ABSTRACT - Aligarh Muslim Universityir.amu.ac.in/1455/1/T 6326.pdfChapter 1: Introduaion Chapter 2:...

ORAL CANCER IN TOBACCO AND BETEL NUT CHEWERS OF NORTHERN INDIA: CORRELATION WITH

INDUCED PROTEIN EXPRESSION

L ^ ABSTRACT

THESIS SUBMITTED FOR THE DEGREE OF

Doctor of Philosophy „ j i f '

BIOCHEMISTRY

M A N Z O O R A H M A D G A T O O

p i^^^ DEPARTMENT OF BIOCHEMISTRY

FACULTY OF MEDIC INE

JAWAHARLAL NEHRU MEDICAL COLLEGE

ALIGAHH M U S L I M UNIVERSITY

AL IGARH ( INDIA)

2008

Fed in Conipuief A \^

i

^ ^ ^ u n s i ^ . r-

,er( Of^' 'boy )'<)| ••

< ^ ^

vt?

. • TT-1 ri -rT.'

ABSTRACT

Cancer is one of the most dreaded diseases of mankind that causes alarming mortality and

morbidity in humans. It has long been evident that cancer has a multi-factorial

etiology and is a multi-stepped process involving initiation, promotion and tumor

progression. Chemical carcinogens, physical agents, ionizing radiation, viruses and

other agents have all been implicated, and clearly host factors are also involved,

mainly via an immunological and/or genetic basis. Cancer-predisposing genes may

act not only via immune surveillance systems affecting the host's ability to

recognize and eliminate incipient tumors, but also may affect the ability to repair

damage to DNA or might affect the rate of metabolism of pre-carcinogens or

carcinogens.

Oral cancer is sixth most common cancer worldwide and third most common cancer

in developing countries accounting for about up to 40% of all cancers. Incidence of

oral cancer is increasing day by day due to more intake of various forms of tobacco

and alcohol drinking, which are considered to be the two most important etiological

factors in the development of oral cancer. It is estimated that 75-90% of all head and

neck cancers are caused due to the tobacco use and tobacco users are between 20-40

times more likely to develop head and neck cancer than non consumers, depending

upon the amount of use as well as the age, sex and race of the user. Tobacco may be

taken in various ways like smoking, and chewing. The most common form of

tobacco chewing in India is betel quid. The 'quid' for chewing consists of areca nut

and pieces of unripe betel fruit or areca nut wrapped in a piece of betel leaf together

ABSTRACT 1

with white or red lime. Betel quid chewing has'a strong association with oral cancer

which arises predominantly from surface epithelium with evolution from early

premalignant lesions. Oral SCC arise as a consequence of multiple molecular events

induced by the effects of various carcinogens from habits such as areca nut and

betel quid chewing, influenced by environmental factors, possibly viruses in some

instances, against a background of inheritable resistance or susceptibility. An

individual difference in the susceptibility to chemical carcinogens is one of the most

important factors in the estimate of risk of human cancer as some patients appear

susceptible because of inherited trait(s) in their ability or inability to metabolize

carcinogens or pro-carcinogens, possibly along with an impaired ability to repair

DNA damage. Oral carcinogenesis is a multi step process in which 6-10 genetic

events lead to the disruption of the normal regulatory pathways that control basic

cellular functions. In recent years, several alterations in the expression of tumor

suppressor genes and oncogenes in the development of Oral Squamous Cell

Carcinoma (OSCC) have been described. Keeping in view above facts, the present

study was done to investigate the expression of p53 (product of tumor suppressor

gene) and cyclin Dl (product of cell cycle regulator gene) as well as to the

determine the frequency of polymorphism in DNA repair enzymes hOGGl, XRCCI

and }ienobiotic metabolizing enzyme CYP2E1 in oral carcinoma patients with

tobacco and betelquid chewing habit.

The present study comprised of 250 human subjects with 100 oral cancer patients

and 150 controls. Biopsy specimens were taken from 60 patients and 10 controls for

ABSTRACT 2

p53 and Cyclin Dl expression studies. Blood samples were collected from all the

subjects for gene polymorphism studies. Immunohistochemistry was done to study

the protein expression studies. For gene polymorphism studies, DNA was isolated

from blood samples and quantified by agarose gel electrophoresis. Genotyping of DNA

repair genes (hOGGI Ser ^ Cys and XRCCI Arg^*°His) and xenobiotic metabolizing gene

(CYP2E1 Rsal and Dral sites) was performed using PCR-RFLP technique. For statistical

analysis, computer programme SPSS (version 13) was used.

In the present study, out of the total 100 patients studied, 75 patients (75%) were

males and majority of patients were in 50-75 age group and complained of

dysphagia.The most common site of incidence of oral cancer in tobacco and betel

quid chewers was buccal mucosa.

It was found that there was no p53 or Cyclin Dl expression in normal tissues while

in oral SCC patients with tobacco and betel quid chewing habit, the percentage of

positive cases as well as p53 or Cyclin Dl positivity showed an increase with

increasing grade of SCC. The expression of p53 was significantly associated with

histological grade in oral cancer in tobacco and betel quid chewers while no such

association was found between Cyclin Dl expression and histological grade.

Statistically significant difference was observed in Cyclin Dl positivity between

well differentiated SCC and moderately differentiated SCC as well as between well

differentiated SCC and poorly differentiated SCC. Similarly significant difference

in Cyclin Dl positivity was observed between moderately differentiated SCC and

ABSTRACT

poorly differentiated SCC but in case of p53 expression, statistically significant

difference in p53 positivity was observed only on comparing well differentiated

SCC with poorly differentiated SCC.

Expression of oncoproteins was not similar in different sites of oral cavity. p53

expression was more frequently seen in gingivia, floor of mouth, tongue, and buccal

mucosa while Cyclin Dl expression was more frequently seen in hard palate, buccal

mucosa and lip.

The polymorphism studies of DNA repair genes (XRCCI Arg^^^His and hOGGI

Ser ^ Cys) and xenobiotic metabolizing gene (CYP2E1 Dral and Rsal sites) revealed that

these polymorphisms were significantly associated with risk of oral cancer in tobacco and

betel quid chewers. The individuals with variant XRCCI Arg^ °His and hOGGI Ser ^ Cys

genotypes were at increased risk of oral cancer as compared to individuals having wild

type homozygous genotypes. Thus XRCCI Arg^ °His and hOGGI Ser ^ Cys

polymorphisms lower DNA repair ability in tobacco and betel quid chewers which results

in increase in risk of oral cancer in this epidemiologically distinct population. The

individuals with the variant genotype of xenobiotic metabolizing gene (CYP2E1 Rsal

and Dral sites) were at increased risk of oral cancer as compared to individuals having

wild type genotypes thus supporting the hypothesis that environmental exposure to the

carcinogens plays an important role in the etiology of oral cancer.

ABSTRACT

In conclusion, it was found that there was over expression of tumor suppressor gene

product, p53 and cell cycle regulator gene product, cyclin Dl in oral SCC patients from

northern India with tobacco and betel quid chewing habit. It was also observed that

XRCCI Arg^*°His, hOGGI Ser ^ ^Cys, CYP2E1 Oral and CYP2E1 Rsal polymorphisms

were closely associated with high risk of oral cancer in this epidemiologically distinct

population.

ABSTRACT

* 3

ORAL CANCER IN TOBACCO AND BETEL NUT CHEWERS OF NORTHERN INDIA : CORRELATION WITH

INDUCED PROTEIN EXPRESSION

îifiSlS

THESIS SUBMITTED FOR THE DEGREE OF

Doctor of Philosophy IN

BIOCHEiVIISTRY "v

BY

M A N Z O O R A H M A D G A T O O

t: r-

F:1 -.^ u\, Sji .,

DEPARTMENT OF BIOCHEMISTRY FACULTY OF MEDICINE

JAWAHARLAL NEHRU MEDICAL COLLEGE ALIGARH MUSLIM UNIVERSITY

ALIGARH (INDIA)

2008

( . ' • ^ & \

Fed in Coinpu»e»

^"îiî^r

S ^ 't ^

T6326

^ sis

Dedicated To My

Parents & Brothers

L '

DEPARTMENT OF BIOCHEMISTRY

JAWAHARLAL NEHRU MEDICAL COLLEGE

ALIGARH MUSLIM UNIVERSITY

ALIGARH

CERTIFICATE

This is to certify that the thesis entitled "Oral cancer In tobacco and betel

nut chewers of northern India: Correlation with induced protein

expression'' is a bonafide work of Mr. Manzoor Ahmad Gatoo for the

degree of Ph. D in Biochemistry. The study has been carried out by the

candidate himself, under our supervision and guidance. The techniques and

observations embodied in this thesis have been checked by us at every

stage. The work is original in nature and is suitable for the award of Ph. D in

Biochemistry.

-B I.U. SIddlqui, Ph. D M. Owais, Ph. D

Supervisor Co-Supervisor Reader Senior Lecturer Department of Biochemistry Interdisciplinary Biotechnology Unit JNMC, Aligarh Muslim University Aligarh Muslim University Aligarh 202 002 Aligarh 202 002

CONTENTS

Acknowledgement

List of Tables

List of Figures

Chapter 1: Introduaion

Chapter 2: Literature Review

Chapter 3: Material and Methods

Chapter 4: Observation

Chapter 5: Discussion

Chapter 6: Summary and Conclusions

References

Appendix 1

^v^?>^^

1

III

IV

1-12

13-60

61-71

72-96

97-119

120 -124

125-155

156 -157

JLCK^<yWL<E<DgEM'E^

In the name ofÛak, the (Beneficent the MerdfuC.

Tirst and foremost all praise is due to Mâh, the Cord of the worCds, the (Beneficent, the Mercifui

SureCy, "Ke is ever aware of seeing his servants. I am paying ad my thanl^s to JlCmighty JiCM who

enaSkdme to complete this wor^successfuCCy.

I express my deepest appreciations and sincere gratitude to my supervisor, (DrMashiatudah Siddiqui,

(Reader, (Department of (Biochemistry, JawaharkC9/ehni MedicaC CoQege for his effective guidance,

encouragement, and unstinted support throughout my research wor^

I express my speciaf and sincere gratitude to my co-supervisor and mentor (Dr. Mohammad Owais,

senior kcturer, interdisciplinary biotechnology unit, who inspired and guided me with his lên

oBservation and amazing perspicacity throughout my research. "Without his guidance and motivation

at every step, this thesis might never have Been come into shape. In actual words, he is a true mentor. I

am etemaffy gratefuf to him for giving me constant encouragement and showing great optimism and

faith in my abilities.

I am highly indebted to (professor Jisifjlli, Chairman, (Department of (Biochemistry, JawaharlddN'ehru

Medical College, ^ligarh Muslim University, Jiligarhfor his support and cooperation in every possible

way.

I would li^ to express thanl{s to the (Professor Zafar 7{ussain (Baig, (DrShagufta Moin, (Dr. %ajmul

islam, (Dr.Jibulfaizi, (Dr. 'Kfiursheed, (Dr. Moinuddin (Department of (Biochemistry, Jawaharldl Jiehru

Medical College, Jiligarh Muslim Vniversity, JiGgarh for all time help during my research worl{.

Thanl^s to my friends and well wishers for their moral support, care and concern. I would be failing in

my duty if I do not express my thanl{s to (Dr.Javidwho not only inspired and helped me during whok

research wor^but also gave me valuable suggestions whenever I required them. Specialthan^ to my

close friend (Dr. !Nisar, (Department of T.Oft, JawaharCaC !Nehru MedicaC CoSege, JiCigarh MusCim

'University, Jlligarhfor helping me in getting samples of oral cancer for conducting this study and for

lieeping aCC the hamstrings and scions in order while drafting this wor^ Jfis support has been a

constant source of inspiration for me throughout my academic career. Special than^ to Mr. Tanweer,

Mr (BiCaC and Mr. ghutam Mohammad ^therfor their cooperation and for heCping in statistical

analysis and proof reading of the manuscript. I also than^my friends Mr. Musharaf Mr. <Kehan, Mr.

Vmar Shaft, Mr.Ji.mir, Mr. Safman, Mr Mushôr, Mr. 'KflCeem, Mr Jahengeer, Mr Showliet

(Bhawanii, Mr. %fianday, Mr JLzhar (Rather, Mr Zahoor, Mr Hamidullah, Mr (Parvez, Mr (Bilal,

Mr Zubair, Mr, Aman, Mr Tariq, Mr 'Ehthesam, Mr Jishfaq, Mr Ashiq, Mr Shoeb, Mr 'Faizy,

Mr Ijaz, Mr Shahid, Mr Sajad and all my room partners during my stay at S.S. South. I am

than^f to my kb colleagues nameCy Mr Suhai[, Mr Javid, Mr Irfan, Mr Tihushnod, Miss

Hamida, Miss. !Nazia, Mr (Rpshan, Miss. Saba, Miss Zeshan and all stajf members of my department

http://Mr.Ji.mir

for their nd behaviour and cooperation. I may not remember the names of ad the persons who in one or other-way heCpedme during my studies But I am thanlifuCto them and am oBRgedto aCCofthem.

My thanlis and appreciations are also due to the typist Mr. JiZM>, (ALL mo:m C094.(FiKm^) who has done the typing wor^with patience, utmost interest and care.

Tinaffy I wouCd Se failing in my duty if I do not place at record the help and encouragement which I got from my parents and my Brothers, MohammadJlmin and IftilârAhmad who stood firmly By me during the most difficult moments, and never allowed me to give up. 'Without their prayers, mentoring advice and even admonishments this accomplishment would have Been impossiSle.

(ManzoorAHmad gatoo)

List of Tables

Table 2.1

Table 2.2

Table 2.3

Table 2.4

Table 2.5

Table 2.6

Table 3.1

Table 4.1

Table 4.2

Table 4.3

Table 4.4

Table 4.5

T^ble 4.6

Table 4.7

Table 4.8

Table 4.9

Table 4.10

Table 4.11

Table 4.12

Table 4.13

Table 4.14

Table 4.15

Stage Grouping (TNM, 2002)

Worldwide incidences of oral cancer (Incidence rates)

Worldwide incidences of oral cancer (Mortality rates)

Relative incidences of oral cancer in different parts in India

Incidence of oral cancer in different sites of oral cavity recorded in India

Incidences of oral cancer in different sex groups in India

Primer Sequences used in the PCR-RFLP of HOGG I, XRCCl, CYP2E1, Rsal andDral genotyping

Occurrence of oral cancer in different age group of patients

Number and percentage of patients in different sex groups

Mean age of patients in different sex groups

Duration of initial presentation of clinical symptoms by patients

Number of cases showing occurrence of different symptoms

Chi square values of tobacco and betel quid in oral cancer patients

Exposure of tobacco and betel quid in oral cancer patient and controls to calculate x2 values

The incidence of oral cancer in different sites of oral cavity

Distribution of oral cancer lesion in different histological types

p53 Expression in oral SCC's in tobacco and betel quid chewers

Cyclin Dl Expression in oral SCC's in tobacco and betel quid chewers

Distribution of XRCCI codon 280 genotypes in oral cancer patients

Distribution of hOGGl codon 326 genotypes in oral cancer patients

Distribution of CYP2E1 Rsal genotypes in oral cancer patients

Distribution of CYP2E1 Dral genotypes in oral cancer patients

20

23

24

25

26

27

70

72

73

73

74

75

75

76

77

78

80

84

89

90

92

94

III

List of Figures

Representative figure showing expression of p53 in normal _„ ° tissue

„ Representative figure showing expression of p53 in well 79 '^ ^ differentiated oral squamous cell carcinoma

„ Representative figure showing expression of p53 in moderately _Q •gure differentiated oral squamous cell carcinoma

, ^ Representative figure showing expression of p53 in poorly 79 •gure differentiated oral squamous cell carcinoma

Expression of p53 in oral SSC's in tobacco and betel quid 81 ^ chewers in different histological grades

Representative figure showing expression of Cycl in Dl in „-Figure 3A * , .. o3

^ normal tissue „ Representati ve figure showing expression of Cycl in Dl in well ^^

igure differentiated oral squamous cell carcinoma „ Representative figure showing expression of CyclinDl in „_

'gure moderately differentiated oral squamous cell carcinoma

- „ Representative figure showing expression of CyclinDl in „-' "' ^ poorly differentiated oral squamous cell carcinoma

Expression of CyclinDl in oral SSC's in tobacco and betel quid 84 ^ chewers in different histological grades

Figure 5 Representative Gel of DNA isolated from oral cancer patients 87

Representative Gel ofPCR-RFLP analysis of XRCC1/280 „„ Figure 6 J . , .. . o6

* codon in oral cancer patients Representative Gel ofPCR-RFLP analysis of hOGG 1/326 „,

Figure? J • 1 ^- J. 91 ^ codon m oral cancer patients

Representative Gel of PCR-RFLP analysis of CYP2E1/Rsal in 93 Figure 8 , ,. ,

" oral cancer patients Representative Gel of PCR-RFLP analysis of CYP2E1 /Dra 1 in 96

Figure 9 , . ^ ° oral cancer patients

iv

CHAPTER 1 INTRODUCTION

About thirty three years ago, US President Richard Nixon declared the "war on

cancer" in 1974 with the hope and anticipation that death from cancer might be

greatly reduced by the end of last century. In spite of advances in cancer research

and treatment, it still remained a major global health issue. In 2000, cancer

accounted for over 7 million deaths and there were more than 10 million new

cases worldwide by the end of new millennium (Shibuya et ai, 2002). According

to report of American Cancer Society on cancer statistics, cancers of the lung,

prostrate, colon and rectum in men and cancers of the lung, breast, colon and

rectum in women continue to be the most common causes of cancer deaths

(Jemal et al, 2002). These four types of cancer account for more than half of

total cancer deaths among men and women.

Carcinogenesis is a complex, multi-step process in which signal transduction

pathways involved in various normal cellular physiology are quantitatively or

qualitatively altered (Vogelstein and Kinzler, 1993). Under normal conditions,

these tightly controlled excitatory or inhibitory pathways regulate cellular

functions like cell division, differentiation and senescence.

Although the cellular pathway of different types of cancers may be diverse, they

contain the same fundamental elements. An extra cellular ligand, such as a

growth factor binds to a cell surface receptor. The receptor-ligand complex

generates excitatory or inhibitory signals, sent through intracellular and nuclear

messengers that can either directly alter cell function or can stimulate the

transcription of genes whose proteins effect change (Bishop, 1991). Cancer is the

CHAPTER 1: INTRODUCTION 1

result of accumulation of changes in the excitatory or inhibitory cellular

pathways that can occur at any level of a given pathway. As the cell collects

these alterations or mutations; it becomes functionally independent from the

surrounding cells. The normal cellular functions tightly controlled by the

stimulatory and inhibitory pathways are subverted in the tumor cell, allowing it

to divide more rapidly, sequester blood vessels to feed that growth, delete or

amplify signals to produce abnormal structural or functional changes, and invade

normal tissue at local or distant sites (Weiner and Cance, 1994).

It has long been evident that cancer has a multi-factorial etiology and is a multi-

stepped process involving initiation, promotion and tumor progression. Chemical

carcinogens, physical agents, ionizing radiation, viruses and other agents have all

been implicated, and clearly host factors are also involved, mainly via an

immunological and/or genetic basis. Cancer-predisposing genes may not act only

via immune surveillance systems affecting the host's ability to recognize and

eliminate incipient tumors, but also may affect the ability to repair damage to

DNA or might affect the rate of metabolism of pre-carcinogens or carcinogens.

According to famous British pathologist, R. A. Wills (1960), tumor can be

defined as, "An abnormal mass of tissue, the growth of which is in excess and

uncoordinated with the normal tissue and persists in the same excessive manner,

even after the cessation of the stimuli that evoked the change." The six major

alterations in cell physiology that collectively dictate malignant growth

(Hanahan and Weinberg, 2000) are:-

Self-Sufficient in growth signals


Insensitivity to growth inhibitor signals

Evasion of apoptosis (programmed cell death)

Limitless replicative potentials

Sustained angiogenesis and adjoining tissue invasion

Metastasis

Each of these physiological changes acquired during tumor development

represent the successful breaching of an anticancer defense mechanism. These

six features are shared in common by most types of human and animal tumors.

Cancer may be caused by a variety of causative factors, usually over a period of

many years. Many specific causes of cancer are now known, the most important

being difference in lifestyle, occupational exposure and exposure to oncogenic

viruses, but a large proportion of global variation for human cancers remains still

unexplained. The known risk factors for cancer can be broadly divided into

'Environmental' and 'Host factors'. Environmental factors can be further

subdivided into "chemical, physical and biological".

In this era of modernization and technology, large numbers of chemicals enter

into our environment through occupational exposure, automobile exhausts,

pesticides, industrial wastes and contamination of food and water. These

chemicals exist in the environment in a relatively stable condition until taken in

by an exposed individual and activated. Thus, these chemicals appear to pose a

great concern and threat to man. Polycyclic Aromatic Hydrocarbons (PAH),

nitrosamines, mycotoxins, pesticides and metallic contaminants such as arsenic


and cadmium are some of xenobiotics that can enter in our food chain during

processing, storage, preservation and cooking. According to International

Agency for Research on Cancer (lARC), now there are about 88 chemicals, with

sufficient evidences of carcinogenic potential in humans (lARC, 1994). Physical

agents such as ultra-violet rays (UV) and the ionizing radiations (X-rays,

gamma-rays) are known to be hazardous in nearly all tissues or organs of human

or experimental animals depending upon the radiation dose and exposure

schedule (lARC, 1992).The scenario is becoming alarming with the application

of nuclear technology in science, medicine, and industries and expanding use of

these radiations in diagnosis and therapy of the disease itself (Trichopoulos et

al. 1996).

Biological agents, such as retroviruses, bacteria and parasitic infections, the

oncogenic viruses such as papillomas-viruses, feline-leukemia viruses and

bovine -leukosis virus are linked with increased incidence of various types of

neoplasia. The Epstein-Barr virus has shown to be implicated with the

occurrence of Burkitt's lymphomas, Hodgkin and non -Hodgkin lymphoma and

pharyngeal carcinoma (Cordova Perez et al, 2003; Young and Murray, 2003).

Certain bacteria like Helicobacter pylori are also implicated in the development

of cervical, esophageal, head, neck and stomach cancer (Peto, 2001).

Various factors that can play crucial role in establishment of cancer are host

(internal) factors comprised of hormonal disturbances, immune functions and

inherited predisposition to certain cancers. The genetic manipulations such as

activation of cellular proto-oncogenes and alterations in tumor suppressor genes

aaaaaBaBSBaaBBBasBBaaaKSKaBSBiiBSBaaaaaBBBaBaaaBaaaa^ CHAPTER 1: INTRODUCTION 4

also result in aberrant proliferation of cells (Ames et al, 1995; Peto et ai, 2001).

