Submitted to the Journal of Biological Chemistry on 10th December 2003 and in revised form on 26th January 2004

A Novel Tctex2-Related Light Chain is Required for Stability of Inner Dynein Arm I1 and Motor Function in the

Chlamydomonas Flagellum

Linda M. DiBella¶, Elizabeth F. Smith§, Ramila S. Patel-King¶, Ken-ichi Wakabayashi¶, and Stephen M. King¶*

¶Departments of Biochemistry and Molecular, Microbial, and Structural Biology

University of Connecticut Health Center 263 Farmington Avenue

Farmington, Connecticut 06030-3305

and

§Department of Biological Sciences

Dartmouth College Hanover,

New Hampshire 03755

Tel: (860) 679 3347 Fax: (860) 679 3408

Email: steve@king2.uchc.edu

*To whom correspondence should be addressed

Key Words: Chlamydomonas / flagella / axoneme / dynein / microtubule

Running Title: Tctex2b is Required for Dynein Motor Function

JBC Papers in Press. Published on March 11, 2004 as Manuscript M313540200

Copyright 2004 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

ABSTRACT

Tctex1 and Tctex2 were originally described in mice as putative distorters/sterility

factors involved in the non-Mendelian transmission of t haplotypes. Subsequently, these

proteins were found to be light chains of both cytoplasmic and axonemal dyneins. We

have now identified a novel Tctex2-related protein (Tctex2b) within the Chlamydomonas

flagellum. Tctex2b copurifies with inner arm I1 following both sucrose gradient

centrifugation and anion exchange chromatography. Unlike the Tctex2 homologue

within the outer dynein arm, analysis of a Tctex2b-null strain indicates that this protein is

not essential for assembly of inner arm I1. However, lack of Tctex2b results in an

unstable dynein particle that disassembles following high salt extraction from the

axoneme. Cells lacking Tctex2b swim more slowly than wild-type and exhibit a reduced

flagellar beat frequency. Furthermore, using a microtubule sliding assay, we observed

that dynein motor function is reduced in vitro. These data indicate that Tctex2b is

required for the stability of inner dynein arm I1 and wild-type axonemal dynein function.

2

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

INTRODUCTION

The dynein microtubule-based molecular motor performs a variety of functions

within eukaryotic cells (1,2). Ciliary and flagellar dyneins comprise the inner and outer

arms of the axoneme and provide the power necessary for the motility of these

organelles. Within flagella of the unicellular green alga Chlamydomonas, the apparently

homogeneous ~ 2 MDa outer arms are assembled at 24 nm intervals along the length of

the A tubules of the outer doublet microtubules. This motor complex helps define the

beat frequency of the flagellum and provides ~ 4/5 of the power output (3,4). Flagellar

waveform is regulated by a complex inner arm system comprised of seven dynein

subspecies (reviewed in (5,6)). Indeed, strains that lack various subsets of inner arms

exhibit defects in waveform associated with reductions in shear amplitude (4).

Subspecies f, or inner arm I1 contains 2 HCs (1α and 1β), three ICs (IC110, IC138, and

IC140) and several LCs, including LC8 and Tctex1 (7-13). Both the 1α and 1β HCs are

essential for the assembly of inner arm I1 (9,14) and a truncated 1β HC fragment

containing the N-terminal ~113 kDa but lacking the motor domain is sufficient for this

activity (14). Of the three identified ICs, IC140 is an essential component and is

involved in the localization of this motor (10,11). In addition, crosslinking experiments

indicate that IC140 is closely associated with IC110 (11). Genetic and biochemical

studies have revealed that inner arm I1 is involved in the regulation of microtubule

sliding through phosphorylation (15-18). IC138 is the only phosphorylated subunit of

inner arm I1, and plays an integral role in the control of dynein motor function

(16,17,19).

3

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Two inner arm I1 LCs have previously been identified, including the highly

conserved 10 kDa protein LC8 and Tctex1 (13). In Chlamydomonas, LC8 is also found

in the outer arms and radial spokes, and is required for intraflagellar transport (IFT)

(13,20,21). Tctex1 is a member of the Tctex1/Tctex2 family of dynein LCs (13,22) that

includes rp3 (23) and the Chlamydomonas outer arm subunit LC2 (24). The Tctex1 and

Tctex2 genes were initially identified in mice within a 30-40 Mb region of chromosome

17 referred to as the t-complex, and are both candidates for distorter/sterility factors

which play roles in the non-Mendelian inheritance of variant forms of this chromosome

known as the t-haplotypes (25,26). Tctex1 is also a component of cytoplasmic dynein

(22) and participates in a variety of motor/cargo interactions that include an association

with rhodopsin within the vertebrate photoreceptor (27). LC2 is a Tctex2 homologue

(24) that is essential for the assembly of the Chlamydomonas outer dynein arm within the

flagellar axoneme (28).

In this study, we describe an additional member (here called Tctex2b) of the

Tctex1/Tctex2 family of LCs in Chlamydomonas. This novel flagellar component

associates with inner arm I1 but, unlike the Tctex2 homologue in the outer arm, is not

essential for its assembly. Interestingly however, Tctex2b plays a role in maintaining the

stability of this dynein complex. Furthermore, mutants lacking Tctex2b swim more

slowly than wild-type and show consistently slower velocities in an in vitro microtubule

sliding assay. These data suggest that Tctex2b is required for wild-type axonemal motor

function.

4

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

MATERIALS AND METHODS

Strains and Media.

The following strains of Chlamydomonas reinhardtii were used in this study: cc124

(wild-type), oda9, ida1, ida4, pf14, pf18 and pf28 (obtained from the Chlamydomonas

Genetics Center, Duke University), pf28pf30 (from Dr. Winfield Sale, Emory

University), A54-e18 (pf16-D2 parental strain), pf16A, pf16-D2, pf16-D2HA4C, pf16-

D2HA5A, pf16-D2pf28, and pf16-D2λ8b (Table 1). Methods for the generation of the

pf16 insertional allele (pf16-D2) as well as transformation of the pf16A and pf16-D2

strains with the wild-type PF16 gene were described previously (29). The pf16-D2λ8b

strain was generated by cotransformation of the pf16-D2 strain with the pArg7.8 plasmid

and λ clone “8b” as previously described (29). The double mutant strain pf16-D2pf28

transformed with the wild-type PF16 gene was constructed from crosses of pf16-D2pf28

with pf16-D2 transformed with the wild-type PF16 gene. The strain of interest was

identified in nonparental ditype tetrads as a very slow swimmer.

To generate the pPF16-HA constructs, an HA-tag encoding three copies of the 9–

amino acid hemagglutinin epitope [(3xHA, obtained from Dr. Carolyn Silflow (30)] was

amplified with flanking MluI sites and then ligated into MluI-digested pb6D2 (31)

resulting in the 3xHA tag inserted after D418 (148 residues from the carboxy terminus).

pf16, arg- cells were cotransformed with 1µg each of the pPF16-HA and pARG7.8 (32)

plasmids using the glass bead method (33). Successful transformants were identified as

swimming cells and then further analyzed by western blot and immunoelectron

microscopy using antibodies to the HA-tag (Santa Cruz Biotechnology, Inc.) as

5

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

previously described (31). The presence of two central tubules and correct localization of

PF16-HA were verified.

