A rice mutant lacking a large subunit of ADP-glucosepyrophosphorylase has drastically reduced starch contentin the culm but normal plant morphology and yield

Frederick R. CookA, Brendan FahyA and Kay TraffordA,B,C

AJohn Innes Centre, Norwich Research Park, Norfolk, NR4 7UH, UK.BPresent address: National Institute of Agricultural Botany, Huntingdon Road, Cambridge, CB3 0 LE, UK.CCorresponding author. Email: kay.trafford@niab.com

Abstract. A mutant of rice (Oryza sativa L.) was identified with a Tos17 insertion in Os05g50380, a gene encoding aplastidial large subunit (LSU) of ADP-glucose pyrophosphorylase (AGPase) that was previously called OsAPL3 orOsAGPL1. The insertion prevents the production of a normal transcript. Characterisation of themutant showed that this LSUis required for 97% of the starch synthesised in the flowering stem (culm), approximately half of the AGPase activity indeveloping embryos and that it contributes to AGPase activity in the endosperm. Despite the near absence of starch in theculms and reduced starch content in the embryos, themutant rice plants growanddevelopnormally, and showno reduction inproductivity. The starch content of leaves is increased in themutant, revealing plasticity in the distribution of photosynthatesamong different temporary carbohydrate storage pools within the plant.

Additional keywords: carbohydrate, flowering stem, Tos17.

Received 26 June 2012, accepted 3 September 2012, published online 23 October 2012

Introduction

Rice (Oryza sativa L.) is a major cereal crop feeding an estimated3 billion people worldwide. The main component of the grain isstarch, which is a polymer of glucose. Understanding starchsynthesis in rice and other cereals is therefore an importantmeans to improve crop productivity. In addition to the grains,starch is also synthesised in various other parts of the rice plantincluding the leaves, culms (stems), developing embryos, pollengrains and root tips. In leaves, culms and embryos, starch servesas a temporary store of carbon. In rice leaf blades, starch isa diurnal store of carbon, the products of starch degradationbeing exported at night. However, the starch content of rice leafblades is relatively low. Rice, like several other species, storesphotosynthate in its leavesmainly as sucrose (Nakano et al. 1995,1997). Starch also accumulates in rice leaf sheaths duringvegetative plant growth and in rice culms mainly after anthesis(Perez et al. 1971; Watanabe et al. 1997). Starch in both of thesestorage pools is remobilised during grain filling and senescence(Yang et al. 2001). It is estimated that starch remobilised fromthe leaves and culms of rice combined contributes up to 40% ofthe carbon required for grain filling (Yoshida 1972). Starch mayaccumulate in developing rice embryos as a temporary store ofcarbon for lipid synthesis, as in the embryos of Brassicaceaespecies (Andriotis et al. 2010).

Starch is synthesised in plastids that are called amyloplasts inthe developing endosperm. The glucan chains in starch areelongated by the addition of glucose units from the nucleotide

sugar, ADP-glucose. ADP-glucose is synthesised by the enzymeADP-glucose pyrophosphorylase (AGPase; enzyme commissionnumber (EC) 2.7.7.27). The supply of ADP-glucose via AGPaseis thought to be themost important determinant of yield in cereals,including rice (Smidansky et al. 2003). The AGPase proteinconsists of two small subunits (SSU) and two large subunits(LSU), and both types of subunit are required for normal AGPaseactivity in vivo (Tsai and Nelson 1966; Dickinson and Preiss1969). The SSUandLSUare both encoded bymultiple genes thatare strongly conserved across grass species. In rice, there are twogenes encoding the SSUs and four encoding LSUs (Table 1).These are expressed in different organs of the plant. In mostorgans, AGPase is entirely plastidial but in the endosperm of allgrasses including rice, there are both plastidial and cytosolicisoforms (Comparot-Moss and Denyer 2009).

The roles of the different subunits of AGPase in cereals havebeen studied using mutants. This has shown that in theendosperm, the most abundant subunits are the cytosolic SSUand LSU, and that both of these are required for normal rates ofstarch synthesis (rice, Lee et al. 2007; maize (Zea mays L.),Giroux andHannah 1994; barley (Hordeum vulgareL.), Johnsonet al. 2003). In rice, for example, mutants lacking cytosolicAGPase accumulate less than one-third of the normal amountof starch (Lee et al. 2007). Of the plastidial LSUs in rice, most isknown about LSU 1 (Table 1). A study of a mutant lacking thisLSU showed that it is required for AGPase activity in the leaf(Rösti et al. 2007). Nomutants of any cereal lacking either LSU 3

CSIRO PUBLISHING

Functional Plant Biology, 2012, 39, 1068–1078http://dx.doi.org/10.1071/FP12186

Journal compilation � CSIRO 2012 www.publish.csiro.au/journals/fpb

or 4, or the plastidial SSUs have been identified previously and sothe importance of these subunits for starch synthesis has not yetbeen determined.

Here, we investigate the role of one of the plastidial LSUs inrice that is encoded by Os05g50380 (NCBI Os05g0580000),called LSU 3 here (Table 1). The gene encoding LSU 3 has beencalled OsAPL3 (Akihiro et al. 2005) or OsAGPL1 (Lee et al.2007; Ohdan et al. 2005). Transcripts encoding LSU 3 are foundmainly in grains and culms, with some expression also in leaves,but it is absent from roots (Table 1). Two independent Tos17insertion mutants were identified and the homozygous lines werecharacterised. One of the mutants, which lacked a full-lengthtranscript for LSU 3, had normal grain weight, moderatelyreduced starch content in the embryo and drastically reducedstarch content in the culm. This suggests amajor role for LSU3 inculm starch synthesis and study of this mutant allows evaluationof the role of culm starch in rice growth and development.

Materials and methodsPlants and growth conditionsMutant lines of rice (Oryza sativa L.) were obtained fromNational Institute of Agrobiological Sciences, Japan (NIAS).Wild-type O. sativa cv. Nipponbare material was a gift fromBarbaraWorland, John Innes Centre. The LSU1mutant seed hadpreviously beenobtained fromNIAS (Rösti et al. 2007). TheLSU2mutants osagpl2–1 andosagpl2–2 and theirwild-type,O. sativacv. Dongjin, were obtained from Jong-Seong Jeon, Kyung HeeUniversity, South Korea (Lee et al. 2007).

Seeds were germinated and grown as described in Rösti et al.(2007). Plants were grown on flooded benches in a controlledenvironment room with 12 h light (28�C) and 12 h (24�C)darkness, and 90% humidity. Light cycle quantum irradiancewas 300–350mmol s–1m–2 at pot height and 400–450mmol s–1m–2

at panicle height. Time after flowering date was used to determine

developmental age. The panicle was judged to have flowered whenanthers were first visible outside the floret.

