A murrel interferon regulatory factor-1: molecularcharacterization, gene expression and cell protection activity

Jesu Arockiaraj • Akila Sathyamoorthi • Venkatesh Kumaresan •

Rajesh Palanisamy • Mukesh Kumar Chaurasia • Prasanth Bhatt •

Annie J. Gnanam • Mukesh Pasupuleti • Abirami Arasu

Received: 7 January 2014 / Accepted: 6 May 2014

� Springer Science+Business Media Dordrecht 2014

Abstract In this study, we have reported a first murrel

interferon regulatory factor-1 (designated as Murrel IRF-1)

which is identified from a constructed cDNA library of

striped murrel Channa striatus. The identified sequence

was obtained by internal sequencing method from the

library. The Murrel IRF-1 varies in size of the polypeptide

from the earlier reported fish IRF-1. It contains a DNA

binding domain along with a tryptophan pentad repeats, a

nuclear localization signal and a transactivation domain.

The homologous analysis showed that the Murrel IRF-1

had a significant sequence similarity with other known fish

IRF-1 groups. The phylogenetic analysis exhibited that the

Murrel IRF-1 clustered together with IRF-1 members, but

the other members including IRF-2, 3, 4, 5, 6, 7, 8, 9 and

10 were clustered individually. The secondary structure of

Murrel IRF-1 contains 27 % a-helices (85 aa residues),

5.7 % b-sheets (19 aa residues) and 67.19 % random coils

(210 aa residues). Furthermore, we predicted a tertiary

structure of Murrel IRF-1 using I-Tasser program and

analyzed the structure on PyMol surface view. The RNA

structure of the Murrel IRF-1 along with its minimum free

energy (-284.43 kcal/mol) was also predicted. The highest

gene expression was observed in spleen and its expression

was inducted with pathogenic microbes which cause epi-

zootic ulcerative syndrome in murrels such as fungus,

Aphanomyces invadans and bacteria, Aeromonas hydro-

phila, and poly I:C, a viral RNA analog. The results of cell

protection assay suggested that the Murrel IRF-1 regulates

the early defense response in C. striatus. Moreover, it

showed Murrel IRF-1 as a potential candidate which can be

developed as a therapeutic agent to control microbial

infections in striped murrel. Overall, these results indicate

the immune importance of IRF-1, however, the interferon

signaling mechanism in murrels upon infection is yet to be

studied at proteomic level.

Keywords Murrel � Interferon regulatory factor � Gene

expression � Cell protection activity � Molecular

characterization

Introduction

Interferon regulatory factor-1 (IRF-1) is an immune mod-

ulatory transcription factor that acts downstream when

Electronic supplementary material The online version of thisarticle (doi:10.1007/s11033-014-3401-5) contains supplementarymaterial, which is available to authorized users.

J. Arockiaraj (&) � A. Sathyamoorthi � V. Kumaresan �R. Palanisamy � M. K. Chaurasia � P. Bhatt � A. Arasu

Division of Fisheries Biotechnology & Molecular Biology,

Department of Biotechnology, Faculty of Science and

Humanities, SRM University, Kattankulathur,

Chennai 603 203, Tamil Nadu, India

e-mail: jesuaraj@hotmail.com

A. Sathyamoorthi

Department of Biotechnology, SRM Arts & Science College,

Kattankulathur, Chennai 603 203, India

A. J. Gnanam

Institute for Cellular and Molecular Biology, The University of

Texas at Austin, 1 University Station A4800, Austin, TX 78712,

USA

M. Pasupuleti

Lab PCN 206, Microbiology Division, CSIR-Central Drug

Research Institute, B.S. 10/1, Sector 10 Jankipuram Extension,

Sitapur Road, Lucknow 226031, Uttar Pradesh, India

A. Arasu

Department of Microbiology, SRM Arts & Science College,

Kattankulathur, Chennai 603 203, India

123

Mol Biol Rep

DOI 10.1007/s11033-014-3401-5

pathogens get recognized by receptors. The gene expres-

sion of IRF-1 and defense response to the pathogen

infections is associated with a regulator of type I interferon

(IFN) [1]. After the discovery of pattern recognition

receptors (PRRs) such as toll-like receptors and cytosolic

PRRs including retinoic acid-inducible gene-1, melanoma

differentiation-associated protein-5, protein kinase RNA

activated protein and nucleotide-binding oligomerization

domain containing protein, IRFs received great consider-

ation in activating immune cells and organizing innate and

adaptive defense system [2]. Brustle et al. [3] reported that

IRFs play various roles such as initiating pathogenic

responses, governing inflammatory cytokine expression,

managing cell-cycle and apoptosis, helping the develop-

ment of macrophages, dendritic cells, B and T

lymphocytes.

Until now, 10 IRFs have been reported from various

vertebrates including human beings [1]. Moreover, Nguyen

et al. [4] found another three virus-encoded IRF homo-

logues. IRF-1 and IRF-2 do not have an IRF association

domain at the C-terminal region. This region helps to

establish the homodimers or the selection of other IRFs and

other transcription factors to target the promoters [5, 6].

Each IRF member has different function in defense pro-

cess; these functional differences are due to the structural

differences, interaction abilities and cell-type specific

expression as suggested by Holland et al. [7]. Among the

reported IRFs, IRF-1 and 2 function as transcriptional

activator [8] and repressor [9], respectively. Barnes et al.

[10], Honda and Taniguchi [11] and Paun and Pitha [12]

stated that IRF-3, 5 and 7 are involved in transducers of

virus mediated IFN signaling. IRF-4 and 8 regulate the

genes which are critical to B and T cell developmental

processes [7]. Blanton et al. [13] stated that IRF-6 is

involved in the development of connective tissue, espe-

cially palate. IRF-9 has been shown to interact with signal

transducer and activator of transcription factor 1 and 2 [14,

15]. IRF-10 is almost similar to IRF-4 but differs in

expression, the earlier is constitutive while the later is

inducible. IRF-10 is also involved in the up-regulation of

major histocompatibility complex class I and guanylate-

binding protein [16].

IRF-1 was the first member in the IRF family. It induces

the expression of cytokine interferon-b and it manages the

expression of targeted genes by attaching to an interferon

stimulated response element (ISRE) within their promoter

regions [17]. The attachment happened through the N-ter-

minal DNA binding domain (DBD), which is highly con-

served among IRFs [18]. IRF-1 is actively involved in T

helper-1-mediated immune response [19], natural killer

activity [20], control of proliferation [21], apoptosis [22–

24], antiviral immunity [21, 25] and oncogenesis [26] in

many of the mammalian species. Other than these, Dornan

et al. [27] showed that IRF-1 activate the tumor suppressor

protein p53 via its co-factor p300. In addition, Pizzoferrato

et al. [28] and Bouker et al. [29] demonstrated that over-

expression of IRF-1 is connected with the growth of human

breast cancer cells.