All cells were grown in Tris-Acetate-Phosphate (TAP) media. pf16A, pf28, A54-

e18 and all pf16-D2-related strains were grown under continuous light.

Purification of Axonemes and Dynein.

Wild-type and mutant strains of C. reinhardtii were deflagellated with dibucaine

using standard methods and demembranated with 1% IGEPAL CA-630 (Sigma Cat #I-

3021; replaces Nonidet P-40) (34). For dynein purification, isolated axonemes were

subjected to extraction with 0.6 M NaCl (35). Extracted proteins were fractionated using

either a 5-20% sucrose density gradient as described previously (34) or anion exchange

chromatography (see below). Samples were routinely electrophoresed in 5-15% gradient

polyacrylamide gels, and either stained with Coomassie brilliant blue, or transferred to

nitrocellulose for western blotting.

Anion Exchange Chromatography.

To separate the different species of axonemal dynein, the 0.6 M NaCl axonemal

extract was dialyzed against buffer A (20 mM Tris, pH 7.5, 60 mM KCl, 0.5 mM EDTA,

0.1 % Tween 20, 1 mM dithiothreitol (DTT), 1 mM phenylmethysulfonyl fluoride

(PMSF)), and applied to an anion exchange column (Mono Q HR5/5, Pharmacia Corp.)

using a Biorad Biologics chromatography work station. Proteins were eluted at a flow

rate of 0.5 ml/min using a linear salt gradient of 0 – 50% buffer B (buffer A with 1 M

KCl) and collected in 0.3 ml fractions. To initially identify fractions pertinent to this

study, samples were electrophoresed in 8% acrylamide gels and silver stained (36).

6

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Molecular Analysis of Tctex2b.

The entire coding region for Chlamydomonas Tctex2b was obtained by the

polymerase chain reaction using a Chlamydomonas λZapII wild-type cDNA library

enriched for flagellar messages as the template. Both the forward primer 5’→3’

GCGCGAATTCATGGCGGAAGCGGCTGACTTC and reverse primer 3’→5’

GCGCCTCGAGTCAGTACAGGTACACGCCGAA were designed based on the entire

coding sequence derived from the Chlamydomonas Expressed Sequence Tag BE122193,

and incorporate an EcoRI site at the 5’end and a XhoI site at the 3’ end, respectively.

Following restriction digestion, the gel-purified product was subcloned into pBluescript

II SK- (Stratagene) across the EcoRI/XhoI restriction sites. 32P-labeled oligonucleotides

were generated from the sequenced clone and used to probe a Southern blot of

Chlamydomonas wild-type genomic DNA, and a northern blot of Chlamydomonas RNA

obtained from wild-type nondeflagellated cells and from cells 30 minutes post-

deflagellation that were enriched for flagellar messages. The entire coding region was

also used to isolate an ~6.5 kb genomic fragment containing the full-length TCTEX2B

gene from a λDashII (Stratagene) genomic DNA library previously constructed from

wild-type strain 1132D- (RPK and SMK, unpublished).

Preparation of Recombinant Protein and Antibody.

The coding region for Tctex2b was subcloned into the pMAL-c2 vector (New

England Biolabs, Inc.) across the XmnI and BamHI restriction sites. This resulted in the

Tctex2b protein fused to the C-terminus of maltose binding protein (MBP) via a 19-

residue linker containing a Factor Xa cleavage site. The over-expressed fusion protein

was purified by amylose affinity chromatography. The full-length fusion protein was

7

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

used as the immunogen to generate rabbit antiserum CT117. Nitrocellulose membrane

containing recombinant Tctex2b following separation from MBP was utilized to affinity

purify the antibody (37).

Swimming Speed Measurements.

For measurement of swimming speeds, cells were suspended in fresh TAP media

and ~ 30 µl of cells were placed on a microscope slide and examined using a Nikon E600

microscope equipped with a 100 W halogen light source and a Diagnostic Instruments

Spot RT monochrome camera. To avoid cell compression and possible impedance of

motility, cells were examined using a 10x PlanFluor objective (NA 0.25) without a

coverslip. Time-lapse images were generated (50 images in 7 seconds) and swimming

speed was measured using Diagnostic Instruments Spot Advanced imaging software. All

swimming speed data were calculated as the mean +/- standard deviation from a

minimum of two experiments and a total sample size of greater than 150 cells. The

Student's t-test was used to determine the significance of differences between means.

Microtubule Sliding Assay.

Flagella were resuspended in 10 mM Hepes, pH 7.4, 5 mM MgSO4, 1 mM DTT,

0.5 mM EDTA and 50 mM potassium acetate (HMDEKAc). Axonemes were prepared

by adding Nonidet P-40 (Calbiochem, La Jolla, CA) at a final concentration of 0.5%

(vol/vol) to remove flagellar membranes. Sliding velocity between doublet microtubules

was measured by the method of Okagaki and Kamiya (38) and as previously described

(15). Approximately 8 µl of axonemes were applied to a perfusion chamber and the

chamber washed with HMDEKAc containing 1 mM ATP to remove nonadherent

axonemes. To initiate microtubule sliding, the chamber was perfused with HMDEKAc

8

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

containing 1 mM ATP and 2 µg/ml Type VIII protease (P-5380; Sigma Chemical Co., St

Louis, MO). Microtubule sliding was observed using an Axioskop 2 microscope (Zeiss

Inc., Thornwood, NY) equipped for dark-field optics including a Plan-Apochromat 40x

oil immersion objective with iris and ultra dark-field oil immersion condenser. All

microtubule sliding velocity data were calculated as the mean +/- standard deviation from

a minimum of two experiments and a total sample size of greater than 45 axonemes. The

Student's t-test was used to determine the significance of differences between means.

Flagellar Beat Frequency Analysis.

Flagellar beat frequency was measured based on the method of Kamiya and

Hasegawa (39,40). This method uses a darkfield microscope equipped with a

photodetector fitted with a linear density gradient filter at the detection plane, and a Fast

Fourier Transform (FFT) analyzer. Chlamydomonas cells grown at low density in liquid

media were analyzed using an Olympus BX51 with a UPLANF1 20X/0.050 PH1

objective, a dry darkfield condenser (U-DCD, Olympus), and a red filter (Marumi, Japan)

placed on the light source. Cell movement was detected by the photodetector which was

constructed by Drs. Shoji Baba and Yoshihiro Mogami (Ochanomizu University, Tokyo,

Japan). Data were captured and analyzed using a sound card (Creative Live!, Creative

Sound Blaster) and SIGVIEW v1.81 FFT signal analysis software.

9

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

RESULTS Identification of a Novel Tctex2-Related Protein.

To identify additional dynein-associated flagellar components, we searched the

Chlamydomonas EST and nonredundant databases using LC2, the Tctex2 homolog from

the outer dynein arm (accession # U89649) as the initial query sequence. This search

identified a Chlamydomonas EST (accession #BE122193; P(n) = 5 X 10-15). The

BE122193 sequence exhibits 33% identity (63% similarity) with LC2. Consequently, we

surmised that this clone may encode a member (here termed Tctex2b) of the

Tctex1/Tctex2 family of dynein LCs. To further characterize this putative dynein LC,

the full-length cDNA was obtained from a λZapII cDNA library enriched for flagellar

messages. The cDNA is 1105 bp in length and contains a single open reading frame

encoding a 120 residue protein with a calculated molecular weight of 13,751 Da and a pI

of 5.31 (Fig. 1a).