Many cancer chemotherapeutic drugs, particularly vinca alkaloids, alkylating

agents, immunosuppressive agents and certain cyclosporins are also reported to

increase the cancer risk. (Ames et al, 1995; Trichopoulos et al, 1996;

Chauvenet et al, 2003).

Besides, the choice of lifestyle and habits such as tobacco, smoking and

chewing, high alcohol intake, high fat diet and dietary habits, are also thought to

initiate or promote various forms of cancers (lARC, 1993). About 40-60 percent

of all cancers are related to our food choices and about one third of all cancer

deaths may be related to what we eat. Besides diets high in fat, low in fiber,

vitamins, fruits, vegetables, over weight and obesity, lack of physical activity etc

have been associated with increased incidences of cancer (La Vechia et al,

1993; Rajkumar et al, 2003). Thus most of the prevalent human cancers to a

significant extent can be prevented and many could be avoided by a suitable

choice of lifestyle, diet and environment.

Carcinogenic risk from exposure to exogenous chemical carcinogens depend not

only on the intrinsic nature and dose of each chemical, but also may depend on

inter-individual variability in sensitivity to the carcinogens. An individual

difference in the susceptibility to chemical carcinogens is one of the most

important factors in the estimate of risk of human cancer (Clapper ML, 2000).

Oral cancer is sixth most common cancer worldwide and third most common

cancer in developing countries accounting for about up to 40% of all cancers


(Parkin SM et al, 1988). Oral cancer includes cancer of lip, tongue, buccal

mucosa, vestibule, gingiva, palate and floor of mouth and tongue being most

common site for both males and females (Johnson NW et al, 1993; Park BZ et

al., 1998). Oral cancer incidence increases with age and its rate varies widely

throughout the world. India and South East Asian countries have highest rate of

incidence of oral cancer while developed countries have low incidence rate of

oral cancer. Incidence of oral cancer is increasing day by day due to more intake

of various forms of tobacco and alcohol, which are considered to be the two most

important etiological factors in the development of oral cancer. It is estimated

that 75-90% of all head and neck cancers are caused due to the use of tobacco

which includes cigarettes, pipes, cigars and smokeless tobacco (chew, dip, snuff,

betel quid and areca nut). Tobacco users are between 20-40 times more likely to

develop head and neck cancer than non consumers, depending upon the amount

of use as well as the age, sex and race of the user (La Vechia C et al., 1997;

Cawson RA et al, 1996; Graham S et al, 1997).

Tobacco smoke consists of more than thirty different carcinogenic compounds

particularly nitrosamines and polycyclic aromatic hydrocarbons. Alcohol and

tobacco act independently of one another to raise the relative risk of oral cancer

(Elwood et al, 1984). In joint exposure risk, alcohol acts synergistically with

tobacco (Notani et al, 1988; Sankaranarayanan et al, 1989, 1990). Oral cancer

risk is related to these etiological factors by qualitative as well as quantitative

point of view. It depends upon the duration of intake, age of onset, time since

quitting, amount and type of tobacco and alcohol taken. Risk is also related to

the demographic, cultural, socio- educational, occupational, dietary differences.


oral hygiene, compromised dentition and ionizing radiations (Notani 1988;

Nandakumar et al, 1990; Hebert et al, 1993; Balaram et al, 2002).

Tobacco may be taken in various ways like smoking and chewing. Tobacco may

be smoked in the form of manufactured cigarettes or indigenous forms like Bedi,

Chutta (Agra), Chilum, Hooka (hubble-bubble) and pipe etc. There is strong

dose-response relationship between tobacco intake and incidence of oral cancer.

The most common form of tobacco chewing in India and Taiwan is betel quid.

The 'Quid' for chewing consists of areca nut and pieces of unripe betel fruit or

areca nut wrapped in a piece of betel leaf together with white or red lime. Betel

quid chewing has a strong association with oral cancer which arises

predominantly from surface epithelium with evolution from early premalignant

lesions. The preneoplastic lesion may exist for years before invasion, and may

behave persistently and progressively after abstinenance from betel quid

chewing. In Taiwan, there are about 2 million people who are suffering from the

habit of betel quid chewing and approximately 80% of all oral cancer deaths are

associated with this habit (Kuo et al, 1999).

The consumption of alcohol is linked to development of cancer in upper

acrodigestive tract particularly the oral cavity and oropharynx. The exact

mechanism is unclear but it is thought to be that due to a combination of local

toxic effects on the mucosa and systemic effects from the associated dietary

deficiency, hepatic damage and possible alteration in the patient's immunity.

Infection agents have also been implicated as possible causes of cancer in the

oral cavity like Treponema Pallidum, Human Papilloma Virus and Candida


albicans (Crispian Scully 1993). So there may be multiple etiological factors

which play significant role in the development of oral cancer. In 1944, Willis

stated that when carcinogenic stimuli affect epithelial tissue, all the epithelium in

that area is affected similarly, but not necessarily equally. A neoplasm, therefore,

is more likely to develop in tissue in which the stimuli have been maximal;

however, similar neoplastic change may occur at a later stage in adjacent tissue

that was exposed to the same carcinogen. The mucosa of the upper aero digestive

tract should, therefore, be regarded as a field of growth that is constantly being

bathed by the carcinogens and therefore will potentially have numerous areas of

malignant and early malignant change. Early symptoms of oral cancer include

persistent mouth ulcers (frequently painless), warty lumps and nodules, white

red, speckled or pigmented lesions, recent onset of difficulty with speaking or

swallowing and enlarged neck nodes. Any new oral lesion that persists longer

than 3 weeks should be referred for a specialist opinion and also

histopathological examination.

Incidences of oral cancer are very high in India and South East Asian countries

in comparison to the western countries (lARC, 2002). Unlike in the west, most of

the oral cancers seen in India, are preceded by distinct premalignant lesions such

as leukoplakia and sub mucous fibrosis. The incidence of oral cancer is affected

by age of the person, sex, site of cancer, religion, diet, tobacco and alcohol

intake (Nandakumar et al, 1990; BaJaram et al, 2002). Incidence of oral cancer

increases with age and shows steep rise in the age group of 60 to 64. Oral cancer

is more frequent in males than females with gender ratio between 2:1 to 6:1. The

most usual site of incidence of oral cancer is tongue followed by floor of mouth.

CHAPTER 1: INTRODUCTION

Risk of oral cancer increases with increased use of alcohol and tobacco in its

various forms. The effect of these factors have been studied by various

researchers (Znaor et al, 2003; Jayant K. et ai, 1987; Sankaranarayanan R. et

al, 1990; Balaram P. et al, 2002 ). In this study, we analyzed the incidence of

sex, age and site of cancer in oral cancer patients with tobacco and betel quid

chewing habit in northern India. We also analyzed the relation of tobacco and

betel quid chewing with oral cancer.

Oral carcinogenesis is a multi step process in which 6-10 genetic events lead to

the disruption of the normal regulatory pathways that control basic cellular

functions (Vogelstein and Kinzler, 1993). In recent years, several alterations in

the expression of tumor suppressor genes and oncogenes in the development of

oral squamous cell carcinoma (OSCC) have been described (Williams HK et al,

2000; Michalides. RJAM, 1999). Regular exposure of the oral cavity to betel

quid and areca nut induces "field cancerization" involving initiation of different

changes in the cellular DNA. Advances in the field of tumor suppressor genes

and oncogenes have provided a tool to study the genetic changes occurring at

different stages of carcinogenesis. In the present study, an attempt was made to

investigate the expression of p53 and Cyclin Dl in tobacco and betel quid related

oral SCC's in northern India.

The ability to metabolize carcinogens or pro-carcinogens, repair DNA damage,

and control cell signaling and the cell cycle are fundamental to homeostasis.

OSCC, under appropriate exposure to areca nut and betel quid, arise if these

mechanisms are defective. Oral SCC arise as a consequence of multiple

CHAPTER 1: INTRODUCTION

molecular events induced by the effect of various carcinogens from habits such

as tobacco and betel quid chewing, influenced by environmental factors, possibly

viruses in some instances, against a background of inheritable resistance or

susceptibility. Consequent genetic damage may affect many chromosomes and

genes, and it is the accumulation of these changes that may lead to carcinoma in

some instances, sometimes via a clinically evident pre-malignant or potentially

malignant lesion (Field, 1992; Yokes et al, 1993). Although lifestyle factors

play an important role in etiology, some patients appear susceptible because of

inherited trait(s) in their ability or inability to metabolize carcinogens or pro-

carcinogens, possibly along with an impaired ability to repair DNA damage. The

characterization of genetic determinants for oral cancer susceptibility is

important for understanding the disease pathogenesis and for defining preventive

measures. There is growing evidence that a group of predisposing polymorphic

genes exists, such as those involved in carcinogen metabolism, which may

increase cancer incidence in certain environmentally exposed subjects, even

when exposed only to low levels of carcinogens. Within preventive strategies, it

is therefore necessary to identify these vulnerable members in our society, in

particular those suffering from an unfavorable combination of high carcinogen

exposure, cancer predisposing genes, and lack of protective (dietary) factors.

Thus, molecular epidemiology faces the difficult task of analyzing carcinogen

exposed individuals for a combination of "at risk" genotypes associated with

higher cancer susceptibility. Rather than taking cancer as an end point,

combinations of cancer predisposing genes can then be explored to better define

gene environmental interactions and provide knowledge that should facilitate the

identification of high risk subjects within carcinogen exposed population. Thus,


by identifying the "at risk" genotype combinations that may serve as markers, it

is possible to identify susceptible consumers of tobacco and chewing products

who are at risk for developing pre-cancerous lesions in a population based study.

In view of the rapid upsurge in the incidence of oral precancerous lesions, in

both genders and high risk of transition to malignancy, there is urgent need to

determine the relationship between polymorphisms in cancer susceptibility genes

and risk of developing tobacco related oral precancerous lesions and cancers.

The study will also help in understanding the mechanism underlying

pathogenesis of the disease and aid in identifying markers for predicting high

risk population.

An individual difference in the susceptibility to chemical carcinogens is one of

the most important factors in estimate of risk of oral cancer. Most chemical

carcinogens require metabolic activation by phase I enzymes (Cytochromes P-

450) and detoxification by conjugation via the various phase II enzymes

(epoxide hydrolase, glutathione S-transferase, N-acetyl transferase, sulfur

transferase etc) (Ernster et al, 1991). Thus, the coordinate expression and

regulation of phase I and phase II drug metabolizing enzymes and their

metabolic balance may be an important host factor in determining whether

exposure to carcinogen results in cancer or not (Idle et al, 1991). At present, it is

accepted that most of the carcinogens in our environment are activated mainly by

restricted number of P-450 species, including CYPIAl, CYPIA2. CYP2E1 and

CYP3A (Guengerich et al., 1991; Kawajiri et al, 1991).CYP2EI polymorphism.


has been associated with an increased risk for tobacco related diseases such as

lung cancer.

Various cellular metabolic processes result in the formation of hydroxyl radicals

that can cause oxidative damage to DNA (Demple B et al, 1994). This damage

often results in single base changes that can be reversed by Base Excision Repair

(BER) mechanism (Lindahl T et al, 1999). hOGGI and XRCCI are two of

enzymes participating in the BER pathway, DNA repair system involved in the

repair of damage resultant from oxidative stress. The enzyme hOGGI can

recognize and excise OH-8-Gua, the major form of oxidative DNA damage

induced by reactive free radicals (Burner S.D et al, 2000). XRCCI complexes

with DNA polymerase via the NH2 terminus domain and with DNA ligase 111

via a blue ribbon commission on transportation (BRCT) domain to repair nicks

or gaps left in the BER pathway (Nash R.A. et al, 1997). XRCCI has also been

shown to be involved in the detection of single strand breaks between incision

and ligation, and effect that likely occurs via poly (ADP-ribose) polymerase

dependent and poly (ADP-ribose) polymerase-independent mechanisms (Masson

M et al, 1998). Genetic polymorphisms of DNA repair genes have been reported

to determine susceptibility to several cancers including lung, esophageal, bladder

and nonmelanoma skin cancers (Perera FP. 1996). The aim of present study is to

determine the frequency of polymorphism in DNA repair enzymes hOGGl,

XRCCI and xenobiotic metabolizing enzyme CYP2E1 in relation to tobacco and

betel quid chewing that may serve as markers to identify individuals susceptible

to develop oral cancer.


CHAPTER 2 LITERATURE REVIEW

Definition

The term "oral" includes the lips and all intra-oral sites corresponding to the ICD9 codes;

140 (lip), 141 (tongue), 143 (gum), 144 (floor of mouth) and 145 (other non-specific

sites), but excludes sites 142 (major salivary glands), 146 (oropharynx), 147

(nasopharynx), 148 (hypopharynx) and 149 (ill defined oral/oropharynx) (Johnson NW et

al, 1993). Approximately 90% of oral cancers are primary squamous cell carcinomas

arising from the lining mucosa of the mouth, most commonly the tongue and the floor of

the mouth (Park BZe/o/., 1998; Johnson NWeM/., 1993).

Histopathology of Oral Cancer

The development of oral cancer seems to begin in many cases with exposure of the

mucosal surfaces of the upper aerodigestive tract to topical carcinogens, predominantly

alcohol and tobacco (Blot WJ et al, 1988; Nam J et al. 1992; Yokes EE et al, 1993;

Million RP et al, 1993). In some persons upon exposure to these carcinogens or co-

carcinogens, there develop premalignant and malignant lesions in a multi-step process

within the mucosa (Lippman SM et al, 1990; Brachman DG et al, 1994). However, oral

cancers occur in some patients with no history of tobacco or alcohol usage and no other

apparent risk factors. Additionally, it is not clear whether all of the tumors have an

apparent "precancerous" state.

The earliest detectable morphologic changes are the appearance of the "premalignant"

lesions of leukoplakia and erythroplakia (Waldron CA et al, 1975; Skhlar G et al, 1986;

CHAPTER 2: LITERATURE REVIEW 13

Hansen LS et al, 1995). Leukoplakia is a white plaque that cannot be removed by gentle

scraping and for which no other etiology can be identified. Microscopically, leukoplakias

exhibit hyperplasia of keratinocytes, as represented by hyperorthokeratosis,

hyperparakeratosis, and/ or acanthosis.

The term dysplasia is reserved for lesions showing combinations and degrees of cytologic

atypia (e.g., hyperchromatism, increased nuclear size, pleomorphism, dyskeratosis, and

increased or abnormal mitotic figures) (Skhlar et al, 1986; Yokes et al, 1993). Atypia

confined to basilar and parabasilar keratinocytes constitutes mild dysplasia, whereas

atypia extending into the midspinous layers is termed moderate dysplasia. When cellular

atypia extends to the surface layer, the terms severe dysplaisa and carcinoma in situ

(complete top-to-bottom cytological atypia) are applied. Architectural changes are also a

feature of dysplasia, the most significant being a bulbous or teardrop shape of rete ridges.

For oral mucosa in general, up to 20% of clinically defined leukoplakias that are biopsied

may exhibit dysplasia while lesions located in the floor of the mouth approach a 40%

prevalence of dysplastic change (Waldron CA et al, 1975). Dysplastic leukplakias have a

high propensity to progress to invasive squamous cell carcinoma. However, leukoplakias

without evidence of dysplastic changes may progress to dysplasia and subsequently to

carcinoma, whereas many leukoplakias fail to undergo malignant transformation (Mincer

HH, 1972; Silverman S Jr, 1984).

Erythroplakia is a velvety red patch of oral mucosa that does not conform to other

defined oral disease processes. There is a high prevalence of dysplastic changes among


these lesions, approaching 80-90%, and progression to invasive carcinoma is high (Shafer

WG, 1975; Yokes EE et al, 1993; Million PP et al, 1993). Although dysplastic, the

epithelium is usually atrophic, and submucosal vasodilation with inflammatory cell

infiltration is a consistent finding. When erythroplakias coexist with white foci, they are

termed speckled leukoplakias or erythroleukoplakias and such lesions exhibit

hyperkeratosis in the white areas.

Malignancies arising from the mucosa of the oral cavity are epithelial in origin and are,

therefore, classified as squamous cell carcinomas more than 90% of the time (Zarbo RJ et

al, 1988; Silverman S Jr et al, 1990). According to the degree of differentiation, three

subtypes are defined: (1) well-differentiated squamous cell carcinoma showing more than

75% keratinization; (2) moderately differentiated squamous cell carcinoma with 25%-

75% keratinization; and (3) poorly differentiated squamous cell carcinoma with less than

25% keratinization (Million RP et al, 1993; Yokes EE et al, 1993). A clear relationship

between histologic differentiation and clinical prognosis has not been established,

although a lack of differentiation has been associated with more rapid growth and spread.

The morphologic classification of squamous cell carcinoma by degree of differentiation

is used in the description of the histopathologic specimen.

There are histopathologic variants of squamous cell carcinoma, all of which are rare, that

affect prognosis and the selection of therapeutic modalities. Spindle cell or sarcomatoid

squamous cancers, occasionally found in the oral cavity, are most frequently encountered

on the lip and in the larynx. Radiation therapy to a pre-existing conventional squamous


cell carcinoma is a common antecedent event; however, spindle cell carcinomas my arise

de novo (Ellis GL et al, 1980). Other rare variants of oral, head and neck carcinoma

include psueudoglandular, basaloid, and small cell neuroendocrine carcinomas, the latter

two being radiosensitive. Because these tumors share histopathologic features with other

neoplasms (i.e., melanomas, neuroblastomas, lymphomas), the use of specific

immunohistochemical markers is warranted.

Verrucous histopathology patterns characterize a subset of oral epithelial tumors.

Because there is evidence that these carcinomas evolve from leukoplakias that also

exhibit a verrucoid architecture, they are termed proliferative verrucous leukoplakia

(PVL) (Hansen S et al, 1995). Two specific forms of squamous cancers may arise from

PVL lesions. The first, verrucous carcinoma is characterized by marked

hyperparakeratosis, acanthosis, parakeratin crypts, and large "pushing" bulbous rete

ridges, said to resemble "elephant's feet" (Blot WJ et al, 1988). It shoud be noted that

verrucous carcinomas do not have dysplastic cytologic features and they do not

metastasize.

The second variant, also often preceded by PVL, is the papillary form of squamous cell

carcinoma. Histologically, these lesions exhibit either an exophytic papillary pattern of

growth or a verrucous inverting architecture (Crissman JD et al, 1988; Ishiyama A et al,

1994). Both patterns harbor dysplastic cytologic changes while a small number (less than

10%) have been shown to metastasize to regional nodes.


Staging of Intraoral Carcinoma

Many types of clinical classifications for the primary growth in oral cavity have been

advocated by various researchers viz.

1. Paymaster's classification,

2. T.N.M. Staging

1. Paymaster's Classification:

Paymaster in 1957 advised staging of the disease on the basis of extent of primary growth

and size of metastasis in cervical nodes. He classified primary grovk h into 3 groups.

Primary Growth

1 P.A: Primary growth less than 11/2 cm in diameter strictly localised to the anatomical

structure in which it is arising (Early and operable stage).

2. P.B.: Primary growth less than 3cm in diameter strictly localised to the anatomical

structure in which it is arising (Moderately advanced yet operable stage).

3. P.C.: Primary growth less than 3 cm in diameter, disease extends to the adjacent

structure (Advanced inoperable).

The Size and Extent of Metastasis

M; Metastasis

1. M.A: Metastatic mass less than 1 "2 cm in diameter. Nodes mobile (Early and

operable).

2. M.B: metastatic mass less than 3 cm in diameter, glands moderately enlarged and not

fixed (Moderately advanced yet operable).

• B B B a a ^ B ^ CHAPTER 2: LITERATURE REVIEW 17

3. M.C: Metastatic mass more than 3 cm in diameter, metastatic nodes hard and fixed

(Advanced Inoperable stage).

Clinical Staging was done on these features into 3 groups-

Early, fit for Curative Surgery or Stage I

Stage II :

Stage III :

P.A. +M.A

P.B. +M .A I Radiotherapy

P.A. +M.A

P.A. + M.B

P.B. + M.A

P.B. + M.B

Advanced but Operable

P.A. +M.C

P.B. + M.C

P.C. + M.C

P.C. + M.A

P.C. + M.B

Advanced Inoperable

2. T.N.M. Classification (2002)

This classification was given by the international union against cancer (UICC) in 2002

and is based on assessment of three components as follows:

(1) 'T' denotes Primary Tumor and T1-T4 relates to the extent of tumor itself

(2) 'N' denotes Lymph Node Metastasis and is described by No- N3

(3) 'M' denotes Distant Metastasis and is described Mo-Mi


Primary Tumor 'T' is classified into following stages-

TX: Primary tumor cannot be assessed

TO: Noevidenceof primary tumor

Tis: Carcinoma in situ

T1: Tumor 2 cm or less in greatest dimension

T2: Tumor more than 2 cm but not more than 4 cm in greatest dimension.

T3: Tumour measuring more than 4 cm in largest dimension

T4 (Lip): Tumor invades through cortical bone, inferior alvelolar nerve, floor of mouth or skin efface, i.e, chin or nose

T4a: (oral cavity). Tumor invades adjacent structures (eg. Through cortical bone, into deep extrinsic muscle of tounge(genioglossus, hyoglossus, palatoglossus, and styloglossus), maxillary sinus skin of face

T4b: Tumor invades masticator space, pterygoid plates or skull base and/or encases internal carotid artery

Regional lymph nodes 'N'-

Nx: Regional lymph nodes cannot be assessed

NO: No regional lymph node metastasis

Nl: Metastasis in a single ipsillateral lymph node, more than 3 cm but not more than 6 cm in greatest dimension; or in multiple ipsillateral lymph nodes, none more than 6 cm in greatest dimension; or in bilateral or contralateral lymph nodes none more than 6 cm in greatest dimension

N2a: Metastasis in a single ipsillateral lymph node, more than 3 cm but not more than 6 cm in greatest dimension

N2b: Metastasis in multiple ipsillateral lymph nodes, none more than 6 cm in greatest dimension

N2c: Metastasis in bilateral or contralateral lymph nodes none more than 6 cm in greatest dimension

N3: Metastasis in lymph node more than 6 cm in greatest dimension


Distant Metastasis 'M'-

Mo M,

Distant metastasis cannot be assessed No distant metastasis Distant metastasis

Table 2.1: STAGE GROUPING (TNM, 2002)

Stage 0 Stage I Stage II Stage m

Stage rV A

Stage IVB

Stage rvC

Tis

Tl

T2 T3 Tl T2

T3

T4a T4a Tl

T2

T3

T4a Any T T4b

Any T

NO NO

NO NO Nl Nl

Nl

NO Nl N2

N2

N2

N2 N3

AnyN

Any N

MO MO MO MO MO MO

MO

MO Mo MO MO

MO

MO MO MO Ml

Histological Differentiation of Oral Squamous Cell Carcinoma

Oral s e c has been divided histological in to three grades, depending on the loss of

differentiation. These are:

• Well differentiated SCC (WD SCC): Possesses cellular maturity and organization similar to normal squamous epithelium; with formation of keratin pearls.