DNA extraction

DNAwas extracted using the REDExtract-N-AmpPlant PCRKit(Sigma Aldrich, Poole, UK) according to the manufacturer’sinstructions or as follows. Leaf fragments were ground using amicropestle in DNA extraction buffer (0.2M TRIS-HCl(pH 7.5), 25mM EDTA, 0.5% (w/v) SDS, 250mM NaCl).After centrifugation for 3min at 20 000g, one volume ofisopropanol was added to the supernatant to precipitate theDNA. The precipitate was collected by centrifugation at20 000g for 7min. The pellet was air-dried and resuspended insterile water.

Isolation of RNA from plant tissue and cDNA synthesis

Total RNA was isolated using the Trizol reagent (Invitrogen,Paisley,UK) according to themanufacturer’s instructions. Tissuewas homogenised in 1mL Trizol reagent per 50–100mg tissue.The RNA pellet was washed free from contaminants from theextraction process using 75% (v/v) aqueous ethanol and brieflyair-dried before resuspension in 30mL sterile water. The first-strand cDNA was synthesised using Superscript II reversetranscriptase (Invitrogen) according to the manufacturer’sinstructions. The cDNA was treated with 5UmL–1 RNaseH(Amersham Pharmacia, Munich, Germany) to remove theRNA before use in PCR.

Polymerase chain reactions

All PCRs were performed using Taq (Qiagen, Crawley, UK) orPhusion High Fidelity (Finnzymes, Crawley, UK) DNApolymerase and the buffers supplied according to themanufacturer’s instructions. The primers used are shown inTable 2. The PCR program was: 2min at 94�C, 35 cycles of(30 s at 94�C, 30 s at 45–60�C and 72�C for 1min per kb product

Table 1. The proteins encoding the large subunit (LSU) and small subunit (SSU) of ADP-glucose pyrophosphorylase (AGPase) in rice

Protein Subcellularlocation

Gene Previous gene names Expression pattern

SSU 1 Plastid Os09g12660(Os09g0298200)

APS1A, AGPS1B,C, Os2E Present in the grain, leaf blade and leaf sheathA,D,E

SSU 2a Cytosol Os08g25734(Os08g0345800)

APS2A, AGPS2B,C,Os1E Strong in the grain and absent in leavesC

SSU 2b Plastid Strong in leaves and weak in grainC

LSU 1 PlastidB,F Os03g52460(Os03g0735000)

APL 1A, AGPL3B,C Strong in leaves and stem, weak in the grain and absent from rootsA,C

LSU 2 CytosolB Os01g44220(Os01g0633100)

APL 2A, AGPL2B,C Strong in the grain, weak in stem and roots, and absent from leavesA,C

LSU 3 PlastidB Os05g50380(Os05g0580000)

APL 3A, AGPL1B,C Present in the grain and stems, weak in leaves and absent from rootsA,C,D

LSU 4 PlastidB Os07g13980(Os07g0243200)

APL 4A, AGPL4B,C Weak in the grain, stem and leaves; absent from rootsA,C

AAkihiro et al. (2005).BLee et al. (2007).COhdan et al. (2005).DHirose et al. (2006).ERösti and Denyer (2007).FRösti et al. (2007).

A rice mutant with reduced culm starch content Functional Plant Biology 1069

(Qiagen Taq) or 30 s per kb–1 product (Phusion Taq, FisherScientific, Loughborough, UK)) and 72�C for 10min. PCRproduct was mixed with 4� loading buffer (Bioline, London,UK), loaded onto 1.5% (w/v) agarose gel and separated byapplying a voltage of 90–120V. The PCR products werevisualised by ethidium bromide staining under UV light.

DNA sequencing

PCRproductswere sequencedusingproduct-specificprimers andthe BigDye terminator kit ver. 3.1 (Perkin Elmer,Waltham,MA,USA) according to the manufacturer’s instructions. Analysis ofthe reaction products was performed by The Genome AnalysisCentre, Norwich, UK (Norwich Research Park).

Extraction and assay of AGPase activity

To preserve enzyme activity, samples were harvested into tubeson ice and extracted immediately, or harvested and frozenimmediately on liquid nitrogen and stored at �80�C beforeextraction.

All steps were performed at 4�C or on ice. Endosperm orembryo tissue (10–100mg tissue per mL of buffer) washomogenised in extraction buffer (50mM HEPES (pH7.4),5mM KCl, 2mM MgCl2, 2mM EDTA 1mM DTT and 5%(v/v) ethanediol; the embryo extraction buffer also contained1% (w/v) BSA and 1% (w/v) polyvinylpyrrolidone (PVP)) usingeither a pestle and mortar and all-glass homogeniser forendosperm samples or a micropestle for embryo samples.After centrifugation for 15min at 20 000g, the supernatant wasassayed for enzyme activity.

AGPase was assayed in the pyrophosphorolysis direction bymonitoring of the rate of production of NADH at 340 nm usinga spectrophotometer (Lamda 40, PerkinElmer) as described bySmith et al. (1989) and modified by Burton et al. (2002a).

Extraction and assay of starch

Starch was extracted in perchloric acid according to Rösti et al.(2007). The insoluble pellet was resuspended in water andautoclaved for 20min at 120�C to solubilise the starch. Starchwas digested to glucose using a-amylase and amyloglucosidase(Megazyme Ltd, Bray, Ireland) and the glucose was measuredenzymatically as described in Rösti et al. (2006). Undigestedcontrols were included in the analysis to account for sugars in thepellet that were not from starch.

Extraction and assay of lipids

Total lipids in rice embryos was determined gravitometricallyusing a method based on Coxon and Wright (1985). Samplesof 20 embryos (each of 12–15mg DW) were dissected frommature rice grains after they had been imbibed, in the presenceof sterile water, overnight at 4�C and were then freeze-driedbefore extraction in chloroform and methanol. Replicate controlextractions, following all steps above but in the absence of tissue,were carried out and the average control residue was subtractedfrom each sample residue.

Iodine staining

Iodine stainingwas performed according to themethod describedby Rösti et al. (2007).

Immunoblotting

Immunoblotting was carried out according to the methoddescribed by Rösti et al. (2007) except that eitherpolyvinylidene difluoride (Thermo Scientific, Basingstoke,UK) or nitrocellulose transfer membranes were used. Antiseraraised against BRITTLE2 and SHRUNKEN2 from maize (fromCurt Hannah, University of Florida, Gainsville, FL, USA) wereused at a dilution of 1 : 5000. Antiserum raised against AGPaseLSU from pea (Pisum sativum L.) (from Alison Smith, JIC) wasused at a dilution of 1 : 750. Antiserum raised against AGPaseLSU from spinach (Spinacia oleracea L.) leaf (from Jack Preiss,Michigan State University, MI, USA) was used at a dilution of1 : 5000. Antisera raised against Barley endosperm ADPglucosepyrophosphorylase large subunit (BEPL) and barley endospermADPglucose pyrophosphorylase small subunit (BEPS) frombarley (from Tine Thorbjornsen, Agricultural University ofNorway, Ås, Norway) were used together with a combineddilution of 1 : 1000.