Secondary structure analysis using Predictprotein (41) suggests that the LC

consists of two N-terminal α- helices followed by four β strands that occupy almost the

entire C-terminal portion of the polypeptide (Fig. 1c). This prediction is consistent with

structural studies of the related protein Tctex1 (42,43). Tctex1 is a dimeric protein

whereas LC2 from the outer arm is a monomer in solution (44). Analysis of the MBP-

Tctex2b fusion protein by native gel electrophoresis yielded a molecular weight of 107.4

kDa, compared to the calculated mass of 53.8 kDa. In contrast, the MBP-LacZ control

protein (calculated mass of 50.8 kDa) appeared to be monomeric with a measured native

molecular weight of 56.2 kDa. This suggests that Tctex2b forms dimers in solution.

10

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Tctex2b shares 31% identity (42% similarity) with murine Tctex2 and 30%

identity (49% similarity) with Chlamydomonas LC2. An unrooted phylogenetic tree for

the Tctex1/Tctex2 family suggests three major subdivisions (Fig. 1b). The Tctex1 group

includes Chlamydomonas flagellar Tctex1, human and mouse Tctex1, and human

cytoplasmic rp3. A group we now term Tctex2a includes Chlamydomonas outer arm

LC2, human and mouse Tctex2, and an EST identified in human glioblastoma. Tctex2b

appears to define a distinct branch of the Tctex2 subfamily that also includes several

mammalian ESTs which share 44% identity (55% similarity) with Chlamydomonas

Tctex2b.

A Southern blot of Chlamydomonas genomic DNA digested with either PstI or

BamHI and probed with the Tctex2b cDNA yielded single bands for each digest,

suggesting that a single gene exists for this protein (Fig. 2a). On northern blots, a single

mRNA of ~1.4 kb was observed that was greatly upregulated in cells actively

regenerating flagella (Fig. 2b). This suggested that Tctex2b may be a flagellar protein.

The TCTEX2B and PF16 Genes are Adjacent.

To determine the location of TCTEX2B within the Chlamydomonas genome, we

obtained an ~ 6.5 kb clone containing the TCTEX2B gene from a λDashII genomic DNA

library. Sequence analysis revealed that the TCTEX2B gene consists of an ~1.9 kb DNA

segment containing 5 exons (Fig. 2c). Furthermore, we found that the 5’ end of the

genomic clone also included a portion of the 5’ UTR of the PF16 gene (positioned in the

opposite orientation relative to TCTEX2B), indicating that the two genes are in close

proximity (within ~ 2 kb). A subsequent search of the previously published genomic

segment that includes the Chlamydomonas flagellar PF16 gene (accession #U40057) (29)

11

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

revealed that it contained part of TCTEX2B. Restriction fragment length polymorphism

analysis (RFLP) indicated that both the PF16 (29) and TCTEX2B genes map to linkage

group IX.

Generation of Antibody Against Tctex2b.

The Tctex2b coding sequence was subcloned into the pMAL-c2 vector (New

England Biolabs, Inc.) and expressed as an N-terminal fusion to maltose binding protein

(MBP). The purified fusion protein was used as the immunogen to generate rabbit

polyclonal antiserum CT117. The specificity of CT117 for Tctex2b was examined using

recombinant versions of each LC from the Chlamydomonas outer dynein arm as well as

the inner arm I1 LC, Tctex1. CT117 recognized only its target antigen, and specifically

did not react with the outer dynein arm LC2 (Tctex2a), or Tctex1 (Fig. 3a). Furthermore,

Tctex2b was not detected by antibodies against Tctex1 (R5205) or LC2 (R5391; not

shown). A single discrete band corresponding to Tctex2b was detected in wild-type

axonemes probed with the CT117 antibody (Fig 3b).

Tctex2b is a Component of Inner Arm I1.

To determine the location of Tctex2b, axonemes were isolated from

Chlamydomonas strains lacking various components (Fig. 4). Tctex2b was present in

wild type axonemes (cc124) as well as in mutants missing the I2 inner arm class (ida4),

the outer arms (oda9), the radial spokes (pf14) and the central pair microtubule complex

(pf18). The levels of Tctex2b were significantly reduced in ida1, which lacks inner arm

I1, as well as in the double mutant pf28pf30, which is missing both the outer arms and

inner arm I1. The markedly reduced levels seen in the ida1 and pf28pf30 strains

suggested that Tctex2b associates with inner arm I1. We also observed that the Tctex2b

12

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

protein is completely absent in axonemes isolated from pf16-D2, a null PF16 allele

generated by insertional mutagenesis (29).

To further confirm that Tctex2b is indeed a component of inner arm I1, high salt

extracts from wild type axonemes were fractionated using sucrose gradient centrifugation

(Fig. 5a). The majority of the inner arm I1 subunit, IC140 and Tctex2b cosedimented in

fractions 5 – 7. When inner arm I1 was purified from wild type axonemal salt extracts by

anion exchange chromatography, IC140 and Tctex2b again cofractionated (Fig 5b.).

These data strongly suggest that Tctex2b is a subunit of inner dynein arm I1.

IC140 from Inner Arm I1 Assembles in the Absence of Tctex2b.

To determine if Tctex2b is essential for assembly of inner arm I1, we took

advantage of the pf16-D2 strain that lacks this component. Immunoblot analysis of

isolated axonemes from pf16-D2 revealed that significant levels of IC140 were present

(Fig. 6). As IC140 is essential for assembly of this dynein (10), this result suggests that

inner arm I1 is present in pf16-D2 mutant axonemes, and that the lack of Tctex2b in this

strain does not prevent assembly of inner arm I1. Similar results were obtained with two

additional pf16-D2 strains rescued with a HA-tagged PF16 gene (pf16-D2HA4C and

pf16-D2HA5A) (Fig. 6). Moreover, Tctex1 is present in pf16-D2HA4C axonemes as

well as the double mutant, pf16-D2pf28 Resc. w/PF16, that lacks both Tctex2b and the

outer dynein arm (see Figure 7b, c). These data indicate that lack of the PF16 protein in

pf16-D2 is not responsible for the absence of Tctex2b, or for its failure to assemble. It is

unclear whether inner arm I1 is present at completely wild-type levels in strains lacking

Tctex2b.

13

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Absence of Tctex2b Destabilizes Inner Arm I1.

When salt extracts were prepared from wild type axonemes or axonemes lacking

the outer dynein arms, and fractionated using sucrose density gradients, all the known

components of inner arm I1 copurified at ~18S. For example, in the outer armless mutant

oda9, all three inner arm I1 ICs, as well as Tctex1 cosedimented in fractions 5-7 (Fig.

