A Primer on Genetic Variation

Variety

Lawrence Brody - NHGRI

Human Genetic Variation

•What is it?

•Where did it come from?

•How is it scored?

•What use is it?

D. Arbus, 1967

Annie Leibovitz

GATACAATGCATCATATGTATCAGATGCAATATATCATTGTATCATGTATCATGTATCATGTATCATGTATCATGTATCATGTCTCCAGATGCTATGGATCTTATGTATCATGTATCATGTATCATGTATGATGTATC

DNA

Self Replicating Molecule

Fidelity of DNA replication is nearly perfect

Luckily for us, mistakes have been made

Mistakes in DNA

The good, the bad and the indifferent

Time (generations)

Frequency

100%

0

Fate of New Mutations

Genetic Variation

SNP Single Nucleotide Polymorphism

Duplications / Deletions

Why SNPs?

•Numerous

•Stable

•Easy to score

•In genes (sometimes)

GATACAATGCATCATAGATGCAATGTATCATAGATGCTATGCATCATA

Human SNPs

• 2 chromosomes differ ~1/1,000 bases

• more chromosomes more sites

• potential for 30 million variable sites

GATACAATGCATCATA

GATGCAATGTATCATA

Haplotype

Human Population History

• relatively young, ~ 100,000 years

• small populations isolated for long periods of time

– estimated “effective breeding pool” - 10,000 individuals

• explosive expansion coincident with the spread of agriculture

Time (generations)

Allele Frequency 1

0

4Ne humans = 40,000 generations ~ 1 million years

Fate of New Mutations

© 1999 Kenneth K Kidd, Yale University

© 1999 Kenneth K Kidd, Yale University

© 1999 Kenneth K Kidd, Yale University

Human Genetic Variation

•What is it?

•Where did it come from?

•How is it scored?

SNP Genotyping Tools

330,000-650,000 SNPs per array

Affymetrix Illumina

Courtesy, S. Gabriel

SNP Chip Image

* *

**

When is a variant a polymorphism?

Classical definition

Two of more alleles

Least frequent > 0.01

Functional consequences not relevant

Popular definition

Mutation = bad!

Polymorphism = neutral

Frequency not relevant

100,000 years ago

Cradle Lands