Results

Identification of a mutant lacking LSU 3

A search of the NIAS germplasm database (http://tos.nias.affrc.go.jp) for rice lines with mutations in genes encoding plastidialsubunits of AGPase revealed three Tos17 insertion lines withinsertions in the gene encoding LSU 3: NC7135, NE1391 andNF3982. No mutants with lesions in the LSU 4 or SSU 1 genes(Table 1) were available. T2 grain for each insertion line was

Table 2. Primers for genotyping Tos17 seed and amplification of rice large subunit (LSU 3) cDNA

Target sequence Primer Use Sequence (50 to 30)

LSU 3 P1 Genotyping NE1391 ACTTTGCGGATCCAAATGAGP2 Genotyping NE1391 GGCCAGGAATTTCAAGATGAP3 Genotyping NF3982 ATGATTTGCGTGGTTGTTGAP4 Genotyping NF3982 GGGAAATTTAGTCGGGTCGTP5 Complementary DNA amplification TGCAGTTCAGCAGTGTGTTTCP6 Complementary DNA amplification CACGATTCCCGACCTTATGT

LSU 1 P7 Genotyping OsApl1 GAGATGGATTCGTCGAGGTGA

P8 Genotyping OsApl1 TCCATGTAGTCCATGCGGTAA

Tos17 P9 Genotyping 30 internal AGGTTGCAAGTTAGTTAAGAB

ARösti et al. (2007).BNational Institute of Agrobiological Sciences, Japan; http://tos.nias.affrc.go.jp.

1070 Functional Plant Biology F. R. Cook et al.

obtained from the Rice Genome Resource Centre, Japan. In thedatabase, the insertions in NC7135 andNE1391 were reported tobe in an intronwhereas that inNF3982was in exon 6 (Fig. 1a). Togenotype individual T2 and T3 plants, primers were designedto amplify fragments of thewild-type andmutant genes. All 20 ofthe NC7135 seedlings tested were found to be wild-type plantsand so this line was discarded. Sequencing of the PCR productsfor NE1391 and NF3982 confirmed their insert positions, and

revealed both homozygous mutant and homozygous wild-type plants. Grains derived from these mutant and wild-typesegregants were used in subsequent experiments.

Tocompare the size and sequenceof transcripts encodingLSU3 in the mutant and wild-type grains, RNA was prepared fromdeveloping grains, and reverse transcriptase (RT) PCR was usedto amplify regions spanning the Tos17 insertion sites. For theNE1391 mutant, the PCR product was indistinguishable in size

(a) NE1391 NF3982NC7135

DNA

Wild type LSU 3 transcript

NE1391 transcript

NF3982 transcript

2 kb

1 kb

WTNF3982NE1391M(b)

(c)Exon5

LSU3 genomic (3087) CAGGACTATTACAAGCATAAAGCTATAGAACACATTTTAATCTTGTCAGGAGATCAGCTTTATCGTATGGACTACLSU3 cDNA ---GACTATTACAAGCATAAAGCTATAGAACACATTTTAATCTTGTCAGGAGATCAGCTTTATCGTATGGACTACLSU3 protein D Y Y K H K A I E H I L I L S G D Q L Y R M D Y NF3982 cDNA ---GACTATTACAAGCATAAAGCTATAGAACACATTTTAATCTTGTCAGGAGATCAGCTTTATCGTATGGACTACNF3982 protein D Y Y K H K A I E H I L I L S G D Q L Y R M D Y

LSU3 genomic (3162) ATGGAGCTTGTGCAGGTTTGTCCTGGCCTCATTCTTCTGTACTTTTCCACATGCTTTTCTTTTGAACTGGCTGACLSU3 cDNA ATGGAGCTTGTGCAG------------------------------------------------------------LSU3 protein M E L V QNF3982 cDNA ATGGAGCTTGTGCAG------------------------------------------------------------NF3982 protein M E L V Q

Exon6LSU3 genomic (3237) TCTTCAATATATGCCATTCACCGTTTGCAGAAACATGTTGATGACAATGCTGACATTACTTTATCATGTGCTCCTLSU3 cDNA ------------------------------AAACATGTTGATGACAATGCTGACATTACTTTATCATGTGCTCCT

P A C S L T I D A N D D V H Knietorp 3USLNF3982 cDNA ---------------------------------------------------------------------------NF3982 protein

LSU3 genomic (3312) GTTGGAGAGAGGTATATCGATTGTACAATATTCCAAAAGTTAGATAATATTATCAGCATTTGTCCTCAGAAAATGLSU3 cDNA GTTGGAGAGAG----------------------------------------------------------------LSU3 protein V G E S NF3982 cDNA ---------------------------------------------------------------------------NF3982 cDNA NF3982 protein

Exon7LSU3 genomic (3387) CAGAGCATCCTGATTTGGTTTTCTTTATTATGGTAGTCGAGCATCTGACTATGGACTAGTGAAGTTCGACAGTTCLSU3 cDNA ------------------------------------TCGAGCATCTGACTATGGACTAGTGAAGTTCGACAGTTC

S S D F K V L G Y D S A Rnietorp 3USLNF3982 cDNA ------------------------------------TCGAGCATCTGACTATGGACTAGTGAAGTTCGACAGTTCNF3982 protein S S I * L W T S E V R Q F

LSU3 genomic (3462) AGGCCGTGTAATTCAATTTTCTGAAAAACCCAAGGGCACTGACTTGGAAGCAATGGTTLSU3 cDNA AGGCCGTGTAATTCAATTTTCTGAAAAACCCAAGGGCACTGACTTGGAAGCAATG---LSU3 protein G R V I Q F S E K P K G T D L E A M NF3982 cDNA AGGCCGTGTAATTCAATTTTCTGAAAAACCCAAGGGCACTGACTTGGAAGCAATG---NF3982 protein R P C N S I F * K T Q G H * L G S N

7 8 9 10 11 12 13 14 15652 431

7 8 9 10 11 12 13 14 15521 3 4

157 8 96521 3 4 10 11 12 13 14

157 8 9 10 11 12 13 146521 3 4

Fig. 1. Identification and characterisation of large subunit (LSU) 3 mutant rice lines. (a) The position of three Tos17inserts in Os05g50380 (Os05g0580000), as described in the National Institute of Agrobiological Sciences (NIAS)database, are shown.The predicted transcripts encodedby thewild-type andmutant genes are showndiagrammatically.(b) PCRproducts amplifiedusing cDNAandprimers inExons 2 and15were separatedon1.2%agarose gel. The sizes ofDNA markers (M) are indicated. (c) Sequencing of the amplified products revealed the absence of exon 6 in NF3982cDNA. The predicted protein sequence contains a stop codon (*) at the start of Exon 7.