7a). However, when high salt extracts from axonemes lacking both the outer arms and

Tctex2b (pf16-D2pf28 Resc. w/PF16) were fractionated in a sucrose gradient, the inner

arm I1 complex was no longer found at 18S (Fig. 7b). The majority of IC140 was

present at ~10S, in fractions 7-11, indicating that the inner arm I1 complex had

dissociated. In addition, Tctex1 now appeared at the top of the gradient in fractions 12-

15. Similarly, when high salt extracts of axonemes lacking only Tctex2b were

fractionated, Tctex1 also appeared at the top of the gradient, indicating that it had

dissociated from inner arm I1 (Fig. 7c). These data suggest that the lack of Tctex2b alone

causes the instability of inner arm I1 and that this is independent of the status of the outer

arms.

Rescue of pf16-D2 with Both PF16 and TCTEX2B Genes.

Isolation of the PF16 gene from a bacteriophage λ library originally created from

wild-type genomic DNA yielded several overlapping clones that included “λ8b” (29).

This ~12-13 kb clone was transformed into both pf16-D2 and pf16A (the original allele,

(45)) and rescued the paralyzed phenotype of both strains, signifying the presence of a

functional PF16 gene. At that time, however, it was not known that TCTEX2B existed,

that it mapped in the immediate vicinity of PF16, or that it might be present in the

14

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

isolated λ clone. To determine whether Tctex2b was encoded within λ8b, the PCR was

performed with TCTEX2B specific primers using λ8b as the template. A DNA fragment

of the expected size (~1.2 kb) for the genomic region of TCTEX2B encompassing all 5

exons (see Fig. 4) was amplified (data not shown). In order to rescue both the pf16 and

tctex2b defects, λ8b was transformed into the pf16-D2 strain. Cells were screened based

on their ability to swim and a transformant (pf16-D2λ8b) was isolated. Immunoblot

analysis of axonemes from the rescued strain revealed that Tctex2b was expressed and

incorporated into the axonemes (Fig. 8a). This verified that the λ8b clone encodes

functional PF16 and TCTEX2B genes.

Lack of Tctex2b Results in Reduced Swimming Speeds and Microtubule Sliding

Velocities.

While transformation of the pf16-D2 insertional allele with the wild-type PF16

gene rescued both the motility and the central apparatus defects in this mutant (29),

subsequent observation revealed that the rescued strain exhibited somewhat reduced

swimming speeds compared to wild-type cells (Fig. 8b). To quantitate these differences,

we measured the swimming speeds of wild-type cells, pf16-D2 cells rescued with the

wild-type PF16 gene, and pf16-D2 cells rescued with the λ8b clone. The average

swimming speed of pf16-D2 cells transformed with only the PF16 gene was significantly

slower (~72%) than that of wild-type cells (P<<0.001). In contrast, the average

swimming speed of pf16-D2 cells transformed with both the PF16 and TCTEX2B genes

was not significantly different from that of wild-type cells or from pf16A cells

transformed with the wild-type PF16 gene. These results indicate that transformation of

15

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

pf16-D2 with the wild-type PF16 gene alone does not completely restore wild-type

motility.

To further investigate differences in motility between wild-type cells and pf16-D2

cells rescued with either PF16 or the PF16 and TCTEX2B genes, we measured dynein

motor activity using a microtubule sliding assay. In this assay, microtubule sliding is

uncoupled from flagellar bending and, therefore, dynein activity is quantified as the

velocity at which the doublet microtubules slide past one another (e.g. (38)). Microtubule

sliding velocities of axonemes isolated from both pf16A and pf16-D2 were approximately

one-half that of wild-type axonemes as previously reported (46). In the present study,

microtubules from pf16A exhibited similar sliding velocities (~60% compared to wild-

type) and regained near wild-type sliding levels when rescued with the wild-type PF16

gene (pf16A Resc. w/PF16) (Fig.9a). Velocities for the pf16tctex2b double mutant (pf16-

D2) were measured at only ~36% of wild-type and ~61% of the pf16 single mutant,

which suggests that the absence of Tctex2b further impairs sliding speeds. Evidence that

a loss of Tctex2b may alter axonemal function can be seen in the mutant lacking only

Tctex2b (pf16-D2 Resc. w/PF16). Unlike the pf16A mutant rescued with PF16, this

mutant displays sliding velocities significantly different from wild-type levels

(P<<0.001), presumably due to the missing dynein subunit. Alternatively, the presence

of less than wild-type levels of inner arm I1 might account for this reduction. The double

mutant rescued with both PF16 and TCTEX2B (pf16-D2λ8b) regains wild-type

microtubule sliding velocities supporting the hypothesis that Tctex2b is essential for

wild-type motor function.

16

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

This reduction in inner arm dynein activity is even more dramatic in strains

lacking the outer dynein arms. We compared microtubule sliding velocities in mutant

axonemes lacking only the outer dynein arms (pf28) with those of a double mutant strain

lacking both the outer dynein arms and Tctex2b (pf16-D2pf28 double mutant rescued

with the PF16 gene). In the absence of the outer dynein arms and Tctex2b, microtubule

sliding velocities were reduced to ~1.6 µm/sec. compared to 5.8 µm/sec. measured for

axonemes lacking only the outer dynein arms.

Absence of Tctex2b Results in Reduced Flagellar Beat Frequency.

To further investigate the functional significance of Tctex2b in vivo, we analyzed

flagellar beat frequency of wild-type and mutant strains. The paralyzed pf16-D2

insertional mutant strain, when rescued only with PF16, exhibited a beat frequency that

peaked at ~28-32 Hz (Fig. 9b). In contrast, when this strain was rescued with both PF16

and TCTEX2B, the peak beat frequency rose to ~33-40 Hz, with a significant shoulder at

close to 50 Hz. This value is similar to the parental strain (A54-e18) used to generate

pf16-D2, which exhibited two significant peaks between ~38-42 Hz with a smaller

population at >50 Hz. These observations suggest that the lack of Tctex2b contributes to

a reduction in flagellar beat frequency. Together with the swimming speed and

microtubule sliding data, these results suggest that although Tctex2b is not essential for

incorporation of inner arm I1 into the axoneme, it does increase the stability of the

enzyme and thus enhances the overall performance of the inner dynein arm system.

17

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

DISCUSSION Tctex2b Defines a New Subfamily of Dynein LCs.

To date, three members of the Tctex1/Tctex2 family have been identified in

Chlamydomonas: Tctex1, an inner arm I1 subunit (13) which also functions as a

component of cytoplasmic dynein (22); LC2 (24), an outer arm LC which is required for

assembly of that dynein (28), and Tctex2b that is described here. Identification of

Tctex2b allowed us to subdivide the Tctex2 family into two major groups. The branch

designated Tctex2a contains sea urchin LC1 and Chlamydomonas LC2 which are outer

dynein arm LCs, and the eponymous human and mouse flagellar Tctex2 proteins.

Chlamydomonas Tctex2b establishes the second branch of this protein family and is most

closely related to ESTs identified from both human B cell lymphocytic leukemia (EST

AI492091), human kidney (EST AW612564), and murine embryo (EST W64276)

libraries. These mammalian proteins are, as yet, undescribed, so it remains unknown

whether they have a common function with Chlamydomonas Tctex2b.

Tctex2b is a Component of Inner Arm I1.

