, Pbrm1, 798
and Phf10 (n=3 per group, data represent ± s.d.). sgNT was used as non-targeting 799
control. B-F. Experiment to measure Treg function of sgNT or sgBrd9 knockout Treg 800
cells relative to no Tregs in a T cell transfer induced colitis model. B, Experimental 801
procedure. C, Body weight loss. D, Colon histology (left) and colitis scores (right). E, 802
Percentage of Foxp3+ cells in transferred CD45.2+CD4+ Treg population at end point. 803
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
34
(n=4-6 per group. Data represent mean ± s.e.m.) Statistical analyses were performed 804
using unpaired two-tailed Student's t test (ns: p≥0.05, *p<0.05, **p<0.01, ***p<0.001). 805
806
Figure 7 | Targeting BRD9 in Treg improves anti-tumor immunity. 807
A, Experiment procedure to measure function of sgNT or sgBrd9 knockout Treg cells 808
relative to no Tregs in MC38 tumor model. B, Tumor growth curve. C, Tumor weight at 809
end point. D,E, Bar graph of total CD4 T cells (D) and CD8 T cells (E) percentage in 810
CD45+ immune cell population. F,G, Bar graph of IFN-γ+ cell percentage in CD4 T cells 811
(F) and in CD8 T cells (G). H, Bar graph of CD4+eGFP+Foxp3+ donor cells in CD4+ T 812
cells. I, Ratio of CD8/Treg. (n=5-7 per group. Data represent mean ± s.e.m.) Statistical 813
analyses were performed using unpaired two-tailed Student's t test (ns: p≥0.05, *p<0.05, 814
**p<0.01, ***p<0.001). 815
816
817
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
35
Methods 818
List of antibodies 819
Target protein Antibody source Application (dilution)
CD4-Alexa fluor 700 eBioscience 56-0042-82 Flow (1:400)
CD4-PerCP-Cy5.5 TONBO 65-0042-U100 Flow (1:400)
CD8-PE eBioscience 12-0081-85 Flow (1:400)
CD8-BV510 Biolegend 100752 Flow (1:400)
CD45.1-BV605 Biolegend 110735 Flow (1:400)
CD45.2-Alexa 700 Biolegend 109822 Flow (1:400)
Foxp3-eFluor 450 eBioscience 48-5773-82 Flow (1:400)
NGFR-PE Biolegend 345106 Flow (1:400)
NGFR-APC Biolegend 345108 Flow (1:400)
Thy1.1-PE eBioscience 12-0900-83 Flow (1:400)
CD44-BV650 Biolegend 103049 Flow (1:400)
CD62L-BV605 Biolegend 104438 Flow (1:400)
IFNg-APC eBioscience 17-7311-82 Flow (1:400)
Ghost Viability Dye TONBO 13-0865-T100 Flow (1:800)
Foxp3 In-house WB (1:2000); ChIP (1:100)
BRG1/SMARCA4 Abcam 110641 WB (1:2000); IP, ChIP (1:100)
BAF155/SMARCC1 Santa Cruz sc-10756 WB (1:1000)
BAF47/SMARCB1 Santa Cruz sc-166165 WB (1:1000)
BRD9 Active Motif 61537 WB (1:2000); IP, ChIP (1:100)
PBRM1 Bethyl A301-591A WB (1:2000)
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
36
PHF10 Thermo Fisher PA5-30678 IP, ChIP (1:100)
ARID1A Santa Cruz sc-32761 WB (1:1000)
Histone H3K27ac Abcam ab4729 ChIP (1:100)
IgG Cell Signaling 2729S IP (1:100)
anti-mouse secondary Thermo Fisher A21058 WB (1:20,000)
anti-rabbit secondary Thermo Fisher SA535571 WB (1:20,000)
820
List of sgRNA sequence 821
Plasmid name Target gene sgRNA sequence
pSIRG-NGFR-sgFoxp3 Foxp3 TCTACCCACAGGGATCAATG
pSIRG-NGFR-sgCbfb Cbfb GCCTTGCAGATTAAGTACAC
pSIRG-NGFR-sgDnmt1 Dnmt1 TAATGTGAACCGGTTCACAG
pSIRG-NGFR-sgArid1a Arid1a GCAGCTGCGAAGATATCGGG
pSIRG-NGFR-sgArid1a-2 Arid1a TACCCAAATATGAATCAAGG
pSIRG-NGFR-sgArid1b Arid1b TGAGTGCAAAACTGAGCGCG
pSIRG-NGFR-sgArid1b-2 Arid1b CAGAACCCCAACATATAGCG
pSIRG-NGFR-sgDpf1 Dpf1 TCTTCTACCTCGAGATCATG
pSIRG-NGFR-sgDpf2 Dpf2 GAAGATACGCCAAAGCGTCG
pSIRG-NGFR-sgPbrm1 Pbrm1 AAAACACTTGCATAACGATG
pSIRG-NGFR-sgPbrm1-2 Pbrm1 CAATGCCAGGCACTACAATG
pSIRG-NGFR-sgArid2 Arid2 ACTTGCAGTAAATTAGCTCG
pSIRG-NGFR-sgBrd7 Brd7 CAGGAGGCAAGCTAACACGG
pSIRG-NGFR-sgPhf10 Phf10 GTTGCCGACAGACCGAACGA
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
37
pSIRG-NGFR-sgBrd9 Brd9 ATTAACCGGTTTCTCCCGGG
pSIRG-NGFR-sgBrd9-2 Brd9 GGAACACTGCGACTCAGAGG
pSIRG-NGFR-sgGltscr1 Gltscr1 GTTCTGTGTAAAATCACACT
pSIRG-NGFR-sgGltscr1l Gltscr1l ATGGCTTTATGCAACACGTG
pSIRG-NGFR-sgSmarcd1 Smarcd1 CAATCCGGCTAAGTCGGACG
pSIRG-NGFR-sgEny2 Eny2 AGAGCTAAATTAATTGAGTG
pSIRG-NGFR-sgAtxn7l3 Atxn7l3 GCAGCCGAATCGCCAACCGT
pSIRG-NGFR-sgUsp22 Usp22 GCCATCGACCTGATGTACGG
pSIRG-NGFR-sgCcdc101 Ccdc101/Sgf29 CCAGGTTTCCCGATCCAGAG
pSIRG-NGFR-sgTada3 Tada3 GAAGGTCTGTCCCCGCTACA
pSIRG-NGFR-sgTada1 Tada1 TTTCCTTCTCGACACAACTG
pSIRG-NGFR-sgTaf6l Taf6l TCATGAAACACACCAAACGA
pSIRG-NGFR-sgSupt20 Supt20 TTAGTAGTCAATCTGTACCC
pSIRG-NGFR-sgSupt5 Supt5 GATGACCGATGTACTCAAGG
pSIRG-NGFR-sgNT Non-targeting AAAAAGTCCGCGATTACGTC
pSIRG-eGFP-sgBrd9 Brd9 ATTAACCGGTTTCTCCCGGG
pSIRG-eGFP-sgNT Non-targeting AAAAAGTCCGCGATTACGTC
822
Mice 823
C57BL/6 Rosa-Cas9/Foxp3Thy1.1 mice were generated by crossing Rosa26-LSL-Cas9 824
knockin mice(Platt et al., 2014) (The Jackson Laboratory #024857) with Foxp3Thy1.1 825