McBeath et al. [30] stated that fishes possess IFN sys-

tems which organize the first line of defense against

infective microbial agents. So far, a few IRFs from fishes

have been characterized at molecular level. However, the

roles of IRF-1 in freshwater striped murrel (otherwise

known as snakehead fish) Channa striatus defense system,

especially in response to fungus (Aphanomyces invadans),

bacteria (Aeromonas hydrophila) and a viral RNA analog

(poly I:C) immune challenges, have not been studied yet.

Channa striatus, an important cultivable teleost in the

Asia-Pacific region, has a good commodity value due to its

tasty meat and medicinal properties [31–33]. However,

epizootic ulcerative syndrome (EUS), an infectious disease

had a serious influence on this species, resulting in high

mortality [34–36]. EUS is the most ruinous infection

among murrels in the Asia-Pacific region, a common

problem faced by Indian murrel fish farmers. The studies

[37, 38] reported that EUS is caused by a fungus, A. in-

vadans, a primary causative agent followed by secondary

infection due to a number of bacteria, specifically A. hy-

drophila, a Gram-negative bacteria and finally the tertiary

infection by fish rhabdo viruses. Thus, a study on C. stri-

atus immune system influenced by these fungus, bacteria

and poly I:C is necessary to make a disease control

parameter at molecular level, especially against EUS. But,

compared to other economically important freshwater fin-

fish species, the details on defense genes from C. striatus is

very limited. So far, very limited and no such report has

been published regarding C. striatus IRF-1 (named as

Murrel IRF-1). A better knowledge on IFN system from

murrels would be beneficial to arrest pathogenic microbial

infections caused by fungus, bacteria and virus. Hence, to

gain insight into the molecular characterization of Murrel

IRF-1 and its role in C. striatus, we have reported the

bioinformatics characterization of a full length Murrel IRF-

1 cDNA, which is identified from the constructed cDNA

library of C. striatus, tissue specific mRNA expression and

cell protection activity of Murrel IRF-1.

Materials and methods

Murrel cDNA library, screening and identification

of Murrel IRF-1

A normalized cDNA library of murrel was established

using total RNA isolated and purified from liver, spleen,

muscle, kidney and gills of murrel. The detailed procedure

Mol Biol Rep

123

on murrel cDNA library construction is described in our

earlier reports [39, 40]. A cDNA encoding IRF-1 was

identified from murrel cDNA library during screening.

Further, the full length cDNA of Murrel IRF-1 was

obtained by internal sequencing method using ABI Prism-

Bigdye Terminator Cycle Sequencing Ready Reaction kit

and analyzed in ABI 3730 sequencer. The forward and

reverse primers used for the sequencing is given in Table 1.

Then, the obtained complete Murrel IRF-1 cDNA sequence

and it’s 50 and 30 untranslated region, coding region and

polypeptide sequences were analyzed on DNAssist (ver.

2.2) as explained by Patterton and Graves [41].

Sequence analysis using biological computational tools

Sequence similarities were observed using BLAST server

in NCBI (http://blast.ncbi.nlm.nih.gov/Blast). High proba-

ble domains and motifs present in the Murrel IRF-1 protein

sequence were identified on PROSITE (http://prosite.

expasy.org/scanprosite/). The N-terminal transmembrane

sequence was determined by SACS MEMSAT2 Trans-

membrane Prediction Program (http://www.sacs.ucsf.edu/

cgi-bin/memsat.py). The presence and location of signal

peptide cleavage site was predicted using the SignalP

program (http://www.cbs.dtu.dk). Multiple sequence

alignment was carried out on ClustalW (ver. 2) (http://

www.ebi.ac.uk/Tools/msa/clustalw2/) program to find out

the evolutionarily conserved residues among the different

organisms. The aligned sequences were edited on Bioedit

(ver. 7.1.3.0). The evolutionary history of Murrel IRF-1

was analyzed by constructing a Neighbor-Joining phylo-

genetic tree at MEGA 5. The evolutionary distances were

computed using the Poisson Correction Method [42].

Secondary structure of the Murrel IRF-1 protein was

predicted using SOPMA Program and is analyzed on

Polyview Method (http://polyview.cchmc.org). The 3D

structure of the Murrel IRF-1 protein was predicted using

I-Tasser Program (http://zhanglab.ccmb.med.umich.edu/I-

TASSER) [43]. The RNA structure of Murrel IRF-1 was

predicted along with minimum free energy (MFE) using

RNA Fold Server Program (http://rna.tbi.univie.ac.at/cgi-

bin/RNAfold.cgi).

Channa striatus

Healthy C. striatus (average body weight of 50 g) were

obtained from the Surya Agro Farms, Erode, Tamil Nadu,

India. The fishes were transported in oxygenated polythene

bags to the laboratory aquarium at Division of Fisheries

Biotechnology & Molecular Biology, SRM University. The

fishes were acclimatized in 15 flat-bottom plastic aquaria

(150 L) with aerated and filtered de-chlorinated freshwater

(temperature: 28 ± 1 �C, DO: 5.8 ± 0.2 mg/L and pH

7.2 ± 0.2). All fishes were acclimatized for a week before

performing various immune stimulant challenge studies.

An average of 15 fish was maintained per tank during the

experiment. During acclimatization period, the fishes were

fed at satiation level with a commercial fish feed (Cargill

Animal Nutrition, Andhra Pradesh, India) two times in a

day (09.00 and 16.00 h).

Poly I:C, fungal and bacterial challenge

In order to examine the defense role of Murrel IRF-1 upon

pathogenic stress, C. striatus were injected with poly I:C,

fungus and bacteria whereas, 1X PBS was injected as

control (100 lL/fish).

For fungal infection, 50 g fish were injected with

100 lL of A. invadans at a concentration of 102 spores.

Briefly, A. invadans were isolated from the EUS infected

C. striatus muscle sample and cultured in algal boost GP

medium. The fungus species was identified according to

the description of Caster and Cole [44] using potato dex-

trose agar and Czapek Dox agar (Himedia, Mumbai).

For bacterial challenge, the fish were injected with A.

hydrophila (5 9 106 CFU/mL) suspended in 19 phosphate

buffer saline (100 lL/fish). A. hydrophila were also iso-

lated and identified from the muscle sample of EUS

infected C. striatus as described by Dhanaraj et al. [38].