• Moderately differentiated SCC (MD SCC): There is wide range of cytological atypia recognizable pricke cells and desmosomes but no keratin production.

Poorly differentiated SCC (PD SCC): there is marked degree of cytological atypia with mitotic activity and cellular pleomorphism, such that there is little or no resemblance to the normal squamous epithelium


Incidence of Oral Cancer

Oral cancer is the sixth most common cancer in the world and third most common cancer

in developing nations and is largely preventable. (Parkin SM et al, 1988; Raubenheimer

EJ et al, 1989). It accounts for approximately 4% of all cancers and 2% of all cancer

deaths world wide (Boring CC et al, 1993). In India, it is the most common malignant

neoplasm accounting for 20-30% of all cancers (Nair UJ et al, 1999).

Oral cancer is newly diagnosed in approximately 40,000 Americans and 350,000 others

worldwide each year (Boring et al, 1992). About half of the patients afflicted will die

within five years of diagnosis, while surviving patients may be left with severe aesthetic

and/or functional compromise (Silverman S et al, 1988; Yokes et al, 1993, Sidransky,

1995).

Although there has been a reduction in total mortality over the past two decades, the five-

year relative cancer survival rate for oral cancer is one of the lowest, far below the rate

for many other cancers, including skin melanoma and cancer of the testis, breast, colon,

rectum and kidney. The survival curves of oral cancer have plateaued over the past two

decades and remain among the worst of all cancer sites.

Incidence of Oral Cancer in World

It is well known that certain types of cancer occur at very high rates in certain regions;

for example cancer of the liver is frequent in parts of Africa but extremely rare in

America and Europe while nasopharyngeal carcinoma is much more frequent among the

Chinese than among other people.


Areas of high risk for oral cancer in world other than India and South East Asia include

Central and Eastern Europe and South America. Incidence rates of oral cancer show

marked geographic variation with the Bas Rhin region in the France having the highest

recorded incidence of oral cancer in the world. The frequency of oral cancer may be

expressed as rates per 10,000 population. The incidence rate of oral cancer in high risk

countries of world is given in Table 2.2.

Mortality rates, based on cause-of-death registration, are often computed as measure of

frequency of cancer. This is a less reliable statistic, partly because the various forms of

cancer exhibit extreme differences in mortality rates, and partly because mortality

statistics reflect such various factors as ease and efficiency of early diagnosis, therapeutic

and surgical techniques, etc. Death per 10,000 populations from cancer of oral cavity in

high risk countries is given in Table 2.3.

CHAPTER 2: LITERATURE REVIEW 2 2

Table 2.2: Worldwide incidences of oral cancer (Incidence rates)

Region

Africa

Carribean

America

Asia

Europe

Australia Melanesia

Country

Ethopia Mozambique Gabon Sudan Botswana Namibia South African Republic Puerto Rico

Brazil Canada America Cambodia Lao Bangladesh Bhutan India Kazakhstan Nepal Pakistan Sri Lanka Turkmenistan Yemen Belarus Hungary Slovokia Ukarine United Kingdom Croatia Portugal • Spain Germany Australia

Papua New Guinea Solomon Islands

Age Standardized Rate (ASR) Male 7.7 2.0 14.1 10.6 23.1 16.1 11.2 10.6

8.3 6.9 7.9 10.2 2.6 13.4 12.8 12.8 14.9 12.8 14.7 24.5 12.9 4.6 12.9 19.1 12.2 12.2 5.0 12.5 13.4 13.5 11.1 11.1

40.9 34.1

Female 7.9 7.0 3.8 5.7 9.5 7.2 2.9 2.5 1.7 2.9 3.4 2.7 6.1 16.8 8.4 7.5 2.7 8.4 14.7 9.2 3.3 6.4 1.8 4.5 1.8 1.8 2.7 2.7 2.1 2.3 2.8 4,7 26.3 21.7

Source: International Agency for Research on Cancer, lARC (GLOBOCAN 2002)


Table 2.3: Worldwide incidences of oral cancer (Mortality rates)

Region

Africa

Carribian America

Asia

Europe

Australia Melanesia

Country

Ethopia Mozambique Gabon Sudan Botswana Namibia South African Republic Puerto Rico Brazil Canada America Cambodia Lao Bangladesh Bhutan India Kazakhstan Nepal Pakistan Sri Lanka Turkmenistan Yemen Belarus Hungary Slovokia Ukarine United Kingdom Croatia Portugal Spain Germany France Australia Papua New Guinea Solomon Islands

Age Standardized Rate (ASR) Male 4.6 1.2 8.5 6.5 14.2 9.8 6.3 3.9 3.0 1.6 1.3 5.3 1.5 7.3 7.1 7.2 6.4 7.1 7.9

24.5 5.7 2.7 5.5 10.8 7.3 6.2 1.6 5.4 3.1 3.0 2.8 3.7 1.8

22.4 18.7

Female 4.7 4.2 2.3 3.5 5.8 4.4 1.6 1.0 0.8 0.8 0.6 1.4 3.2 9.4 4.7 4.2 1.3 4.7 8.2 5.1 1.5 3.3 0.6 1.8 0.7 0.6 0.8 0.6 0.6 0.6 0.8 0.7 0.9 15.0 12.4

Source: International Agency for Research on Cancer, lARC (GLOBOCAN 2002)


Incidence of Oral Cancer in India

It is well known that oral cancer is quite frequent in India accounting for 20-30% of all

cancers (Nair UJ et al, 1999). Table 2.4 shows relative incidence of oral cancer in

different parts of India as studied by various researchers.

Table 2.4: Relative incidences of oral cancer in different parts of India

Authors

Wahi-Saxena(I958) Paymaster (1957)

Krishnamurthy(1959)

Saxena & Agarwal (1965)

Krishna, G. e/a/., (1967)

Mehrotra, R. et al, (2003)

Institution

S.N.M.C, Agra Tata Memorial Hospital, Bombay Cancer Institute, Madras J.K Institute of Radiology & Cancer Research, Kanpur L.L.R. Hospital & J.K. Institute of Radiology & Cancer Research, Kanpur

M.L.N. Medical college, Allahbad

Period of Study

1948-56 1941-55

1953-57

1959-63

Jan. - Dec. 1964

1990-2000

Total No. of Malignancies

2800 6077

3927

3544

2811

40559

Percentage of Oral Cancer

26.8 35.9

39.0

27.2

27.6

18.7

Incidence According to the Site

Oral cancer may occur at different sites of oral cavity like buccal mucosa, tongue, palate,

lips and alveolar region. The frequency of oral cancer according to the site has been

reported from different parts of the world. Table 2.5 gives a brief review of the incidence

as reported by various authors.


Table 2.5: Incidence of oral cancer in different sites of oral cavity recorded in India

Place & author

Bombay- Khanolkar (1944) Ceylon-Corey (1944) Vishakhapatanam- Kini & SubbaRao (1937) Vishakhapatnam -Khanolkar & Surya Bai (1945) Patna- Khanolkar & Surya Bhai (1945) Agra-Haldar (1953) Travanvore-SomerWell (1944) Bombay- Rao et al., (1994) Aichi, Japan Takezaki H. e/a/., (1996)

Total Cases

1000

274

155

284

145

600

4497

713

266

Buccal Mucosa %

16.5

48.5

16.8

15.4

28.0

54.1

45.5

44.2

49.2

Tongue %

52.2

15.7

32.2

27.7

18.2

26.0

13.0

24.6

-

Palate %

6.2

5.4

33.5

36.8

11.2

8.2

-

3.2

-

Lips %

1.7

13.2

9.0

7.0

12.6

3.4

6.0

4.2

-

Alveolar Mucosa %

6.0

15.7

8.7

4.9

21.0

8.3

35.0

17.2

-

Age Incidence

Age for oral cancer is 5"' and 6* decade as with other cancers and 95% of patients with

oral cancer are over 40 years of age at diagnosis and mean age at diagnosis is 60 years ,

63.5 years for males and 60.6 years for females(Blot W J e/ al, 1994)

Age specific incidence rate for 45-49 age group is 3.1 per 10 while for 70-74 age group

is 49.2 per 10 population while incidence of oral cancer in young adults ranges between

0.4% and 3.6% (Friedlander PL et al, 1988)

Sex Incidence

It is widely accepted fact that oral cancers occur more commonly among the males than

in females (Boring CC et al, 1992; Balaram et al, 2002; Rosenquist et al, 2005;


Muwonge et al, 2007). In high risk areas except India, the male: female ratio is between

3 and 10. In India, incidence has also been reported to be higher among men than women,

but the sex disparity is much less marked than in Europeans. The sex incidence of oral

cancer in India has been studied by various researchers as given in Table 2.6.

Table 2.6: Incidence of oral cancer in different sex groups in India

Authors Subrahmanyam, B. et al., (1954) Percentage

Sbarma (1964) Percentage Saxena & Agrawal (1965) Percentage Krishna, G. et al., (1967) Percentage Sankaranyanan, R. et aL, (1990) Percentage Rajkumar, T. et al., (2003) Percentage Mehrotra, R. et al, (2003) Percentage Muwonge, R. et al, (2005) Percentage

Total Cases

445

122

963

116

414

591

159

282

Male 279

62.7

97 79.5 706 73.3 552 71.1 25.0 60.38 308

52.11 232

76.57 163

57.8

Female 166

37.3

25 20.5 257 26.7 224 28.9 164

39.61 283

47.98 71

23.43 119

42.2

Etiology

The etiology of oral cancer is ill understood like any other cancer elsewhere in the body.

However it has been observed that the varying incidence of oral cancer in different parts

of the world and in the same parts of the country is due to certain social customs and

habits predominant in that particular country.


The factors that have from time to time been referred as etiological factors responsible for

oral cancer are tobacco, areca nut, betel quid, alcohol, oral hygiene, diet, socio economic

status and viruses.

I. Tobacco

Tobacco has long been incriminated as one of the main factors causing chronic irritation

in the buccal cavity in India, Ceylon, Malaysia, Taiwan, Thailand and Indochina (Davis,

1915). The incidence is unequal in the above countries due to the individual variation in

the ingredients chewed with tobacco.

Tobacco either by chewing or by smoking can produce oral cancer. In India, association

of tobacco chewing and smoking with oral cancer has been demonstrated in various

studies (Sanghvi et al, 1955; Wahi et al, 1965; Jussawala and Desphaparde, 1971;

Jayant et al, 1977; Nandakumar et al, 1990; Balaram et al, 2002 etc).

Tobacco acts as an initiator and promoter of the disease. The relative risk of cancer seems

to be dose related and early age chewers, chain chewers and night chewers are more

likely affected.

Chronic habit of chewing tobaccoêtel quid (betel leaf coated with slaked lime wrapped

around areca nut) and reverse type of smoking (chutta) are causally associated with the

high incidence of oral malignancies in the Indian subcontinent (Sanghivi et al, 1981). In

India, tobacco is smoked in the form of cigarette, bidi, cigar/chutta, hukkah, chewed


alone or with lime, used as an ingredient in betel quid, inhaled as snuff powder and is

applied to the gums in form of paste-dentobac, mishri etc. Nearly 2 decades ago, another

product pan masala has been introduced in India. It is mixture of catechu (about 10%),

lime (about 1%), areca nut and betel leaf pieces (nearly 80% of the mixture), the

remaining 9% include menthol and various spices such as cardamom and flavoring agents

(Sanghivi et al., 1981). Tobacco is added to pan masala after it is made into a thick

extract, locally known as 'kimam'. It is made from tobacco dust (floor sweepings from

cigarette factories), veins and midribs of tobacco leaf and cigarette cuttings. Pan tobacco

chewing is considered to be the most important determinant of oral cancer in South India

(Sankaranarayanan et al, 1989) and interestingly areca nut, one of main ingredients of

paan is considered strongest risk factor for oral sub mucous fibrosis, a precancerous

condition very common in India. Presently, two types of chewing products are available

i.e pan masala without tobacco, and gutkha, which is a mixture of pan masala and

tobacco (Chaudhry, 1999).

Thus, changing pattern of tobacco use, especially with regard to alarming upsurge in

gutkha consumption, is a major cause of concern for health professionals. Recent reports

indicate that the incubation period of oral cancer may be shorter with the use of this

substance (Chaudhary, 1999). Pan masala is popular not only with males but also among

women and children who generally refrain from tobacco use in any form. In view of the

rapid upsurge in the incidence of oral precancerous lesions particularly, in the age groups

(13-30 yeas), in both genders, there is urgent need to undertake molecular epidemiology

studies pertaining to pan masala consumption in the Indian population.

CHAPTER 2; LITERATURE REVIEW 29

Consumption of pan masala and areca nut has been proposed to have association with

precancerous lesions such as Oral Submucous Fibrosis (OSMF). There have been no

studies on the association of gutkha and oral leukoplakia. However, chewing of Manipuri

tobacco has been shown to be associated with a higher prevalence of oral leukoplakia as

compared to no chewing (Wahi et al., 1968). Studies have also shown malignant

transformation of oral leukoplakia to cancer (Mehta et al, 1969, 1972).

In the Western World, cigarette smoking is responsible for the majority of all tobacco

related oral cancers. The risk of developing oral cancer is directly related to the intensity

of tobacco usage (Graham S et al, 1977;La Vechia et al, 1997) with heavy smokers

(over 20 cigarettes or 5 cigras per day) having a six fold increased risk of developing the

disease compared to non-smokers (Cawson RA et al, 1996) . Quitting smoking for 10

years or more reduces the odds ratio for developing oral cancer almost to unity

(Franceschi S et al, 1990). In the western world, oral cancer is rare in non-smokers

(Lemon FR era/., 1964).

Chapman (1961) studied the effect of tobacco smoking in relation to leukoplakia and he

observed that the length of time of smoking bears strong relation to severity of

leukoplakia.

n. Alcohol

Alcohol has been established as a etiological factor in oral cancer in various studies

(Rothman & Keller, 1972; Mccoy GD et al, 1979).

CHAPTER2: LITERATURE REVIEW 30

Alcohol is an independent risk for oral cancer and also acts synergistically with tobacco

in an additive or multiplicative fashion (Elwood JM et al, 1984). Heavy drinkers (> 30

drinks per week) and heavy smokers have a relative high risk for developing oral cancer

i.e. twenty four times greater than non drinkers and non smokers (McCoy GD et al.,

1979). Notani has reported the relative risk associated with combined habits of chewing

and alcohol intake with or without smoking in Indian population (Notani et al, 1988).

III. Poor Oral Hygiene

The standard of oral hygiene in an average patient of oral cancer is very poor. Whether it

is one of the causes or the effect of growth, is disputable. However oral sepsis specially

chronic long standing untreated Pyrrhoea alveolus is said to be contributing factor in the

production of cancer gums. Similarly lack of oral hygiene, as indicated by no use of tooth

brush, accounted for 32% of oral cancer in men and 64% in women in study conducted

by Prabha Balaram et al, (2002).

rv. Diet

Approximately 15% of oral and oropharyngeal cancers can be attributed to dietary

deficiencies or imbalances (La Vechia C et al, 1997). In an international ecological study

of nutrient predicators for oral cancer, the risk level has been shown to increase with

increasing meat and animal fat consumption and to decrease with fruit and cabbage

consumption (Hebert et al, 1993).


Beta carotene and vatamin E can produce regression of oral leukoplakia. Prolonged and

heavy consumption of food rich in nitrates and nitrosamines such as preserved meat and

fish significantly increase lifetime risk for the development of oral cancer as may diets

low in carotenoids (Garewal HS et al, 1995).

Frequent consumption of eggs, raw green vegetables, carrots, pulses, apple or pears,

citrus fruit, and overall consumption of vegetables and fruits decreases oral cancer risk

(La Vechia C et al, 1993). The risk associated with low consumption of vegetables was

higher among smokers than among non smokers.

V. Viruses:

Of the many viruses that are potential candidates for oral carcinogenesis there is little or

no evidence at the present time for either the retroviruses, adenoviruses or the Esptein-

Barr virus (Cox MF et al, 1991). There are some date implicating Herpes Simplex

Viruses (HSV) and the Human Papilloma Viruses (HPV) in the etiology of oral cancer

(Johnson NW et al, 1993) although; if they do have an oncogenic role it is likely to be

small.

Diagnosis and Treatment Modalities

One of the real dangers of oral cancer is that in its early stages, it can go unnoticed.

However in its earliest stages, it may appear as a white or red patch of tissue in the

mouth, or a small indurated ulcer which looks like a common sore. Because there are so

many benign tissue changes that occur normally in mouth, and some thing as simple as a


bite on the inside of cheeic may mimic the look of a dangerous tissue change. Other

symptoms include; a lump or mass which can be felt inside the mouth or neck, pain or

difficulty in swallowing, speaking, or chewing, any wart like masses, hoarseness which

lasts for a long time, or any numbness in the oral/facial region. The most common areas

for oral cancer to develop are on the tongue and the floor of the mouth. Individuals that

use chewing tobacco are likely to have them develop in the sulcus between the lip or

cheek and the soft tissue (gingiva) covering the lower jaw (mandible). The base of the

tongue at the back of the mouth and the pillars of the tonsils, are other sites where it is

commonly found. It is important to have a firm diagnosis as early as possible. Usually, a

biopsy is done with local anesthesia to diagnose the cancerous tissue. Treatment

modalities include surgery to remove the tumor in the mouth or throat and radiation

therapy which is used alone for small tumors or for patients who cannot have surgery. It

may be used before surgery to kill cancer cells and shrink the tumor. It also may be used

after surgery to destroy cancer cells that may remain in the area and chemotherapy.

Genetic Susceptibility

CYP2E1: The gene, CYP2E1, encodes a member of the cytochrome P450

superfamily of enzymes. The cytochrome P450 proteins are mono oxygenases which

catalyze many reactions involved in drug metabolism and synthesis of cholesterol,

steroids and other lipids. This protein localizes to the endoplasmic reticulum and is

induced by ethanol, the diabetic state and starvation. The enzyme metabolizes both

endogenous substrates such as ethanol, acetone and acetal, as well as exogenous

substrates including benzene, carbon tetrachloride, ethylene glycol, and


nitrosamines which are premutagens found in cigarette smoke. Due to its more than

one substrates, this enzyme may be involved in as many processes such as

gluconeogenesis, hepatic cirrhosis, diabetes as well as cancer. CYP2E1 gene maps

on chromosome 10, at lOq 24.3.

Alcohol dehydrogenase-2 (ADH2), aldehyde dehydrogenase-2 (ALDH2) and

Cyp2El are important enzymes for the catalysis of the conversion of ethanol to

acetaldehyde and to acetate in humans. Genetic polymorphisms have been reported

in ADH-2 and ALDH2, as well as in CYP2E1 (Hayashi etal, 1991). Hayashi et al,

(1991) described a polymorphism in the 5-prime flanking region of Cyp2El, and the

alleles were designated Ci (Rsal+) and C2 (Rsal-). Sarmanova et al, (2001)

described another polymorphism in Cyp2El-intron 6 and the alleles were designated

C [Dral+] and D [Oral-].

Tanaka et al, (1997) observed that the individuals with the C2/C2 genotype at

CYP2E1 locus could consume more ethanol on average than those with the Ci/Ci

genotypes .In subjects homozygous for the ALDH2*1 homozygous genotype, there

is an interactive effect between ALDH2 and CYP2E1 on alcohol consumption. To

evaluate the independent and interactive effects of the genetic polymorphisms of

ALDH2, ADH2 and CYP2E1 in relation to alcohol consumption large enough to

cause adverse health effects, Sun et al, (1999) analyzed 643 Japanese men for

genotype and drinking habits. They showed that Japanese men with the ALDH2*1

warn CHAPTER 2: LITERATURE REVIEW 34

homozygous genotype and the C2 allele of CYP2E1 are at a higher risk of showing

excessive alcohol consumption.

The development of Oral SCC has been linked to exposure to carcinogens such as

nitrosamines that cause various alkyl DNA damages. O - methylguanine-DNA

methyltransferase (MGMT) offers a primary defence against alkylation induced

mutagenesis and carcinogenesis. Because cytochorome P-450 (CYP2E1) is involved

in metabolic activation of environmental chemical carcinogens, gene

polymorphisms that alter its function may be associated with cancer susceptibility.

Genetic polymorphisms of CYP2E1 gene have been reported to determine

susceptibility to several cancers, including esophageal, gastric, nasopharyngeal and

breast cancer. In a study by Cai L et ah, 2005, the genetic risk for gastric cardia

cancer is shown to be associated with CYP2E1 polymorphism. The genetic

polymorphism of CYP2E1 gene in gastric cardia cancer susceptibility was assessed

by examining polymorphic prevalence in 159 gastric cardia cancer patients and 192

healthy controls (who were individually matched to the patients with respect to sex

and age). It was concluded that CYP2E1 genotype influences individual

susceptibility to development of gastric cardia cancer and that the risk increases

significantly in smokers.

In another study by Itoga et al, 2002, correlation of CYP2E1 Rsal polymorphism

with susceptibility to esophageal and lung cancer has been described. Enzyme

genotypes were determined using PCR and restriction enzyme digestion of


leukocyte DNA collected from 85 lung cancer patients and 82 esophageal cancer

patients and 192 healthy controls. The data suggested that CYP2E1 polymorphism

was associated with esophageal cancer but no association was found in patients with

lung cancer. The genotype frequencies in 346 breast cancer patients & 377 control

individuals was assessed by Choi et al., 2003 and it was concluded that CYP2E1 C2

allele genetic polymorphism is associated with susceptibility to breast cancer in

alcohol-consuming women.

In another population based study by Kongrutanachok N et al, (2001), the

association of CYP2E1 polymorphism with development of nasopharyngeal

carcinoma in Thailand was assessed. It was concluded that there is correlation

between the Rsal homozygous genotype in the CYP2E1 gene and a higher relative

risk of nasopharyngeal carcinoma development in the Thai or Chinese population in

Thailand.

A case control study of 99 Indian leukoplakia patients along with 227 healthy

controls was conducted by Sikdar et al, (2003) to assess any association between

CYPIAI and CYP2E1 polymorphisms, either separately or in combination, with the

likelihood of development of leukoplakia in this population. The frequencies of

genotypes at polymorphic sites in CYPlAl and CYP2E1 genes, were similar in

patients and control groups but the combined rare and homozygous genotypes

(CC+DD) at the Dral site in the CYP2E1 gene were over expressed among patients

compared with controls (OR=2.02, 95% confidence interval (CI)=1.21-3.35). Light


tobacco smokers (i.e. <21 pack per year) and light tobacco chewers (i.e. 104

chewing per year) with a "rare" C allele at the Dral site had high risk of leukoplakia

(OR=2.88, 95% Cl = l.16-7.22; OR=2.94, 95% CI=1.15-7.65 respectively). The

"mixed tobacco" users with "rare" C allele are more susceptible to the leukoplakia

than "exclusive" tobacco smokers and chewers. These results indicate that the "rare"

C allele at the Dral polymorphic site in CYP2E1 gene may enhance susceptibility to

leukoplakia among tobacco users in this population.