reporter mice(Liston et al., 2008). Male Cas9/Foxp3Thy1.1 mice at 8-12 weeks age were 826
used to isolate Tregs for the CRISPR screen, and no gender preference was given for 827
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
38
other experiments. C57BL.6 Ly5.1+ congenic mice and Rag1-/- mice purchased from 828
the Jackson Laboratory were used for Treg suppression assay and adoptive T cell 829
transfer in colitis and tumor models. All mice were bred and housed in the specific 830
pathogen-free facilities at the Salk Institute for Biological Studies and were conducted 831
under the regulation of the Institutional Animal Care and Use Committee (IACUC) and 832
institutional guidelines. 833
834
Retroviral vectors and sgRNA library construction 835
Self-inactivating retroviral vector pSIRG-NGFR was generated by modifying pSIR-836
dsRed-Express2(Fujita and Fujii, 2014) (Addgene #51135), which enables us to clone 837
sgRNA as efficient as lentiCRISPRv2, to enrich transduced cells via magnetic beads 838
isolation, and to perform intracellular staining without losing transduced reporter marker. 839
We first mutated all BbsI sites in pSIR-dsRed-Express2, then inserted a sgRNA 840
expressing cassette containing the U6 promoter, guide RNA scaffold and a 500bp filler 841
embedded with BbsI cloning site. The dsRed cassette was replaced by cDNA sequence 842
of human NGFR with truncated intracellular domain. We also generated pSIRG vector 843
with eGFP (pSIRG-eGFP) for the purpose of T cells transfer in tumor study, minimizing 844
potential immune rejection. The pSIRG-eGFP was generated by cutting pSIRG-NGFR 845
with XcmI to remove NGFR cassette and replaced by eGFP cDNA by Gibson cloning. 846
For cloning single guide RNA into the pSIRG vector, an annealed sgRNA oligos can be 847
directly inserted into BbsI-digested pSIRG-NGFR by T4 ligation similar to the cloning 848
method utilized by lentiCRISPRv2(Sanjana et al., 2014). To create a pooled sgRNA 849
library in pSIRG-NGFR, we first amplified sgRNA sequences from an optimized mouse 850
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
39
CRISPR knockout library lentiCRISPRv2-Brie (Addgene #73632). A total of eight 50 μL 851
PCR reactions were performed to maximize coverage of sgRNA complexity. Each 50 μL 852
PCR reaction contained Q5 High-Fidelity DNA polymerase and buffer (NEB #M0491), 853
15ng of lentiCRISPRv2-Brie, and targeted primers (Forward: 854
GGCTTTATATATCTTGTGGAAAGGACGAAACACCG, Reverse: 855
CTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC). PCR was performed at 98°C 856
denature, 67°C annealing, 72°C extension for 12 cycles. The sgRNA library amplicons 857
were then combined and separated in 2 % agarose gel, and purified by the QIAquick 858
Gel Extraction Kit (Qiagen #28704). The purified sgRNA amplicons was inserted into 859
the BbsI-digested pSIRG-NGFR by NEBuilder HIFI assembly (NEB #E2621S). The 860
sgRNA representative of the retroviral CRISPR library (pSIRG-NGFR-Brie) was 861
validated by deep sequencing and comparing to the original lentiCRISPRvs-Brie. The 862
coverage of the new pSIRG-NGFR sgRNA library was evaluated by the PinAPL-Py 863
program (Spahn et al., 2017) (see Extended Data Figure 1). 864
865
T cell isolation and culture 866
For large scale Treg culture, we first expanded Treg in Rosa-Cas9/Foxp3Thy1.1 mice by 867
injecting IL-2:IL-2 antibody immune complex according protocol described in Webster 868
KE et. al(Webster et al., 2009). Spleen and lymph node Tregs were labeled with PE-869
conjugated Thy1.1 antibody and isolated by magnetic selection using anti-PE 870
microbeads (Mitenyl #130-048-801). All isolated Tregs were activated by plate bound 871
anti-CD3 and anti-CD28 antibodies and cultured with X-VIVO 20 media (LONZA #04-872
448Q) supplemented by 1X Pen/Strep, 1X Sodium pyruvate, 1X HEPES, 1X GlutaMax, 873
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
40
55 μM beta-mercaptoethanol in the presence of IL-2 at 500 U/mL. For experiments with 874
BRD9 degradation, Tregs were treated at day 0 with 2.5μM dBRD9 (Tocris #6606) and 875
cultured for four days for RNA- and ChIP-seq and 0.16-10μM treated at day 0 and 876
cultured dBRD9 for four days for Foxp3 MFI, cell viability and cell proliferation assays. 877
Live cells were enriched by Ficoll-Paque 1.084 (GE Health 17-5446-02) for RNA-seq 878
and ChIP-seq. 879
880
Retroviral production and T cell transduction 881
HEK293T cells were seeded in 6-wells plate at 0.5 million cells per 2mL DMEM media 882
supplemented by 10% FBS, 1% Pen/Strep, 1X GlutaMax, 1X Sodium Pyruvate, 1X 883
HEPES, and 55 μM beta-mercaptoethanol. One day later, cells from each well was 884