For poly I:C [polyinosinic-polycytidylic acid sodium

salt, a synthetic analog of double-stranded RNA (dsRNA),

a molecular pattern associated with viral infection. Poly I:C

is composed of a strand of poly(I) annealed to a strand of

poly(C)] challenge, the fishes were injected with 150 lg

poly I:C (c-irradiated) per 50 g fish (100 lL/animal)

(Sigma-Aldrich, USA).

Table 1 Description of forward

and reverse primers used in this

study

Primers Target Sequence (50–30 direction)

Murrel IRF-1 (F1) Internal sequencing ATGCCCGTGTCAAGAATGAGG

Murrel IRF-1 (R2) Internal sequencing GAGAGCTCCAGGACAGGAAAGGACAG

Murrel IRF-1 (F3) qRT-PCR amplification GATGACTCAATGCCGGAAGA

Murrel IRF-1 (R4) qRT-PCR amplification CTCGATCTCAACTGACGAAGAC

b-Actin (F5) qRT-PCR housekeeping gene TCTTCCAGCCTTCCTTCCTTGGTA

b-Actin (R6) qRT-PCR housekeeping gene GACGTCGCACTTCATGATGCTGTT

Mol Biol Rep

123

Tissue collection, total RNA extraction and cDNA

synthesis

Tissues (liver, gills, blood, spleen, kidney, muscle, heart,

head kidney, intestine, brain and skin) were dissected out

and collected from C. striatus before (0 h) and after

injection (3, 6, 12, 24, 48 and 72 h) and were snap-frozen

in liquid nitrogen and stored at -80 �C until total RNA

was collected. Using a sterilized syringe, the blood

(0.5–1.0 mL per fish) was taken from the fish caudal fin

and centrifuged at 4,0009g for 10 min at 4 �C to allow

blood cell collection for total RNA extraction.

Total RNA from the control and infected fishes were

isolated using Tri ReagentTM (Life Technologies),

according to the manufacture’s protocol with slight modi-

fications [45, 46]. Using 2.5 lg of RNA, the first strand

cDNA synthesis was carried out using a SuperScript�

VILOTM cDNA Synthesis Kit (Life technologies) with

slight modifications [47, 48]. The isolated cDNA was

stored at -20 �C for further analysis.

Murrel IRF-1 transcriptional analysis by real time PCR

The relative expression of Murrel IRF-1 in various col-

lected tissues was quantified by quantitative real time

polymerase chain reaction (qRT-PCR). qRT-PCR was

carried out using a ABI 7500 Real-time Detection System

(Applied Biosystems) in 20 lL reaction volume containing

4 lL of cDNA synthesized from each tissue, 10 lL of Fast

SYBR� Green Master Mix, 0.5 lL each of forward and

reverse primer (20 lM) and 5 lL dH2O. The qRT-PCR

cycle profile was 1 cycle of 95 �C for 10 s, followed by 35

cycles of 95 �C for 5 s, 58 �C for 10 s and 72 �C for 20 s

and finally 1 cycle of 95 �C for 15 s, 60 �C for 30 s and

95 �C for 15 s. The same qRT-PCR cycle profile was used

for the internal control gene, b-actin. b-actin of C. striatus

primers were designed from the sequence of GenBank

Accession No. EU570219. The primer details are given in

Table 1. After the PCR program, data were analyzed with

ABI 7500 SDS software (Applied Biosystems). To main-

tain the consistency, the baseline was set automatically by

the software. The comparative CT method (2-ddCT method)

was used to analyze the expression level of Murrel IRF-1

[49]. Three fishes were sampled for each tissue at each time

point for each microbial challenge.

Cell protection assay

Cells and virus

Splenocytes were prepared as explained in our earlier

report [50] with slight modifications [7]. Briefly, spleno-

cytes (1 9 107) were collected into 25 cm2 cell culture

flasks (Greiner Bio-one) in 5 mL of complete Leibovitz

(L)-15 medium at 22 �C supplemented with penicillin/

streptomycin (P/S; 100 U/ml and 100 lg/mL, respectively)

and 10 % fetal bovine serum (FBS). A commercial strain

of viral hemorrhagic septicemia virus (VHSV), a negative-

sense single-stranded RNA virus (Order: Mononegavirales;

Family: Rhabdoviridae; Genus: Novirhabdovirus) were

obtained from Genesig (UK) and used for the assay.

Isolation of plasmid DNA and vaccination

In this study, we used plasmid vector pCMV (Life Tech-

nologies). The plasmid pCMV-Murrel IRF-1 was prepared

as described by Caipang et al. [51] and Holland et al. [7].

Briefly, the plasmid pCMV-Murrel IRF-1 contains the

cDNA of the Murrel IRF-1 under the transcriptional status

of the cytomegalovirus (CMV) immediate/early enhancer

promoter. The plasmid was purified using cesium chloride–

ethidium bromide reagent. Further, the plasmid was dia-

lyzed for 48 h against 200 volumes of phosphate buffered

saline (PBS) without calcium and magnesium. Finally, the

isolated pure plasmid DNA was stored at -80 �C until used.

For vaccination, we used 30 (for each treatment) C.

striatus (average body weight 50 g). The fishes were

obtained from a commercial fish farm as reported else-

where. The fishes were injected with 100 lL of the purified

plasmid (100 lg/50 g fish) intramuscularly. The empty

vector with similar dosage and concentration and also PBS

(100 lL/fish) injected individuals were treated as controls.

Preparation of C. striatus peripheral blood leukocytes

This study was performed as explained in our earlier study

[48] with slight modifications [52]. The peripheral blood

leukocytes (PBLs) from C. striatus of each treatment were

extracted at 1, 2, 3 and 4 weeks post-vaccination (wpv)

period. In brief, the blood samples were obtained from the

caudal vein of C. striatus. The obtained blood samples

were diluted using 19 PBS with a ratio of 1:3. Then, an

equal quantity of percoll solution (1.072 g mL-1) was

added into the mixture and the reaction mixture was cen-

trifuged at 7,000 rpm for 20 min in 4 �C. After centrifu-

gation, the cells which are present in the interface region

were collected. The collected cells were washed three

times with 19 PBS and again centrifuged at 7,000 rpm for

5 min in 4 �C. Finally, the PBLs were collected and re-

suspended in L-15 medium with 5 % FBS and the con-

centration was adjusted to 2 9 105 cells mL-1.

Isolation of cytokine-like substances from C. striatus PBLs

To perform this protocol, we followed the methodology of

Caipang et al. [53]. In brief, the isolated PBLs (5 mL) were

Mol Biol Rep

123

suspended with L-15 culture medium at a concentration of

2 9 105 cells mL-1. Then, the mixture was placed in a

25 cm2 cell culture flask (Greiner Bio-one) and incubated

at 20 �C for 48 h. After incubation, the mixture was cen-

trifuged at 1,200 rpm for 10 min in 4 �C. Finally, the

supernatant was collected and stored at -80 �C until fur-

ther use.