A rice mutant with reduced culm starch content Functional Plant Biology 1071

from that of the wild-type but for the NF3982mutant, the productwas ~100 bp smaller than that of the wild-type (Fig. 1b).Sequencing of the product from the NE1391 mutant showedthat it was identical to the wild-type, suggesting that the Tos17insert is spliced from the transcript together with the intron inwhich it lies. The normal removal of an intron containing a Tos17insertion has been described previously (e.g. Chen et al. 2007).Sequencing of the PCRproduct from theNF3982mutant showedthat it lacked 56 bp corresponding to exon 6 (Fig. 1c). Thus, theTos17 insertion in this line results in the exclusion of Exon 6 fromthe transcript. This is probably due to abnormal splicing. Similarabnormal splicing of an exon containing a Tos17 insert was alsoobserved for LSU1of riceAGPase (Rösti et al. 2007). The loss ofthe 56-bp exon in the NF3982 transcript leads to a frame shift andto a premature stop codon at the start of Exon7 (Fig. 1c). Thus, theLSU 3 gene in the NF3982 mutant is incapable of encoding afunctional protein. The NF3982 insertionmutant will hence forthbe referred to as the LSU 3 mutant.

Embryos and culms lacking LSU 3 have reduced amountsof AGPase SSU protein

LSU 3 is expressed mainly in grains and culms (stems)(Table 1). To test the effect of the LSU 3 mutation on AGPaseproteins in these organs, extracts were probed with antisera to theSSU and LSU of AGPase. Endosperms and embryos were firstprobed with various AGPase LSU antisera: SHRUNKEN2 (LSU2 orthologue) frommaize, BEPL (LSU 3 orthologue) from barleyand theAGPase LSU from spinach leaf. For comparison, extractsof previously-identifiedmutant rice lines lacking LSU1 or LSU2and a wild-type line were also probed. Proteins of ~58 kDa wererecognised in endosperm extracts of the wild-type, the LSU 1mutant and the LSU3mutant, but no LSUproteinwas detected inendosperm from the LSU 2 mutant (Fig. 2a) with any of theantisera tested. The LSU2mutant lacks the cytosolic LSU,whichis known to be themost abundant LSU protein in rice endosperm.However, it has one or more of the plastidial LSU proteins(LSUs 1, 3 or 4), which are normally present in minoramounts. These results suggest that the only type of LSUprotein that is detectable in the endosperm of any line is themajor cytosolicLSUofAGPase, LSU2, and that the antisera usedwere unable to detectminor plastidial LSUproteins. This could bedue to the lack of specificity of the antisera to the plastidial LSUproteins in rice endosperm or to their low abundance or to acombination of these factors. In embryo extracts, noproteinsweredetected with any of the LSU antisera and in culms, no proteinswere detected with the SHRUNKEN2 antiserum. Without anantibody capable of detecting the plastidial LSUs, it has not beenpossible to determine the effect of the LSU 3 mutation on theseproteins in grains or culms.

Endosperms and embryos were also probedwith an antiserumto themaize endospermAGPase SSU,BRITTLE2. The predictedmasses of the SSU1, SSU2a and SSU2b proteins in rice are 49.5,52.9 and 49.4 kDa, respectively. Proteins of 49–53 kDa wererecognised in the endosperm and embryo extracts of all four ricegenotypes tested and in wild-type culms (Fig. 2b). However, forthe LSU 3 mutant, the cross-reaction with embryo extractswas consistently comparatively weak and no SSU protein wasdetected in culm extracts (Fig. 2b). This shows that the amount of

AGPase SSU protein is reduced in embryos lacking LSU 3 andthat it is absent from culms.

LSU 3 contributes to AGPase activity in developingendosperm and embryos

To determine whether LSU 3 is required for normal AGPaseactivity in developing rice grains, total AGPase activities in theembryos (Fig. 3a) and endosperm (Fig. 3b) of the LSU 3 mutantandwild-type segregantswere compared. Inbothorgans,AGPaseactivity increased slightly during development but was lower ateach stage in the mutant than in the wild type. During this period,the mean AGPase activity in mutant embryos was 33% of that inthe wild-type, but in mutant endosperm, the mean AGPaseactivity was 77% of that in the wild-type. These data suggestthat LSU 3 makes a major contribution to AGPase activity in theembryo and a minor contribution in the endosperm.

To check that it was the Tos17 insertion in the LSU 3 gene andnot an insertion in another gene in this line that was responsiblefor the low AGPase activity in the LSU 3 mutant embryos, we

- 72

(a) LSU antiserum

SSU 1SSU 2

Endosperm Embryo

LSU 2

WT

LSU

1 m

utan

t

LSU

2 m

utan

t

LSU

3 m

utan

t

WT

LSU

1 m

utan

t

LSU

2 m

utan

t

LSU

3 m

utan

t

Endosperm Embryo

(b) SSU antiserum

- 95

- 55

- 43

- 72

- 95

- 55

- 43

WT

LSU

1 m

utan

t

LSU

2 m

utan

t

LSU

3 m

utan

t

WT

LSU

1 m

utan

t

LSU

2 m

utan

t

LSU

3 m

utan

t

Culm

180

116

9058

4937

WT

LSU

3 m

utan

t

Culm

180

116

9058

4937

WT

LSU

3 m

utan

t

Fig. 2. Analysis of proteins. Developing endosperm, embryos and culmsfrom wild-type rice plants (WT) and large subunit (LSU) mutants wereextracted. Volumes of extract containing 0.25mg, 0.5mg and 20mg oftissue, respectively, were separated by SDS–PAGE. Immunoblots wereprobed with antisera to (a) the maize cytosolic ADP-glucosepyrophosphorylase (AGPase) LSU (SHRUNKEN2) and (b) small subunit(SSU) (BRITTLE2). The positions of marker proteins (masses in kDa) andthe immunoreactive bands corresponding to the major AGPase subunits inthe endosperm (LSU2 andSSU2) and the embryoSSU (SSU1) are indicated.

1072 Functional Plant Biology F. R. Cook et al.

measured the embryo AGPase activity in a T3 populationsegregating for the mutation (Fig. 3c). The populationcontained 16 wild-type, 32 heterozygous and 12 mutant plants,which approximates to the 1 : 2 : 1 ratio predicted for thesegregation at a single locus. The AGPase activity in embryoswas segregated along with the plants’ genotype, indicating thatthe Tos17 insertion in the gene encoding LSU 3 is responsible for

the altered activity. In this experiment, the activity in the mutantaccounted for 42% of that in the wild-type. This confirms thatLSU 3 is required for more than half of the AGPase activity inembryos.

The AGPase activity in T4 embryos from heterozygous T3

plants was intermediate between that for embryos of wild-typeandmutant plants. TheseT4 embryoswere amixture of genotypes(in the same 1 : 2 : 1 ratio seen in the heterozygous T3). Thus it canbe inferred that the AGPase activity in individual heterozygousembryos is intermediate between that in wild-type and mutantembryos.