All characterized Tctex2 family LCs are flagellar components (24,47). Here we

have shown that, in Chlamydomonas, Tctex2b is encoded by a single gene and that its

message is upregulated in response to deflagellation, suggesting that it functions in the

flagellum. Furthermore, we observed that Tctex2b levels are drastically reduced only in

Chlamydomonas strains that do not assemble inner arm I1 (i.e., ida1 that lacks I1, and

pf28pf30, which is missing both I1 and the outer arms). That even minor amounts of this

LC are present in these strains implies that Tctex2b can partially assemble within the

axoneme even in the absence of intact inner arm I1. This notion is consistent with earlier

18

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

data demonstrating that low levels of IC140 assemble in pf28pf30 and pf9-3 axonemes

which completely lack the 1α HC (11). In addition, reconstitution experiments revealed

that a 53 kDa, C-terminal portion of IC140 binds only to axonemes lacking inner arm I1,

and is presumably localized to the correct axonemal location independent of additional

inner arm I1 subunits (11).

Further evidence that Tctex2b is associated with inner arm I1 was obtained

following sucrose gradient centrifugation and anion exchange chromatography of

axonemal extracts. Tctex2b copurified with known components of inner arm I1 (notably

LC8, Tctex1, IC110, IC138, and IC140) which, under wild-type conditions, sediment

together as a complex at ~18S (7,48). Based on these biochemical and genetic data, we

conclude that Tctex2b is an integral component of inner arm I1. This novel LC is the

first Tctex2 protein to be identified within the inner arm system. As Tctex1 is present in

both inner arm I1 and cytoplasmic dynein (13,22), it will be interesting to determine

whether Tctex2b also functions as a cytoplasmic dynein subunit.

It was initially established in studies of Chlamydomonas and sea urchin sperm

outer arm dynein that the ICs localize to the base of the soluble dynein particle and that

they interact with each other and a series of LCs to form a basal or cargo-binding

complex (49-53). Thus, it is likely that the related IC140 of inner arm I1 also has several

binding partners. For example, chemical crosslinking of pf28 axonemes or purified

dynein using the zero-length reagent l-ethyl-3-(3-dimethylaminopropyl)carbodiimide

(EDC) suggests that IC140 also interacts with IC110 (11). The presence of both Tctex2b

and IC140 in strains that lack other components of this inner arm raises the possibility

that these two dynein polypeptides also interact.

19

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Inner Arm I1 Components Assemble in the Absence of Tctex2b.

Both the 1α and 1β HCs and IC140 are required for inner arm I1 assembly (8-

10,14,48), and mutants lacking this motor display an impaired swimming phenotype due

to alterations in waveform. Of the previously identified I1-associated LCs (LC8 and

Tctex1), LC8 is apparently required for assembly as the LC8 null mutant (fla14) produces

short flagella, due to defects in intraflagellar transport (IFT) (21), that have inner arm,

outer arm, and radial spoke defects (LC8 is a component of all three complexes)

(12,13,20). No tctex1 mutant has been identified in Chlamydomonas. However, in

Drosophila, a homozygous mutant at the dtctex1 locus is viable, although males are

sterile due to defects in sperm motility (54). This suggests that Tctex1 is not required for

cytoplasmic dynein function but does play an essential role in either sperm development,

sperm axonemal function, or perhaps both. In contrast to the requirement for LC2

(Tctex2a) in outer arm dynein assembly (28), we found that axonemes from mutants

lacking either Tctex2b or both PF16 and Tctex2b contained significant amounts of

IC140, suggesting that this novel LC is not essential for assembly of inner arm I1.

Tctex2b Maintains the Integrity of Inner Arm I1.

Although Tctex2b does not appear to be required for the assembly of inner arm

I1, our data suggest that it augments the stability of this dynein motor. In wild type

axonemal salt extracts, inner arm I1 (including Tctex2b) sediments as an ~18S particle.

Furthermore, this association occurs in both the presence and absence of outer arms,

eliminating the possibility of this dynein influencing the localization of Tctex2b as is the

case for a novel member of the LC7/Roadblock family (DiBella and King, in

preparation). However, the lack of Tctex2b did result in a very different sedimentation

20

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

pattern for inner arm I1. In these strains, the subunits of this dynein no longer remained

associated following extraction from the axoneme. IC140 sedimented at ~10S and

Tctex1 no longer cofractionated with the higher molecular weight ICs, indicating that the

entire complex had disassembled. This suggests that Tctex2b stabilizes the inner dynein

arm through salt-insensitive associations.

Tctex2b is Required for Dynein Motor Function.

We have demonstrated that in the absence of Tctex2b, inner arm I1 is unstable in

vitro. Furthermore, our microtubule sliding data indicate that the in situ inner arm

lacking Tctex2b displays deficiencies in motor function as well. Using axonemes

prepared from a Tctex2b null mutant (pf16-D2 rescued with PF16), we observed an

~25% reduction in microtubule sliding velocity relative to the parental strain. An even

more dramatic reduction occurred in the absence of the outer arm. When Tctex2b was

reintroduced back into the null strain, sliding velocities recovered to those of the parent.

These in vitro data implicating Tctex2b as a factor required for efficient motor function

were also supported by in vivo observations. Cells lacking Tctex2b exhibited reductions

of ~27% and 29% in both swimming speed and beat frequency, respectively, compared to

the parental strain. This indicates that the Tctex2b deficiency translates into functional

inadequacies in vivo. It has been shown that the Tctex2a family members in salmonid

and sea urchin sperm outer arm dynein are subject to phosphorylation that occurs

coincident with the activation of sperm motility (47), suggesting that these LCs perform a

regulatory function within the axoneme. Unlike the sperm Tctex2a proteins however,

Chlamydomonas Tctex2b lacks any predicted phosphorylation sites and inner arm I1 LCs

do not appear to be phosphorylated in vivo (55). Together, these data suggest that the

21

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

reintroduction of Tctex2b corrects impaired motor function by increasing the structural

stability of the motor rather than through a direct regulatory mechanism.

A Model for the Organization of Inner Arm I1.

This dynein consists of two distinct heavy chains (1α and 1β), three ICs and

several LCs including Tctex1, Tctex2b and LC8. Previously, we observed an additional

12 kDa component (13) that may represent a member of the LC/Roadblock family of

dynein LCs (DiBella and King, in preparation). Current models for the arrangement of

proteins within this dynein (7,10) place the ICs and LCs at the base of the particle by

analogy with the known location of outer arm and cytoplasmic dynein components. In

axonemes from the double mutant pf28pf30, which lacks both the outer arm and inner

arm I1, we detected both IC140 and Tctex2b. This observation implies that these two

subunits can assemble in the absence of other dynein components and suggests that they

may interact directly with an inner arm docking complex (analogous to that needed for

outer arm assembly) (56), that is presumably necessary to specify the appropriate binding

site within the axoneme.