transfected with 1.2 μg of targeting vector pSIRG-NGFR and 0.8 μg of packaging vector 885
pCL-Eco (Addgene, #12371) by using 4 μL of FuGENE HD transfection reagent 886
(Promega #E2311) according manufactured protocol. Cell culture media was replaced 887
by 3 mL fresh DMEM complete media at 24 hours and 48 hours after transfection. The 888
retroviral supernatant was collected at 48 and 72 hours post transfection for T cell 889
infection. For experiments with CRISPR sgRNA targeted knockdown, Cas9+ Tregs 890
were first seeded in 24-wells plate coated with CD3 and CD28 antibodies. At 24 hour 891
post-activation, 70% of Treg media from each well was replaced by retroviral 892
supernatant, supplemented with 4 μg/mL Polybrene (Milipore # TR-1003-G), and spun 893
in a benchtop centrifuge at 1,258 x g for 90 minutes at 32°C. After centrifugation, Treg 894
media was replaced with fresh media supplemented with IL-2 and cultured for another 895
three days. Transduced cells were analyzed for Foxp3 and cytokine expression in 896
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
41
eBioscience Fix/Perm buffer (eBioscience #00-5523-00) using flow cytometry. 897
Transduced NGFR+ cells were FACS-sorted for subsequent RNA- and ChIP-seq 898
experiments. 899
900
Genome-wide CRISPR screen in Treg 901
Approximately 360 million Treg cells isolated from Rosa-Cas9/Foxp3Thy1.1 mice were 902
used for the Treg screen. On day 0, Tregs were seeded at 1x106 cells/mL into 24-wells 903
plate coated with anti-CD3/28 and cultured with X-VIVO complete media with IL-2 (500 904
U/ml). On day 1, sgRNA retroviral library transduction was performed with a MOI<0.2. 905
On day 3, approximately 4 million (~50X coverage) NGFR+ transduced cells were 906
collected in three replicates as the starting state sgRNA input. Treg cells reached 907
confluence on day 4. NGFR+ transduced cells were isolated via magnetic selection by 908
anti-PE beads (Mitenyl #130-048-801), and then plated onto new 24-wells plates coated 909
with anti-CD3/CD28, and cultured in X-VIVO complete media with IL-2 (500 U/ml). On 910
day 6, approximately 4 million NGFR+ transduced cells were collected in three 911
replicates as the ending state sgRNA output. The remaining cells were fixed, 912
permeabilized, and stained for intracellular Foxp3. Approximately 2 million Foxp3High 913
(top 20%) and 2 million Foxp3Low (bottom 20%) cell populations were sorted in three 914
replicates by a FACS Aria cell sorter for genomic DNA extraction and library 915
construction. 916
917
Preparation of sgRNA amplicons for Next-Generation Sequencing 918
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
42
To extract genomic DNA, we first lysed cells with homemade digestion buffer (100mM 919
NaCl, 10mM Tris, 25mM EDTA, 0.5% SDS, 0.1mg/mL Proteinase K) overnight in 50 °C. 920
On the following day, the lysed sample was mixed with phenol: chloroform: isoamyl 921
alcohol (25:24:1, v/v) in 1:1 ratio, and spun at 6000rpm for 15 min at room temperature. 922
The supernatant containing genomic DNA was transferred into a new tube and mixed 923
with twice volume of 100% ethanol, then spun at 12,500 rpm for 5 min in room 924
temperature to precipitate DNA. Supernatant was removed, and the precipitated DNA 925
was dissolved in ddH2O. DNA concentration was measured by Nanodrop. To generate 926
sgRNA amplicons from extracted genomic DNA, we used a two-step PCR protocol 927
which was adopted from the protocol published by Shalem et. al. (Shalem et al., 2014). 928
We performed eight 50 μL PCR reactions containing 2 μg genomic DNA, NEB Q5 929
polymerase, and buffer, and targeted primers (Forward: 930
GGCTTTATATATCTTGTGGAAAGGACGAAACACCG, Reverse: 931
CTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC). PCR was performed at 98°C 932
denature, 70°C annealing, 15s extension for 20 cycles. The products from the first PCR 933
were pooled together, and purified by AMPure XP SPRI beads according to 934
manufacturer’s protocol, and quantified by Qubit dsDNA HS assay. For the second 935
round PCR, we performed eight 50 μL PCR reactions containing 2 ng purified 1st round 936
PCR product, barcoded primer (see primer set from (Shalem et al., 2014), Priming site 937
of reverse primer was changed to CTTCCCTCGACGAATTCCCAAC), NEB Q5 938
polymerase, and buffer. PCR was performed at 98°C denature, 70°C annealing, 15 s 939
extension for 12 cycles. The 2nd round PCR products were pooled, purified by AMPure 940
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
43
XP SPRI beads, quantified by Qubit dsDNA HS assay, and sequenced by NEXTSeq 941