Cell protection activity

The assay was performed as described by Renault et al.

[54] with slight modifications [53]. The supernatants

obtained from the PBLs were examined for the presence of

cytokine-like substances using the cell protection activity

study. In brief, 100 lL of splenocyte cells were suspended

in L-15 culture medium which contains 10 % FBS were

seeded in a 96-well plate and incubated at 20 �C for 24 h.

Followed by a 1:2 dilution ratio of the supernatants which

is obtained from the PBLs of the Murrel IRF-1, empty

vector and PBS injected or vaccinated C. striatus was

prepared in the L-15 medium with 5 % FBS. Further, the

cell medium was replaced with 100 lL of the supernatants

and incubated at 20 �C for 24 h. The wells incubated only

with the L-15 medium were considered as control. After

incubation, the cells were infected with 100 lL of VHSV.

Then, the virus induced lysis was quantified in cells by

reading the absorbance at 540 nm by a microplate reader

(Thermo Scientific). The assay was performed in three

replicates.

Statistical analysis

The results of gene expression and cell protection activity

were analyzed statistically using one-way ANOVA. Fur-

ther, the average was compared using Tukey’s Multiple

Range Test. Statistical package, SPSS (ver. 11.5) tool was

used for statistical analysis.

Results and discussion

The full length Murrel IRF-1 cDNA is 945 base pairs (bp)

long and contains a 942 bp open reading frame (ORF). The

ORF encodes 314 amino acid (aa) residues with a calcu-

lated molecular weight of 36 kDa and an isoelectric point

(pI) of 4.8. The obtained full length Murrel IRF-1 sequence

(data shown in Electronic Supplementary Material) was

submitted to EMBL GenBank database under the gene

accession number HF571336. The earlier reported IRF-1

from fishes varied in their polypeptide size, for example,

IRF-1 from Oncorhynchus mykiss [55], turbot and sea

bream [56], Carassius auratus [57], Pseudosciaena crocea

[58] and Polyodon spathula [59] are 344, 297, 289, 286 and

324 aa, respectively. The variation in the polypeptide size

may be due to species differentiation as reported by Ozato

et al. [6]. Hence, it is possible to suggest that the variation

influences the DBD’s position and size. Moreover, Ozato

et al. [6] predicted that the variation leads to differences in

interferon expression pattern.

Murrel IRF-1 polypeptide neither has a signal sequence

nor a transmembrane sequence, hence, it is predicted that

the polypeptide of Murrel IRF-1 is a mature protein. The

domain and motif analysis showed that the Murrel IRF-1

contains a DNA binding domain (DBD) at 5-112 along

with a tryptophan pentad repeat DNA binding domain

signature between 29 and 50. In addition, the DBD of

Murrel IRF-1 also carries a gene specific motif of six

tryptophan (W) residues (commonly known as tryptophan

cluster or tryptophan repeats) at W11, W26, W38, W46, W58

and W76. Escalante et al. [18] reported that the DBD is

important for the regulation of interferons and interferon-

inducible genes in response to pathogenic infections. Fur-

ther, it is reported [60] that this domain recognizes double

or single stranded DNA and is involved in various bio-

logical activities such as replication, repair, storage and

modification of DNA including methylation. Moreover,

Moscou and Bogdanove [61] stated that most of the DBD

identify specific DNA sequences including DBD of tran-

scription factors that activate particular genes, or those of

enzymes that modify DNA at specific sites like restriction

enzymes and telomerase.

In this study, we noticed a nuclear localization signal

(NLS) in our Murrel IRF-1 protein sequence between 73

and 115 and we also observed the following six amino

acids which are necessary for the NLS function: Lys74,

Lys77, Phe80, Lys94, Lys96 and Lys100. This signal is

involved in tagging protein for import into the cell nucleus

by nuclear transport as suggested by Kalderon et al. [62].

Further, we noticed a transactivation domain (TAD) in

Murrel IRF-1 protein at 222–246. According to the avail-

able literature [63], this TAD is transcription proteins

which help to activate the transcription by initiating tran-

scription factor. Moreover, Miller et al. [64] also reported

that the TAD is believed to be completed to procure the

general transcription factors onto the gene promoter region.

In addition to these domains and motifs, Murrel IRF-1

contains 22 high probability motifs which are listed in

Table 2. Nguyen et al. [4] stated that these multiple

phosphorylation sites are involved in regulation of IRF-1

function. Moreover, they reported that these various

phosphorylation sites also function as a potential regulator

of IRF during post-translational modifications with a crit-

ical function in the coordinated activation of interferons

and other cytokines.

The sequence similarity analysis showed that Murrel

IRF-1 had a significant sequence similarity with other

Mol Biol Rep

123

known fish IRF-1 groups. Among the fish IRF-1 groups,

the highest sequence identity (96 %) was observed with

IRF-1 from rock bream Oplegnathus fasciatus and the

lowest was observed with IRF-1 from grass carp Cteno-

pharyncodon idella (51 %). Moreover, Murrel IRF-1

showed a 42 % sequence similarity with IRF-1 from

human (data not shown). The deduced amino acid

sequences of the Murrel IRF-1 were aligned with the other

IRF-1 from fish, insect, bird and human (data shown in

Electronic Supplementary Material). The results revealed

that Murrel IRF-1 and O. fasciatus IRF-1 have the longest

amino acid sequence (314 aa). Even though the length of

the amino acids varied from species to species, many

conserved residues were observed. Moreover, the analysis

showed that all the observed domain and motif from

Murrel IRF-1 including DBD and transactivation domain

and motif of DBD such as IRF tryptophan pentad repeat

DBD signature, tryptophan repeats and NLS was conserved

among the sequences considered for multiple sequence

alignment.

In the phylogenetic analysis of Murrel IRF-1, we have

shown the evolutionary relationship of IRF family mem-

bers. The results showed that each IRF family member

such as IRF-1, 2, 3, 4, 5, 6, 7, 8, 9 and 10 formed separate

clad (Fig. 1). The genetic distance is 0.1. Murrel IRF-1

clustered together with IRF-1 from C. argus (CaIRF1)

which showed 78 % similarity in homologous analysis.

Moreover, the analysis showed that Murrel IRF-1 is dis-

tantly related to the other IRF family members. Based on

this analysis, it is confirmed that the identified and char-

acterized molecule Murrel IRF-1, belongs to IRF-1 family

member.