For comparison, the activities in embryos of mutant NE1391,which had a wild-type transcript sequence (Fig. 1), and in LSU 1mutant embryos were also measured and both were found to besimilar to that in the wild-type control. The means� s.e. (n= 5or 6) were 111� 0.2% and 98� 0.1% of wild-type values,respectively. These data suggest that LSU 3 is the mostabundant LSU in embryos and that LSU 1 makes little, if any,contribution in this organ.

LSU 3 is required for normal starch content in embryos

To test whether the reduction in AGPase activity in embryos hadany impact on their starch content,mutant andwild-type embryoswere compared (Fig. 4a). In both, starch content increased withincreasing embryoweight between10 and15 days afterflowering(DAF) but was lower in the mutant than in the wild-type at eachstage. During this period, the mean starch content in mutantembryoswas65%of that in thewild-type.Thus,LSU3 is requiredfor normal starch content in developing embryos.

US patent no. 6 232 529 claims that reduced starchbiosynthesis in the developing embryos of maize increases theamount of lipids in the mature embryo (Singletary et al. 2001).To determine whether there is a similar inverse relationshipbetween the accumulation of starch and lipids in rice embryos,the lipid content of LSU 3 and wild-type embryos wascompared. The lipid content of mutant embryos(85.25� 10.4mg per embryo, mean� s.e.) was not statisticallysignificantly different from that of thewild-type (84.23� 11.0mgper embryo, mean� s.e.) (t-test, P-value = 0.94).

LSU 3 is required for normal starch content in culms

To investigate whether LSU 3 is required for normal starchcontent in various other organs of the plant, including culms, apreliminary survey was conducted by staining plant organs withiodine solution (Fig. 5). Samples were harvested at the end of thelight period, heated in ethanol to remove chlorophyll and stainedwith Lugol’s solution (iodine or potassium iodide in water). Forthe flag leaf sheath (Fig. 5a) and pollen grains (not shown), therewas no discernable difference in the intensity of staining betweenthe mutant and wild-type. However, the staining of the flag leafblade was more intense in the mutant than in the wild-type(Fig. 5a). In contrast, the developing panicles of the LSU 3mutant and their subtending culms were stained less intenselythan those of the wild type (Fig. 5b). Closer examination of thepanicles showed that someofmutantflorets (Fig. 5c) and all of thefirst internodes (Fig. 5d) of the mutant were stained less intenselythan those of the wild-type. This suggests that in the LSU 3mutant, there is a decrease in starch content in the panicle,

(a)

(c)

(b)

R2 = 0.1604

R2 = 0.0691

R2 = 0.1135

R2 = 5E-06

0.0

0.4

0.8

1.2

1.6

0.3 0.4 0.5 0.6 0.7 0.8

AG

Pas

e ac

tivity

(nm

ol p

er m

in p

er e

mbr

yo)

Embryo mass (mg)

0

50

100

150

200

250

300

350

12 13 14 15 16 17 18 19 20 21 22

AG

Pas

e ac

tivity

(nm

ol p

er m

in p

er e

ndos

perm

)

Endosperm mass (mg)

0.0

0.5

1.0

1.5

2.0

2.5

WT HET MUT

AG

Pas

e ac

tivity

in e

mbr

yos

(µm

ol p

er m

in p

er g

FW

)

Fig. 3. ADP-glucose pyrophosphorylase (AGPase) activity in developingembryos and endosperm of rice. Samples were dissected from developinggrains harvested at 10–15 days after flowering weighed, extracted andassayed. Each extract was assayed in duplicate. (a) Samples of 6–11embryos (n= 5 per genotype, from five separate plants). Closeddiamonds =wild-type plants; open diamonds = large subunit (LSU) 3mutants. (b) Samples of individual endosperms (n= 17 per genotype, from3 or 4 separate plants). Closed diamonds =wild-type plants; opendiamonds =LSU 3 mutant. (c) A population of segregated T3 plants(n= 60) were genotyped for the LSU 3 insertion and the AGPase activityin a sample of 10 T4 embryos from each of these was measured. Values aremeans� s.e. WT, homozygous wild-type (n= 17); HET. heterozygous(n= 31); MUT, homozygous LSU 3 mutants (n= 13).

A rice mutant with reduced culm starch content Functional Plant Biology 1073

particularly in the lower culm, and an increase in the flag leafblade.

To investigate the effects on starch content further, the starchcontents of theculmandflag leaf bladewerequantifiedat differentstages of development (Fig. 4). In thewild-type, the starch contentin the culm from the first internode to the base of the paniclewas low on the day of flowering and increased over the following10 days. In the mutant, the starch content of the culm was low

throughout this 10-day period. At 10 DAF, the culm starchcontent in the mutant was only 3% of that in the wild-type.The starch content of the flag leaf blade was generally lower thanthat in the culm. In both the wild-type and mutant, the starchcontent decreased by approximately half after flowering. At 15DAF, there was statistically significantly more starch in the leafblades of the mutant at the end of the light period than in those ofthe wild-type (t-test, P-value = 0.04).

A reduction in culm starch had no effect on plantdevelopment or yield

Several metrics relating to growth and yield were determined formutant andwild-type plants growing in controlled environmentalconditions (Table 3). There were no statistically significantdifferences between genotypes for any of these values. Despitethe drastic reduction in starch content in the culms, the mutantplants flowered at the normal time, and grain weight and numberwere also normal.

Discussion

Two independent Tos17 insertions in rice gene Os05g50380,which encodes an LSU of plastidial AGPase (called LSU 3 here)were identified andcharacterised. In one line, theTos17 insertwaslocated within an intron and no effect was observed on thesequence of the mature RNA transcript. We did not assesswhether the amount of transcript was affected in this line. Inthe other line, the Tos17 insert was located within an exon andgenerated a premature stop codon in the mature RNA transcript.This line, which cannot produce LSU 3 protein, was designatedthe LSU3mutant. The pattern of expression of the gene encodingLSU 3 suggests that it is expressed mainly in the grain and culm(Akihiro et al. 2005; Ohdan et al. 2005). Consistent with this,AGPase activity and protein were reduced in the developingembryo, endosperm and culm of the LSU 3 mutant.

A disadvantage of the Tos17 system is that it is not easy tocomplement the mutant line with a functional transgene, asthe Tos17 transposon is activated under the tissue cultureconditions necessary for stable rice transformation (Hirochika1997). The absence of multiple independent lines lackingLSU 3 also prevented confirmation of the causal link betweenthe mutant phenotype and the Tos17 insertion. However,segregation analysis showed that the reduction in AGPaseactivity in embryos cosegregated with the presence of theTos17 insert in the LSU 3 gene. This provides good evidenceof a causal link but it does not rule out the possibility, althoughremote, that the mutant phenotype is due to a second mutation ina closely-linked gene.