sequencer at single end 75 bp (SE75). 942
943
Data analysis of pooled CRISPR screen 944
The screening hit identification and quality control was performed by MAGeCK-VISPR 945
program(Li et al., 2015; Li et al., 2014a). The abundance of sgRNA from a sample fastq 946
file was first quantified by MAGeCK “Count” module to generate a read count table. For 947
hit calling, we used MAGeCK “test” module to generate a gene-ranking table that 948
reporting RRA gene ranking score, p-value, and log2 fold change. The size factor for 949
normalization was adjusted according to1000 non-targeting control assigned in the 950
screen library. All sgRNAs that are zero read were removed from RRA analysis. The 951
log2 fold change of a gene was calculated from a mean of 4 sgRNA targeting per gene. 952
The scatter plots showing the screen results were generated by using the R script 953
EnhancedVolcano (https://github.com/kevinblighe/EnhancedVolcano). The R script that 954
generated the sgRNA distribution histogram was provided by E. Shifrut and A. Marson 955
(UCSF)(Shifrut et al., 2018). A gene list from Foxp3 regulators (either positive or 956
negative) without affecting cell proliferation was subjected to Gene Ontology analysis 957
using Metascape(Zhou et al., 2019). Genes were analyzed for enrichment for Functional 958
Set, Pathway, and Structural Complex. 959
960
In vitro Treg suppression assay 961
Tregs were transduced by retrovirus expressing sgRNA targeting gene of interest and 962
cultured in X-VIVO complete media supplemented with IL-2 (500 U/ml). Four days after 963
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
44
transduction, transduced cells were sorted and mixed with FACS sorted CD45.1+ naive 964
CD4 T cells (CD4+ CD25– CD44Low CD62LHigh) labeled with CellTrace Violet (Thermo 965
Fisher Scientific #C34571) in different ratio in the presence of irradiated T cell depleted 966
spleen cells as antigen-presenting cells (APC). Three days later, Treg suppression 967
function was measured by the percentage of non-dividing cells within the CD45.1+ 968
effector T cell population. For dBRD9 treatment experiment, dBRD9 was first dissolved 969
in DMSO (10 mM stock) and added into Treg:Teff:APC mixture at 2.5μM. For Foxp3 970
overexpression rescue experiment, Tregs were first transduced with sgNT or sgBrd9 at 971
24 hour post-activation, and then transduced with MIGR empty vector or MIGR-Foxp3 972
at 48 hour post-activation. Double transduced Tregs were FACS sorted on day 4 based 973
on NGFR+ and GFP+ markers and then mixed with CellTrace labeled effector T cells in 974
the presence of APC. Treg suppression readout was measured after three days of co-975
culture. 976
977
Adoptive T cells transfer-induced colitis model 978
Tregs were transduced by retrovirus expressing sgRNA targeting gene of interest, and 979
cultured in X-VIVO complete media and IL-2 (500 U/ml). Four days after transduction, 980
the NGFR+ transduced Treg cells were FACS sorted before transferred into recipient 981
mice. To induce colitis, 2 million effector T cells (CD45.1+ CD4+ CD25– CD45RBHigh) and 982
1 million sgRNA knockout Tregs (CD45.2+ CD4+ Thy1.1+ NGFR+) were mixed together 983
and transferred into Rag1 knockout recipient mice. The body weight of recipient mice 984
was monitored weekly for signs of wasting symptoms. Mice were harvested 7 weeks 985
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
45
after T cell transfer. Spleens were used for profiling immune cell populations by FACS. 986
Colons were collected for histopathological analysis. 987
988
Colon histopathological analysis 989
Histopathological analysis was performed in a blinded manner and scored using the 990
following criteria. Eight parameters were used that include (i) the degree of inflammatory 991
infiltrate in the LP (0-3); (ii) Goblet cell loss (0–2); (iii) reactive epithelial 992
hyperplasia/atypia with nuclear changes (0–3); (iv) the number of IELs in the epithelial 993
crypts (0–3); (v) abnormal crypt architecture (distortion, branching, atrophy, crypt loss) 994
(0–3); (vi) number of crypt abscesses (0–2); (vii) mucosal erosion to frank ulcerations 995
(0–2) and (viii) submucosal spread to transmural involvement (0-2). The severity of 996
lesion was scored independently in 3 regions (proximal, middle and distal colon) over a 997
maximal score of 20. The overall colitis score was based as the average of each 998
regional score (maximal score of 20). 999
1000
Adoptive T cells transfer and MC38 tumor model 1001
Similar to the “Adoptive T cells transfer-induced colitis model”, Tregs were activated in 1002