The secondary structure of Murrel IRF-1 contains 27 %

a-helices (85 aa residues), 5.7 % b-sheets (19 aa residues)

and 67.19 % random coils (210 aa residues) (data shown in

Electronic Supplementary Material). Further, the analysis

indicated the formation of hydrogen bond between the

polar amino acids threonine (25th position) and non-polar

tryptophan (26th position), which lead to shortest b-sheet

formation at the N-terminal region.

We predicted five different 3D models of Murrel IRF-1

protein tertiary structure using I-TASSER online program.

The quality of the models was validated using Rama-

chandran plot analysis (data not shown) and the best model

(Fig. 2) was taken for further structural analysis. While the

best protein model was selected, we also considered the

C-score and RMSD value. Further, the selected model was

viewed and analyzed in PyMol surface view program. The

analysis showed that the Murrel IRF-1 contains a DBD like

all IRF family members. This domain is mainly charac-

terized by a cluster of six tryptophan residues. Au et al.

[65] and Escalante et al. [18] reported that this region

forms a helix-turn-helix motif that attached to the ISRE and

IRF regulatory element (IRFE) in the target of the promoter

region. Many studies [18, 66] reported that four of the six

tryptophan residues are necessary for DNA–protein inter-

actions, which guide and stabilize the amino acid contacts

in the DBD along with short core regions (188GAAA191 and228GAAA231) ISRE and IRFE in Murrel IRF-1. The RNA

structure of Murrel IRF-1 was predicted with MFE and

presented in Electronic Supplementary Material. The MFE

of the predicted RNA structure of Murrel IRF-1 is

-284.43 kcal/mol. The prediction shows that the RNA is

mostly paired and very few nucleotides are left unpaired.

The tissue specific Murrel IRF-1 mRNA expression was

quantified in quantitative real time PCR using cDNA of

various C. striatus tissues as template. The highest

expression was observed in spleen (Fig. 3a), an important

hemopoietic organ. Most of the earlier reported fish IRF-1

were also highly expressed in hemopoietic organs includ-

ing spleen, kidney, head kidney and gills. For instance,

IRF-1 from P. crocea was highly expressed in gills and

spleen [58] and IRF-1 from P. spathula and O. mykiss was

highly expressed in gills, spleen and head kidney [55, 59].

The wider tissue specific mRNA expression showed that

the IRF-1 may also have various other functions other than

immune function as reported by Hu et al. [66].

To examine the immune role of Murrel IRF-1 against

various pathogenic microbes, its expression profile was

studied over a 3-day time period. Based on the results of

tissue specific Murrel IRF-1 mRNA expression, Murrel

IRF-1 mRNA expression in C. striatus is induced in spleen

following challenge by fungus A. invadans, bacteria A.

hydrophila and poly I:C. A. invadans challenged C. striatus

Table 2 High probability hits

of Murrel IRF-1 proteinHits Position of amino acid

Caesin kinase II phosphorylation site (12) 25–28, 138–141, 303–306, 86–89, 149–152,

154–157, 161–164, 191–194, 214–217,

238–241, 261–264 and 262–265

Protein kinase C phosphorylation site (5) 62–64, 75–77, 114–116, 300–302 and 303–305

cAMP and cGMP dependent protein

kinase phosphorylation site (1)

131–134

Tyrosine kinase phosphorylation site (2) 137–144 and 212–218

N-myristoylation site (2) 255–260 and 276–281

Mol Biol Rep

123

Murrel IRF-1 mRNA expression significantly (P \ 0.05)

increased at 48 h post-injection (p.i.) when compared to the

control group (Fig. 3b). A. hydrophila induced mRNA

expression was significantly (p \ 0.05) higher at 12 h p.i.

compared to the control (Fig. 3c). The poly I:C challenged

Murrel IRF-1 mRNA expression significantly (s \ 0.05)

increased at 24 h p.i., then drastically decreased at 72 h p.i

(Fig. 3d). The significantly (p \ 0.05) highest gene

expression in spleen upon microbial infections showed a

strong interferon response in this tissue, where more

number of immune cells are present. Moreover, Hu et al.

[66] stated that the maximum expression in the infected

tissues indicate the efficient role of IRF-1. Further, they

reported that during infection, IRF-1 is involved in the

activation of downstream cascade of the interferon-ISRE,

which releases the signals mediated by the pathogen

IRF-1 Siniperca chuatsi (AAV65042)

IRF-1 Larimichthys crocea (ADE75397)

IRF-1 Cynoglossus semilaevis (AFJ00091)

IRF-1 Channa argus (ABK63483)

Channa striatus

IRF-1 Sparus aurata (AAY68283)

IRF-1 Epinephelus coioides (AEA39723)

IRF-1 Oplegnathus fasciatus (ADJ21809)

IRF-1 Anoplopoma fimbria (ACQ58746)

IRF-1 Scophthalmus maximus (ACD62782)

IRF-1 Paralichthys olivaceus (BAA83468)

IRF-1 Takifugu rubripes (AAK28340)

IRF-1 Gadus morhua (ACJ06730)

IRF-1 Polyodon spathula (AEW27151)

IRF-1 Protopterus annectens (ADZ46234)

IRF-1 Xenopus laevis (NP 001083250)

IRF-1 Mesocricetus auratus (AAY96753)

IRF-1 Heterocephalus glaber (EHB00056)

IRF-1 Mustela putorius furo (ACJ54423)

IRF-1 Pteropus alecto (ELK03111)

IRF-1 Mus musculus (CAJ18442)

IRF-1 Homo sapiens (NP 002189)

IRF-2 Macaca mulatta (AFH32296)

IRF-2 Homo sapiens (CAG33358)

IRF-2 Danio rerio (NP 001008614)

IRF-10 Danio rerio (NP 998044)

IRF-10 Gallus gallus (NP 989889)

IRF-9 Danio rerio (NP 991273)

IRF-9 Homo sapiens (NP 006075)

IRF-8 Danio rerio (NP 001002622)

IRF-8 Homo sapiens (NP 002154)

IRF-4 Danio rerio (NP 001116182)

IRF-4 Homo sapiens (NP 001182215)

IRF-7 Danio rerio (NP 956971)

IRF-7 Homo sapiens (NP 004020)

IRF-3 Danio rerio (NP 001137376)

IRF-3 Homo sapiens (AAH71721)

IRF-5 Homo sapiens (NP 001229381)

IRF-5 Danio rerio (NP 998040)

IRF-6 Danio rerio (NP 956892)

IRF-6 Homo sapiens (SP O14896)100

75

99

99

62

87

95

98

42

31

44

81

98

75

99

99

65

99

95

40

40

100

24

82

45

41

55

23

21

239

4

20

1

5

0.1

Fig. 1 Phylogenetic tree of

Murrel IRF-1 with other IRF

homologous. The tree was

constructed using Neighbor-

Joining Method on Mega (ver.