In cytoplasmic dynein, Tctex1 binds the consensus (K/R)(K/R)XX(K/R) within

IC74 (43). A perfect copy of this motif is present in Chlamydomonas IC140 (residues

269-273) and may mediate association of Tctex1 with inner arm I1. However, this

cannot be the sole interaction involved in Tctex1 binding as we found that this protein

completely dissociates from the I1 complex in the absence of Tctex2b. Quantitative

densitometry indicated that two copies of Tctex1 are present within the inner arm

complex (13). However, we have found that Tctex1 and Tctex2b precisely comigrate in

SDS-polyacrylamide gels. As Tctex1 and Tctex2b form dimers, it is possible that inner

22

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

arm I1 actually contains a heterodimer formed from these two LCs. Alternatively,

different classes of inner arm may exist depending on whether they contain a Tctex1 or

Tctex2b homodimer.

In conclusion, we describe here a novel component of the Chlamydomonas inner

dynein arm I1 that defines a distinct subfamily within the Tctex2 class of dynein LCs and

is required for the structural integrity and motor function of this enzyme. Tctex2b has the

intriguing property that it can assemble within the axoneme in the absence of many other

components of this dynein. Further analysis will provide insight into the structural

mechanisms by which Tctex2b modulates dynein motor activity.

23

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

ACKNOWLEDGEMENTS

We thank Dr. Winfield Sale (Emory University School of Medicine) for

Chlamydomonas strain pf28pf30 and for the polyclonal antibody to IC140, and Drs.

Carolyn Silflow and Paul Lefebvre (University of Minnesota) for mapping the TCTEX2B

gene. We also thank the following for their help in developing the beat frequency

analysis system: Drs. Ritsu Kamiya, Shinji Kamimura, and Toshiki Yagi (University of

Tokyo), Drs. Shoji A. Baba and Yoshihiro Mogami (Ochanomizu University), and Dr.

Miho Sakato (University of Connecticut Health Center). This study was supported by

grants GM51293 (to S.M.K.) and GM51379 (to E.F.S., as a consortium agreement, P.A.

Lefebvre, University of Minnesota), from the National Institutes of

Health, grant #5-FY99-766 (to E.F.S.) from the March of Dimes Birth Defects

Foundation, and a postdoctoral fellowship from the Lalor Foundation (to K.W.). SMK is

an investigator of the Patrick and Catherine Weldon Donaghue Medical Research

Foundation.

FOOTNOTES

1. Abbreviations used: FFT, fast Fourier transform; HA, hemagglutinin; HC, heavy

chain; IC, intermediate chain; IFT, intraflagellar transport; LC, light chain.

24

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

TABLE 1. Strains Used in This Study

Strain Description References

cc124 wild-type

A54-e18 wild-type (57)

oda9 Missing outer arms/slow swimming (58)

ida1 Missing inner arm I1/slow swimming (48,58)

ida4 Lacks inner arm species a, c and d (58)

pf14 Radial spoke defect/paralyzed flagella (59)

pf16A Lacks C1 tubule protein/paralyzed flagella (45)

pf16A Resc. w/PF16 pf16A defect rescued (29,45)

pf16-D2 Missing C1 tubule protein and Tctex2b/ paralyzed flagella (29)

pf16-D2 Resc. w/PF16 pf16 defect rescued/Lacks Tctex2b (29); this study

pf16-D2HA4C pf16 defect rescued w/HA-tagged gene/ Lacks Tctex2b (29); this study

pf16-D2HA5A pf16 defect rescued w/HA-tagged gene/ Lacks Tctex2b (29); this study

pf18 Lacks central pair/paralyzed flagella

pf28 (oda2) Missing outer arms/slow swimming (60)

pf16-D2pf28 Resc. w/PF16 pf16 defect rescued/Lacks outer arms and Tctex2b (29); this study