vitro and transduced with pSIRG-eGFP expressing sgNT or sgBrd9. Four days after 1003
transduction, the eGFP+ transduced Treg were FACS sorted. Concurrently, Treg 1004
depleted CD4 and CD8 T cells isolated from Rosa-Cas9/Foxp3Thy1.1 mice were used as 1005
effector T cells. A total of 1 million pSIRG-sgRNA transduced eGFP+ Tregs, 1 million 1006
effector CD8 T cells, and 2 million Treg-depleted CD4 T cells were mixed and 1007
transferred into Rag1 knockout recipient mice. on the following day, mice were 1008
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
46
implanted with 0.5 million MC38 cells (a gift from the laboratory of Dr. Susan Kaech) by 1009
subcutaneous injection on the flank of mouse. When palpable tumor appeared, tumor 1010
size was measured every two day by electronic calipers. At the end point, spleen and 1011
tumor were collected for immune profiling. For tumor processing, tumor tissues were 1012
minced into small pieces and digested with 0.5 mg/mL Collagenase IV (Sigma #C5138) 1013
and DNAase I (Roche #4716728001) for 20 minutes and passed through 0.75 μm cell 1014
strainer to collect single cell suspension. Isolated cells were stimulated with 1015
PMA/Ionomycin and Golgi plug for 5 hours, and then were subjected to Foxp3 and 1016
cytokines staining with eBioscience Fix/Perm buffer (eBioscience #00-5523-00). 1017
1018
Nuclear protein extraction 1019
Nuclear lysates were collected from Treg cells following a revised Dignam 1020
protocol(Andrews and Faller, 1991). After cellular swelling in Buffer A (10 mM Hepes pH 1021
7.9, 1.5 mM MgCl2, 10 mM KCl) supplemented with 1 mM DTT, 1 mM PMSF, 1 µM 1022
pepstatin, 10 µM leupeptin and 10 µM chymostatin, cells were lysed by homogenization 1023
using a 21-gauge needle with six to eight strokes. If lysis remained incomplete, cells 1024
were treated with 0.025 - 0.05% Igepal-630 for ten minutes on ice prior to nuclei 1025
collection. Nuclei were spun down at 700 x g for five minutes then resuspended in 1026
Buffer C (20 mM Hepes pH 7.9, 20% glycerol, 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM 1027
EDTA) supplemented with 1 mM DTT, 1 mM PMSF, 1 µM pepstatin, 10 µM leupeptin 1028
and 10 µM chymostatin. After thirty minutes of end-to-end rotation at 4°C, the sample 1029
was clarified at 21,100 x g for ten minutes. Supernatant was collected, flash frozen in 1030
liquid nitrogen and stored in the -80°C freezer. 1031
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
47
1032
Co-Immunoprecipitation 1033
Nuclear lysates were thawed on ice then diluted with two-thirds of original volume of 50 1034
mM Tris-HCl pH 8, 0.3% NP-40, EDTA, MgCl2 to bring down the NaCl concentration. 1035
Proteins were quantified using Biorad DC Protein Assay (Cat #5000112) according to 1036
manufacturer’s instructions. For the co-IP reaction, 200-300 µg of proteins were 1037
incubated with antibody against normal IgG, SMARCA4, BRD9, ARID1A or PHF10 1038
overnight at 4°C, with end-to-end rotation. Precipitated proteins were bound to 50:50 1039
Protein A: Protein G Dynabeads (Invitrogen) for one to two hours and washed 1040
extensively with IP wash buffer (50 mM Tris pH 8, 150 mM NaCl, 1 mM EDTA, 10% 1041
glycerol, 0.5% Triton X100). Proteins were eluted in SDS-PAGE loading solution with 1042
boiling for five minutes and analyzed by western blotting. 1043
1044
Western blot 1045
Protein samples were run on 4-12% Bis-Tris gels (Life Technologies). After primary 1046
antibody incubation which is typically done overnight at 4°C, blots were probed with 1047
1:20,000 dilution of fluorescently-labeled secondary antibodies in 2% BSA in PBST (1X 1048
Phospho-buffered saline with 0.1% Tween-20) for an hour at room temperature (RT). 1049
Fluorescent images were developed using Odyssey and analyzed using Image Studio 2. 1050
Protein quantitation was performed by first normalizing the measured fluorescence 1051
values of the proteins of interest against the loading control (TBP) then normalizing 1052
against the control sample (vehicle treated). 1053
1054
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
48
RNA-seq sample preparation 1055
RNA from 1-3 x 106 cells was extracted and purified with TRIzol reagent (Thermo Fisher) 1056
according to manufacturer’s instructions. RNA-seq libraries were prepared using 1057
Illumina TruSeq Stranded mRNA kit following manufacturer’s instructions with 5 µg of 1058
input RNA. 1059
1060
RNA-seq analysis 1061
Single-end 50 bp reads were aligned to the mouse genome mm10 using STAR 1062
alignment tool (V2.5)(Dobin et al., 2013). RNA expression was quantified as raw integer 1063