5). The tree is based on the

alignment of protein sequences

of corresponding species. The

number in the branches

indicates the percentage of

1,000 bootstrap replicates. The

analysis involved 41 amino acid

sequences (including Murrel

IRF-1) from fish, amphibian,

bird and mammals. Our

sequence Murrel IRF-1

clustered together with other

IRF-1 is highlighted in grey

shade. The GenBank accession

ID is given in parentheses

Mol Biol Rep

123

associated molecular pattern (PAMP) recognition receptors

in fish. Collet et al. [67] demonstrated that the decreased

gene expression represents the symbol of interferon sup-

pression made by pathogens. Collet and Secombes [9]

reported that IRF-1 respond maximum to viral infection

and minimum to bacterial infection. In contrast, we

observed that the IRF-1 equally respond to poly I:C and

bacterial infections. Moreover, so far, there are no reports

on interferon response to fungal infection in fish. Hence,

this mechanism on interferon response to fungal infection

in fish remains to be investigated further. This is the first

time we showed the interferon response against fungal

infection in fish. It is interesting to note that the highest

IRF-1 expression against all the tested pathogenic microbes

DAB signature

Fig. 2 The predicted 3D structure of Murrel IRF-1 protein. The

predicted protein model of Murrel IRF-1 obtained from I-Tasser

Program viewed in PyMol PDB viewer and given here. The DAB

signature (or tryptophan cluster) is highlighted in ball models

a b b cc c c cdd

e

A

B

C

D

Fig. 3 Relative quantification of Murrel IRF-1 gene expression by

real time PCR. a Results of tissue distribution analysis of Murrel IRF-

1 from various organs of C. striatus. Data are given as a ratio to

Murrel IRF-1 mRNA expression in skin. The different alphabets are

statistically significant at p \ 0.05 level by one-way ANOVA and

Tukey’s Multiple Range Test. b–d The time course of Murrel IRF-1

mRNA expression in spleen at 3, 6, 12, 24, 48 and 72 h post-injection

with A. invadans, A. hydrophila and poly I:C respectively. The

significant difference at p \ 0.05 level by one-way ANOVA and

Tukey’s Multiple Range Test of MrTGase expression between the

challenged and the control group were indicated with asterisk

Fig. 4 Percentage survival of cells incubated with cytokine-like

substances obtained from peripheral blood leukocytes of C. striatus at

1st, 2nd, 3rd and 4th weeks post-vaccination upon viral hemorrhagic

septicemia virus infection. Data presented as the average of percent-

age survival of cell from five fish ± standard deviation

Mol Biol Rep

123

is almost similar; for example, the highest expression in

response to fungus, bacteria and poly I:C are 71-fold (at

48 h p.i.), 72-fold (at 12 h p.i.) and 82-fold (at 24 h p.i.)

respectively. However, this interferon signaling mechanism

in murrels during infected state is yet to be clarified at

proteomic level.

The presence of cytokine-like substances in the PBLs was

measured using cell protection activity against VHSV. The

result indicates the presence of cytokine-like substances in

the supernatants which is obtained from the PBLs of vacci-

nated C. striatus. Moreover, the results showed that the

splenocyte cells incubated with cytokine-like substances

obtained from the PBLs of Murrel IRF-1 vaccinated C.

striatus at 1st and 2nd wpv had significantly (p \ 0.05)

higher survival than the PBS vaccinated. But, at 3rd and 4th

wpv, no significant difference was observed in the percent-

age of cell survival among the treatments (Fig. 4). The

results are in accordance with the earlier study of IRF-1 from

Japanese flounder [53]. Moreover, the results indicated that

the Murrel IRF-1 vaccinated C. striatus were able to give a

particular level of protection against VHSV. It is suggested

that the Murrel IRF-1-vaccinated C. striatus activate the

antiviral properties as reported by Caipang et al. [51]. The

result of the present findings also showed that the Murrel

IRF-1 is responsible for the up-regulation of antiviral sub-

stances. Hence, the results obtained from this study sug-

gested the possibility of using Murrel IRF-1 as a therapeutic

agent to control microbial infection.

Acknowledgments This research is supported by DBT’s Presti-

gious Ramalingaswami Re-entry Fellowship (D.O.NO.BT/HRD/35/

02/2006) funded by Department of Biotechnology, Ministry of Sci-

ence and Technology, Government of India, New Delhi.

