Abdulsalam Abu Libdeh, MDPediatric Endocrinologist

Makassed Islamic Hospital

3 months old male infant, referred from Al-Watani hospital c/o fever, irritability, FTT and vomiting.

Past history: product of FT,NVD, birth wt: 3.6kg, at

Rafidia hospital. At 22d of age admitted to Al-Watani

hospital as he developed fever, irritability, vomiting and FTT.

Investigations at al-Watani: Na :177 K: 4.5 Urea: 44 Crea: 0.9 LFT: NL CBC: NL Urinalysis : free

Family history: Parents were healthy and not consanguineous. A male sibling was diagnosed clinically previously to have nephrogenic diabetes insipidus.

He was started on hydrochlorothiazide 2mg/kg/day, but due to inadequate response, the patient was referred to Makassed hospital.

Physical Examination: Wt: 4.42kg <3rd% Lt: 58cm 25th% Hc: 37.5cm <3rd% Temp: 37c HR: 130/min BP:

72/45 Positive findings on P/E Cachectic , irritable

Investigations: Na+: 150 K+: 3.7 s.osmolality: 304mOsm/kg

BUN: 13 Crea: 0.5

LFT: NL Glu: 97 CBC: NL Blood gas: PH 7.52, HCO3 29, BE +6 Urine: osmolality: 145mOsm/kg

Na: 27

●

●

Investigations: Urine output: 9cc/kg/hr

Urine culture: positive for Klebsiella Blood culture: negative Renal U/S : normal GFR: 43ml/min/1.73m2

Diagnosis

Diabetes Insipidus

Central Nephrogenic

Minirin test:

Diagnosis: Nephrogenic Diabetes Insipidus

S.osmolality

Serum Na Urine osm

Before 304 149 65

After 318 157 96

Kaluril (Amiloride & hydrochlorothiazide) 4mg/kg/day

Indomethacin 2mg/kg/day Feeding 180cc/kg/day (oral & gavage)

Upon discharge: Na: 139 s.osm: 323mOsm/kg urine osm: 85mOsm/kg U.O.P: 2.4cc/kg/hr Wt: 5.1kg

Primers for amplification and sequencing of the AVPR2 gene were:

Exon 1: For: attgaacttgctcctcaggc Rev.: gcttccctgaatcgtcaaac

Exon 2-start: For: ctaggagccaggaagtggg Rev.: gaagatgaagagctggggc

Exon 2-end: For: tcctcctacatgatcctggc Rev.: tggaggatctaggttgggttc

Exon 3: For: gtggctagggctgacgg Rev.: ccagtggctcccaggac

Sequencing the DNA of the affected patient showed mis-sense mutation with replacement of G by A in codon 82 (TGC---TAC). This mutation predicted a substitution of Cysteine to Tyrosine (C82Y) at the amino acid residue of the AVPR2 gene

Patient

Mother was heterozygous for this mutation (carrier)

Mother

Father

Sister

Sister was heterozygous for this mutation (carrier)

Definition: NDI is a clinical disorder, characterized by a urinary concentrating defect resulting from resistance of the collecting duct to the antidiuretic action of vasopressin (AVP).

Classification: Hereditary X-linked V2R Autosomal recessive AQP2 Autosomal dominant AQP2 Acquired Drugs (lithium, amphotericin B) Ureteral obstruction Acute or chronic renal failure Renal cystic disease Interstitial nephritis Nephrocalcinosis Toxic nephropathy due to hypokalemia

X-linked recessive NDI is caused by mutations in the gene encoding the V2 vasopressin receptor (V2R) and is the most frequent genetic cause of the inherited NDI.

To date, 178 different mutations have been reported for V2R NDI, and the mutations spread throughout all portions of the protein.

There are two different receptors for ADH: V1 (AVPR1) & V2 (AVPR2) receptors.

Activation of the V1 receptors:- a. Induces vasoconstriction b. Enhancement of prostaglandin release, while

Activation of V2 receptors:- a. Mediate the antidiuretic responses. b. Peripheral vasodilation

c. The release of factor VIIIc and von Willbrand’s factor from endothelial cells.

Pathogenesis

Clinical manifestations: Massive polyuriaVolume depletionHypernatremia HyperthermiaIrritability Constipation FTT Developmental delay & mental retardation

Clinical manifestations: Diminished appetite & poor food intake due to consumption of large volume of waterGrowth abnormalities. Behavioral problems, including hyperactivity & short term memory problems.

Diagnosis: water deprivation test If the serum osmolality is 290mOsm/kg or higher with a urine osmolality value <290mOsm/kg, water deprivation test is not necessary. To distinguish between central DI & NDI: administration of vasopressin 10-20mcg, followed by serial urine and serum osmolality measurements hourly for 4hrs.

Maintenance of adequate fluid intake & access to free water. Infants require gastrostomy or NG tube feeding to ensure adequate fluid administration throughout day & night.

Minimizing urine output by limiting solute load with a low osmolar, low-sodium diet. For infants, human milk or a low solute formula, such as Similac PM 60/40 is preferred.

Administering medications directed at decreasing urine output. Thiazide diuretics (2-3mg/kg/d) effectively induce Na loss & stimulate proximal tubule reabsorption of water. Potassium-sparing diuretics, amiloride (0.3mg/kg/d) by its additive effect with thiazide are often indicated.

NSAIDs – indomethacin (2mg/kg/d) has an additive effect in reducing water excretion in some patients, dependent upon inhibition of renal prostaglandin synthesis.

Exogenous ADH: most patients with NDI have partial rather than complete resistance to ADH. It is therefore possible that attaining supraphysiologic hormone levels will increase the renal effect of ADH to a clinically important degree.

Experimental approaches: most patients with congenital x-linked NDI have defective V2 vasopressin receptors that are unable to properly fold intracellularly and, as a consequence, correctly transfer to the cell surface. In vitro, the administration of selective, cell permeable nonpeptide V2 and V1a receptor antagonists were able to rescue mutant V2 receptors by promoting their proper folding and maturation. This resulted in the expression of functional cell surface V2 receptors, suggesting that such a therapeutic approach may be fruitful.

Abu Libdeh Abdulsalam, Dweikat Imad & Abu-Libdeh Bassam

Department of Pediatrics, Makassed Hospital, Jerusalem

Thank you for your attention