counts using analyzeRepeats.pl in HOMER(Heinz et al., 2010) using the following 1064
parameters: -strand both -count exons -condenseGenes -noadj. To identify differentially 1065
expressed genes, we performed getDiffExpression.pl in HOMER, which uses the 1066
DESeq2 R package to calculate the biological variation within replicates. Cut-offs were 1067
set at log2 FC = 0.585 and FDR at 0.05 (Benjamin-Hochberg). Principal Component 1068
Analysis (PCA) was performed with the mean of transcript per million (TPM) values 1069
using Cluster 3.0 with the following filter parameters: at least one observation with 1070
absolute value equal or greater than two and gene vector of four. TPM values were log 1071
transformed then centered on the mean. 1072
1073
Gene Set Enrichment Analysis 1074
GSEA software(Mootha et al., 2003; Subramanian et al., 2005) was used to perform the 1075
analyses with the following parameters: number of permutations = 1000; enrichment 1076
statistic = weighted; and metric for ranking of genes = difference of classes (Input RNA-1077
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
49
seq data was log-transformed). For Figure 5G, input RNA-seq data contained the 1078
normalized log-transformed reads of the 1,325 differentially expressed genes (DEGs) in 1079
sgFoxp3/sgNT Tregs. The compiled gene list included GSEA Gene Ontology, 1080
Immunological Signature, Curated Gene, and the up- and down-regulated DEGs in 1081
sgBrd9/sgNT Tregs. The resulting normalized enrichment scores and FWER p values 1082
were combined to generate the graph. 1083
1084
ChIP-seq sample preparation 1085
Treg cells were collected and cross-linked first in 3 mM disuccinimidyl glutarate (DSG) 1086
in 1X PBS for thirty minutes then in 1% formaldehyde for another ten minutes, both at 1087
RT, for chromatin binding protein ChIP or in 1% formaldehyde only for histone 1088
modification ChIP. After quenching the excess cross-linker with a final concentration of 1089
125 mM glycine, the cells were washed in 1X PBS, pelleted, flash-frozen in liquid 1090
nitrogen, and stored at -80°C. Cell pellets were thawed on ice and incubated in lysis 1091
solution (50 mM HEPES-KOH pH 8, 140 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% 1092
NP40, 0.25% Triton X-100) for ten minutes. The isolated nuclei were washed with wash 1093
solution (10 mM Tris-HCl pH 8, 1 mM EDTA, 0.5 mM EGTA, 200 mM NaCl) and 1094
shearing buffer (0.1% SDS, 1 mM EDTA, 10 mM Tris-HCl pH 8) then sheared in a 1095
Covaris E229 sonicator for ten minutes to generate DNA fragments between ~ 200-1096
1000 base pairs (bp). After clarification of insoluble material by centrifugation, the 1097
chromatin was immunoprecipitated overnight at 4°C with antibodies against Foxp3, 1098
SMARCA4, BRD9, PHF10 or H3K27ac. The next day, the antibody bound DNA was 1099
incubated with Protein A+G Dynabeads (Invitrogen) in ChIP buffer (50 mM HEPES-1100
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
50
KOH pH 7.5, 300 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% DOC, 0.1% SDS), 1101
washed and treated with Proteinase K and RNase A. Cross-linking was reversed by 1102
incubation at 55°C for two and a half hours. Purified ChIP DNA was used for library 1103
generation (NuGen Ovation Ultralow Library System V2) according to manufacturer’s 1104
instructions for subsequent sequencing. 1105
1106
ChIP-seq analysis 1107
Single-end 50 bp or paired-end 42 bp reads were aligned to mouse genome mm10 1108
using STAR alignment tool (V2.5)(Dobin et al., 2013). ChIP-Seq peaks were called 1109
using findPeaks within HOMER using parameters for histone (-style histone) or 1110
transcription factor (-style factor) (Christopher Benner, HOMER, 1111
http://homer.ucsd.edu/homer/index.html, 2018). Peaks were called when enriched > two-1112
fold over input and > four-fold over local tag counts, with FDR 0.001 (Benjamin-1113
Hochberg). For histone ChIP, peaks within a 1000 bp range were stitched together to 1114
form regions. ChIP-Seq peaks or regions were annotated by mapping to the nearest 1115
TSS using the annotatePeaks.pl command. Differential ChIP peaks were found by 1116
merging peaks from control and experiment groups and called using 1117
getDiffExpression.pl with fold change ≥ 1.5 or ≤ -1.5, Poisson p value < 0.0001. 1118
1119
Motif analysis 1120
Sequences within 200 bp of peak centers were compared to motifs in the HOMER 1121
database using the findMotifsGenome.pl command using default fragment size and 1122
motif length parameters. Random GC content-matched genomic regions were used as 1123