LSU 3 makes a major contribution to AGPasein the embryo

Analysis of the LSU3mutant suggested thatmore than half of theAGPase activity in the embryo is accounted for by the LSU 3protein. What genes are responsible for the AGPase activityremaining in the embryos in the absence of LSU 3 has yet tobe established. This could be due to the SSU alone. There isevidence that in some heterologous systems, SSU proteins can beactive in the absence of LSUs (Ballicora et al. 1995; Doan et al.1999; Salamone et al. 2000). However, in vivo, there is also

(a)

R2 = 0.8015

R2 = 0.564

0

5

10

15

20

25

30

35

0.4 0.5 0.6 0.7 0.8 0.9 1

Sta

rch

cont

ent

(µg

per

embr

yo)

Embryo mass (mg)

(b)

0

10

20

30

40

50

60

70

–14 0 5 10

Cul

m s

tarc

h co

nten

t(m

g pe

r g

FW

)

WT

MUT

(c)

0

5

10

15

–14 0 10 15

Leaf

sta

rch

cont

ent

(mg

per

g F

W)

Days after flowering

WT

MUT

Fig. 4. Starch contents of (a) developing embryos, (b) culm and (c) leaf ofrice were determined. Samples were weighed, extracted and assayed forstarch. Each extract was assayed in triplicate. In (a), samples of five embryos(n= 8, from four different plants) were dissected from developing grainsharvested 10–15 days after flowering. Closed diamonds =wild-type plants;open diamonds = LSU 3 mutant. In (b), samples of individual culms (n= 3,from three separate plants) were harvested at different times after anthesis,weighed, extracted and assayed for starch. Values are means� s.e.WT,wild-type; MUT, LSU 3 mutants. In (c), samples of individual leaves (n= 5, fromfive separate plants) were harvested at the end of the daily light period atdifferent times after anthesis, weighed, extracted and assayed for starch.Values are means� s.e. WT, wild-type; MUT, LSU 3 mutants.

1074 Functional Plant Biology F. R. Cook et al.

evidence that SSUs are unstable in the absence of the LSU. Inbarley leaves, no SSU protein was detected in the absence ofLSU 1 (Rösti et al. 2007). Similarly in maize, although a SSUprotein was detected in the endosperm of the LSU mutantshrunken2 early in development, it disappeared later in

development (Giroux et al. 1994). Thus, in the absence ofLSU 3, one or more of the other plastidial LSUs (LSU 1 andLSU 4) are likely to be responsible for the residual AGPaseactivity.Of these, LSU4maymake the greater contribution, sinceanalysis of an LSU 1 mutant suggests that this subunit does

(a)

(b)

(c)

(d)

Fig. 5. Organs from wild-type and LSU 3 mutant plants were harvested and stained with Lugol’s solution toreveal their starch content. In each figure, several randomly selected wild-type organs are shown on the left andan equal number of mutant organs are shown on the right. (a) Flag leaf sheaths, 10 days after flowering (DAF);(b) panicles, 10 DAF; (c) developing florets 3� 5 DAF and 3� 10 DAF; (d) internodes, first below panicle,3� 5 DAF and 3� 10 DAF.

A rice mutant with reduced culm starch content Functional Plant Biology 1075

not contribute significantly to AGPase activity in the embryo(results shown here and Rösti et al. 2007). LSU 4 transcripts arefound in grains at low levels as well as in stems and leaves(Akihiro et al. 2005;Ohdan et al. 2005) but, to our knowledge, therelative amountsof transcript in the embryos andendosperm isnotknown. A mutant lacking LSU 4 will be required to test the rolesand importance of this subunit.

The lack of LSU 3 led to reduced starch content in the riceembryos. However, this did not have any effect on embryodevelopment or grain filling, as both embryos and maturegrain were normal in weight. This suggests that if starch isrequired in the embryo to establish sink strength or to providea temporary carbon store during development, the quantity ofstarch is not critical to these functions, or that the residual starchin the LSU 3 mutant is sufficient.

LSU 3 makes a minor contribution to AGPase activityin the endosperm

In the absence of LSU 3, there was a reduction of 23% in thetotal AGPase activity in rice endosperm compared with that inthe wild-type, suggesting that this plastidial LSU makes aminor contribution to AGPase activity in the endosperm. It hasbeen estimated that ~90% of the total AGPase activity in riceendosperms is cytosolic (Sikka et al. 2001). Thus the reduction inAGPase activity in the endosperm of the LSU 3 mutant could bedue to severe reduction or elimination of plastidial AGPaseactivity. Despite this, there was little effect, if any, on starchsynthesis in the LSU 3 mutant, as no difference in mature grainweight was found. This suggests that AGPase LSU 3 in the riceendosperm is not required for normal rates of starch synthesis.

We were unable to test whether LSU 3 or any of the otherminor plastidial LSUs were present in normal endosperm, as wewere unable to detect any of these proteins using three differentLSUantisera. Similarly, nominorLSUproteins could be detected

in rice endosperm lacking the major cytosolic LSU protein,LSU 2, using an antiserum raised to the rice LSU 2 protein(Lee et al. 2007). We were also unable to quantify the plastidialAGPase activity in the developing endosperm of either the wild-type or the LSU 3 mutant using plastid isolation experiments,although these have been used by others for rice (Sikka et al.2001) and by us for other cereals (barley, Thorbjørnsen et al.1996; wheat (Triticum aestivum L.), Burton et al. 2002b; maize,Denyer et al. 1996). We obtained an insufficient yield of plastidsfrom rice to allow an accurate estimation of plastidial activity(data not shown). Thus although theLSU3mutant of rice is likelyto have reduced plastidial AGPase in the endosperm, we havebeen unable to measure the extent of this reduction, and thus testthe role and importance of plastidial AGPase in this tissue.

The LSU 3 mutant has drastically reduced culm starchbut grows normally

In the absence of LSU 3, almost no starch accumulated in theculms.At 10DAF,LSU3mutant culms had only 3%of the starchcontent of wild-type culms (wild-type = 59.3� 9.1mg g–1 FW;mutant = 1.6� 0.2mg g–1 FW). In the absence of LSU 3, wecould not detect any SSU protein in the culms. This suggests thatLSU 3 probably accounts for most of the LSU protein in the culmand that in its absence, the SSU is unstable and is degraded.Despite thevery lowstarch content in the culms, theLSU3mutantplants grew normally and had normal grain weight and yield. Theimportance of culm starch for normal growth in grasses had notpreviously been tested, as no mutants lacking culm starch wereavailable. In a previous experiment, we showed that a LSU 1mutant of rice that entirely lacks leaf starch also grows and yieldsnormally (Rösti et al. 2007).Togetherwith the results shownhere,this work suggests that under experimental growth conditions,neither leaf nor culm starches alone are essential for growth orgrain filling in rice.

