Date post: | 28-Jan-2016 |
Category: |
Documents |
Upload: | harry-palmer |
View: | 215 times |
Download: | 0 times |
A Primer on Genetic Variation
Variety
Lawrence Brody - NHGRI
Human Genetic Variation
•What is it?
•Where did it come from?
•How is it scored?
•What use is it?
D. Arbus, 1967
Annie Leibovitz
GATACAATGCATCATATGTATCAGATGCAATATATCATTGTATCATGTATCATGTATCATGTATCATGTATCATGTATCATGTCTCCAGATGCTATGGATCTTATGTATCATGTATCATGTATCATGTATGATGTATC
DNA
Self Replicating Molecule
Fidelity of DNA replication is nearly perfect
Luckily for us, mistakes have been made
Mistakes in DNA
The good, the bad and the indifferent
Time (generations)
Frequency
100%
0
Fate of New Mutations
Genetic Variation
SNP Single Nucleotide Polymorphism
Duplications / Deletions
Why SNPs?
•Numerous
•Stable
•Easy to score
•In genes (sometimes)
GATACAATGCATCATAGATGCAATGTATCATAGATGCTATGCATCATA
Human SNPs
• 2 chromosomes differ ~1/1,000 bases
• more chromosomes more sites
• potential for 30 million variable sites
GATACAATGCATCATA
GATGCAATGTATCATA
Haplotype
Human Population History
• relatively young, ~ 100,000 years
• small populations isolated for long periods of time
– estimated “effective breeding pool” - 10,000 individuals
• explosive expansion coincident with the spread of agriculture
Time (generations)
Allele Frequency 1
0
4Ne humans = 40,000 generations ~ 1 million years
Fate of New Mutations
© 1999 Kenneth K Kidd, Yale University
© 1999 Kenneth K Kidd, Yale University
© 1999 Kenneth K Kidd, Yale University
Human Genetic Variation
•What is it?
•Where did it come from?
•How is it scored?
SNP Genotyping Tools
330,000-650,000 SNPs per array
Affymetrix Illumina
Courtesy, S. Gabriel
SNP Chip Image
* *
**
When is a variant a polymorphism?
Classical definition
Two of more alleles
Least frequent > 0.01
Functional consequences not relevant
Popular definition
Mutation = bad!
Polymorphism = neutral
Frequency not relevant
100,000 years ago
Cradle Lands