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
51
background. Enriched motifs are statistically significant motifs in input over background 1124
by a p-value of less than 0.05. P-values were calculated using cumulative binomial 1125
distribution. 1126
1127
ATAC-seq sample preparation 1128
ATAC-seq was performed according to previously published protocol(Buenrostro et al., 1129
2013). Briefly, 50,000 Treg cells were collected in duplicates and washed first with cold 1130
1X PBS then with Resuspension buffer (RSB; 10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 1131
mM MgCl2). Cells were lysed in RSB supplemented with 0.1% Igepal-630 and nuclei 1132
were isolated by centrifugation at 500 x g for ten minutes. Nuclei were incubated with 1133
Tn5 transposase in Tagment Buffer (Illumina) for thirty minutes at 37°C. Purified DNA 1134
was ligated with adapters, amplified and size selected using AMPure XP beads 1135
(Beckman) for sequencing. Library DNA was sequenced using paired end 42 bp reads. 1136
1137
ATAC-seq analysis 1138
Paired end 42 bp reads were aligned to mouse genome mm10 using STAR alignment 1139
tool (V2.5). ATAC-seq peaks were called using findPeaks within HOMER using the style 1140
parameter dnase. Peaks were called when enriched > four-fold over genomic 1141
background and > four-fold over local tag counts, with FDR 0.001 (Benjamin-Hochberg). 1142
1143
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
Day 0
Cas9 TregsIsolation
Pooled sgRNAsretroviral infectionMOI < 0.2
1 2 3
CollectingTransduced T cells(sgRNAs Input)
Refreshingmedia &reactivation
CollectingTransduced T cells(sgRNAs Output)
Fix/Perm andFoxp3 staining
4 5 6
Foxp3
Low
High
IL2
A
sgNT sgFoxp3 sgCbfb sgDnmt1
Foxp3
B
sgNT
sgFoxp
3
sgCbfb
sgDnmt1
0
200
400
600
800
MFI
Fox
p3
C
sgNT
sgFoxp
3
sgCbfb
sgDnmt1
-4
-2
0
2
4
6
8
Log2
FC o
f cel
l cou
nt
Loo, et al. Figure 1
D
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
Loo, et al. Figure 2
A B
C
2.40E-07
2.40E-07
0.00273
0.06094
Foxp3Low Vs Foxp3High
EnrichedDepleted
0.0
0.5
1.0
−10 −5 0 5 10Log2FC [sgRNA]
0.00798
0.00758
P-value
Foxp3
Cbfb
Runx3
Usp7
Dnmt1
Stub1
163
1278
56
3271971
21Expansion
Contraction
NegativePositive
D
0 4 8 12 16
protein polyubiquitinationchromosome, telomeric region
dendritic cell differentiationregulation of DNA-binding transcription factor activity
nuclear receptor transcription coactivator activitySWI/SNF complex
regulation of histone acetylationRNA polymerase II, holoenzyme
negative regulation of T cell activationSAGA-type complex
-Log10(P)
E
-10 -8 -6 -4 -2 0
mRNA metabolic processforebrain radial glial cell differentiationpositive regulation of transferase activitycellular response to hormone stimulusprotein export from nucleusregulation of small molecule metabolic processHypusine synthesis from eIF5A-lysineDeadenylation-dependent mRNA decaytranscriptional repressor complexnegative regulation of TOR signaling
Log10(P)
F Negative Foxp3 regulator
Positive Foxp3 regulator
Il2ra
Commd4Tbx21
Slc39a7
Tox4 Runx3
Taf5l
Zap70
Gtf2a2
Rc3h1 Taf11
Rrm1BatfJak1
Ccdc101
Brd9
Usp22
Cbfb
Ssu72SympkUbe2m
Tada1Smarcd1Wdr82Foxp3
Log2 Fold Change-4 -2 0 2 4 6
6
4
2
0
-Log
10P
Positive Foxp3 regulator (254 hits)
6
4
2
0
-Log
10P
Cnot11Bcor Ccdc84
Dhps Cnot10Mettl14
Aip Stk11Wdr25
Dbr1Edrf1Drap1
Prpf19DohhDdit4 Snrnp40 Usp5
Otud5 Eif5a Rps3Mettl3 Rpl19
Rpl32 Defa2
4 2 0 -2 -4 -6Log2 Fold Change
Negative Foxp3 regulator (490 hits)
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
Loo, et al. Figure 3
A
CInputIgG SMARCA4
ARID1A
BRD9PHF10
IP for BAF subunits
SMARCA4
SMARCC1
SMARCB1
ARID1A
BRD9
PBRM1
sgArid1a sgArid1b
sgBrd9 sgSmarcd1
sgBrd7 sgArid2 sgPbrm1
Foxp3
BAF
ncBAF
PBAF
sgPhf10
sgGltscr1 sgGltscr1l sgGltscr1/1l
sgDpf1 sgDpf2sgArid1a/b
****
n.s.
n.s.
*******
****
**** ****
n.s.n.s. n.s.
Nor
mal
ized
Fox
p3 M
FI
****
ARID1AARID1B
A4A2
C1 C2ACTB
ACTL6A
B1
E1D1-D3SS18
DPF1-3
Bcl7a-c
Bcl11a,b
BAF
D1
SS18A4A2
C1 C1ACTB
ACTL6A
Bcl7b,c
BRD9
GLTSCR1LGLTSCR1
ncBAF
BRD7
ARID2
A4A2
C1 C2ACTB
ACTL6A
E1D1-D3
PHF10
PBAF
PBRM1B1
-60 -40 -20 0 20 40
-20
0
20
40
PC1 (20.3%)
PC2
(11.
5%)
NT
Arid1aArid1a-2
Arid1a/bArid1a-2/b-2
Dpf2Dpf1/2
Smarcd1Brd9
Brd9-2Gltscr1 Gltscr1/Gltscr1l
Pbrm1
Pbrm1-2
Brd7
Phf10Arid2
D
B
PCA of transcriptomic changes in Tregs
E
sgNT
sgArid
1a
sgArid
1b
sgArid
1a/1b
sgDpf1
sgDpf2
sgDpf1/
2
sgBrd
9
sgSmarc
d1
sgGlts
cr1
sgGlts
cr1l
sgGlts
cr1/1l
sgBrd
7
sgArid
2
sgPbrm
1
sgPhf10
0.0
0.5
1.0
1.5
2.0
*n.s.
****
0
2000
4000
6000
8000
Foxp
3 M
FI
DMSO
0.16u
M
0.31u
M
0.63u
M
1.25u
M2.5
uM5u
M10
uM
dBRD9
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
Loo, et al. Figure 4
C
Rea
d de
nsity
cen
tere
d on