References

1. Tamura T, Yanai H, Savitsky D, Taniguchi T (2008) The IRF

family transcription factors in immunity and oncogenesis. Annu

Rev Immunol 26:535–584

2. Honda K, Takaoka A, Taniguchi T (2006) Type I interferon gene

induction by the interferon regulator factor family of transcription

factors. Immunity 25:349–360

3. Brustle A, Heink S, Huber M, Rosenplanter C, Stadelmann C et al

(2007) The development of inflammatory TH-17 cells requires

interferon-regulatory factor 4. Nat Immunol 8:958–966

4. Nguyen H, Hiscott J, Pitha PM (1997) The growing family of

interferon regulatory factors. Cytokine Growth Factor Rev

8:212–293

5. Eroshkin A, Mushegian A (1999) Conserved transactivation

domain shared by interferon regulatory factors and smad mor-

phogens. J Mol Med 77:403–405

6. Ozato K, Tailor P, Kubota T (2007) The interferon regulatory

factor family in host defense: mechanism of action. J Biol Chem

282:20065–20069

7. Holland JW, Karim A, Wang T, Alnabulsi A, Scott J et al (2010)

Molecular cloning and characterization of interferon regulatory

factors 4 and 8 (IRF-4 and IRF-8) in rainbow trout, Oncorhyn-

chus mykiss. Fish Shellfish Immunol 29:157–166

8. Sato M, Taniguchi T, Tanaka N (2001) The interferon system and

interferon regulatory factor transcription factors-studies from

gene knockout mice. Cytokine Growth Factor Rev 12:133–142

9. Collet B, Secombes CJ (2002) Type I-interferon signalling in fish.

Fish Shellfish Immunol 12:389–397

10. Barnes BJ, Field AE, Pitha-Rowe PM (2003) Virus-induced

heterodimer formation between IRF-5 and IRF-7 modulates

assembly of the IFNA enhanceosome in vivo and transcriptional

activity of IFNA genes. J Biol Chem 278:16630–16641

11. Honda K, Taniguchi T (2006) IRFs: master regulators of sig-

naling by Toll-like receptors and cytosolic pattern-recognition

receptors. Nat Rev Immunol 6:644–658

12. Paun A, Pitha PM (2007) The IRF family revisited. Biochimie

89:744–753

13. Blanton SH, Cortez A, Stal S, Mulliken JB, Finnell RH et al

(2005) Variation in IRF6 contributes to nonsyndromic cleft lip

and palate. Am J Med Genet Part A 137A:259–262

14. Horvath CM, Stark GR, Kerr IM, Darnell JE (1996) Interactions

between STAT and non-STAT proteins in the interferon-stimulated

gene factor 3 transcription complex. Mol Cell Biol 16:6957–6964

15. Martinez-Moczygemba M, Gutch MJ, French DL, Reich NC

(1997) Distinct STAT structure promotes interaction of STAT2

with the p48 subunit of the interferon-alpha-stimulated tran-

scription factor ISGF3. J Biol Chem 272:20070–20076

16. Nehyba J, Hrdlickova R, Burnside J, Bose HR Jr (2002) A novel

interferon regulatory factor (IRF), IRF-10, has a unique role in

immune defense and is induced by the v-Rel oncoprotein. Mol

Cell Biol 22:3942–3957

17. Miyamoto M, Fujita T, Kimura Y, Maruyama M, Harada H et al

(1988) Regulated expression of a gene encoding a nuclear factor,

IRF-1, that specifically binds to IFN-beta gene regulatory ele-

ments. Cell 54:903–913

18. Escalante CR, Yie J, Thanos D, Agarwal AK (1998) Structure of

IRF1 with bound DNA reveals determinants of interferon regu-

lation. Nature 391:103–106

19. Tanaka N, Ishihara M, Lamphier MS, Nozawa H, Matsuyama T

et al (1996) Cooperation of the tumor suppressors IRF-1 and p53

in response to DNA damage. Nature 382:816–818

20. Ohteki T, Yoshida H, Matsuyama T, Duncan GS, Mak TW et al

(1998) The transcription factor interferon regulatory factor 1

(IRF-1) is important during the maturation of natural killer 1.1þT

cell receptor-a/bþ (NK1þ T) cells, natural killer cells, and intes-

tinal intraepithelial T cells. J Exp Med 187:967–972

21. Kirchhoff S, Schaper F, Hauser H (1993) Interferon regulatory

factor (IRF-1) mediates cell growth inhibition by transactivation

of downstream target genes. Nucl Acid Res 21:2881–2889

22. Kirchhoff S, Hauser H (1998) Cooperative activity between HER

oncogenes and the tumor suppressor IRF-1 results in apoptosis.

Oncogene 18:3725–3736

23. Nozawa H, Oda E, Nakao K, Ishihara M, Ueda S et al (1999)

Loss of transcription factor IRF-1 affects tumor susceptibility in

mice carrying the Ha-ras transgene or nullizygosity for p53.

Genes Dev 13:1240–1245

24. Kano A, Haruyama T, Akaike T, Watanabe Y (1999) IRF-1 is an

essential mediator in IFN-gamma-induced cell cycle arrest and

apoptosis of primary cultured hepatocytes. Biochem Biophys Res

Comm 257:672–677

25. Pine R (1992) Constitutive expression of an ISGF2/IRF1 transgene

leads to interferon-independent activation of interferoninducible

genes and resistance to virus infection. J Virol 66:4470–4478

26. Tanaka N, Ishihara M, Kitagawa M, Harada H, Kimura T et al

(1994) Cellular commitment to oncogene-induced transformation

or apoptosis is dependent on the transcription factor IRF-1. Cell

77:829–839

Mol Biol Rep

123

27. Dornan D, Eckert M, Wallace M, Shimizu H, Ramsay E et al

(2004) Interferon regulatory factor 1 binding to p300 stimulates

DNA-dependent acetylation of p53. Mol Cell Biol

24:10083–10098

28. Pizzoferrato E, Liu Y, Gambotto A, Armstrong MJ, Stang MT

et al (2004) Ectopic expression of interferon regulatory factor-1

promotes human breast cancer cell death and results in reduced

expression of survivin. Cancer Res 64:8381–8388

29. Bouker KB, Skaar TC, Riggins RB, Harburger DS, Fernandez DR

et al (2005) Interferon regulatory factor-1 (IRF-1) exhibits tumor

suppressor activities in breast cancer associated with caspase

activation and induction of apoptosis. Carcinogenesis

26:1527–1535

30. McBeath AJA, Snow M, Secombes CJ, Ellis AE, Collet B (2007)

Expression kinetics of interferon and interferon-induced genes in

Atlantic salmon (Salmo salar) following infection with infectious

pancreatic necrosis virus and infectious salmon anaemia virus.

Fish Shellfish Immunol 22:230–241

31. Arockiaraj J, Muruganandam M, Marimuthu K, Haniffa MA

(1999) Utilization of carbohydrates as a dietary energy source by

striped murrel Channa striatus (Bloch) fingerlings. Acta Zool

Taiwan 10:103–111

32. Arockiaraj J, Haniffa MA, Perumalsamy PRR, Marimuthu K,

Muruganandam M (2003) An effective treatment to the spotted

murrel Channa punctatus for epizootic ulcerative syndrome

(EUS). Fish Chimes 23:27–28

33. Marimuthu K, Haniffa MA, Arockiaraj J, Muruganandam M

(2001) Spawning and parental behavior in the induced bred

murrels. Indian J Fish 48:409–411

34. Marimuthu K, Haniffa MA, Muruganandam M, Arockiaraj J

(2001) Low cost murrel seed production technique for fish

farmers. Naga 24:21–22

35. Haniffa MA, Arockiaraj J, Sridhar S (1999) Weaning diet for

striped murrel. Channa striatus Fish Technol 36:116–119

36. Marimuthu K, Arokiaraj J, Haniffa MA (2009) Effect of diet

quality on seed production of the spotted snakehead Channa

punctatus (Bloch). Am-Eurasian J Sustain Agricult 3:344–347

37. Kasornchandra J, Engelking HM, Lannan CN, Rohovec JS, Fryer

JL (1992) Characteristics of three rhabdoviruses from snakehead

fish Ophicephalus striatus. Dis Aqua Org 13:89–94

38. Dhanaraj M, Haniffa MA, Ramakrishnan CM, Arunsingh SV

(2008) Microbial flora from the Epizootic Ulcerative Syndrome

(EUS) infected murrel Channa striatus (Bloch, 1797) in Tirun-

elveli region. Turk J Vet Anim Sci 32:221–224

39. Arockiaraj J, Annie JG, Dhanaraj M, Mukesh P, Milton J et al

(2013) An upstream initiator caspase 10 of snakehead murrel

Channa striatus, containing DED, p20 and p10 subunits:

molecular cloning, gene expression and proteolytic activity. Fish

Shellfish Immunol 34:505–513

40. Abirami A, Venkatesh K, Akila S, Rajesh P, Prabha N et al

(2013) Fish lily type lectin-1 contains b-prism 2 architecture:

immunological characterization. Mol Immunol 56:497–506

41. Patterton HG, Graves S (2000) DNAssist: the integrated editing

and analysis of molecular biology sequences in windows. Bio-

inform Appl Note 16:652–653

42. Uinuk-Ool TS, Takezaki N, Kuroda N, Figueroa F, Sato et al

(2003) Phylogeny of antigen-processing enzymes: cathepsins of a

cephalochordate, an agnathan and a bony fish. Scand J Immunol

58:436–448

43. Zhang Y (2008) I-TASSER server for protein 3D structure pre-

diction. BMC Bioinform 9:40

44. Caster GR, Cole JR (1990) Diagnostic procedures in veterinary

bacteriology and mycology, 5th edn. Academic Press Inc, San

Diego

45. Arockiaraj J, Puganeshwaran V, Sarasvathi E, Arun S, Tahereh A

et al (2011) Gene profiling and characterization of arginine

kinase-1 (MrAK-1) from freshwater giant prawn (Macrobrachi-

um rosenbergii). Fish Shellfish Immunol 31:81–89

46. Arockiaraj J, Puganeshwaran V, Sarasvathi E, Arun S, Rofina YO

et al (2012) Molecular cloning, characterization and gene

expression of an antioxidant enzyme catalase (MrCat) from

Macrobrachium rosenbergii. Fish Shellfish Immunol 32:670–682

47. Arockiaraj J, Puganeshwaran V, Sarasvathi E, Arun S, Rofina YO

et al (2011) Effect of infectious hypodermal and hematopoietic

necrosis virus (IHHNV) infection on caspase 3c expression and

activity in freshwater prawn Macrobrachium rosenbergii. Fish

Shellfish Immunol 32:161–169

48. Arockiaraj J, Puganeshwaran V, Sarasvathi E, Arun S, Rofina YO et al

(2012) Prophenoloxidase activating enzyme-III from giant freshwater

prawn Macrobrachium rosenbergii: characterization, expression and

specific enzyme activity. Mol Biol Rep 39:1377–1386

49. Livak KJ, Schmittgenm TD (2001) Analysis of relative gene

expression data using real-time quantitative PCR and the 2(-Delta

Delta C(T)) method. Methods 25:402–408

50. Bhatt P, Venkatesh K, Rajesh P, Mukesh KC, Annie JG et al

(2013) Immunological role of C4 CC chemokine-1 from snake-

head murrel Channa striatus. Mol Immunol 57:292–301

51. Caipang CM, Hirono I, Aoki T (2005) Induction of antiviral state

in fish cells by Japanese flounder, Paralichthys olivaceus, inter-

feron regulatory factor-1. Fish Shellfish Immunol 19:79–91

52. Nam BH, Yamamoto E, Hirono I, Aoki T (2000) A survey of

expressed genes in the leukocytes of Japanese flounder, Para-

lichthys olivaceus, infected with Hirame rhabdovirus. Dev Comp

Immunol 24:13–24

53. Caipang CMA, Hirono I, Aoki T (2009) Modulation of the early

immune response against viruses by a teleostean interferon reg-

ulatory factor-1 (IRF-1). Comp Biochem Physiol Part A

152:440–446

54. Renault T, Torchy C, De Kinkelin P (1991) Spectrophotometric

method for titration of trout interferon, and its application to

rainbow trout fry experimentally infected with viral hemaor-

rhagic septicemia virus. Dis Aquat Org 10:23–29

55. Collet B, Hovensa GCJ, Mazzoni D, Hirono I, Aoki T et al (2003)

Cloning and expression analysis of rainbow trout Oncorhynchus

mykiss interferon regulatory factor 1 and 2 (IRF-1 and IRF-2).

Dev Comp Immunol 27:111–126

56. Ordas MC, Abollo E, Costa MM, Figueras A, Novoa B (2006)

Molecular cloning and expression analysis of interferon regula-

tory factor-1 (IRF-1) of turbot and sea bream. Mol Immunol

43:882–890

57. Shi Y, Zhang YB, Zhao Z, Jiang J, Zhang QY et al (2008)

Molecular characterization and subcellular localization of Car-

assius auratus interferon regulatory factor-1. Dev Comp Immu-

nol 32:134–146

58. Yao CY, Kong P, Huang XN, Wang ZY (2010) Molecular

cloning and expression of IRF1 in large yellow croaker, Pseu-

dosciaena crocea. Fish Shellfish Immunol 28:654–660

59. Xiaoni G, Zhuo C, Xuzhen W, Dengqiang W, Xinwen C (2012)

Molecular cloning and characterization of interferon regulatory

factor 1 (IRF-1), IRF-2 and IRF-5 in the chondrostean paddlefish

Polyodon spathula and their phylogenetic importance in the

Osteichthyes. Dev Comp Immunol 36:74–84

60. Kummerfeld SK, Teichmann SA (2006) DBD: a transcription

factor prediction database. Nucl Acids Res 34:D74–D81

61. Moscou MJ, Bogdanove AJ (2009) A simple cipher governs

DNA recognition by TAL effectors. Science 326:1501

62. Kalderon D, Roberts BL, Richardson WD, Smith AE (1984) A

short amino acid sequence able to specify nuclear location. Cell

39:499–509

63. Boch J, Scholze H, Schornack S, Landgraf A, Hahn S et al (2009)

Breaking the code of DNA binding specificity of TAL-type III

effectors. Science 326:1509–1512

Mol Biol Rep

123

64. Miller JC, Tan S, Qiao G, Barlow KA, Wang J et al (2010) A

TALE nuclease architecture for efficient genome editing. Nat

Biotechnol 29:143

65. Au WC, Moore PA, Lowther W, Juang YT, Pitha PM (1995)

Identification of a member of the interferon regulatory factor

family that binds to the interferon stimulated response element

and activates expression of interferon-induced genes. Proc Natl

Acad Sci USA 92:11657–11661

66. Hu G, Xia J, Lou H, Liu Q, Lin J et al (2011) Cloning and

expression analysis of interferon regulatory factor 7 (IRF-7) in

turbot, Scophthalmus maximus. Dev Comp Immunol 35:416–420

67. Collet B, Boudinot P, Benmansour A, Secombes CJ (2004) A

Mx-1 promoter reporter system to study interferon pathways in

rainbow trout. Dev Comp Immunol 28:793–801

Mol Biol Rep

123