In another study by liu et al, 2001 the role of CYP2E1 Rsal/Pstl polymorphism as

risk factor for oral cancer was elucidated in 570 patients. It was shown that a

significant increase in CYP2E1 (Cl/Cl Rsal) genotype was observed in oral cancer

cases as compared to frequency matched controls in subjects who smoked less than

24 packs per year (p=0.33). No association was observed between CYP2E1

genotype and risk for oral cancer in the heavy smoking group (i.e., > 24 packs per

year). These data suggest that the Ci Rsal polymorphism contributes to increased

risk for oral cancer.

To investigate whether alcohol dehydrogenase 3 (ADH3) and CYP2E1 Dral and

Rsal genotypes modify the risk of upper acrodigestive tract cancers, Bouchardy et

al, 2000 studied 127 laryngeal cancer and 121 oral cavity/pharyngeal cancer

patients and 172 healthy controls. The results revealed that alcohol dehydrogenase 3

(ADH-3) was not associated with UAT cancer. In contrast, a two fold risk of oral

cavity/pharyngeal (OR=2.0, 95% CI=1.0-3.9) and laryngeal (0R=1.8, 95% CI= 1.0-


3.5) cancers was observed for carriers of the CYP2E1 Dral C variant allele

compared with other individuals. The risk associated with the CYP2E1 Rsal C2

variant allele also increased for oral cavity/ pharyngeal cancer (OR=2.6,

95%Cl = 1.0-6.6). The highest risk of oral cavity/pharyngeal cancer was among the

heaviest drinkers (>80g/day) with the CYP2E1 Dral C allele (OR=5.8, 95% Cl = 1.9-

18.2) or the CYP2E1 Rsal C2 allele (OR=7.2, 95% Cl = l.4-38.2) compared with

lighter drinkers with other genotypes. The data suggested that CYP2E1 genotype

modifies the risk of upper aero digestive tract cancers.

In another study by Hung et ai, (1997), the role of allelism at the GSTMI, GSTII

and CYP2E1 loci in determining individual susceptibility to oral cancer has been

described. Enzyme genotypes were determined using polymerase chain reaction and

restriction enzyme digestion of leukocyte DNA collected from 41 male oral cancer

patients and 123 healthy controls. The data suggested that null genotype of GSTMI

and/or GSTII is associated with an increased oral cancer risk. Besides CYP2E1

C1/C2 and C2/C2 genotypes were associated with a significantly increased oral

cancer risk compared with the Cl/Cl genotype among those who did not chew betel

quid (OR=4.7; 95% C 1=1.1-20.2), but not among betel quid chewers. Habitual

alcohol drinking was associated with significantly increased oral cancer risk,

showing an OR of 3.0 (95% C 1 = 1.8-8).

In another study by Gattas et al, 2006, the role of metabolic enzyme

polymorphisms on the risk of head and neck cancer in a hospital based case-control


study was evaluated. CYPlAl Mspl, CYP2E1 PstI, GSTMl, and GSTTl

polymorphisms were evaluated in 103 histologically confirmed head and neck

cancer cases and 102 controls. GSTMl null genotype increased the risk of head and

neck cancer (OR =2.2, 95% CI=1.24-3.79), oral cancer (OR=2.8; 95% CI=1.28-

5.98), and pharyngeal cancer (OR=2.2; 95% CI= 1.29-11.56). The joint effect of

GSTMl null and CYPIAI polymorphisms increased the risk of head and neck cancer

(OR =2.4; 95% CI= 1.13-5.10).

hOGGI and XRCCI: Human OGGI (hOGGI) and XRCCI are two of the important

enzymes participating in the BER (Base Excision Repair) pathway, the DNA repair

system involved in the repair of damage resultant from oxidative stress. The Human

OGGI (hOGGI) gene is located on chromosome 3p26.2, a region that frequently

shows loss of heterozygosity in several human cancers (Shinmura et ah, 2001,

Kohno et al, 1998). Human OGGI gene consists of seven exons and six introns and

encodes a 345 amino acid, a bi-functional glycosylase. Human OGGI can recognize

and excise, 8-oxoguanine, the major form of oxidative damage induced by free

radicals (Bruner S.D. et al, 2000). 8-oxoguanine is able to base pair with adenine

and cause GC-AT transversion in repair-deficient bacteria and yeast (Demple B,

Harisson L 1994). At least 20 sequence variants have been described and among

these, a C-G sequence variant leading to an amino acid change from serine to

cysteine at codon 326 (ser 326 Cys) has been studied most frequently.


XRCCI (X-ray repair cross complement group 1) gene is located on chromosome

19q 13.2 and consists of 17 exons and encodes a protein of 633 amino acids

(Lindahl et ah, 1999). The XRCCI protein is essential for mammalian viability and

its deficiency in mice results in embryonic lethality. XRCCI is required for the

efficient repair of single strand breaks and damaged bases in DNA. XRCCI has no

known enzymatic activity, and it is thought to act as a scaffold protein for both

single-strand break repair and base excision repair activities (Lindahl et al, 1999).

XRCCI complexes with DNA polymerase fi via the NH2 terminus domain and with

DNA lagase 111 via a blue ribbon commission on transportation (BRCT) domain to

repair nicks or gaps left in the BER pathway (Nash R.A. et al, 1997). XRCCI has

also been shown to be involved in the detection of single strand breaks between

incision and ligation, and effect that likely occurs via poly (ADP-ribose) polymerase

dependent and poly (ADP-ribose) polymerase independent mechanisms (Masson M

et al, 1998). More than 60 validated single nucleotide polymorphisms in XRCCI

gene have been described and among these, the most extensively studied single

nucleotide polymorphisms are Arg 194 on exon 6, Arg 280 His on exon 9, and Arg

399Glnonexon 10.

In a case-control study of 169 orolaryngeal cancer patients and 388 healthy controls

by Elahie et al, (2002), the results suggested that hOGGI Ser 326 Cys

polymorphism plays an important role in risk for smoking and alcohol related

orolaryngeal cancer. Significantly increased risk for orolaryngeal cancer was

observed for both the hOGGI/326(Ser)/326(Cys) (OR=1.6,95%(CI)= 1.04-2.6) and


hoGGI/326(Cys)/326(Cys) (OR=4.1,95% CI=1.3-7.3) genotypes while increased

risk for orolaryngeal cancer was observed for the hOGGI 326(Cys)/326(Cys)

genotype in smokers (>100 cigarettes lifetime, OR=4.8,95% CI=1.3-8) and alcohol

drinkers (>1 shot/weak, OR=6.9, 95% CI= 1.6-2.9).

In a study by Park J et al., 2004, the genetic risk for lung cancer was shown to be

associated with hOGGl Ser 326 Cys polymorphism. The genetic polymorphism of

hOGGI gene in lung cancer susceptibility was assessed by examining polymorphic

prevalances in 179 Caucasian lung cancer patients and 358 healthy controls.

Significantly increased risk for lung cancer was observed for both hOGGI 326

(Ser)/326(Cys) (0R=1.9, 95% CI= 1.2-2.9) and hOGGI 326 (Cys)/326(Cys)

(0R=1.7, 95% CI=l.l-2.8) genotypes.

The genetic polymorphism of hOGGI gene among 84 prostrate cancer patients was

investigated by Chen et al, (2003), to evaluate the role of genetic susceptibility in

prostrate cancer. A significant association was found between hOGGI genotypes and

prostrate cancer with a dose effect relationship (P<0.003). A significantly increased

risk of prostrate cancer was observed for subject with hOGGI (326 Cys) allele

(OR=2.1,95%CI=1.2-3.8).

In another study by Jiaox et al, (2007), the role of hOGGI Ser 326 Cys

polymorphism in determining individual susceptibility to gallbladder cancer has

been described. Genotype assays were determined using polymerase chain reaction-


Restriction fragment length polymorphism (PCR-RFCP) method from 204 patients

and 209 controls. The data suggested that hOGGI 326 Cys polymorphism is

associated with gallbladder cancer risk but this association was not found in

gallstone absence.

A community based case control study of 109 lung cancer patients along with 109

healthy control subjects, individually matched on age and gender, was conducted in

China by Chen et al, (2002), to assess any association between XRCCI and XPD

polymorphisms with the likelihood of development of lung cancer in this

population. The results revealed that XRCCI 194 Trp/Trp genotype was associated

with a borderline increased risk of lung cancer [OR =3.06, 95% CI=0.94-9.92]

suggesting that XRCCI 194 Trp/Trp might be the risk genotype for lung cancer in

Chinese population. In another study by Shen et al., (2003), the role of DNA repair

gene polymorphisms on the risk of bladder cancer in a hospital-based case control

study was evaluated. XRCCI, XRCC3 and XPD polymorphisms were evaluated in

201 bladder cancer cases and 214 controls. The results suggested that XRCC3 codon

241 variant genotype exhibited a protective effect against bladder cancer which was

more prominent among heavy smokers while XPD polymorphism was not

associated with bladder cancer. XRCCI codon 399 polymorphism had a protective

effect on bladder cancer among heavy smokers only (OR=0.38, 95%CI=0.14-1.02).

A hospital based case-control study was conducted in India to determine the

interaction between XRCCI (codon 280) and GSTM3 polymorphisms and tobacco


use in oral leukoplakia and oral cancer by Majumder et ai, 2005. The results

revealed that variant haplotypes, containing one variant allele on XRCCI increased

the risk of leukoplakia (0R=1.3, 95% CI=1.0-1.7) while mixed tobacco users,

containing variant haplotypes, also had increased risk of both leukoplakia (OR=2.2,

95% CI=1.3-3.9) and oral cancer (0R=1.9, 95% CI=1.2-1.3). Besides, the

simultaneous presence of 2 risk genotypes in smokers, one on each of two loci,

GSTM3 and XRCCI (codon 280) increased the risk of cancer (OR=2.4, 95%

CI=1.0-5.8). Therefore presence of variant haplotypes on XRCCI and two risk

genotypes, one on each of two loci, GSTM3 and XRCCI (codon 280) could be

useful to determine the leukoplakia that might progress to cancer in a group of

patients.

In a study by Ramachandran et ai, 2006 on 110 oral cancer, 84 leukoplakia and 110

controls belonging to Travancore South Indian population, the results revealed the

association of XRCCI 194 Trp, XRCCI 399 Gin and XPD 751 Gin polymorphisms

with increased risk of oral cancer. In another study by Kietthubthew et al., (2006),

the role of polymorphism of DNA repair genes on the risk of oral squamous cell

carcinoma in Thailand community was evaluated. XRCCI (Arg 194 Trp and Arg

399 Gin), XRCC3 (Thr 241 Met), XPC (PAT and Lys 93 Gin), XPD (exon 6 and

Lys 751 Gin) and MGMT (Trp 65 Cys and Leu 8 phe) polymorphisms were

evaluated in 106 histological confirmed OSCC patients and 164 healthy controls

that were frequency-matched by age (+/- 5 years), gender, and cigarette smoking

and alcohol drinking habits. The results revealed that XRCC3 241 Met genotype


exhibited a three fold elevated risk (OR=3.3, 95% CI=1.31-8.36, p=0.01) for OSCC

in Thailand. There was a marginally significant risk observed in variants with

XRCCI 194 Trp (0R=1.81, 95% CI=0.91-3.63, P=0.09) and XPD exon 6 (0R=1.71,

95% CI=0.93-3.16, P=0.09). The joint effect of XRCC3 324 Met, XRCCI 194 Trp

and XPD exon 6 polymorphisms increased the risk of OSCC (OR=3.93, 95%

Cl = l.14-13.6, P<0.05).

A population-based case control study was conducted in United States by Gal TJ. et

al. 2005, to assess the effect of polymorphisms of DNA repair genes (XRCCI,

XRCC3, XPD and MGMT) on second primary neoplasm and mortality in OSCC.

Genotype assays were determined using the polymerase chain reaction-restriction

fragment length polymorphism (PCR-RFLP) method from 279 OSCC patients. The

data suggested that polymorphism of XRCC3 241 Met gene was associated with an

increased risk of second neoplasm, and polymorphism of the XRCCI 399 Gin gene

was associated with a decreased risk of all-cause mortality in patients with primary

OSCC.

A case control study of 237 OSCC patients was conducted in Taiwan by Hsieh et

al, 2003 to evaluate the association of XRCCI 399 Gin polymorphism with

frequency of P53 mutations. The OSCC patients with a Gln/Gln genotype exhibited

a significantly higher frequency of p53 mutation than those with an Arg/Gln and

Arg/Arg genotype (OR=4.5, 95%CI=1.52-13.36). These findings support the


hypothesis that XRCCI Arg 399 Gin change may alter the phenotype of the XRCCI

protein, resulting in a DNA repair deficiency.

Molecular Basis of Human Oral Cancer

Carcinogenesis is a complex, multi-step process in which genetic events within

signal transduction pathways governing normal cellular physiology are

quantitatively or qualitatively altered (Vogelstein and Kinzler, 1993). The genetic

basis of cancer is now well-established. Under normal conditions, these tightly

controlled excitatory and inhibitory pathways regulate oral keratinocyte biology.

Basic cellular functions under these controls include cell division, differentiation,

senescence, and adhesion. These regulatory pathways are composed of extra cellular

ligands which bind to cell-surface receptors to generate intracellular signals sent

through secondary messengers. These signals either directly alter cell function or

stimulate the transcription of genes whose proteins effect change (Bishop, 1991).

Cancer is the result of an accumulation of changes in the excitatory and inhibitory

cellular pathways, which may occur at any level of a given pathway. It has been

estimated that from three to six somatic mutations are needed to transform a normal

cell into its malignant counterpart (Vogelstein and Kinzler, 1993). As the cell

accumulates these alterations or mutations, it becomes functionally independent

from the surrounding oral epithelium made up of normal oral keratinocytes

(Sidransky, 1995). The normal cellular functions tightly controlled by these

regulatory pathways are subverted in tumor cells, thus enhancing the cell's ability to

proliferate, stimulate neo-vascularization, and grow by invading locally or


metastasizing to distant sites (Weiner and Cancer, 1994). The histological

progression of oral carcinogenesis is believed to reflect the accumulation of these

changes (Field, 1992; Yokes et al, 1993).

Cytogenetics of Human Oral Cancer

In 1914, Boveri's study of tumor cell chromosomes led him to propose that

alterations in chromosomes resulted in conversion of normal to malignant

proliferation (Boveri, 1914). For human oral cancer, the karyotypes of 63 short-term

cultured tumors have been described (Owens et al, 1992; Jin and Mertens, 1993).

All karyotypes are complex, with great heterogeneity. Nonetheless, some genomic

sites seemingly are non-randomly involved. There is the recurrent loss of

chromosomes 9, 13, 18, and deletions are frequently involved in the chromosome

arms of 3p, 7q, 8p, llq, and 17p, and in the short arm of all acrocentric

chromosomes while chromosomes break points are frequently seen in the

centromeric regions of chromosomes 1, 3, 8, 14, 15 and in bands Ip22, IIql3, and

19pl3 (Field, 1992; Jin and Mertens, 1993). Since the cellular oncogenes bcl-l, int-

2, and hst-l have been mapped to 1 lql3, while N-ras has been mapped to Ip22, it is

proposed that activation of the oncogenes located in these bands may be preceded

by cytogenetic mechanisms.

Approximately two-third of all head and neck cancer cells contain a deleted region

located in chromosome 9p21-22 (Ahsee et al, 1994; Nawroz et al, 1994), which

appears in dysplastic and carcinoma in situ (CIS) lesions, thereby suggesting that a


gene in this region is knocked out early in oral carcinogenesis (Van der Riet et al,

1994). A tumor suppressor gene (TSG) initially isolated from melanoma cells, pl6

(MTSI or CDKN2), is also found in this region and may prove to be a cell-cycle

inhibitor important in oral cancer development (Serrano and Hannon et al, 1993;

Kamb et al, 1994; Van der Riet et al, 1994). Chromosomal regions in 3p and Ipl

also contain regions frequently deleted and may yield new tumor suppressor genes

of oral carcinogenesis (Sidransky, 1995).

Genetic damage in oral cancer cells can be divided into two categories,dominant and

recessive changes. Dominant changes, most frequently occurring in proto-oncogenes

but also in certain tumor suppressor genes (TSGS), resuh in gain of function.

Recessive changes, mutations most frequently noted in growth-inhibitory pathway

genes or commonly in tumor suppressor genes, cause loss of function (Bishop,

1991).

Oncogenes Implicated in Human Oral Cancer

Oncogenes, gain-of-function mutations of highly regulated normal cellular

counterparts (proto-oncogenes), are likely involved in the initiation and progression

of oral neoplasia (Field, 1992). Cellular oncogenes were initially discovered by the

ability of tumor cell DNA to induce transformation in gene transfer assays (Shih et

al, 1981). These experiments have led to the identification of more than 60 cellular

oncogenes (Cooper, 1995). Mechanisms of activation of these cellular oncogenes

include point mutations and DNA re-arrangements.


Several oncogenes have been implicated in oral carcinogenesis (Field, 1992).

Aberrant expression of the proto-oncogenes, epidermal growth factor receptor

{EGFR)/c-erh 1, members of the ras family, as well as c-myc-, int-2, hst-\, PRAD-1

and bcl-\, is believed to contribute to oral cancer development (Berenson et al,

1989; Wong et al, 1989; Merritt et al, 1990; Riviere et al, 1990; Somers et al,

1990; Sidransky, 1995). Overexpression of bcl-2 and bax has been reported in

squamous cell carcinoma (Staibano et al, 1998; Xie et al, 1999). It has been shown

that TGF-a is aberrantly expressed in human oral cancer and in hamster oral tumor

(Wong et al, 1998; Todd et al, 1989, 91) and it has been postulated that TGf-a

promotes neo-vascularization and mitogenesis (Elovic et al, 1990).

1. Growth factors

Growth factors can stimulate oral keratinocyte proliferation (Aaronson, 1991; Issing

et al, 1993). During oral carcinogenesis, growth factors are de-regulated through

increased production and autocrine stimulation (Sporn and Todaro, 1980; Wong et

al, 1990; Todd et al, 1991). TGF- a is overexpressed early in oral carcinogenesis

by hyperplastic epithelium and later by the inflammatory infiltrate, particularly the

eosinophils, surrounding the invading oral epithelium (Chang et al, 1989; Todd et

al, 1991). The increase in eosinophils in oral cancer — up to 17% of the total

inflammatory infiltrate -was noted as early 1975 by Healy (Healy, 1975), and this is

a consistent feature in all cases of oral cancer examined. TGF-a is a 50-amino-acid

polypeptide that promotes cell proliferation in oral tissues as well as in other cell

types in the body. TGF-a stimulates a target cell by binding to the epidermal growth


factor receptor (EGFR) in an autocrine or paracrine fashion (Derynck, 1992).

Overexpression of this growth factor in transgenic mice led to epithelial hyperplasia

and malignant transformation of mammary epithelium (Jhappan et al, 1990; Matsui

et al, 1990; Sandgren et al., 1990). In addition, TGF-a likely serves a tumor-

promoting role in epithelial carcinogenesis (Sandgren et al., 1993; Coffey et al.,

1994). In head and neck cancer patients who later develop second primary cancers,

"normal" oral mucosa oversecretes TGF-a suggesting a "premalignant" state of

rapid proliferation and genetic instability of the epithelium (Grandis and Tweardy,

1993). Concomitant expression of TGF-a and EGFR may indicate more aggressive

tumors than those overexpressing EGFR alone (Issing et al., 1993).

2. Cell-surface receptors

Ligand receptor binding activates a cascade of intracellular biochemical steps

(Aaronson, 1991). Regulation of protein phosphorylation is an important event in

cellular function and gene expression. Mutations of genes encoding cell-surface

receptors can result in an increased number of receptors or production of a

constituent ligand-independent mitogenic signal (Bishop., 1991; Cantley et al.,

1991; Hunter., 1991).

EGFR, the biological receptor of EGF and TGF-a, is a 170,000-dalton

phosphoglycoprotein frequently found to be overexpressed in human oral cancers

(Partridge et al., 1988; Shin et al., 1990; Todd et al., 1991; Rikimaru et al., 1992;

Saranath et al., 1992; Grandis and Tweardy, 1993). Malignant oral keratinocytes


possess from 5 to 50 times more EGER than their normal counterparts (Christensen

et al, 1993). Currently, three mechanisms have been postulated to activate the

EGER gene in carcinogenesis: (1) deletions or mutations in the N-terminal ligand-

binding domain such as those occurring in the viral oncogene v-erbB (Downward et

al, 1984; Ullrich et al, 1984); (2) over expression of the EGFR gene concurrent

with the continuous presence of EGF and/or TGF-a (Di Fiore et al, 1987; Di Marco

et al, 1989); and (3) deletion in the C-terminus of the receptor, which prevents

down-regulation of the receptor after ligand binding (Wells et al, 1988; Batra et al,

1994). It is therefore of great importance to conduct studies to determine the

spectrum of mutations in the human EGFR gene in order to gain a better insight into

the mechanisms responsible for the over expression of this frequently activated

biomarker in human oral cancer. The molecular mechanisms responsible for the

over expression are not fully understood. EGFR gene amplification is detected in

about 30% of cases (Scully, 1993), which suggests that other mechanisms are

responsible for the majority of EGFR over expression. Whether the mutation in the

EGFR gene results in over expression of normal receptors or formation of receptors

that can signal without stimulation or a combination of the two in oral cancer has

not been understood. Oral tumors overexpressing EGFR exhibit a higher proportion

of complete responses to chemotherapy than tumors with low-level EGFR

expression. Over expression of EGFR presumably due to higher intrinsic

proliferative activity could result in higher sensitivity to drug therapy cytotoxic to

cells undergoing mitogenesis (Santini et al, 1991).


3. Intracellular messengers

Intracellular messengers can also be intrinsically activated, thereby delivering a

continuous rather than a ligand-regulated signal (Cantley et ai, 1991; Hunter,

1991). Of all the members of the intracellular signaling pathway, members of the ras

gene family (H-ras, K-ras) have been extensively examined in human oral cancer.