Fox
p3 p
eaks
(n =
11,
287)
sgNT sgFoxp3 sgBrd9 sgPbrm1
-3 kb 3 kb
0 1-10
4
8
12
distance from peakcenter (kb)
0 1-1distance from peak
center (kb)
048
1612
sgNTsgFoxp3sgBrd9
Sites with decreased Foxp3 binding
Foxp
3 C
hIP-
seq
dens
ity
H3K27ac at BRD9-dependentFoxp3 target sites
H3K
27ac
ChI
P-se
qde
nsity
sgPbrm1
BRD9-dependent Foxp3target sites
J
sgNTsgFoxp3sgBrd9sgPbrm1
Foxp3 binding
Down insgFoxp3n = 9,730
Down insgBrd9
n = 1,809sgNT, n = 11,287
1,699
B
sgFoxp3n = 10,609
Overlap of H3K27ac down sites
I
sgBrd9n = 2,880
sgNT, n = 25,678
1,847
966
8,548
Foxp3
Rea
d de
nsity
cen
tere
d on
Fo
xp3
peak
s (n
= 2
0,09
6)
BRD9SMARCA4
PHF10ATAC
-3 kb 3 kb
D
F
G H
E
Decreased Foxp3binding with dBRD9
Down indBRD9
n = 7,245
DMSO, n = 17,135
7,154
0
16
FOXP
3 C
hIP-
seq
dens
ity
BRD9-dependent Foxp3sites
0 1-1distance from peak
center (kb)
DMSOdBRD9
4
8
12
ConservationFo
xp3
sgNTsgFoxp3
sgBrd9sgPbrm1
ATACSMARCA4
BRD9PHF10
DMSOdBRD9
Ppp1r3fFlicr
Foxp3Ccdc22
1.6 _0.7 _1.5 _0.6 _1.8 _1.8 _1.8 _1.8 _2.1 _2.1 _
CNS0 CNS2
A
Overlap of binding sites, nTreg
BRD9n = 21,916
FOXP3n = 20,096
PHF10n = 6,791
3,362
7,00110,565 8,763
9861,475
968
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
Loo, et al. Figure 5
A C
G
-10 -5 0 5 10
10-300
10-250
10-200
10-150
10-100
10-50
100
sgFoxp3 vs. sgNT Log2 Fold Change
adj p
val
ue
Foxp3-dependent genes
n = 793 n = 532
Il21
Gbp2
Il5
Il13
Il4
Igfbp4 Ccr8
B
0 5 10 15 20 25-log10 of P value
regulation of MAPK cascadeangiogenesistaxispositive regulation of cell deathnegative regulation of catalytic activityregulation of innate immune responsecytokine biosynthetic processpositive regulation of locomotioncytokine-cytokine receptor interactionleukocyte differentiationregulation of cell adhesionregulation of defense responsecytokine production
GO Enrichment of Foxp3 DEGs Foxp3 and BRD9 binding at Foxp3-dependent genes
-10 -5 0 5 10-4-20246
Log2FC sgFoxp3/sgNT
Log2
FC s
gBrd
9/sg
NT
r = 0.5342
Foxp3-dependent genesD E
0 250 500 750 1000 1250
-0.8
-0.6
-0.4
-0.20.0
Rank in ordered data set
Run
ning
ES
Up in sgBrd9 Genes
sgNT (positive correlation)
sgFoxp3 (negative correlation)
0.0
0.2
0.4
0.6
0.8
Run
ning
ES
Down in sgBrd9 Genes
5.02.50.0
-5.0-2.5
Ran
ked
list
met
ric
0 250 500 750 1000 1250Rank in ordered data set
sgNT (positive correlation)
sgFoxp3 (negative correlation)
5.02.50.0
-5.0-2.5
Ran
ked
list
met
ric
NES = -3.30FWER p = 0
NES = 3.13FWER p = 0
Down in sgFoxp3/sgNT
Up in sgFoxp3/sgNT
9,229 gene lists
0 0.6 1.2FWER p value
Norm
. Enrichment Score
-4
-2
0
2
4
Down,dBRD9
Up, dBRD9
Down,sgBrd9
Up,sgBrd9
Gene Set Enrichment
Up, FOXP3 mutant
Down, FOXP3 mutant
Down, Tregvs Tcell
Down, CD8vs Treg
JAK STATsignaling
F
0 250 500 750 1000 1250
-0.6
-0.4
-0.2
0.0Up in dBrd9 Genes Down in dBrd9 Genes
Run
ning
ES
Rank in ordered data set
Ran
ked
list
met
ric
-4.0-6.0
-2.0
4.02.0
0
NES = -2.52FWER p = 0
sgNT (positive correlation)
sgFoxp3 (negative correlation)
0.00.10.20.30.40.5
NES = 2.25FWER p = 0R
unni
ng E
S
Foxp3 and BRD9
BRD9 only
Foxp3 only
Neither
81169272
803
0 250 500 750 1000 1250Rank in ordered data set
Ran
ked
list
met
ric
-4.0-6.0
-2.0
4.02.0
0sgNT (positive correlation)
sgFoxp3 (negative correlation)
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
sgNT sgBrd9 Teff only
150 uM 150 uM 150 uM
A
Loo, et al. Figure 6
B C
D
sgNT sgBrd90
20
40
60
80
CD
45.2
Fox
p3+
%
sgNT sgBrd9
Foxp3
CD
4
sgNT
sgBrd9
Teff o
nly0
5
10
15
20
Colit
is sc
ore
0 1 2 3 4 5 6 7-20
-15
-10
-5
0
5
Weeks
Bod
y w
eigh
t cha
nge
(%)
sgNT
sgBrd9
Teff only
E
1:1 1:2 1:4 1:80
20
40
60
80
100
Treg:Teff ratioN
on-d
ivid
ing
Cel
ls (%
) sgNT
sgBrd9**
******
***
1:1 1:2 1:4 1:80
20
40
60
80
100
Treg:Teff ratio
Non
-div
idin
g C
ells
(%) sgNT
sgSmarcd1******
******
1:1 1:2 1:4 1:80
20
40
60
80
100
Treg:Teff ratio
Non
-div
idin
g C
ells
(%) sgNT
sgPbrm1******
ns
ns
1:1 1:2 1:4 1:80
20
40
60
80
100
Treg:Teff ratio
Non
-div
idin
g C
ells
(%) sgNT
sgPhf10ns
*****
**
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint
Loo, et al. Figure 7
0 8 10 12 14 16 180
200
400
600
800
1000
Day
Tum
or s
ize
(mm
3 )sgNT
sgBrd9
No Treg
*
**
*
sgNT
sgBrd
9
No Treg
0.0
0.5
1.0
1.5
Tum
or w
eigh
t (g)
Tumor Spleen0
20
40
60
80
100
CD
4+ IF
Nγ+
%
Tumor Spleen0
20
40
60
80
100
CD
8+ IF
Nγ+
%
sgNT
sgBrd9
No Treg
Tumor Spleen0
5
10
15
20
25
CD
8/Tr
eg ra
tio
sgNT
sgBrd9
B C
D E
F G
H
Tumor Spleen0
10
20
30
40
CD
4 of
CD
45+
(%)
Tumor Spleen0
10
20
30
40
50
CD
8 0f
CD
45+
(%)
I
A
Tumor Spleen0
5
10
15
CD
4+ e
GFP
+ Fo
xp3+
(%)
sgNT
sgBrd9
No Treg
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 27, 2020. . https://doi.org/10.1101/2020.02.26.964981doi: bioRxiv preprint