Table 3. Analysis of rice growth metrics and yield componentsFive plants per genotype were grown together in controlled environmental conditions. Plants were allowed to dry for

several weeks before harvest. Values are means� s.e.

Wild-type LSU 3 mutant t-test(P-value)

Plant weight (aerial parts) (g) 19 ± 2 22 ± 3 0.45Straw weight per plant (g) 9 ± 1 10 ± 1 0.64Panicles per plant 7 ± 0.7 10 ± 1 0.18Florets per panicle 56 ± 2 56 ± 3 0.92Unfilled florets per panicle 9 ± 0.7 11 ± 0.8 0.11Filled florets per panicle 47 ± 3 45 ± 2 0.53Grains per plantA 354 ± 42 435 ± 62 0.31Grain weight per panicle (g)A 1 ± 0.1 1 ± 0.1 0.42Mean grain weight (mg)A 26 ± 0.2 26 ± 0.2 0.42Mean embryo weight (mg)B 0.68 ± 0.02 0.66 ± 0.02 0.36Mean grain weight (1st panicle) (mg)A,C 26 ± 0.3 26 ± 0.3 0.14Mean grain weight de-hulled (first panicle) (mg)C 23 ± 0.2 22 ± 0.2 0.12Calculated hull weight (mg)C 4 ± 0.1 4 ± 0.1 0.48

AHulled grain.BA sample of 20 embryos from each of five plants was weighed.CTen grains were removed from the first flowering panicle from each of the five plants and these 50 grains were weighedindividually, with and without the hull.

1076 Functional Plant Biology F. R. Cook et al.

In rice, as in other grasses, small water-soluble carbohydratesare synthesised in culms and leaf sheaths as reserves in addition tostarchwhen the supplyof carbon fromphotosynthesis exceeds thedemands of grain filling (Schnyder 1992). Rice is unable tosynthesise fructans, and so sucrose and other simple sugars arethe main water-soluble storage reserves. In the LSU 1 and LSU 3mutants, these sugars may be sufficient to supply the grain withcarbon, or theymay increase in amount to compensate for the lackof starch. In addition, in the LSU3mutant, a small but statisticallysignificant increase in the starch content of the leaf blades duringgrain filling was observed. This additional carbon store may alsohelp to compensate for the lack of culm starch. Thus this worksuggests that the rice plant temporarily stores carbon in severalforms and in several separate pools, and there appears to beconsiderable plasticity in the distribution of reserves betweenthese.

Our plantswere grown in controlled environmental conditionsand their lack of dependence on culm starch for normal growthmight not be reproducible underfield conditions or under stressfulgrowth conditions. It is thought that starch stored in the culmmaybe particularly important for grainfilling inwater-stressed cereals(Blum 1998), since culm starch is remobilised faster under theseconditions (Yang et al. 2001). Starch accumulation in the riceculm is also associated with resistance to lodging (Kashiwagiet al. 2006; Ishimaru et al. 2008). Taken together, this suggeststhat LSU 3 mutant rice may be more susceptible to droughtstress and to lodging. This will need to be investigated. Theimpact of upregulation of AGPase activity on culm starchcontent and resistance to these abiotic stresses may also beworth investigation.

Acknowledgements

This work was supported by a Collaborative Awards in Science andEngineering (CASE) studentship from the Biotechnology and BiologicalSciences Research Council UK. The industrial sponsor for the CASEstudentship was BASF Plant Sciences LLC. The authors are gratefulto Dr Harriet Hunt, McDonald Institute, Cambridge University forconstructive criticism of the manuscript.

References

Akihiro T, Mizuno K, Fujimura T (2005) Gene expression of ADP-glucosepyrophosphorylase and starch contents in rice cultured cells arecooperatively regulated by sucrose and ABA. Plant & Cell Physiology46, 937–946. doi:10.1093/pcp/pci101

Andriotis VM, Pike MJ, Kular B, Rawsthorne S, Smith AM (2010) Starchturnover in developing oilseed embryos. New Phytologist 187, 791–804.doi:10.1111/j.1469-8137.2010.03311.x

Ballicora MA, Laughlin MJ, Fu Y, Okita TW, Barry GF, Preiss J (1995)Adenosine 50-diphosphate-glucose pyrophosphorylase from potato tuber(significance of theN terminus of the small subunit for catalytic propertiesand heat stability). Plant Physiology 109, 245–251. doi:10.1104/pp.109.1.245

Blum A (1998) Improving wheat grain filling under stress by stem reservemobilisation. Euphytica 100, 77–83. doi:10.1023/A:1018303922482

BurtonRA, JennerH,CarrangisL, FahyB, FincherGB,HyltonC,LaurieDA,Parker M, Waite D, van Wegen S, Verhoeven T, Denyer K (2002a)Starch granule initiation and growth are altered in barley mutants thatlack isoamylase activity. The Plant Journal 31, 97–112. doi:10.1046/j.1365-313X.2002.01339.x

Burton RA, Johnson PE, Beckles DM, Fincher GB, Jenner HL, Naldrett MJ,Denyer K (2002b) Characterization of the genes encoding the cytosolicand plastidial forms of ADP-glucose pyrophosphorylase in wheatendosperm. Plant Physiology 130, 1464–1475. doi:10.1104/pp.010363

Chen C, Gao M, Liu J, Zhu H (2007) Fungal symbiosis in rice requiresan ortholog of a legume common symbiosis gene encoding aCa2+/calmodulin-dependent protein kinase. Plant Physiology 145,1619–1628. doi:10.1104/pp.107.109876

Comparot-Moss S, Denyer K (2009) The evolution of the starch biosyntheticpathway in cereals and other grasses. Journal of Experimental Botany60, 2481–2492. doi:10.1093/jxb/erp141

Coxon DT, Wright DJ (1985) Analysis of pea lipid content by gaschromatographic and microgravimetric methods. Genotype variation inlipid content and fatty acid composition. Journal of Agricultural andFood Chemistry 36, 847–856. doi:10.1002/jsfa.2740360914

DenyerK,Dunlap F, ThorbjornsenT,KeelingP, SmithAM(1996)Themajorform of ADP-glucose pyrophosphorylase in maize endosperm is extra-plastidial. Plant Physiology 112, 779–785. doi:10.1104/pp.112.2.779

Dickinson DB, Preiss J (1969) ADP glucose pyrophosphorylase from maizeendosperm. Archives of Biochemistry and Biophysics 130, 119–128.doi:10.1016/0003-9861(69)90017-4

DoanDNP,Rudi H,OlsenO-A (1999) The allosterically unregulated isoformof ADP-glucose pyrophosphorylase from barley endosperm is the mostlikely source of ADP-glucose incorporated into endosperm starch. PlantPhysiology 121, 965–975. doi:10.1104/pp.121.3.965

Giroux MJ, Hannah LC (1994) ADP-glucose pyrophosphorylase inshrunken-2 and brittle-2 mutants of maize. Molecular & GeneralGenetics 243, 400–408.