pf16-D2λ8b pf16 and tctex2b defects rescued (29); this study

________________________________________________________________________________________

25

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

REFERENCES

1. Vale, R. D. (2003) Cell 112, 467-480

2. King, S. M. (2002) in Molecular Motors (Schliwa, M., ed), pp. 45-78, Wiley-

VCH GmbH, Munchen, Germany

3. Kamiya, R., and Okamoto, M. (1985) J Cell Sci 74, 181-191

4. Brokaw, C. J., and Kamiya, R. (1987) Cell Motil Cytoskeleton 8, 68-75

5. DiBella, L. M., and King, S. M. (2001) Int Rev Cytol. 210, 227-268

6. Kamiya, R. (2002) Int Rev Cytol. 219, 115-155

7. Piperno, G., Ramanis, Z., Smith, E. F., and Sale, W. S. (1990) J Cell Biol 110,

379-389

8. Kamiya, R., Kurimoto, E., and Muto, E. (1991) J Cell Biol 112, 441-447

9. Myster, S. H., Knott, J. A., O'Toole, E., and Porter, M. E. (1997) Mol Biol Cell 8,

607-620

10. Perrone, C. A., Yang, P., O'Toole, E., Sale, W. S., and Porter, M. E. (1998) Mol

Biol Cell 9, 3351-3365

11. Yang, P., and Sale, W. S. (1998) Mol Biol Cell 9, 3335-3349

12. King, S. M., and Patel-King, R. S. (1995) J Biol Chem 270, 11445-11452

13. Harrison, A., Olds-Clarke, P., and King, S. M. (1998) J Cell Biol 140, 1137-1147

14. Perrone, C. A., Myster, S. H., Bower, R., O'Toole, E. T., and Porter, M. E. (2000)

Mol Biol Cell 11, 2297-2313

15. Smith, E. F., and Sale, W. S. (1992) Science 257, 1557-1559

16. Habermacher, G., and Sale, W. S. (1995) Cell Motil Cytoskeleton 32, 106-109

17. Habermacher, G., and Sale, W. S. (1997) J Cell Biol 136, 167-176

26

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

18. King, S. J., and Dutcher, S. K. (1997) J Cell Biol 136, 177-191

19. Habermacher, G., and Sale, W. S. (1996) J Cell Sci 109, 1899-1907

20. Yang, P., Diener, D. R., Rosenbaum, J. L., and Sale, W. S. (2001) J Cell Biol.

153, 1315-1326

21. Pazour, G. J., Wilkerson, C. G., and Witman, G. B. (1998) J Cell Biol 141, 979-

992

22. King, S. M., Dillman, J. F., III, Benashski, S. E., Lye, R. J., Patel-King, R. S., and

Pfister, K. K. (1996) J Biol Chem 271, 32281-32287

23. King, S. M., Barbarese, E., Dillman, J. F., III, Benashski, S. E., Do, K. T., Patel-

King, R. S., and Pfister, K. K. (1998) Biochemistry 37, 15033-15041

24. Patel-King, R. S., Benashski, S. E., Harrison, A., and King, S. M. (1997) J Cell

Biol 137, 1081-1090

25. Lader, E., Ha, H. S., O'Neill, M., Artzt, K., and Bennett, D. (1989) Cell 58, 969-

979

26. Huw, L. Y., Goldsborough, A. S., Willison, K., and Artzt, K. (1995) Dev Biol

170, 183-194

27. Tai, A. W., Chuang, J. Z., Bode, C., Wolfrum, U., and Sung, C. H. (1999) Cell 97,

877-887

28. Pazour, G. J., Koutoulis, A., Benashski, S. E., Dickert, B. L., Sheng, H., Patel-

King, R. S., King, S. M., and Witman, G. B. (1999) Mol. Biol. Cell 10, 3507-3520

29. Smith, E. F., and Lefebvre, P. A. (1996) J Cell Biol. 132, 359-370

30. Silflow, C.D., LaVoie M., Tam, L.W., Tousey, S., Sanders, M., Wu, W.,

Borodovsky, M., Lefebvre, P.A. (2001) J Cell Biol. 153, 63-74

27

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

31. Smith, E.F., Lefebvre, P.A. (1997) Mol. Biol. Cell 8, 455-467

32. Debuchy, R., Purton, S., Rochaix, J.D. (1989) EMBO J. 8, 2803-2809

33. Kindle, K.L. (1990) Proc Natl Acad Sci USA 87, 1228-1232

34. King, S. M., Otter, T., and Witman, G. B. (1986) Methods Enzymol 134, 291-306

35. Nakamura, K., Wilkerson, C. G., and Witman, G. B. (1997) Cell Motil

Cytoskeleton 37, 338-345

36. Merril, C. R., Goldman, D., Sedman, S. A., and Ebert, M. H. (1981) Science 211,

1437-1438

37. Olmsted, J. B. (1986) Methods Enzymol 134, 467-472

38. Okagaki, T., and Kamiya, R. (1986) J Cell Biol 103, 1895-1902

39. Kamiya, R., and Hasegawa, E. (1987) Exptl. Cell Res. 173, 299-304

40. Kamiya, R. (2000) Methods. 22, 383-387

41. Rost, B., and Sander, C. (1993) J. Mol. Biol. 232, 584-599

42. Wu, H., Maciejewski, M. W., Benashski, S. E., Mullen, G. P., and King, S. M.

(2001) J Biomol NMR 20, 89-90

43. Mok, Y. K., Lo, K. W., and Zhang, M. (2001) J Biol Chem 276, 14067-14074

44. DiBella, L. M., Benashski, S. E., Tedford, H. W., Harrison, A., Patel-King, R. S.,

and King, S. M. (2001) J Biol Chem 276, 14366-14373

45. Huang, B., Piperno, G., and Luck, D. J. L. (1979) J. Biol. Chem. 254, 3091-3099

46. Smith, E. (2002) Cell Motil Cytoskeleton 52, 33-42

47. Inaba, K., Kagami, O., and Ogawa, K. (1999) Biochem Biophys Res Commun

256, 177-183

48. Porter, M. E., Power, J., and Dutcher, S. K. (1992) J Cell Biol 118, 1163-1176

28

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

49. Pfister, K. K., Fay, R. B., and Witman, G. B. (1982) Cell Motil 2, 525-547

50. Tang, W. J., Bell, C. W., Sale, W. S., and Gibbons, I. R. (1982) J Biol Chem 257,

508-515

51. Sale, W. S., Goodenough, U. W., and Heuser, J. E. (1985) J Cell Biol 101, 1400-

1412

52. Mitchell, D. R., and Rosenbaum, J. L. (1986) Cell Motil Cytoskeleton 6, 510-520

53. King, S. M., and Witman, G. B. (1990) J Biol Chem 265, 19807-19811

54. Caggese, C., Moschetti, R., Ragone, G., Barsanti, P., and Caizzi, R. (2001) Mol

Genet Genomics. 265, 436-444

55. King, S. M., and Witman, G. B. (1994) J Biol Chem 269, 5452-5457

56. Takada, S., and Kamiya, R. (1994) J Cell Biol 126, 737-745

57. Tam, L. W., and Lefebvre, P. A. (1993) Genetics 135, 375-384

58. Kamiya, R. (1988) J Cell Biol 107, 2253-2258

59. Luck, D., Piperno, G., Ramanis, Z., and Huang, B. (1977) Proc Natl Acad Sci 74,

3456-3460

60. Mitchell, D. R., and Rosenbaum, J. L. (1985) J Cell Biol 100, 1228-1234

29

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

FIGURE LEGENDS

Figure 1. Molecular Cloning and Phylogenetic Analysis of Tctex2b.

(a) Nucleotide and predicted amino acid sequence of the cDNA clone encoding Tctex2b.

The 5’ UTR contains four in-frame stop codons upstream of the first Met and the 3’UTR

contains a perfect copy of the Chlamydomonas polyadenylation signal (underlined).

These sequence data are available from Genbank under accession #BE122193. (b)

Phylogenetic analysis of the Tctex1/Tctex2 family of LCs. Distances were calculated

using PROTDIST and FITCH from the Phylip group of programs and the unrooted tree

was generated using DRAWTREE. The tree reveals two Tctex2 subfamilies designated

as Tctex2a and Tctex2b. Chlamydomonas Tctex2b shares 44% identity with a homolog

from human kidney (AW612564) and a mouse embryo EST (W64276). The Tctex2a

family members include Chlamydomonas flagellar LC2 (489649), human testis Tctex2

(AA781436), mouse Tctex2 (U21673), human glioblastoma EST (AI421187), and

Anthocidaris crassispina flagellar LC1 (BAA24185). Members of the Tctex1 subfamily

are murine Tctex1 (A32995), human Tctex1 (U56255), Anthocidaris crassispina Tctex1

(AB004251), Chlamydomonas flagellar Tctex1 (AF039437) and human rp3 (U02556).

We have also identified three distantly-related Caenorhabditis elegans proteins (D1009-

5, C48724 and T05C12-5) in this family. (c) The secondary structure of Tctex2b was

predicted using PredictProtein. E = Extended sheet, H = helix.

Figure 2. Southern and Northern Blot Analysis of TCTEX2B.

(a) Southern blot of Chlamydomonas wild-type genomic DNA digested with either

SmaI, PvuII, PstI, or BamHI. A probe generated from the full-length TCTEX2B coding

30

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

region detects single bands in SmaI- and BamHI-digested DNA, suggesting a single gene.

(b) Northern blot of total RNA isolated from non-deflagellated cells (NDF) and cells

actively regenerating their flagella for 30 minutes (30’postDF). A faint signal at ~1.3 kb

was detected in NDF RNA and a highly upregulated band of the same size was observed

in 30’postDF RNA. (c) Map of the TCTEX2B genomic region. Restriction fragment

length polymorphism (RFLP) analysis revealed that the TCTEX2B gene maps to linkage

group IX. Sequencing of this genomic region indicated that this gene was ~ 2 kb

downstream of the PF16 gene. TCTEX2B spans an ~1.9 kb region; 5’ and 3’ untranslated

regions (UTRs, dark grey), 5 exons (black) and a portion of the PF16 5’ UTR (light grey)

are indicated.

Figure 3. Specificity of the Tctex2b Polyclonal Antibody.

In panels (a) and (b), gels were either stained with Coomassie brilliant blue, or transferred

to nitrocellulose. (a) Maltose binding protein (MBP) fusions to Tctex2b, Tctex1 and LC2

were digested with Factor Xa, and the LCs separated from MBP by SDS-PAGE. Blots

were probed with either affinity purified rabbit polyclonal antibody CT117 (Tctex2b) or

R5205 (Tctex1)(22). Both antibodies are specific and only recognize their respective LC.