The ras oncogenes were first identified in the murine Harvey and Kirsten sarcoma

retroviruses. They all encode for the related protein p21 that has been localized to

the cytoplasmic side of the cellular membrane. Of importance is the realization that

the ras proteins bind guanine nucleotides (GDP and GTP) with high affinity and

specificity. The ras proteins were eventually shown to be analogous to the G

proteins in coupling receptors to intracellular secondary messengers (Shih et al,

1980). The ras proteins transmit mitogenic signals by binding to GTP. Hydrolysis of

GTP to GDP ends the signal. Members of the ras gene family are mutated in

approximately 30% of all human tumors (Bos, 1989). A report from India

demonstrated that 35% of oral squamous cell carcinomas contained H-ras mutations

(Saranath et al., 1991). However, studies from the Western world have shown that

H-ras mutations are found in fever than 5% of head and neck cancers (Rumsby et

al, 1990; Sheng et al, 1990; Chang et al, 1991). In oral cancer, Kirsten ras (k-ras)

has been shown to be activated, by a point mutation (Spandidos et al, 1985). Thus,

it remains activated, but unable to hydrolyze GTP due to an amino acid change

resulting from this mutation (Barbacid, 1987). Because K-ras cannot convert GTP to

GDP, it continues to stimulate the cell to proliferate. In a hamster oral cancer model,

the c-Ha-ras and the c-erbB oncogenes were shown to be sequentially expressed


during oral carcinogenesis (Husain et al, 1989). Mutation in codon 61 of the Ha-ras

gene was identified as an early event in this rodent oral cancer model (Kwong et al,

1992).

4. Transcription factors

Transcription factors, or proteins that regulate the expression of other genes, are

also altered in oral cancer. Modulation of gene expression is an important outcome

in the alteration of the intracellular pathways (Bishop, 1991). The transcription

factor C-myc, which codes for a nuclear protein p62 and helps in regulating cell

proliferation and differentiation, is frequently over expressed in oral cancers

(Spandidos et al, 1985; Field, 1992). Over expression due to gene amplification of

C-myc is most frequently associated with poorly differentiated tumors and with poor

prognosis (Schantz, 1995).There is overexpression of p53 and C-myc proteins in

advanced stages of betel and tobacco releated oral squamous cell carcinomas (Baral

et al, 1998). Overexpression of transcriptional factors, C-raf and C-jun in oral

cancer has also been reported. Product of C-raf oncogene is a cytoplasmimc serine

theonine kinase and has been shown to be implicated in drug and radiation

resistance (Kasid U et al, 1987; Burt RK et al, 1988) while product of C-jun

oncogene is postulated to have DNA binding activity (Xanthoudakis et al, 1994)

.Another transcription factor, PRADI (also called CCNDI or cyclin DI), a cell-cycle

promoter, is also amplified in head and neck cancers.


While no particular order of oncogene activation has been demonstrated in oral or in

other cancers, the accumulation of activated oncogenes appears to be of primary

importance (Sidransky, 1995). The importance of the presently identified

oncoproteins to oral carcinogenesis is currently under investigation. Other

oncogenes linked to oral cancer development are fet-1, int-I, bd-\, sea, men 1, and

emsA (Field, 1992; Yokes et al., 1993). However oncogenes alone are not sufficient

to cause oral cancer but appear to be initiators of the process. The critical event in

the transformation of a premalignant cell to a malignant cell is the inactivation of

cellular negative regulators, tumor suppressor genes.

5. Tumor Suppressor Gene (TSG)

Tumor suppressor genes or anti-oncogenes have been documented to confer potent

negative regulatory controls which are lost due to chromosomal alterations during

tumor formation. Functional loss of multiple tumor suppressor genes is believed to

be the major event leading to the development of malignancy (Lee, 1993; Yokota

and Sugimura, 1993). Unlike oncogenes, which can effect a cellular change through

mutation of only one of the two gene copies, tumor suppressor genes are most often

inactivated by point mutations, deletions, and rearrangements in both gene copies in

a "two-hit" fashion. Therefore, the critical events for the malignant transformation

of oral keratinocytes, i.e. the loss of function of tumor suppressor genes, are

difficult to achieve. This may account, in part, for the length of time required for the

formation of adult solid tumors.


Many tumor suppressor genes were initially identified in pediatric tumors that

formed early in life because one mutated tumor suppressor gene had been inherited.

However, identification of these genes lagged a decade behind the isolation of the

first oncogenes, because, in cancer cells, tumor suppressor genes are negative

phenotypes- an event no longer present within the cell. Knudson predicted that the

inactivation of both copies of tumor suppressor genes occurs in a two-hit fashion

(Knudson, 1977). Experimental evidence followed with the observation that normal:

tumor hybrids demonstrated normal phenotypes, which suggested that normal cells

contained suppressors of the tumor phenotype (Stranbridge, 1981). These same

experiments have been performed with normal and malignant oral kerationocytes

(Moroco et al, 1990). Only after extensive "Chromosomal walking" analysis of

pediatric tumors with large chromosomal alterations were the first tumor suppressor

genes isolated (Bookstein and Lee, 1991). Therefore, while the identification of

these "cancer genes" is one of the primary focuses of tumor biologists today, far

less is known about tumor suppressor genes. p53, doc-I and thromobospondin 1-

have been studied extensively for tumor suppressor activity in malignant oral

keratinocytes (Rastinejad et al, 1989; Good et al, 1990; Liu et al, 1994; Todd et

al, 1995).

p53, the product of tumor suppressor gene TP53 and localized on 17p 13.1, has a

central role in the control of the cell cycle of cells bearing sub lethal damage within

their genome. It arrests the cell cycle in the late Gi phase until repair of the genomic

damage or causes induction of apoptosis (Cordon Cardo et al, 1995; Hartwell L. et


al, 1992; Yonish-Rouache E. et al. 1991; Attardi LD et ai, 1996). p53 is involved

in DNA synthesis and repair, genomic plasticity, programmed cell death and

negative regulation of cell cycle (Donehower L.A & Baradley. A., 1993) and is

called "Guardian of the Genome" (Chang F et al., 1993; Greenblatt MS et al., 1994;

Lane DP et al., 1992). Loss of tumor suppressor gene function due to mutations in

the p53 tumor suppressor genes are among the most frequent genetic changes

detected in human cancers especially in development of head and neck cancer

(Greenblatt et al., 1994; Harris., 1996; Sidransky and HolIstein,1996; Liloglou et al.,

1997). More than 85% of the p53 mutations are missense mutations and fall within

exon 5 through 8 that code for the internal and most conserved part of the p53

protein. Overexpression of the p53 protein was found to be associated not only with

oral cancers and premalignant lesions (Yan JJ et al., 1996; Chiba I et al., 1998;

Murti PR et al., 1998) but also with the histological grade of malignancy (De Araujo

VC et al., 1997) suggesting that p53 alteration is an early event in oral

carcinogenesis (Kaur et al., 1994). The carcinogenic pathway of overexpressed p53

protein has been suggested to synergize with bcl-2 overexpression which occurs

early in oral carcinogenesis resulting in defective apoptosis and subsequent tumor

progression (Ravi D etal., 1996).

In normal cells, wild type p53 protein has a very short half life, 6-20 minutes

(Chiang CP et al., 1999) and is present in such small quantities that it can not be

detected by Immunohistochemical methods. However, misense mutations in the p53

gene often result in a more stable gene product and prolong the half life of the p53


protein, causing it to accumulate within cell nuclei to the extent that it can be easily

detected by means of immunohistochemistry. Therefore, positive p53 staining has

been proposed as an indirect indicator for mutations of the p53 gene (Bennett WP et

al, 1991). Increased amount of the p53 protein have been found in wide variety of

human tumors, such as carcinomas of breast, colon, stomach and uterus, and in

melanomas and soft tissue carcinomas (Bartek et al., 1991).

Mutation of p53 allow tumors to pass through the Gl-S boundary and propagate the

genetic alterations that lead to other activated oncogenes or inactivated tumor

suppressor genes. The p53 gene appears to be mutated at the transition of superficial

to invasive carcinoma (Sidransky et al, 1993). Alteration of the p53 gene occurs as

point mutations and deletions. Point mutations result in a structurally altered protein

that sequesters the wild-type protein, thereby inactivating it in a "dominant-

negative" fashion. Deletions lead to a reduction and loss of p53 expression and

protein function. Not only has p53 been demonstrated to be functionally inactivated

in oral tumors, but also restoration of p53 function in oral cancer cell lines and in

oral tumors induced in animal models results in the reversion of the malignant

phenotype, thereby turning back oral carcinogenesis (Schantz, 1995).

It should be noted that p53 has been shown to interact with the oncogenic protein E6

of the human papilloma virus (HPV), which results in the rapid degradation of the

p53 protein by the ubiquitin-mediated proteolysis system (Scheffner et al., 1990;

Werness et al., 1990). Multiple lesions of HPV infection have also been found in the


patients with oral cancer and betel quid chewers, and it was suggested that viral

infection was an important etiological component, with betel quid probably causing

additional mutagenic steps in the carcinogenic processes (Balaram P et ah, 2002).

Similar interaction has been shown for the HPVE7 protein with pRB (Dyson et al.,

1989), which interferes with the regulation of the activity of the E2F transcription

factor family, a phenomenon that has profound consequences for the proliferative

pattern of the affected cells. The p53 gene appears to be one of the molecular targets

of tobacco related carcinogens in head and neck squamous cell carcinoma (Kaur et

al, 1998). Smoking and tobacco use have been associated with mutation of the p53

gene in squamous cell carcinoma (SCC), of -the head and neck. By

immunohistochemistry, p53 overexpression has been shown in oral tumors from

patients who were heavy smokers and chewers (Langdon and Partridge, 1992).

Polymerase chain-reaction (PCR) has been used to show an association between a

history of tobacco use and a high frequency of p53 mutations in patients with SCC

of head and neck (Brennan et al, 1995). Other tumor suppressor gene having role in

oral cancer, (doc-1) (deleted in oral cancer -1), was identified by Todd et al, (1995)

using hamster oral cancer model.

Cyclin Dl gene (CCNDI, bcl-1 or PRADl gene) located on chromosome llq 13

(Carlos et al, 2002) encodes a protein forming a complex with cyclin- dependent

Kinases, CDK4 and CDk6. Cyclin D-CDK4 and CDK6 complexes phosphorylate Rb

protein during the Gi-S transition which leads to their dissociation from the E2F

transcription factor and the intiation of DNA replication (Michalides RJAM et al.


1999; Kudo Y et al, 2000) .Cyclin Dl overexpression, either by amplification or by

transcriptional upregulation, shows accerelated Gi progression and cell enters in the

S phase, with lower cell dependence on growth factors for proliferation (Kuo MY et

al, 1999). This overexpression has been reported in a variety of human tumors,

including head and neck squamous cell carcinomas (Motokura T et al, 1993)and is

correlated with cytological grade, infiltrative growth pattern and metastasis

(Williams HK et al, 2000).

Several studies (Lam KY et al, 2000; Akervall JA et al, 1997; XU J et al, 1998)

have described the expression of Cyclin Dl in various subsites within the oral cavity

adding that it was more often detected in sites such as tounge (Akervall JA et al,

1997; Xu J et al, 1998), retromolar region (Xu J et al, 1998), palate (Lam KY et

al, 2000), gingiva (Xu J et al, 1998) and floor of mouth (Lam KY et al, 2000)

which has suggested that it might reflect epidemiological or racial differences in

various populations.

Oral Growth Suppressors and the Signal Transduction Pathway

As oncogenes subvert pathways leading to growth promotion, inactivation of tumor

suppressor genes cripples growth-inhibitory pathways. These events can occur at

any level of the growth-inhibitory signal transduction pathway. Several extracellular

ligands are oral keratinocyte growth inhibitors while TNF-a and transforming

growth factor-beta (TGF-P) may provide important growth-inhibitory signals in oral

epithelial cell biology. TNF-a alone and with interferon-7, has been demonstrated to


inhibit malignant oral keratinocyte proliferation (Aaronson, 1991; Howe et al, 1991;

Sacchi et al, 1991). TGF-P is an inhibitor of keratinocyte proliferation whose

activity is due, in part, to a known tumor suppressor gene, the retinoblastoma

susceptibility gene (Rb) (Moses et al., 1990 Bookstein and Lee, 1991; Irish, 1992).

Cell-surface molecules may also be important in inhibiting oral keratinocyte

proliferation. E-cadherin, a cell-cell adhesion molecule associated with both

invasion and metastasis, is downregulated in oral cancers (Frixen UH et al, 1991;

Morton RA 1993; Mareel et al, 1994; Jiang et al, 1996; Hirohashi et al, 1998).

Similarly P-cadherin expression was reduced in OSCC and it acts as an independent

prognostic factor in patients with OSCC (Lo Muzio et al, 2004). Deleted in oral

cancer (DCC) is a N-CAM like molecule believed to be an important cell-cell

contact inhibitor that is mutated during oral cancer development (Kim et al, 1993).

Growth suppressor intracellular messengers may include the adenomatous polyposis

coli (APC) gene, a G-like protein frequently mutated in certain familial colorectal

cancers (Groden et al, 1991). Recent evidence suggests that the APC gene may be

altered in premalignant oral lesions {Largey et al, 1993).

The transcription factor Rb, a known tumor suppressor gene, has been shown to

have reduced expression in oral tumors (Kim et al, 1993). Alterations of Rb

pathway components are frequent events in patients with epithelial dysplasia and

predict clinical outcome in patients with squamous cell carcinoma (Soni R et al,


2005). Deregulation of both Rb and p53 pathways is associated with malignant

transformation and adverse prognosis in oral tumorigenosis. It has been

demonstrated that Rb pathway proteins are comparatively more important than p53

pathway proteins for the prognostication of oral cancer patients (Jayasurya et al,

2005). Expression of PRb2 /pl30 may be good prognostic indicator in patients with

oral squamous cell carcinoma and also may be utilized for the sub classification of

tumors with the Grade 3 mode of carcinoma invasion (Tanaka et al, 2001).

Retinoic acid receptor-beta (RAR-P) is down regulated in head and neck cancers

(Khuri et al, 1997). Retinoids are currently under investigation for prevention and

reversion of oral premalignant lesions (DeLuca, 1991; Lotan et al, 1995; Ralhan R

et al, 2006).

Human chorionic Gonado-Tropin-p (hCGP), a glycoprotein hormone, is not

expressed by normal or benign cells but is expressed in oral SCC (Acevedo HF,

1995). Thus hCGP can be used as a marker of malignant transformation, and hCGp

assays can serve as indicators of tumor progression (Regelsion W et al, 1995).


CHAPTER 3 MATERIALS AND METHODS

The present study was conducted in the Department of Biochemistry, Jawaharlal

Nehru Medical College, Aligarh Muslim University, Aligarh (JNMC,AMU,Aligarh)

from Nov. 2004 to March 2007. Cases for the present study comprised of patients of

oral cancer attending the OPD of Department of Otorhinolaryngology (ENT) or

admitted to their wards of JNMC, Aligarh. Age and sex matched controls were

recruited from healthy individuals. Prior consent was taken from all the cases as

well as controls.

The study comprised of total 250 human subjects with 100 patients and 150

controls. Biopsy specimens were taken from 60 cases & 10 controls. Blood samples

were collected from all the cases & controls. A thorough proper history with special

emphasis on the tobacco & betel quid intake was taken. Patients having habit of

smoking and/or alcohol intake were excluded from the present study. Complete

clinical evaluation and relevant investigations were done in all the patient samples.

This all information was recorded in the following pro forma:

PRO FORMA

S.No Name Age/Sex Education Occupation Marital Status Environment Complaints

Date Ward/Bed No. OPD/CADS No. C/I

Rural/Urban

CHAPTER 3: MATERIALS & METHODS 61

Past History Treatment History Personal History Tobacco and betel quid intake Duration

Site of lesion

INVESTIGATION Routine Biopsy and histopathology Diagnosis Specific investigations Immunohistochemistry Agarose gel electrophoresis PCR-RFLP genotyping

less than 6 months 6-12 months 12-18 months 18-24 months

Histopathology

Post surgical specimens received included excisional and incisional oral biopsy

specimens. They were processed by an automatic tissue processor (Histokinette).

Embedding of the block was done as follows:

a) Xylol with paraffin wax-one and half hour. b) Paraffin wax-one and half hour.

Blocks were prepared in paraffin wax with the help of L-blocks. Sections were cut

at 4-5 |im thickness with the help of rotatory microtome (SP-1120) and were

subjected to following stains:

a) Haematoxylin and Eosin b) Immunostaining


Staining Procedure

Hematoxylin and Eosin methods: The following protocol was observed:

1. Slides were dewaxed by application of heat and 1-2 min. in xylol.

2. Hydration of sections done by graded alcohol (absolute alcohol, 80%, 70%, 50%).

3. Slides were washed in running tap water for 1-2 min.

4. Dipped in filtered haematoxylin stain for lOmin.

5. Washed in running tap water for 5-19 min.

6. Decolonized using 1% acid alcohol to remove the excess stain.

7. Rinsed in running water.

8. Counter stained with eosin 1% for 2-4 min.

9. Washed in running water to wash off excess stain.

10. Dehydrated by dipping in 95% ethanol and absolute alcohol-15 dips in each.

11. Cleared in xylol-15 dips. Mounted with DPX after drying.

Result

Cytoplasm of cells-pink

Nucleus- blue

Differentiation of tumors was analyzed according to the Broder's Classification as:

1. Well differentiated (Grade I) - < 25% undifferentiated cells

2. Moderately differentiated (Grade II) - <50% undifferentiated cells


3. Poorly differentiated (Grade III) - <75% undifferentiated ceils

4. Anaplastic/pleomorphic (Grade IV) - >75% undifferentiated cells

Methodology:

Immunohistochemistry Procedure:

• Positive Control: - Breast carcinoma (known to express p53 /cyclin Dl)

• Preparation of sections:

1. Formalin fixed, paraffin embedded sections were mounted on slides coated with poly-L-lysine solution.

2. Sections mounted on coated slides were incubated at 56°C overnight for better adhesion.

3. Sections were deparaffinized in xylol and hydrated through graded alcohols to Tris buffered saline (0.005 M TRIS buffer, pH7.6).

4. Antigen retrieval was done using citrate buffer (0.01 mol/L, pH 6.0) in a pressure cooker by heating up to one whistle and then allowing to cool to room temperature before opening the lid of cooker.

5. Endogenous peroxidase activity was blocked by treating sections with 3% hydrogen peroxide in methanol (LSAB Kit) for 10-15 minutes.

IMMUNOSTAINING:

1. Primary antibody (FL-393 and H-295 antibodies, Santa Cruz Biotechnology, USA for p53 and cyclinDl respectively) was added to the sections at room temperature and incubated overnight at SS C in a moist chamber.

2. Sections were then washed with three changes of TBS for 10 minutes each.

3. Sections were incubated in biotinylated secondary (Link) antibody at room temperature for 30 minutes in a moist chamber and washed in TBS(x3) for 10 minutes duration each.

4. Sections were incubated in streptavidin at room temperature for 45 minutes in a


moist chamber and washed in TBS.

5. Sections were incubated in freshly prepared 3, 3' diaminobenzidine tetrahydrochloride (DAB) solution. This was prepared by diluting DAB chromogen (1 drop) in 1 ml of DAB substrate.

6. Sections were washed in distilled water, counterstained in hemotoxylin (1-2 dips), dehydrated through graded alcohols, cleaned in xylol and mounted in DPX.

Results

Positive staining was identified in the form of strong dark brown nuclear staining of the

epithelial cells.

Scoring of positive immunostaining

For protein expression, only nuclear positivity (strong brown staining) was assessed

quantitatively. Cells with only cytoplasmic staining were not counted.

The quantification of protein positivity was done according to the method recommended

by Hall and Lane (1994) and adopted by Chiang et al, (2000). Only the percentage was

quantified and the percentage of positively stained cells in the whole layer of epithelium

was determined by scanning the entire section and was recorded as follows:

For Squamous cell carcinomas:

= No epithelial cells stained + (+1) = up to 25% of cells positive ++(+2) = 26 to 50% of cells positive +++ (+3) = > 50% of ceils positive

CHAPTER 3: MATERIALS & METHODS 6 5

Genomic DNA Isolation from Whole Blood

For the present study, genomic DNA was isolated from 5ml of human whole blood

samples, by Phenol-Chloroform method of DNA isolation.

1. Human blood (5ml) was collected in vial containing anti-coagulant EDTA (Img/ml).

2. Ice cold red cell lysis buffer ( 20ml, PH=7.6) was added to the blood sample in a falcon tube and kept on ice for 15 minutes with intermittent mixing several times to lyse RBCs.

3. The lysate was centrifuged at 6000 rpm for 15 min at 4°C.

4. The supernatant was discarded.

5. Steps 2 to 4 were repeated until the white nuclear pellet was obtained.

6. The pellet was suspended in 5 ml of lysis buffer (pH 8.0) buffer, followed by lOOul of proteinase K solution and 500nl of 10% SDS solution and incubated at 37 C on a shaker, overnight to lyse the nuclei.

7. Equal volume of Tris equilibrated phenol (pH 7.5-8.0) was added, mixed well and centrifuged at 4000 rpm for 10 min at room temperature.

8. The aqueous layer was transferred to another tube and equal volume of phenol: chloroform: isoamylalcohol (25:24:1) was added, mixed and centrifuged at 4000 rpm for 10 min at room temperature.

9. The aqueous layer was transferred to a fresh tube and equal volume of chloroform: isoamylalcohol (24:1) was added, mixed and centrifuged at 4000 rpm for 10 min at room temperature.

10. DNA was precipitated by adding double the volume of ice cold absolute ethanol to the aqueous layer by gently mixing ,spin and pellet was washed with 70% ethanol, air dried and dissolved in double distilled water.

Agarose Gel Electrophoresis

The isolated DNA samples were quantified by agarose gel electrophoresis using 0.8%

concentration of agarose in 0.5x TBE (Tris borate EDTA). Agarose (3% in 0.5x TBE)

was used for determination and identification of PCR products, after genomic DNA


samples were assayed by polymerase chain reaction. The location of DNA within the gel

can be determined directly by staining with low concentrations of fluorescent

intercalating dyes, such as Ethidium bromide. Agarose gels have a greater range of

separation. DNA's from 50 bp to several megabases in length can be separated on

agarose gels of various concentrations and configurations. Small DNA fragments (50-

20,000 bp) are best resolved in agarose gels run in a horizontal configuration in an

electric field of constant strength and direction. Under these conditions, the velocity of

the DNA fragments decreases as their length increases and is proportional to electric field

strength. The agarose gels casted with low concentration of agarose are capable of

resolving extremely large DNA molecules.

Preparation of Gel

Prior to the preparation of agarose gel, appropriate combs were set into the gel plate

according to the requirement of wells.

1. The solution was boiled, preferably in a microwave oven.

2. Then the solution was cooled down to 50°C.

3. Ethidium bromide (0.5 mg/ml) was added to the agarose solution, mixed and then poured into the gel plate.

4. When the gel was polymerized, combs were removed.

5. The gel was placed in the running apparatus filled with 0.5x TBE.

Preparation of samples to be loaded

The appropriate amount of each sample was transferred to a microfuge tube and mixed

with loading buffer to give final Ix strength.