GirouxMJ, Boyer C, Feix G, Hannah LC (1994) Coordinated transcriptionalregulation of storage product genes in the maize endosperm. PlantPhysiology 106, 713–722.

Hirochika H (1997) Retrotransposons of rice: their regulation and use forgenome analysis. Plant Molecular Biology 35, 231–240. doi:10.1023/A:1005774705893

Hirose T, Ohdan T, Nakamura Y, Terao T (2006) Expression profiling ofgenes related to starch synthesis in rice leaf sheaths during the headingperiod. Physiologia Plantarum 128, 425–435. doi:10.1111/j.1399-3054.2006.00758.x

IshimaruK,TogawaE,OokawaT,KashiwagiT,MadokaY,HirotsuN (2008)New target for rice lodging resistance and its effect in a typhoon. Planta227, 601–609. doi:10.1007/s00425-007-0642-8

Johnson PE, Patron NJ, Bottrill AR, Dinges JR, Fahy BF, Parker ML, WaiteDN, Denyer K (2003) A low-starch barley mutant, Risø16, lacking thecytosolic small subunit of ADP-glucose pyrophosphorylase, reveals theimportance of the cytosolic isoform and the identity of the plastidial smallsubunit. Plant Physiology 131, 684–696. doi:10.1104/pp.013094

Kashiwagi T, Madoka Y, Hirotsu N, Ishimaru K (2006) Locus prl5 improveslodging resistance of rice by delaying senescence and increasingcarbohydrate reaccumulation. Plant Physiology and Biochemistry 44,152–157. doi:10.1016/j.plaphy.2006.02.004

Lee SK, Hwang SK, Han M, Eom JS, Kang HG, Han Y, Choi SB, Cho MH,Bhoo SH,AnG, Hahn TR, Okita TW, Jeon JS (2007) Identification of theADP-glucose pyrophosphorylase isoforms essential for starch synthesisin the leaf and seed endosperm of rice (Oryza sativa L.). Plant MolecularBiology 65, 531–546. doi:10.1007/s11103-007-9153-z

Nakano H, Makino A, Mae T (1995) Effects of panicle removal on thephotosynthetic characteristics of the flag leaf of rice plants during theripening stage. Plant & Cell Physiology 36, 653–659.

NakanoH,MakinoA,MaeT (1997)The effect of elevated partial pressures ofCO2 on the relationship between photosynthetic capacity andN content inrice leaves. Plant Physiology 115, 191–198.

Ohdan T, Francisco PB, Sawada T, Hirose T, Terao T, Satoh H, Nakamura Y(2005) Expression profiling of genes involved in starch synthesis insink and source organs of rice. Journal of Experimental Botany 56,3229–3244. doi:10.1093/jxb/eri292

A rice mutant with reduced culm starch content Functional Plant Biology 1077

Perez CM, Palmiano EP, Baun LC, Juliano BO (1971) Starch metabolism inthe leaf sheaths and culms of rice. Plant Physiology 47, 404–408.doi:10.1104/pp.47.3.404

Rösti S, Denyer K (2007) Two paralogous genes encoding small subunitsof ADP-glucose pyrophosphorylase in maize, Bt2 and L2, replace thesingle alternatively spliced gene found in other cereal species. Journalof Molecular Evolution 65, 316–327. doi:10.1007/s00239-007-9013-0

Rösti S, Rudi H, Rudi K, Opsahl-Sorteberg H-G, Fahy B, Denyer K (2006)The gene encoding the cytosolic small subunit of ADP-glucosepyrophosphorylase in barley endosperm also encodes the majorplastidial small subunit in the leaves. Journal of Experimental Botany57, 3619–3626. doi:10.1093/jxb/erl110

Rösti S, Fahy B, Denyer K (2007) A mutant of rice lacking the leaf largesubunit of ADP-glucose pyrophosphorylase has drastically reduced leafstarchcontent but growsnormally.FunctionalPlantBiology34, 480–489.doi:10.1071/FP06257

Salamone PR, Greene TW, Kavakli IH, Okita TW (2000) Isolation andcharacterization of a higher plant ADP-glucose pyrophosphorylasesmall subunit homotetramer. FEBS Letters 482, 113–118. doi:10.1016/S0014-5793(00)01985-2

Schnyder H (1992) The role of carbohydrate storage and redistribution inthe source-sink relations of wheat and barley during grain filling –

a review.NewPhytologist 123, 233–245. doi:10.1111/j.1469-8137.1993.tb03731.x

Sikka VK, Choi SB, Kavakli IH, Sakulsingharoj C, Gupta S, Ito H, Okita TW(2001) Subcellular compartmentation and allosteric regulation of therice endosperm ADPglucose pyrophosphorylase. Plant Science 161,461–468. doi:10.1016/S0168-9452(01)00431-9

Singletary G, Anderson PC, Coughlan SJ (2001) Patent assigned to PioneerHi-Bred International, Inc., Methods of producing high-oil seed bymodification of starch levels. US Patent no. 6 232 529 (The UnitedStates Patent and Trademark Office: Alexandria, Virginia).

Smidansky ED, Martin JM, Hannah LC, Fischer AM, Giroux MJ (2003)Seed yield and plant biomass increases in rice are conferred byderegulation of endosperm ADP-glucose pyrophosphorylase. Planta216, 656–664.

Smith AM, Bettey M, Bedford ID (1989) Evidence that the rb locus altersthe starch content of developing pea embryos through an effect onAGP glucose pyrophosphorylase. Plant Physiology 89, 1279–1284.doi:10.1104/pp.89.4.1279

Thorbjørnsen T, Villand P, Denyer K, Olsen OA, Smith AM (1996) Distinctisoforms of ADPglucose pyrophosphorylase occur inside and outside theamyloplasts in barley endosperm. The Plant Journal 10, 243–250.doi:10.1046/j.1365-313X.1996.10020243.x

Tsai CY, Nelson OE (1966) Starch-deficient maize mutant lacking adenosinediphosphate glucose pyrophosphorylase activity. Science 151, 341–343.doi:10.1126/science.151.3708.341

Watanabe Y, Nakamura Y, Ishii R (1997) Relationship between starchaccumulation and activities of the related enzymes in the leaf sheath asa temporary sink organ in rice (Oryza sativa). Australian Journal of PlantPhysiology 24, 563–569. doi:10.1071/PP96107

Yang J, Zhang J, Wang Z, Zhu Q (2001) Activities of starch hydrolyticenzymes and sucrose-phosphate synthase in the stems of rice subjected towater stress during grain filling. Journal of Experimental Botany 52,2169–2179.

Yoshida S (1972) Physiological aspects of grain yield. Annual Review ofPlant Physiology 23, 437–464. doi:10.1146/annurev.pp.23.060172.002253

1078 Functional Plant Biology F. R. Cook et al.

www.publish.csiro.au/journals/fpb