(b) Approximately 50 µg wild-type (cc124) axonemes were electrophoresed in a 5-15%

polyacrylamide mini-gel. The blot was probed with affinity purified CT117 which

detected a single discrete band of ~Mr14,000.

31

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Figure 4. Localization of Tctex2b in Chlamydomonas axonemes.

Approximately 150 µg isolated axonemes from various strains were electrophoresed on

5-15% gradient acrylamide gels and stained with Coomassie blue (upper panel), or

transferred to nitrocellulose, and probed with CT117 (lower panel). Strains used include

wild type (cc124), and mutants lacking various axonemal components: ida1 (inner arm

I1), oda9 (outer arm), ida4 (inner arm subtypes a, c and d from I2), pf28pf30 (outer arm

and inner arm I1), pf14 (radial spokes), pf16-D2 (C1 tubule from central pair), and pf18

(central pair). Levels of Tctex2b are significantly reduced in axonemes that lack inner

arm I1 (ida1 and pf28pf30); this protein is completely absent in pf16-D2. Molecular

weight markers are indicated on the left.

Figure 5. Tctex2b is a Component of Inner Arm I1.

(a) A 0.6 M NaCl extract of wild-type axonemes was loaded onto a 5-20% sucrose

gradient. After sedimentation, fractions were electrophoresed in 5-15% acrylamide gels

and either stained with Coomassie blue (upper panel) or blotted to detect Tctex2b and

IC140 from inner arm I1. Tctex2b comigrates with the peak of inner arm I1 in fractions

5-7. Molecular weight markers are indicated at left. (b) Wild type high salt extracts

were subject to anion exchange chromatography. A linear KCl gradient was used to elute

the various dynein subspecies. Fraction “f” (inner arm I1) eluted at ~ 380-400 mM salt.

Tctex2b copurified with the peak IC140 fractions. IC138 and IC140 (from inner arm I1)

and IC1 and IC2 (from the outer arm) are indicated at right.

32

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Figure 6. Inner Arm I1 Components Can Assemble in the Absence of Tctex2b.

Axonemes from wildtype (cc124) and mutant strains lacking either PF16 and Tctex2b

(pf16-D2) or only Tctex2b (pf16-D2HA4C, pf16-D2HA5A) were electrophoresed in 5-

15% acrylamide gels and either stained with Coomassie blue (upper panel) or blotted to

detect Tctex2b and IC140. IC140 assembles even in the absence of Tctex2b.

Figure 7. Absence of Tctex2b Results in Instability of Inner Arm I1 In Vitro.

In (a-c), Coomassie blue-stained 5-15% acrylamide gels are shown in the upper panel and

immunoblots in the lower panel(s). (a) Sucrose gradient analysis of a high salt extract

from oda9 axonemes. Tctex1 comigrates with the inner arm I1 ICs at ~18S (fractions 5-

7). Thus, the absence of the outer arm alone does not result in dissociation of inner arm

I1. (b) Sucrose gradient analysis of a salt extract from the Tctex2b “knockout” (pf16-

D2) rescued for PF16 in the pf28 (lacks outer arms) background (pf16-D2pf28 Resc.

w/PF16). Tctex1 is dissociated from the I1 complex and migrates near the top of the

gradient whereas most IC140 is present in fractions 7-12. (c) Sucrose gradient analysis

of a high salt extract from Tctex2b “knockout” axonemes (pf16-D2HA4C). In the

absence of Tctex2b alone, Tctex1 no longer migrates at ~18S but appears near the top of

the gradient (similar to panel b), indicating that the absence of outer arms is not

responsible for the instability of Tctex1. Due to the high levels of protein in the pf16-

D2HA4C fractions and the high affinity of the IC140 antibody, a blot containing ~20%

the level of protein shown in the CBB-stained gel was probed to obtain the IC140 signal

shown in (c).

33

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Figure 8. Lack of Tctex2b Results in Decreased Swimming Speeds.

(a) Approximately 150 µg axonemes from wild-type (cc124), pf16-D2 (lacking both

PF16 and Tctex2b), pf16-D2HA4C (lacking only Tctex2b), and pf16-D2λ8b (transformed

with both PF16 and TCTEX2B genes) were electrophoresed in 5-15% acrylamide

gradient gels and either stained with Coomassie blue or transferred to nitrocellulose.

Western blot analysis using affinity purified CT117 verified that pf16-D2λ8b expressed

Tctex2b and that it is localized to the axoneme. (b) Swimming speeds for A54-e18

(parental strain to pf16-D2), Tctex2b “knockout” (pf16-D2 Resc. w/PF16), pf16-D2λ8b

(pf16-D2 resc. with both the PF16 and TCTEX2B genes) and pf16A resc. with PF16 were

calculated using Diagnostic Instruments Spot Advanced imaging software. The

histogram reveals the mean swimming speeds (+/- standard deviation) in µm/sec from

total sample sizes of >150 cells, from a minimum of two experiments.

Figure 9. Microtubule Sliding Velocity and Flagellar Beat Frequency Analysis.

(a) Isolated axonemes from various strains were demembranated before initiation of

microtubule sliding by addition of protease and ATP. Strains analyzed were parental

strain (A84-e18), a pf16 point mutant (pf16A), pf16A rescued with PF16, the pf16 and

tctex2b double mutant (pf16-D2), pf16-D2 rescued for only PF16, pf16-D2 rescued for

both PF16 and Tctex2b (pf16-D2λ8b), an outer armless mutant (pf28), and a double

mutant lacking both Tctex2b and outer arms (pf16-D2pf28 Resc. w/PF16). Microtubule

sliding velocities are expressed in µm/sec as the mean +/- standard deviation. (b)

Flagellar beat frequency was determined using the Fast Fourier Transform (FFT)

method. Cells from strains that lack Tctex2b (pf16-D2, pf16-D2 Resc. w/PF16) show a

34

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

decreased beat frequency compared to the parental strain (A84-e18) or cells rescued for

PF16 and Tctex2b (pf16-D2λ8b).

Figure 10. Model for the Organization of Inner Arm I1

This inner arm subspecies is composed of two HCs (1α and 1β) whose N-terminal stems

lead to a basal/cargo binding region that also includes three ICs (IC140, IC138, and

IC110) and several LCs (LC8, Tctex1, and Tctex2b, and an unidentified 12 kDa

component). The arrangement of ICs and LCs at the base of the dynein particle is

hypothetical. Based on chemical crosslinking data, IC140 and IC110 are thought to

interact (11). Tctex1 is positioned near the N-terminus of IC140 as this region contains a

Tctex1-binding consensus sequence (42). A potential interaction between Tctex2b and

IC140 is predicted based on the ability of both proteins to assemble in small amounts in

inner arm I1-defective strains. An additional association between Tctex2b and Tctex1 is

predicted, because in high salt extracts Tctex1 dissociates from inner arm I1 in the

absence of Tctex2b.

35

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Stephen M KingLinda M. DiBella, Elizabeth F. Smith, Ramila S. Patel-King, Ken-ichi Wakabayashi and

motor function in the chlamydomonas flagellumA novel Tctex2-related light chain is required for stability of Inner dynein arm I1 and

published online March 11, 2004J. Biol. Chem. 

  10.1074/jbc.M313540200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from