Loading of samples into the wells:

1. The DNA samples or the PCR products were loaded into the wells using micropipette.

2. The electrophoresis chamber was closed with a lid and current was applied (5V/cm).

3. The bromophenol blue dye in the DNA samples acts as a "front wave" that runs faster than the DNA itself. When the "front wave" approached the end of the gel (app 3/4th of the gel), electrophoresis was terminated.

4. The DNA or PCR product was visualized in a UV transilluminator.

PCR-RFLP Genotyping

Polymerase chain reaction is a molecular biology technique which allows a small amount

of the DNA molecule to be amplified exponentially. PCR is an iterative process

consisting of three elements: denaturation of the template by heat (temperature, 94-96°C),

annealing of the oligonucleotide primers to the single stranded target sequence(s), the

temperature of this stage depends on the primers and is usually 5°C below their melting

temperature (45-60°C), and extension of the annealed primers by a thermostable

DNApolymerase, (Taq polymerase), this step takes 1 minute per thousand base pairs. In

PCR-RFLP, PCR products are subjected to restriction digestion overnight at 37°C, the

digestion products are resolved on agarose gel and bands are visualized.

hOGGI Genotyping

hOGGI genotyping was performed using a PCR-RFLP technique. The primers used to

identify the polymorphism at codon 326 of hOGGI were adopted from those published in

literature (Table 3.1). A 40-\il reaction mixture containing 29.71 [xl of double-distilled


water, 4nl of lOxPCR buffer , 1 |A1 of each primer (5 mM/nl), 1 nl of the mixture of

deoxynucleoside triphosphates (2.5 mM/ nO, 1.2 il of MgCl2 (50 mM/ ill), and 0.45 unit

of (5 unit/ jil) Taq DNA polymerase (Amersham Pharmacia Biotech) was used. The PCR

condition was initiated by a 4 min denaturation step at 94°C, followed by 35 cycles at 94^

C for 40 s, 55°C for 30 s, 72°C for 2 min. and a final step at 72''c for 10 minutes. The

PCR products were subjected to restriction digestion overnight at 37°C by Fnu4HI. The

digestion products were resolved on 3% agarose gel.

XRCCI Genotyping

XRCCI genotyping was performed using a PCR-RFLP technique. The primers used to

identify the polymorphism at codon 280 of XRCCI were adopted from those published in

literature (Table 3.1). A 40- pi reaction mixture containing 29.71 nl of double-distilled

water, lOxPCR buffer (4 |il), 1 |A1 of each primer (5 mM/ i l), 1 |il of the mixture of

deoxynucleoside triphosphates (2.5 mM/ |il), 1.2 nl of MgCb (50 mM/ \i\), and 0.45 unit

of (5 unit/ \x\) Taq DNA polymerase (Amersham pharmacia Biotech) was used. The PCR

condition was initiated by a 4- min denaturation step at 94" C, followed by 35 cycles at

94V for 40 s, 55''C for 30 s, 72°C for 2 min. and a final step at 72° C for 10 min. The

PCR products were subjected to restriction digestion overnight at 3 7 ^ by Rsal. The

digestion products were resolved on 3.0% agarose gel.

CYP2E1 Genotyping

The RFLPs in the 5' flanking region and in intron 6 of the CYP2E1 gene were determined

by PCR amplification followed by digestion with Rsal and Dral restriction enzymes


respectively. The primers used to identify the polymorphism at Rsal and Dral sites of

CYP2E1 were adopted from those published in literature (Table 3.1). Briefly, a 40- 1

reaction mixture containing 29.71 \i\ of double-distilled water, lOx PCR buffer (4nl), 1 1

of each primer(5 mM/^l),l}il of the mixture of deoxynucleoside triphosphates (2.5 mM/

nO, 1.2 \i\ of MgCb (50 mM/ ^1), and 0.45 unit of (5 unit/ nl),TaqDNA polymerase

(Amersham Pharmacia Biotech) was used. The PCR condition was initiated by a 4-min

denaturation step at 94°C, followed by 35 cycles at 94°C for 40 s, 55^0 for 30 s, 72° C for

2 min. and final step at 72''C for 10 min. The PCR products were subjected to restriction

digestion overnight at 37°C by Rsal and Dral (New England Biolabs, Inc., Beveraly, MA)

respectively. The digestion products were resolved on 3.0% agarose gels.

Table 3.1: Primer Sequences used in the PCR-RFLP of hOGGI, XRCCl, CYP2E1 Rsal and Dral genotyping

Target

CYP2E1

CYP2E1

GRXRCCl

GRhOGGl

F-Rsa R-Rsa F-Dra R-Dra F-280 R-280 F-326 R-326

Primer sequence (5'-3')

ccagtcgagtctacattgtca Ttcattctgtcttctaactgg tcgtcagttcctgaaagcagg gagctctgatgcaagtatcgca ttgacccccagtggtgct Ccctgaaggatcttccccagc actgtcactagtctcaccag ggaaggtgcttggggaat

Approximate size (bp)

410

995

188

200


statistical Analysis

An SPSS for windows computer programme (SPSS Inc. Chicago 11, USA, version 13)

was used for statistical analysis. The association between protein expression and tumor

location was analyzed by the Chi-square test. The relationship between protein

expression and histolopathological grade was analyzed by Kruskal-Wallis analysis of

variance (ANOVA) .Wilcoxon paired sample test was used to analyze the differences

within the three categories of histopathological grade and protein expression.

The chi-square test for heterogenity was used for categorical variables to test the

hypothesis that the distribution of allele prevalance was same for the cases and controls.

Conditional logistic regression technique was used to examine association of

polymorphisms with risk of oral cancer.


CHAPTER 4 OBSERVATIONS

In the present case control study, risk of oral cancer has been estimated in the

tobacco and betel quid chewers. Total 250 human subjects with 100 patients and 150

controls, who attended the ENT O.P.D. or were admitted in their ward in J.N.

Medical College Hospital, A.M.U., Aligarh from Nov, 2004 up to May, 2007 were

included in the study.

Age Incidence

In the present series, patients belonged to age group of 25-100 years, out of which

maximum incidence of cases(n=62) was seen between 50-75 years of age group

(62% of cases). Only 20% (n=20) and 18% (n=18) cases were in the age group of

25-50 years and 75-100 years respectively (Table 4.1). In controls, 50-75 age group

predominated with 60% (n=90) of the controls belonging to this age group. Only

6.66% (n=10), 18% (n=27) and 15.33 % (n=23) controls were in the age group of 0-

25, 25-50 and 75-100 age groups respectively.

Table 4.1: Occurrence of oral cancer in different age group of patients

CATEGORY Age Group (in yrs.)

0-25 25-50 50-75

75-100 Total

Male 0 13 48 14 75

CASES Female

0 07 14 04 25

Total 0

20 62 18

100

CONTROLS Male

7 21 68 19

125

Female 3 6

22 04 35

Total 10 27 90 23 150

CHAPTER 4: OBSERVATIONS 72

Sex Incidence

Out of the total 100 cases studied, 75 cases (75%) were males and rest (25%) were

female, male-female ratio being 3:1 (Table II). Out of 150 controls, 115 (76.66%)

were males and rest 35 (23.33%) were females, male: female ratio being 3.28:1.

Table 4.2.

Table 4.2: Number and percentage of patients in different sex groups

Category Sex Male Female Total

Cases Number

75 25 100

Percentage 75% 25% 100%

Controls Number

115 35 150

Percentage 76.6%

23.33% 100%

Mean age of male and female cases were 58 years and 53 years respectively and

average age of cases was 56.75 years (Table 4.3). Mean age of male and female

controls was 56 years and 54 years respectively and average age of controls was

55.53 years.

Table 4.3: Mean age of patient in different sex groups

Category

Sex

Male

Female

Total

Cases

Number

75

25

100

Mean age

58

53

56.75

Controls

Number

115

35

150

Mean age

56

54

55.53


Duration of Symptoms

Most of cases (68.97%) presented with some complaint within first 6 months of the

start of the lesion. Only 23.72% presented after 6 months to 1 year while 5.83% and

1.45% presented symptoms after 12 months and 18 months respectively (Table 4.4).

Table 4.4: Duration of initial presentation of clinical symptoms by patients

^^~~~—-__Î)uration (in months) ~~~-~-~..__^^

Presenting Complaint ~"~~~~--~~-,__ Difficulty in swallowing Burning in mouth & throat Pain during swallowing Swelling in neck Change in voice Pain in the lesion Pain in the ear Difficulty in opening the mouth Difficulty in speech Bleeding from the mouth Increased salivation

Total Percentage

<6

55 35 15 13 06 36 06 07 03 06 07

189 68.97%

6-12

14 08 14 07 03 11 04 -

01 01 02

65 23.72%

12-18

10 -

-

-

01 02 02 -

-

-

01

16 5.83%

18-24

01 02 -

-

-

01 -

-

-

-

-

04 1.45%

Symptoms of Patients

Most of the patients presented with multiple symptoms with difficulty in swallowing

being the most common symptom (80 cases). Pain in the lesion (50 cases), burning

in the mouth and throat(45 cases) and pain during swallowing(29 cases) were the

next common symptoms. Other complaints were less common as shown in table 4.5.

^ H CHAPTER 4: OBSERVATIONS 74

Table 4.5: Number of cases showing occurrence of different symptoms

S. No.

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11.

Presenting Complaint

Difficulty in swallowing Pain in the lesion Burning in mouth & throat Pain during swallowing Swelling in neck Pain in the ear Change in voice Increased salivation Difficulty in opening the mouth Bleeding from the mouth Difficulty in speech

No. of cases

80 50 45 29 20 12 10 10 07 07 04

Relation of Tobacco and Betel Quid Chewing with Oral Cancer

Out of 100 cases studied, all 100 (100%) had used tobacco & betel quid. Thirty

eight controls (out of 150) had used tobacco and betel quid (Table 4.6).

Table 4.6: Chi square values of tobacco and betel quid in oral cancer in patients and controls

""""• ---...... ^ Disease

Risk factor —..^ Tobacco & betel quid (Exposed) Non-users (Not exposed)

Total

Oral Cancer present (cases)

100 (a) 0

(c) 100

(a+c)

Oral Cancer absent

(Controls) 38 (b) 112 (d) 150

(b+d)

Total

138 (a+b) 112

(c+d) 250

(1) Exposure Rates:

Cases = a/(a+c) Controls = b/ (b+d)

100/100 38/150

100% 25.3%


This shows that the consumption of tobacco and betel quid is highly related with the

development of oral cancer as exposure rate among cases is very high i.e. 100% in

comparison to the low exposure rate of 25.3% among controls. However this cause-

effect relationship is examined more scientifically on the basis of various other

statistical tests like Chi-square test (x test).

Chi square test offers an opportunity of testing the significance of difference

between two proportions. This test is based on the "Null Hypothesis" viz. there is no

difference between tobacco and betel quid users and non-users in the development

of oral cancer. We shall now rewrite the previous table showing the observed (O)

and expected (E) values in each cell (Table 4.7).

Table 4.7: Exposure of tobacco and betel quid in oral cancer patients and controls to calculate x value

^ ^ ~~-._.,. ^ Disease

Risk factor -~—. Tobacco and betel quid chewers

Non-users

Total

Oral Cancer Present

0=100 E= 69

0=0 E=56

125

Oral Cancer Absent

0=38 E=69

0=112 E=56

125

Total

138

112

250

X = E (O-E)VE=135.226

The calculated value of x is 135.226 while the value ofp (Probability) at 95% level

of significance for 1 degree of freedom (d.f.) is .000.

It means that p<0.001 so it is "Statistically significant". It indicates that our "Null

hypothesis" was wrong and there is definite cause-effect relationship or we can say


that there is strong association between consumption of tobacco and betel quid with

development of oral cancer.

Socio Economic Status and Oral Hygiene

The role of these factors in the predisposition of patients to the development of oral

cancer was not studied. However it was noted that most of the sufferers belonged to

the lower socio-economic status and oral hygiene was poor in most of the patients.

Site of Lesion

Oral cancer most commonly occurred in buccal mucosa in cases. The incidence of

oral cancer in different sites of oral cavity is given below (Table 4.8).

Table 4.8: The incidence of oral cancer in different sites of oral cavity

S. No. 1. 2. 3. 4. 5. 6. 7.

Site of Lesion Tongue Buccal mucosa Lip Hard palate Floor of mouth Gingivia Retromolar region

No. of Cases 22 45 06 05 17 03 02

Percentage 22% 45% 06% 05% 17% 03% 02%

Oral cancer most commonly involved buccal mucosa and occurred in 45 cases

(45%). Next commonly it involved tongue (22%) and floor of mouth (17%)

respectively. Other sites are less commonly involved.


Histological Type of Lesion

All the biopsy samples of the patients were found to be having squamous eel

carcinoma on histopathological examination (Table 4.9).

Table 4.9: Distribution of oral cancer lesion in different histological types

Histological type Squamous cell carcinoma Adenocarcinoma Lymphoepithelioma

No. of cases 60 0 0

Percentage 100 0 0

Immunohistochemical Studies

p53 Protein Expression

Tissues of oral SCC patients with tobacco and betel quid chewing habit (60

specimens) and 10 normal oral tissues were subjected to immunohistochemical

staining for expression of p53 using FL-393 antibody (Santa Cruz Biotechnology,

USA). Only strong brown nuclear staining of epithelial cells was considered

positive. Those histological sections with uniform and good intensity were assessed

for p53 scoring. The scores obtained were expressed as:

Positive cases (%)^ the percentage of cases showing positive staining with IHC.

p53 positivity (%)-> the percentage of cells showing a positive staining-i;eaction with P53 IHC.

p53 was expressed in 65% (n=39) of the cases but was not expressed in controls.

Figure 1 (A-D) shows the expression of p53 in tobacco and betel quid chewers as

well as in controls. There were 34(56.6%) cases of well differentiated SCC,


^ * ' • " • . . • ' - " • - • •

' ^ J -

^"•:-/

".W--. , V-V.»r-'.

• • • " ' * " , • ; • • • • . ' " '

Representative Figu

',«• '/ :.

• ... i ,.

^,

.

yi '^ u<R( a jSuSn **'

, • ** ,.."

r:*'*. f',4''"A- 4-"*'."

re Showing Expression of pS3 in Normal Tissue

Representative Figure Showing Expression of pS3 in IVIoderately Differentiated Oral SCC

•

% •

t

•

# •

Representative Figure Showing Expression of pS3 in Well Differentiated Oral SCC

• « f >

Representative Figure Showing Expression of pS3 in Pooriy Differentiated Oral SCC

Figure 1 (A - D): Immunohistochemical detection of p53 using p53 antibody in tissues obtained from oral cancer patients


18(30%) cases of moderately differentiated SCC and 8(13.3%) cases of poorly

differentiate SCC. Table 4.10 depicts the positive cases (%) and mean p53 positivity

(%) in oral SCC patients and controls along with their sub categories.

Table 4.10: p53 Expression in oral SCC's in tobacco and betel quid chewers

Histological Diagnosis

Category

Oral SCC a)Well differentiated b)Moderately differentiated c)Poorly differentiated Controls

Total Cases

60 34 18 08 10

p53 Expression Positive cases

(%) 39(65%) 20(58.8%) 13(72.22%) 06(75%) 0

Negative cases (%)

21(35%) 14(41.2%) 05(27.77%) 02(25%) 10

Positivity

Mean + SD

26.46 ±23.90 20.0+19.32 29.33+23.50 47.5+31.38 0

Range

0-75 0-55 0-70 0-75 0

It was found that there was no detectable level of p53 expression in controls (Figure

lA) while in oral SCC patients with tobacco and betel quid chewing habit, the

percentage of positive cases as well as p53 positivity showed an increase with

elevated grade of SCC (Figure 2).

It was found that expression of p53 was significantly associated with histological

grade in oral cancer in tobacco and betel quid chewers (x^=7.077, df=2, p=0.029).

Statistically significant difference in p53 positivity was observed on comparing well

differentiated SCC (p53 positivity= 20+19.32) with poorly differentiated SCC (p53

positivity=47.5+31.38, p=0.001) but no statistical significance (p=0.27) was

observed in p53 positivity between poorly differentiated SCC (p53 positivity=

47.5+31.38) and moderately differentiated SCC (p53 positivity= 29.33+23.50), as


80

70

60

SO

8 a. 40

^ 3 0

20

10

• Positiviy(%) {•Maan

Total OSCC WDSCC MOSCC POSCC

Figure 2: Expression of p53 in oral SCC's in tobacco and betel quid chewers

well as between well differentiated SCC (p53 positivity= 20+19.32) with

moderately differentiated SCC (p53 positivity=29.33±23.50, p value =0.27).

Expression of p53 in various sites of oral cavity was investigated and it was found

that p53 was more frequently expressed in sites like gingivia (-,100%), floor of

5 20 7 1 mouth (-,71%) buccal mucosa (—,64.5%) tongue (—,70%) and lip (-,60%)

7 31 10 5

while less frequently in sites like hard palate (2/4,50%) and retromolar region


(—,50%). Further the association between expression of p53 and site of incidence

of oral cancer was evaluated. It was found that there is no significant association

between p53 expression and primary site of incidence of oral cancer (x =1.427,

df=6, p=0.964)

Cyclin Dl Expression

Tissues of oral SCC patients with tobacco and betel quid chewing habit (60

specimens) and 10 normal oral tissues were subjected to immunohistochemical

staining for expression of Cyclin Dl using H-295 antibody (Santa Cruz

biotechnology, USA). The strong brown nuclear staining of epithelial cells was

considered positive. Those histological sections with uniform and good intensity

were assessed for Cyclin Dl scoring. The scores obtained were expressed as:

• Positive cases (%)^ the percentage of cases showing positive staining with IHC.

• Cyclin Dl positivity (%)-> the percentage of cells showing a positive staining reaction with Cyclin Dl IHC.

Cyclin Dl was expressed in 58.33% (n=35) of the cases but was not expressed in

controls. Figure 3 (A-D) shows the expression of Cyclin Dl in tobacco and betel

quid chewers as well as controls. There were 34(56.6%) cases of differentiated SCC,

18(30%) cases of moderately differentiated SCC and 8(13.3%) cases of poorly

differentiated SCC. Table 4.11 depicts the positive cases (%) and mean Cyclin Dl

positivity (%) in OSCC patients and controls along with their sub categories.


Representative Figure Showing Expression of Cyclin Dl in Normal Tissue

V " • " • • • . . • . ' . , i i H . . - J •" - . ' . . .

B Representative Figure Showing Kxpression of

Cyclin Dl in Well Differentiated Oral SCC

mmm^mm •7-':JSW.-^

Representative Figure Showing Expression of CycUn Dl in Pooriy Differentiated Oral SCC

Figure 3 (A - D): Immunohistochemical detection of Cyclin Dl using Cyclin Dl antibody in tissues obtained from oral cancer patients

83 CHAPTER 4: OBSERVATIONS

Table 4,11: Cyclin Dl Expression in Oral SCC's in tobacco and betel quid chewers

Histological Diagnosis

Category

Oral s e c a)Well differentiated b)Moderately differentiated c)Poorly differentiated Control

Total Cases

60 34 18 08 10


Positive cases (%)

35(58.33%) 18(52.94%) 11(61.1%) 06(75.0%) 0

Negative cases (%)

25(41.6%) 16(47.05%) 07(38.88%) 02(25%) 10

Positivity

Mean ± SD

22.16±22.18 16.61±17.89 24.38±21.93 37.0±32.51 0

Range

0-75 0-51 0-70 0-74 0

As revealed by immunohistochemistry, there was no cyclin Dl expression in

controls (Figure 3A) while in oral SCC patients with tobacco and betel quid

chewing habit, the percentage of positive cases as well as cyclin Dl positivity

showed an increase with high grade of SCC (Figure 4).

80

70

60

SO

40

30

20

10

• P(MilMly(%)

TOTAL OSCC WDSCC MDSCC PDSCC

Figure 4: Expression of Cyclin Dl in oral SCC's in tobacco and betel quid chewers


It was found that there is no statistically significant association between Cyclin Dl

expression and histological grade in oral cancer in tobacco and betel quid chewers

(X =3.954, df=2, p=0.138). However statistically significant difference (p=.002)

was observed in Cyclin Dl positivity between well differentiated SCC (Cyclin Dl

positivity=16.61±17.89) and moderately differentiated SCC (Cyclin Dl positivity=

24.38+21.93) as well as between well differentiated SCC (Cyclin Dl

positivity= 16.61 ±17.89) and poorly differentiated SCC (Cyclin Dl

positivity=37.0±32.51), p=.043. Similarly, statistically significant difference was

observed between moderately differentiated SCC (Cyclin Dl positivity=

24.38+21.93) and poorly differentiated SCC (Cyclin Dl positivity=37.0±32.5]), p

value=0.043.

Expression of Cyclin Dl in various sites of oral cavity was investigated and it was

found that Cyclin Dl was more frequently expressed in sites like hard palate

3 "l —,75% , buccal mucosa 4 /

21 31

,67% I and lip -,60% and less frequently in gingivia v5 )

°,00/. , tongue f 4 — ,40% I and floor of mouth

lio

4 - , 4 3 % 7

The association between expression of Cyclin Dl and sites of incidence of oral

cancer was also evaluated in our study. It was found that there is no significant

association between Cyclin Dl expression and primary site of incidence of oral

cancer (;f-=5.122, df=6, p=0.528).



Blood was collected in EDTA vials from 100 patients of oral cancer with tobacco and

betel quid chewing habit and 150 age and gender matched healthy controls were recruited

for the study and used for isolation of DNA.

Genomic DNA was subjected to the agarose gel electrophoresis for assaying its quality

and quantity. Figure 5 shows a representative agarose gel of the genomic DNA isolated

from patients with tobacco and betel quid chewing habit and healthy controls.

XRCCI Genotyping

PCR-RFLP based analysis of XRCCI codon 280 gene polymorphism was carried out by

the method of Cho et al, 2003. The polymorphism results in mutation from A to G in

exon I at codon 280 which resulted in the replacement of Arginine by Histidine. The PCR

products were subjected to restriction digestion overnight at 37°C by Rsal. The PCR

products were resolved on 3.0% agarose gel. Two bands at 126 and 62 bp characterized

the wild type Arg allele for codon 280 while a single band at 188 bp characterized the

variant type His allele and heterozygotes (Arg/His) showed all the three bands (Figure 6).

The distribution of XRCCI codon 280 genotype frequencies in oral cancer patients and

age and gender matched healthy controls is summarized in Table 4.12.


Kl K2 K3 K4 K5 K6 K" K8 K9 KIO Kll

DNAbaiul «-23.13kb 4-9.41 kb <-6.55kb «-4.36kb

«-2.32kb ^ 2.02 kb

«-0.56kb

Figure 5: RepresentativeGd of DNA Isolated from oral carx»r patients

Integrity of DNA isolated from the specimens was analysed by 0.8% agarose gel electrophoresia In this figure lanes representing are DNA samples isolated from b)lood of healthy controls& patients having oral cancer.

CHAPTH? 4: OBSERVATI ONS 87

UD kl k2 lc3 k4 kS k6 VI k8 k9 klO kll kl2 kl3 kU kl5 kl6 kl7 kl8

Figure 6: Representative Gel of PCR-RFLP analysis ofX/?CC7/280 codon in oral cancer patients

RFLPs of PCR-amplified fragments obtained using Rsal and subjected to Polyacrylamide gel electrophoresis. Kl, homozygote variant His allele at codon 280; k2, k3, k4, k5, k6, k7, k9, klO, kl 1, kl3,kl4, kl6, kl7, kl8„ homozygote wild type Arg allele at codon 280; kl5, heterozygote. A single band at 188 bp characterizes the variant type His allele at codon 280; two bands at 126 and 62 bp characterize the wild type Arg allele for codon 280. DNA was isolated from blood as described in materials and methods.


Table 4.12: Distribution of XRCCI codon 280 genotypes in oral cancer patients

XRCCI Genotypes

Arg/Arg

Arg/His

His/His

Healthy Controls (N%)

116(77.33%)

32(21.33%)

02(1.33%)

Oral Cancer Patients (N%)

62(63%)

33(33%)

04(4%)

p value

.015

Odds Ratio

1.63(95 CI=1.1-2.413)

The XRCCI (Arg/His) genotype was observed in 33% of patients as compared to 21.33%

in controls, and XRCCI (His/His) genotype was observed in 4% of patients as compared

to 1.33% in controls.

XRCCI Arg^ °His Polymorphism was found to be associated significantly with risk of

oral cancer in tobacco and betel quid chewers (p=.015 ).The individuals with variant

genotypes (Arg/His or His/His) were at increased risk of oral cancer ( 0R= 1.63, 95%

CI= 1.1-2.413) as compared to individuals having wild type homozygous genotype

(Arg/Arg).Thus it can be concluded that XRCCI (Arg/His , His/His) genotypes are

closely related with high risk of development of oral cancer in tobacco and betel quid

chewers.

hOGGl Genotyping

hOGGl codon326 gene polymorphism was carried out by the method of Le Marchand et

al, 2002.The polymorphic mutation at codon 326 results in the replacement of Serine by

Cysteine. The PCR products were subjected to restriction digestion overnight at 37''C by

fhu4Hl. The digestion products were resolved on 3% agarose gel. A single band at 200bp


characterized the wild type Serine allele at codon 326 while a band at 100 bp

characterized the variant Cysteine allele while heteozygotes (Cys/Ser) show both the

bands (Figure 7). The distribution of hOGGl genotype frequencies in oral cancer patients

and age and gender matched healthy controls is summarized in table 4.13.

Table 4.13: Distribution of hOGGl codon 326 genotypes in oral cancer patient's oral cancer

Genotype

Ser/Ser (Wild type) Cys/Ser Cys/Cys (Variant)

Healthy Controls N (%)

125(83.33%) 22 (14.66%)

03 (2%)

Oral cancer patients N (%)

61(61%) 32(32%) 07(7%)

p-value

.000

Odds ratio (OR)

2.3(95% CI=1.5-3.61)

The hOGGl (Ser/Cys) genotype was observed in 32% of patients as compared to

14.66%! in controls, and hOGGl (Cys/Cys) genotype was observed in 7% of patients as

compared to 2% in controls.

hOGGl Ser ' ^Cys polymorphism was found to be significantly associated with the risk of

oral cancer in tobacco and betel quid chewers (p=.000). The individuals with the variant

genotype ( Cys/Cys or Ser/Cys) were at increased risk of oral cancer as compared to

individuals having wild type genotype (0R= 2.3, 95%)C1= 1.5-3.61). The data of present

study suggest that hOGGl (Ser/Cys) and (Cys/Cys) genotypes are closely related with

high risk of development of oral cancer in tobacco and betel quid chewers.


UD Icll kl2 kl3kMkl51tl6 kl7 kl8 kl9 k20 k21 k22 k23 k24 k2S k26k27 k28 M

Undigested

Figure 7: Representative Gel of PCR-RFLP analysis of hOGGl/326 codon in oral cancer patients

RFLPs of PCR-amplified fragments obtained using Fnu4H\ and subjected to Polyacrylamide gel electrophoresis. UD, undigested; M, marker. K13, K15, K18, K20, K21, K24, K27, homzygote wild type Ser allele at codon 326; Kll, K12, K14, K16, KIT, K19, K22, K23, K25, K26, K28, heterozygote Cys variant at codon 326;. A single band at 200 bp characterizes the wild type Ser allele at codon 326; a band at 100 bp characterizes the variant Cys allele. DNA was isolated from blood as described in materials and methods.


CYP2E1 Genotyping

PCR-RFLP based analysis of CYP2E1 gene polymorphism was carried out by following

method of Wen Tan et ai, (2000) and Kato et al, (1994) for Rsa 1 and Oral

polymorphisms respectively. The RFLP in the 5' flanking region and in intron 6 of the

CYP2E1 gene were determined by PCR amplification followed by digestion with Rsal

and Dral respectively. Rsal specific primers produced a 410 bp product. Rsal digestion

produced three CYP2E1 genotypes, i.e., the predominant homozygote A/A, the

heterozygote A/C, and the rare homozygote C/C. The predominant allele (A) was

sensitive to Rsal digestion and resulted in two fragments at 360 and 50 bp, whereas the C

allele was resistant to Rsal digestion and heterozygotes (A/C) show all the three bands.So

variant homozygote individuals have a single 410 bp band (C allele homozygous,C/C)

where as Rsal-site homozygotes have a smaller sized band (360 bp) in case 50 bp

fragment has run out (homozygous type A/A genotype). Heterozygous cases should have

two bands 410 bp and 360 bp after a 50-bp fragment has run out (genotype A/C) (Figure

8). The distribution of CYP2EI Rsal genotype frequencies in oral cancer patients and age

and gender matched healthy controls is summarized in Table 4.14.

Table 4.14: Distribution of CYP2EI Rsal genotypes in oral cancer patients

Genotype

A/A (Wild type) A/C variant

C/C (variant type)


120(80%) 27(18%) 03(2%)


60(60%) 34(34%) 06(6%)

p-value

.001

Odds ratio (OR) 2.0

(95C1 = 1.3-2.9)


M kl k2 k3 k4 k3 k6 k7 k8 k9

Figure 8: Representative Gel of PCR-RFLP analysis of CYP2E1/Rsal in oral cancer patients

RFLPs of PCR-amplified fragments obtained usiftg Rsal, and subjected to Agarose gel electrophoresis. k8 and k9 hetrozygote A/C allele; k5 homozygote C/C allele; k2, k3, k6,k7 homozygote A/A allele. Variant homozygote individuals have a single 410 bp band (C allele homozygous,C/C) where as Rsal-site homozygotes have a smaller sized band (360 bp) in case 50 bp fragment has run out (homozygous type A/A genotype). DNA was isolated from blood as described in materials and methods. DNA was isolated from blood as described in materials and methods.


The occurrence of CYP2E1 (A/C) genotype was observed in 34% of patients as

compared to 18% in controls and CYP2E1 (C/C) genotype was observed in 6% of

patients as compared to 2% in controls.

CYP2ElRsal polymorphism was found to be significantly associated with the risk of oral

cancer in tobacco and betel quid chewers (p=0.001). The individuals with the variant

genotype (A/C or C/C) were at increased risk of oral cancer as compared to individuals

having wild type genotype (0R= 2.0, 95% Cl= 1.3-2.9). It can be concluded that

CYP2E1 (A/C) and (C/C) genotypes are closely related with high risk of development of

oral cancer in tobacco and betel quid chewers. In CYP2E1 Dral polymorphism, Dral

specific primers produced 995 bp product. Dral digestion produced three CYP2E1

genotypes: (a) the predominant homozygote, DD; (b) the heterozygote, CD; and (c) the

rare homozygote, CC. Dral site yielded 3 fragments of 572-, 302-, and 121- bp (D allele

homozygous, D/D) while its absence yielded 874- bp band and 121- bp band (C allele

homozygous, C/C) while heterozygotes (D/C) showed 874-, 572-, 302-, and 121-bp

bands (Figure 9).The distribution of CYP2E1 Dral genotype frequencies in oral cancer

patients and age and gender matched healthy controls is summarized in Table 4.15.

Table 4.15: Distribution of CYP2E1 Dral genotypes in patients

Genotype

D/D(Wild type) C/D C/C (variant)


102(68%) 47(31.33%) 01(0.66%)


56(56%) 39(39%) 03(3%)

P-value

.049

Odds ratio (OR)

1.37(0.9-1.89)


The CYP2E1 (C/D) genotype was observed in 39% of patients as compared to 31.33% in

controls and CYP2E1 (C/C) genotype was observed in 3% of patients as compared to

0.66% in controls. CYP2E1 Dral polymorphism was found to be significantly associated

with the risk of oral cancer in tobacco and betel quid chewers (p=.049). The individuals

with the variant genotype (C/D or C/C) were at increased risk of oral cancer as compared

to individuals having wild type genotype (0R= 1.37, 95% Cl= 0.9-1.89). Thus, it can be

concluded that CYP2E1 (C/D) and (C/C) genotypes are closely related with high risk of

development of oral cancer in tobacco and betel quid chewers.

CHAPTER 4; OBSERVATIONS 95

kl k2 k3 k4 k5 k6 k7 UD M

995 bp

874 bp

572 bp

302 bp

121 bp

"--.

— •

•-1031bp «-900 <-800 •-TOO •-600 «-500 «^D0 «-300

•-200

MOO «-80

Figure 9: Representative Gel of PCR-RFLP analysis of CYP2E1/Dral in oral cancer patients

RFLPs of PCR-amplified fragments obtained using Dral and subjected to Agarose gel electrophoresis, kl, k6, k2 homozygote DD genotype; k3 homozygote CC genotype; k4, k5 heterozygote CD allele. Dral site yielded 3 fragments of 572-,302-, and 121- bp (D allele homozygous, D/D) while its absence yielded 874- bp band and 121-bp band (C allele homozygous, C/C) .DNA was isolated from blood as described in materials and methods.


CHAPTER 5 DISCUSSION

Oral cavity cancer is one of the commonest cancers in India and other South Asian

countries (Park, 2005). It is a major cause of cancer morbidity and mortality, and its

poor prognosis ensues in full blown cancer (Pindborg, 1977; Saranath, 2000).

Therefore an improvement in prevention and control is of critical importance.

Researchers agree that the early diagnosis of oral carcinoma greatly increases the

probability of cure with minimum impairment and deformity. In this regard,

detection of mutations in tumor suppressor genes or oncogenes and interindividual

variability in sensitivity to the carcinogens might facilitate identification of

individuals who are at a high risk of developing cancer.

Keeping this in view, the purpose of the present study was to evaluate the

expression of p53 (tumor suppressor gene) and Cyclin Dl (cell Cycle regulator

gene) as well as association of DNA repair genes (hOGGI Ser^^^Cys, XRCCI

Arg^^^His) and drug metabolizing gene (CYP2E1 Rsal and Dral) polymorphisms

with risk of oral cancer in tobacco and betel quid chewers of northern India.

The present study included 100 patients and 150 healthy subjects as controls.

Biopsy specimens were taken from 60 oral cancer patients and 10 controls. Blood

samples were collected from all the human subjects. A thorough proper history with

special emphasis on the areca nut & betel quid intake was taken. Patients having

habit of smoking and/or alcohol intake were excluded from the present study.

CHAPTER 5: DISCUSSION 97

Age Incidence

In this study the highest number was between 50-75 years of age group i.e. 62

individuals (62%) suffering from cancer. Peak age incidence in Wahi's series (1958)

was 50-54 years while in another study by Sanlcararanayanan et ai, (1989), 45% of

oral cancer cases were between 5" & 6" decade. In study by Chiang CP et al,

(1999), 51.85% patients belonged to 50-70 age group. The maximum incidence,

according to Kuo MY et al, (1999), is between 50-70 year age group (64.5%) while

in another study by Huang et al, (2001), 60% of oral cancer cases were between 50-

70 year age group.

There was no significant difference in age incidence between the age groups of

patients of our series and that of other workers.

The average age in this study was 56.75 years in patients in comparison to 54.8

years in the study of A.Nandakumar et al, (1990) and 50.35 years in the study of

D.N. Rao et al, (1994). The average age in study by Stefania Staibano et al, (1998)

was 62.04 years while it was 50 years in study by Chang et al, (2002).

Sex Incidence

Oral cancer is more common in males as compared to females. Krihna et al, (1967)

reported the incidence of males to be 77.6% while Mehrotra R. et al, (2003) from

Motilal Medical College Allahabad have reported about 74% of oral cancer in

males. In our series, also, males constituted about 15% of the total cases.


In Wahi's series (1958), the male female ratio was 2:1. In case control study by

Krishna et al, (1967), there were 552 males and 224 females i.e. 2.5:1 ratio. In

Mehrotra series, (2003), the female ratio was 2.3:1. In our series, it was 3:1. Mean

age of male and female cases in our series was 58 and 53 years respectively while

the mean age was found to be 63.5 years for males and 60.6 years for females in

study by Langdon JD et al, (1977).

Relation of tobacco and betel quid chewing with oral cancer

In our study we have observed that tobacco and betel quid chewing is significantly

associated with development of oral cancer. In India, association of tobacco and

betel quid chewing and smoking with oral cancer has been demonstrated in earlier

studies (Jayant et al, 1977, Motani, 1988; Shankaranarayanan et al, 1989;

Nandakumar et al, 1990). The observations made by all of them pointed that the

habit of tobacco and betel quid chewing is important risk factor in development of

oral cancer. Our findings are in accordance with observation made by earlier

studies.

Habit of Paan chewing is common in India in both genders. Paan generally includes

calcium hydroxide, areca nut (from the areca catechu tree) and betel leaf (from the

piper betel vine). R. Sankaranarayanan et al, (1989) showed that paan-tobacco

chewing is major risk factor for cancers of buccal and labial mucosa. Similarly

Nandakumar et al, (1990) confirmed that paan tobacco chewing is a major risk

factor in the occurrence of cancers of the oral cavity. In the study conducted by


Prabha Balaram et al, (2002), 591 oral cancer cases (309 males and 282 women)

with 584 hospital controls were taken. They found that most cases of oral cancer in

both genders were attributed to habit of paan tobacco intake.

Incidence of site of lesion

In our series, maximum 45 cases (45%) were of cheek carcinoma (Buccal mucosa)

followed by malignancy of tongue (22%) and the floor of mouth (17%).

In Wahi's series (1958), cases of carcinoma cheek were maximum in the oral cancer

patients (53.91%). In a study conducted by Rao et al, (1994), the frequency of

carcinoma cheek was maximum (44.4%). In study conducted by Agarwal et al,

(1999), buccal mucosa was predominant site in betel related oral cancer. Ranasinghe

et al, (1993) have also shown that buccal mucosa cancer is predominant site of oral

cancer in tobacco and betel quid chewers while Chang et al, (2002) found 57.8%

cases of oral cancer to be cheek carcinomas in betel and tobacco related oral cancer.

Our findings about incidence of site of lesion are in accordance with earlier studies.

p53 Expression

The immunohistochemical detection of p53 in biopsy specimen as a potential marker is

of immense interest to researchers, as it is most commonly identified mutated gene in

various human cancers like lung, breast, prostrate and oral cancer.


The gene coding for p53 protein i.e. TP53 is located on human chromosome 17 P 13:1

and encodes a 53 KDa nuclear phosphoprotein that plays an important role in regulation

of normal cell proliferation (Raybaud-Diogene et al, 1996;Lane and Benchimol, 1990).

The wild type p53 protein has a half life time of 6-20 minutes (Chiang et al, 2000), while

the mutant form has a half life of several hours and can be detected

immunohistochemically.

p53 mutations are often associated with the development and/or progression of malignant

neoplasm (Allred et al, 1993). About 90% of mutation at p53 locus were found to be

mis-sense mutations, within the region of exon 5 to 8 (Lane DP, 1998 and Lain et al,

1999). Immunohistochemical studies of p53 expression in SCC of oral mucosa has shown

overexpression of p53 protein (Kaur e/a/., 1994; Kuttan e/o/., 1995; Baral e/a/., 1998;

Change/a/., 1999; Chiang e/a/., 1999; Pande er o/., 2002).

In the present study, immunohistochemical studies for p53 expression was done on

formalin fixed and paraffin embedded tissue sections, using FL-393 antibody (Santa Cruz

Biotechnology) on biopsy specimens of 60 oral SCC patients with tobacco and betel quid

chewing habit and 10 controls. Only strong brown nuclear staining was considered

positive and p53 scoring was done in accordance to Hall and Lane (1994) and Chiang et

al, (2000). The scores were expressed as the percentage of positive cases in each

category and the percentage of p53 positivity in each case.

In control specimens who were taken from normal individuals, there was no expression


of p53 protein. This can be attributed to fact that p53 in its wild form has very short Hfe

time (16-20 min) and can not be detected by immunohistochemistry. In present study,

increased percentage of positive cases as well as mean p53 percent positivity was

observed with increasing grade of differentiation in oral squamous cell carcinoma (oral

SCC) patients with tobacco and betel quid chewing habit. Thirty nine oral SCC cases

(65%) showed positive p53 expression and mean positivity was 26.46 + 23.90.

Many previous studies have reported similar positivity in oral SCC patients with tobacco

r32'i and betel quid chewing habit. Agarwal et al, (1999) reported that 65.3% — of cases

of oral SCC with tobacco and betel quid chewing habit showed p53 positivity while

( 69 Pande et al, (2002) reported 65% positivity, Jie Xu et al, (1998) reported 59%

— positivity and Kaur et al, (1998) reported 70% positivity respectively in

patients with tobacco and betel quid chewing habit. However lower values were observed

by Kuttan et al, (1995), Baral et al, (1998), Thongsukai et al, (2001) who reported

^ 3 ^

U3, 56.5% ,

^22^

v48y 45.8%, and

032^ V'56y

38.5% positivity respectively but all researchers

reported increase in number of positive cells.

In our study, we further investigated the expression of p53 in various sites of oral cavity.

p53 expression was more frequently seen in gingivia (-, 100%), floor of mouth


5 20 (-,71%), tongue (7/10, 70%) and buccal mucosa (— ,64.5%). There are only few

studies which have correlated the expression of p53 with site of incidence in oral cavity.

Kaur et al, (1998) found that there was no association between p53 expression and

primary site of cancer (p=0.08). Similarly Claudia et al, (2006) found no association

between p53 expression and different oral sites (p=0.53). In our study, expression of p53

was not found to be associated with site of oral cancer (p=0.964) thus supporting the

earlier studies that p53 expression is independent of site of incidence of oral cancer.

The complete absence of p53 positivity in some squamous cell carcinomas was explained

by Nylander et al, (2000), as the tumors completely lacking detectable p53 could either

comprise of wild tumor protein or have a change in function in TP53 gene resulting in

production of a truncated, non-functional and non detectable protein.

The relationship between p53 expression and tumor grade was also evaluated in our

study. An increased positivity with increasing grade was observed in the present study.

The difference was found to be significant between well differentiated (20.0 ± 19.32) and

poorly differentiated (47.5 ± 31.38) oral SCC, p=.001. However no statistical

significance (p=0.27) was observed in p53 positivity among poorly differentiated

SCC (p53 positivity = 47.5 ± 31.38) and moderately differentiated SCC (p53

positivity = 29.33 ± 23.50), as well as between well differentiated SCC (p53

positivity = 20 ± 19.32) and moderately differentiated SCC (p53 positivity = 29.33

±23.50), p value =0.27.


Although most of the published data have shown no positive relationship between p53

expression and histological grading of oral SCC (Chiang et al, 1999; Saranath et al,

1999. Kerdpon et al, 2001). However, some studies have demonstrated a positive

correlation between p53 expression and high grade of malignancy (Kaur et al, 1998). In

our study, significant association was found between p53 positivity and degree of

differentiation of tumors (p= .029). Similar to results in our study, Zariwala et al, (1994)

and Shintani et al, (1995) found a tendency towards higher incidence of p53 positivity in

poorly differentiated oral carcinomas.


Cyclin Dl gene encodes a protein that is a cell cycle regulator (Hunter et al, 1994). The

Cyclin Dl gene (CCNDl, bcl-1 or PRADl) located on chromosome 1 Iq 13 (Jaun Carlos

et al, 2002) encodes a protein that forms a complex with Cyclin dependent Kinases,

CDK4 and CDK6. Cyclin D-CDK4 and CDK6 complexes phosphorylate Rb

(Retinoblastoma) protein during the Gl-S transition which leads to their dissociation

from the EF2 transcriptional factor and the initiation of DNA replication (Michalides

RJAM et al, 1999; Kudo et al, 2000). Cyclin Dl overexpression, either by amplification

or transcriptional upregulation, shows accerelated Gl progression and cell enters in the S

phase, with lower cell dependence on growth factors for proliferation (Kuo MY et al,

1999).

Immunohistochemical studies of cyclin Dl expression in SCC of oral cavity has shown

overexpression of cyclin Dl protein (Akerall JA et al, 1997; XU J et al, 1998; Lam KY


et al, 2000). In present study, immunohistochemical studies for cyclin Dl expression

was done on formalin fixed and paraflTin embedded tissue sections, using H-295 antibody

(Santa Cruz Biotechnology) on biopsy specimens of 60 oral SCC patients with tobacco

and betel quid chewing habit and 10 controls. Only strong brown nuclear staining was

considered positive and the scores were expressed as the percentage of positive cases in

each category and the percentage of Cyclin Dl positivity in each case.

In control specimens who were taken from normal individuals, there was no expression

of Cyclin Dl protein. In present study, an increased percentage of positive cases as well

as mean cyclin Dl positivity was observed in oral SCC patients with tobacco and betel

quid chewing habit. Thirty five oral SCC (58.33%) cases showed positive Cyclin Dl

expression and mean positivity was 22.16 ± 22.18.

Many previous studies have reported similar positivity in oral SCC patients. Arora et al.,

(2004) reported that 61% of cases of betel related oral SCC showed Cyclin Dl positivity

while Lam et al, (2000) reported 63% positivity. Similarly Staibano et al, (1998)

reported 60% positivity and Gimenez-conti IB et al, (1996) reported 61% positivity for

Cyclin Dl in oral SCC patients. Angadi et al, {imi), Akervell et al, (2002), Kuo et al,

(1999) and Van Oijen et al, (1998) have observed higher cyclin Dl positivity in oral

SCC patients and have reported 70.7%), 78%, 83% and 69% positivity respectively.

However lower values were observed by koontongkaew et al, 2000, Takes et al,

(1998); Xu J et al, (1998); Akervall et al, (1997), Michalides et al, (1995) who


reported 39.62%, 29%, 38%, 43% and 33% positivity respectively for Cyclin Dl in oral

s e c patients.

In our study, we further investigated the expression of Cyclin Dl expression in various

sites of oral cavity. Cyclin Dl expression was more frequently expressed in hard palate,

buccal mucosa and lip and less frequently in tongue and floor of mouth. There are only

few studies that have described the expression of Cyclin Dl in various sites of oral cavity

in oral SCC patients. Akervell et al, (1997) and Xu J et al, (1998) reported that

expression of Cyclin Dl in oral SCC patients was more frequently seen in sites like

tongue and retromolar region. In our study, Cyclin Dl expression was more frequently

expressed in hard palate \

- ,75% 4

21 • , buccal mucosa | —,67% and lip

31 ) -,60%

v5 J . The

correlation between Cyclin Dl expression and primary site of oral cancer was also

evaluated in our study. It was found that there was no significant association between

Cyclin Dl expression and primary site of oral cancer (p=0.528). Similar results were

reported by various studies (Kuo et al, 1999; Carlos et al, 2002) who found no

association between Cyclin Dl expression and primary site of oral cancer.

The relationship between Cyclin Dl expression and tumor grade was also evaluated in

our study. An increased positivity with increasing grade was observed in the present

study. The difference was found to be significant between well differentiated SCC

(Cyclin Dl positivity=l6.61 ±17.89) and moderately differentiated SCC (Cyclin Dl

positivity= 24.38+21.93, p=.002) as well as between well differentiated SCC

(Cyclin Dl positivity= 16.61 +17.89) and poorly differentiated SCC (Cyclin Dl

CHAPTER S: DISCUSSION 106

positivity=37.0±32.51, p=.043). Similarly statistically significant difference was

observed between moderately differentiated SCC (Cyclin Dl positivity=

24.38±21.93) and poorly differentiated SCC (Cyclin Dl positivity=37.0±32.51, p

=.043). Although most of published data have shown no positive relationship between

Cyclin Dl expression and histological grade of oral SCC (Kuo MY et al, 1999; Wu M et

al, 2002; Neves Adac et al, 2004) but Angadi et al, (2007) have observed positive

correlation between Cyclin Dl expression and histological grade of oral SCC. In our

study, we found no significant association between Cyclin Dl positivity and degree of

differentiation of tumor (p=0.138) in oral cancer patients with tobacco and betel quid

chewing habit. Further in our study, we found a tendency towards higher incidence of

Cyclin Dl positivity with high grade of differentiation of tumors. Similar results were

reported by Lam KY et al, (2000) who found that Cyclin Dl expression was more

positive in high grade lesions.

hOGGI Genotyping

Molecular cloning of a human counterpart of yeast OGGI paved way for possible

application of hOGGI variants as genetic markers for individual susceptibility to various

cancers (Aburatani et al, 1997; Radicella et al, 1997). The hOGGI gene maps to 3p25

chromosomal region and encodes a DNA glycosylase/AP-lyase that catalyzes removal of

8-OH-dG adducts as part of the base excision repair pathway (Boiteux et al, 2000;

Sunaga et al, 2001). 8-OH-dG is one of major forms of DNA adducts induced by

oxidative damage and increased 8-OH-dG formation in DNA is likely to be involved in

mutagenesis and carcinogenesis (Cheng et al, 1992; Kamiya et al, 1992). The hOGGI


gene is expressed as 12 alternatively spliced isoforms with only the la-form containing a

nuclear localization signal (Shinmura et al, 2000) while P-hOGGl is targeted to

mitochondria. Although no differences in catalytic activities were observed between the

326 Cys and 326 Ser variants in one study (Dherin et al, 1999), the hOGGI protein

encoded by wild type Ser326 allele exhibited substantially higher DNA repair activity

than the 326Ser variant in an in vitro E.coli complementation activity assay (Kohno et al,

1998).

At least 10 polymorphism of hOGGI have been identified, one of which is C->G at bp

(C1245G) in the la specific exon 7 that causes an amino acid substitution from Ser to

Cys in codon 326 (Ser 326 Cys), potentially resulting in functional alteration (Kohno et

al, 1998). In the present study, the association between Ser"^ Cys polymorphism and

oral cancer risk was evaluated in tobacco and betel quid chewers. The study consisted of

100 oral cancer patients with tobacco and betel quid chewing habit and 150 controls. In

this study we have evaluated the risk of combined variant genotype (Ser/Cys+Cys/Cys)

versus wild type homozygote (Ser/Ser) genotype to evaluate the association between

Ser ^ Cys polymorphism and oral cancer risk.

The epidemiological studies that have evaluated the association between polymorphism

at codon 326 of hOGGl and cancer risk have reported conflicting results. Elahi et al,

(2002), Marchand et al, (2002), Xu et al, (2002), Cho et al, (2003) and Jiao et al,

(2007) have reported that Ser ^ Cys polymorphism is associated with risk of

oropharyngeal and laryngeal, lung, prostrate, nasopharyngeal and gallbladder cancers

CHAPTER S: DISCUSSION 108

respectively. While Choi et al, (2003), Zhang et al, (2004), Monteiro et al, (2005),

Poplawski et al, (2006) and Park et al, (2007) have reported that there is no association

of ser ^ Cys polymorphism with breast, head & neck, laryngeal, gastric and colorectal

cancers respectively.

Sugimura et al, (1999) have reported that there is no association of hOGGI Ser ^ Cys

polymorphism with lung cancer susceptibility when different types of lung cancer cases

were taken together but hOGGI Ser ^ Cys polymorphism is independently associated

with increased risk of lung squamous cell carcinoma (OR=3.01, 95%C 1 = 1.33-6.83)and

non-ademocarcinoma (OR=2.18,95%C 1=1.05-4.54).

Kim et al, (2003) and Hashimoto et al, (2006) have reported that there is no association

of Ser ^ Cys hOGGI polymorphism with colon and head and neck carcinomas

respectively but positive association is found between Ser ^ Cys polymorphism in heavy

smokers, in both colon (OR=2.75, 95% Cl=l.07-7.53) and head and neck (0R=8.1, 95%

Cl=1.06-61.73) carcinomas. Similarly Takezaki et al, (2002) have reported that there is

no association of Ser ^^Cys polymorphism with stomach cancer but the association is

significant in alcohol drinkers. These findings suggest that hOGGI ser ^ Cys

polymorphism may alter the impact of some environmental factors on cancer

development. In our study, we have observed that Ser ^ Cys polymorphism is

significantly (p=0.00)associated with oral cancer risk in tobacco and betel quid chewers.

Most of the studies have reported that Ser ^ Cys polymorphism increases the risk of

cancer while one study has reported decrease in cancer risk. Increase in lung cancer risk


due to hOGGI ser ^^Cys polymorphism has been reported by Wikman et al, (2000)

[OR=2.2, 95% Cl=0.4-11.8] and Le Marchand et al, (2002) [0R=2.1, 95% CI = 1.2-3.7]

respectively. Similarly Cho et al., (2003), Chen et al, (2003) and Xing et al, (2001)

have reported increase in nasopharyngeal [OR=3.0, 95% Cl = l.0-8.8], prostrate cancer

[0R=2.1, 95% Cl=1.2-3.8] and esophageal cancer[0R=1.9, 95% Cl=1.3-2.6]

respectively. But Hansen et al, (2005) have reported that hOGGl ser ^ Cys

polymorphism is associated with lower risk of colorectal cancer (OR=0.56, 95%

Cl=0.33-0.95). In our study, we observed that hOGGl Ser ' Cys polymorphism

increases the risk of oral cancer in tobacco and betel quid chewers of northern India

(OR=2.3, 95% Cl= 1.5-3.61). Thus in our study we have observed positive correlation

between Ser ^ Cys polymorphism and oral cancer risk. We have found that Ser ^ Cys

polymorphisms lowers DNA repair ability in tobacco and betel quid chewers which

results in increase in risk of oral cancer in this epidemiologically distinct population.

XRCCI Genotyping

Human cancer can be initiated by DNA damage caused by ultraviolet rays, ionizing

radiation and environmental chemical agents. To safeguard the integrity of genome,

humans have developed a set of complex DNA repair systems. Among the five main

DNA maintenance mechanisms operating in mammals, base excision repair is the

primary guardian against damage where non bulky base adducts produced by

methylation, oxidation, reduction or fragmentation of bases by ionizing reduction or

oxidative damage are removed (Yu et al, 1999). Therefore base excision repair is a

universal event in the cells and is relevant for preventing mutagenesis.


XRCCI, one of more than 20 genes that participate in base excision repair pathway

encodes a scaffolding protein that functions in the repair of single strand breaks, the most

common lesion in cellular DNA (Caldecott et al, 1995). Both biological and biochemical

evidence indicate a direct role for XRCCI in base excision repair because it interacts with

complex of DNA repair proteins, including poly (ADP-ribose) polymerase DNA ligase

III, and DNA polymerase P .

Mouse XRCCI -1- Knockout mutation is lethal and mutation in XRCCI results in an

increased sensitivity to these agents and decreased genetic stability, including increased

frequencies of spontaneously or induced chromosome translocations or deletions

(Thompson et al, 2000). There are a total of eight non synonymous coding single

nucleotide polymorphism in XRCCI, three of which are common and lead to amino acid

substitutions in XRCCI at codon 194 (Exon 6, base C to T, amino acid Arg to Trp),

codon 280 (Exon 9, base G to A, amino acid Arg to His) and codon 399 (Exon 10, base G

to A, amino acid Arg to Gln).These three polymorphism occur at residues that are

identical in humans, hamster and mouse suggesting that these amino acid are

evolutionary conserved (Shen et al, 1998; Lamerdin et al, 1995). Arg 399 Gin

polymorphism is located in the region of BRCT-1 interaction domain of XRCCI within a

poly (ADP-ribose) polymerase binding region and has been extensively studied as 399

Gin variant allelic is most frequently found. XRCCI Arg' '*Trp and Arg^^^His variants

occur in the newly identified proliferating cell nuclear antigen binding region (Fan et al,

2004).


There are relatively few studies conducted to examine the association between Arg ' His

variant and cancer risk and only one study evaluated the association of Arg His

polymorphism and altered DNA adducts (Zhibin HU et al, 2005). In the present study

the association between Arg^ ^His polymorphism and oral cancer risk in tobacco and

betel quid chewers was evaluated. The study consisted of 100 oral cancer patients with

tobacco and betel quid chewing habit and 150 controls. Because of the rare variant allelle

frequencies of Arg^*°His polymorphism, we evaluated only the risk of combined variant

genotypes (His/His+Arg/His) versus wild type homozygote (Arg/Arg).

The epidemiological studies that have evaluated the association between polymorphism

at codon 280 of XRCCI and cancer risk have reported conflicting results. Ratnasingha et

al, (2001), Carla et al, (2002), Moullan et al, (2003),Cho et al, (2003), and Hao et al,

(2004) have shown that Arg^ ^His polymorphism is associated with risk of

lung,prostrate,breast, nasopharyngeal, and esophageal cancers respectively. Other studies

have shown that there is no association of Arg^*°His polymorphism with risk of oral

cancer (Ramachandran et al, 2006; Majumder et al, 2007) breast cancer (Metsola et al,

2005), lung cancer (Mishra et al, 2003; Scheneider et al, 2005) and esophageal cancer

(Lee et al, 2001) respectively. In a meta-analysis of 38 case control studies about

association of XRCCI polymorphisms with cancer risk, Hu et al, (2005) observed that

Arg * His polymorphism is associated with cancer risk and individuals with the variant

genotypes (His/His+His/Arg) had a borderline significantly increased cancer risk,

compared with the individuals with wild type genotype (OR=I.19;95% CI=1.00-1.42). In


our study, we have observed that XRCCl Arg^*°His polymorphism is associated with

oral cancer risk in tobacco and betel quid chewers (p=.015).

Whether the Arg^*°His polymorphism increases or decreases the cancer risk, there are

conflicting results. Some studies have reported that Arg ** His polymorphism increases

the risk of cancer while others studies have reported negative association between

Arg^ °His polymorphism and cancer risk. Ratnasingha et al, (2001) have observed that

XRCCI Arg' ' His polymorphism increases the risk of lung cancer (0R=1.8, 95%

C 1=1.0-3.4) while MouUan et al, (2003) reported that XRCCI Arg^*°His polymorphism

increases the risk of breast cancer (0R=1.8, 95% Cl=l.07-3.05). Similar increase in

prostrate cancer risk was observed by Carla et al, 2002 (0R=1.5, 95% Cl=0.7-3.5). But

Cho et al, (2003) have reported that Arg^*°His polymorphism decreases the risk of

nasopharyngeal cancer (OR=0.64, 95% CI =0.43-0.96). Similarly Hao et al, (2004) have

reported that Arg^*°His polymorphism decreases the risk of esophageal squamous cell

carcinoma (OR=0.79, 95% C 1=0.56-1.11). In our study, we observed that Arg^ ^His

polymorphism increases the risk of oral cancer in tobacco and betel quid chewers of

northern India (OR=1.63, 95% Cl= 1.1-2.413). Thus in our study we have observed

positive correlation between Arg ^ His polymorphism and oral cancer risk. We have

found that Arg^^^His polymorphism may result in lower DNA repair ability which results

in increase in oral cancer risk in tobacco and betel quid chewers.


CYP2E1 Genotyping

Both genetic and environmental factors are involved in the development of cancer. The

environment-gene interaction on carcinogenesis has been well demonstrated by phase-1

&. phase -II enzymes that are involved in the metabolism of carcinogens. An individual

difference in the susceptibility to chemical carcinogens is one of the most important

factors in the estimate of risk of cancer. Most chemical carcinogens require metabolic

activation by phase 1 enzymes (cytochrome p-450) and detoxification by conjugation via

the various phase 11 enzymes (epoxide hydrolase, N-actyl transferese etc.) Thus, the

coordinate expression and regulation of phase I and phase II drug metabolizing enzymes

and their metabolic balance may be an important host factor in determining whether

exposure to carcinogens results in cancer or not. The phase I enzymes, CYP, activate

many environmental procarcinogens by adding or exposing their functional

groups(Kawajiri e/o/., 1991)

CYP2E1 is ethanol induced phase 1 enzyme which has received much attention because

of potentially important toxicological roles of this enzyme. Human CYP2E1 gene is

highly conserved compared with other human p450 genes with products active in

metabolism of xenobiotics. This enzyme is localized mainly in the liver but is also

expressed and induced in the brain after ethanol treatment or ischemia and is also

expressed at significant levels in human esophagus and other extrahepatic tissues

(Nakajima et al, 1996; Lechevrel et a/., 1999).


The physiological role of this enzyme seems to be connected mainly with the conversion

of acetone to gluconeogenetic precursors. Among more than 70 different substrates

specifically metabolized by this enzyme are most of the organic solvents, drugs

(paracetomol, chlorzoxazone) and are several potential carcinogens (nitrosamines,

benzene, aniline) which are transferred to their active forms. In addition, CYP2E1 causes

oxidative stress and the oxygen radicals generated by this enzyme are able to initate

NADPH- dependent lipid peroxidation with the concomitant production of cytotoxic

aldehydes (Hu et al, 1997). Although certain chemicals and physiological status can

induce the activity of CYP2E1, considerable inter-individual variation has been observed

before and after induction, suggesting that the variation may be determined by genetic

factors in the locus. Thus any functional polymorphism of this enzyme might be an

important factor in determining the relative risk of alcohol mediated hepatotoxicity, any

form of cancer or susceptibility for drug toxicity.

Human CYP2E1 gene is polymorphic at several sites, the most important being PstI site,

Rsal site and Dral site. Pstl and RSal site are present in the 5' flanking region while

Dral site is present in intron 6. Phenotypic studies using the drug chlorzoxazone as a

metabolic probe have shown that individuals with the variant Rsal allele have a lower

CYP2E1 activity and that enzyme activity is less inducible by ethanol (Lucas et al,

1995). A polymorphism of CYP2E1 detected by Rsal restriction enzyme may be

functionally important because it is located in a putative binding site for the

transcriptional factor HNF 1 and has been associated with higher levels of CYP2E1

transcription (London etal, 1996).

^•BiaaBiaBBs^gaa^HBaâBiaBB^BBaiiâaai^BB^BaBBaaaasBai CHAPTER 5: DISCUSSION 115

In the present study, the association of Rsal polymorphism and Dral polymorphisms of

the CYP2E1 gene with oral cancer risk in tobacco and betel quid chewers was evaluated.

The study consisted of 100 oral cancer patients with tobacco and betel quid chewing habit

and 150 controls. To find any association between these CYP2E1 Polymorphisms and

oral cancer risk, we evaluated the risk of combined variant genotypes

(AC D C ^ \— +—for Rsa\,— +—for Dral versus wild type homozygote \C C C C J

f A D \ —for Rsal,—for Dral genotypes.

Rsal polymorphism present in the 5' flanking region of CYP2E1 is most extensively

studied polymorphism of CYP2EI but the studies that have evaluated association of Rsal

polymorphism of CYP2E1 and cancer risk have reported conflicting results. Hildesheim

et ai, (1995), Ladero et al, (1996), Marchand et al, (1998), Tan et al, (2000) and

Sugimura et al, (2006) have reported that CYP2E1 Rsal polymorphism is associated

with nasopharyngeal, liver, lung, esophageal and oral carcinomas respectively while

Matthias et al, (1998), Watanabe et al, (1995), Ferreira et al, (2003), and Choi et al,

(2003) have observed that there is no association of Rsal polymorphism with head and

neck, lung, prostrate and breast carcinomas respectively. Choi et al, ( 2003) have

reported that although there is no association between breast cancer risk and Rsal

polymorphism but increased cancer risk is found in ever drinking women (OR=1.9, 95%,

Cl= 0.99-3.83) with CI C2 or C2 C2 genotype compared to non-drinkers with CYP2E1

CI/CI genotype.


Similarly Bouchardy et al., (2000) have reported that Rsal polymorphism is associated

with risk of head and neck carcinoma (0R= 2.0, 95% Cl= 1.0-3.5) but the risk is

increased in drinkers (OR=5.8, 95% Cl= 1.9-18.2). These findings suggest that gene-

environment interactions play an important role in oral cancer. In our study, we have

observed that CYP2E1 Rsal polymorphism is significantly (p=.001) associated with risk

of oral cancer in tobacco and betel quid chewers.

Most of studies that have investigated association of Rsal polymorphism with cancer risk

have observed increase in the risk of cancer while one study has reported decrease in

cancer risk. Hildesheim et al., (1995) reported that individuals who have C2/C2 genotype

were at increased risk for nasopharyngeal carcinoma (0R= 7.7, 95% Cl= 0.87-6.8)

compared to those who had Ci/Ci genotype while Bouchardy et al., (2000) reported that

subjects with C1C2 or C2C2 genotype have increased risk of oral cavity / pharyngeal

cancer (0R= 2.6, 95% Cl= 1.0-6.6) but Marchand et al., (1998) reported that Rsal

homozygous variant genotype (C2/C2) was associated with 10 fold (0R= 0.1, 95% Cl=

0.0-0.5) decrease in risk of overall lung cancer. We observed positive correlation between

CYP2E1 Rsal polymorphism and oral cancer risk. Our findings support the hypothesis

that environmental exposure to the carcinogens plays an important role in the etiology of

oral cancer. In our study, we observed that Rsal polymorphism of CYP2E1 gene

increases the risk of oral cancer in tobacco and betel quid chewers. The carriers of C

variant allele (A/C or C/C) were at increased risk of oral cancer (OR=2.0, 95%C 1=1.3-

2.9).


The epidemiological studies that have evaluated the association of CYP2E1 Dral

polymorphism with cancer risk have reported results which are inconclusive. Some

studies have reported the association of CYP2E1 Dral polymorphism with cancer risk,

while other studies have found no association. Hildesheim et al, (1995) Ferreira et al,

(2003) and Sugimura et al, (2006) have reported that CYP2E1 Dral site polymorphism

is associated with risk of nasopharyngeal, prostrate and oral cancers respectively. While

Kato et al, (1994) and Matthias et al, (1998) have reported that there is no association of

Dral polymorphism with lung and head and neck carcinomas respectively. Bouchardy et

al, (2000) have further reported that risk of oropharyngeal cancer was increased in

individuals with CC or CD variant genotypes as compared to other individuals (0R=

2.0, 95% Cl= 1.0-3.9) but the risk was more increased in drinkers (0R= 5.8, Cl= 1.0-

3.5) suggesting that gene-environment interactions play a significant role in oral cancer.

In our study, we have observed that CYP2E1 Dral polymorphism is significantly

(p=.049) associated with risk of oral cancer in tobacco and betel quid chewers.

Most of earlier investigations that have reported association of CYP2E1 Dral

polymorphism with cancer risk have observed increase in the risk of cancer while some

studies have reported decrease in cancer risk. Hildesheim et al, (1995 ) have reported

that subjects with CC variant genotypes were at increased risk of nasopharyngeal

carcinoma (0R= 5.0, 95% Cl= 0.95-1.6) while Ferreira et al, (2003) have reported that

CYP2E1 Dral polymorphism is associated with increased risk of prostrate cancer (0R=

2.12, 95% Cl= 1.11-4.05). However, Marchand et al, (1998) have reported that CC

homozygous variant Dral genotypes was associated with 5 fold decrease in overall lung


cancer (0R= 0.2, 95% Cl= 0.1-0.7) compared to corresponding homozygous wild type.

In our study, we observed that Dral site polymorphism of CYP2E1 gene increases the

risk of oral cancer in tobacco and betel quid chewers. The carriers of C variant allele (CC

or CD) were at increased risk of oral cancer (OR=1.37; 95% CI =0.9-1.89). Thus in our

study, we have observed positive correlation between CYP2E1 Dral polymorphism and

oral cancer risk.


CHAPTER 6 SUMMARY AND CONCLUSIONS

The present study was conducted in the Department of Biochemistry, Jawaharlal

Nehru Medical College, AMU, Aligarh during the period November, 2004 to March

2007. The study comprised of patients of oral cancer attending the

Otorhinolaryngology (E.N.T) O.P.D. or outdoors admitted to their wards. The salient

features of the present study are as foilows:-

The present study comprised of 100 oral cancer patients and 150 control subjects.

Biopsy specimens were taken from 60 oral cancer patients and 10 controls.

Blood samples were collected from all the subjects.

The purpose of the present study was to evaluate the expression of p53 and Cyclin Dl

in tobacco and betel quid chewers of northern India. We further aimed to evaluate the

association of hOGGl Ser ^^Cys, XRCCI Arg^^^His, CYP2E1 Oral and CYP2E1 Rsal

polymorphisms with risk of oral cancer in tobacco and betel quid chewers.

The 60 oral cancer biopsy samples were further divided into well differentiated,

moderately differentiated and poorly differentiated squamous cell carcinomas on basis

of degree of differentiation. Well differentiated SCC was found to be the commonest,

34 cases (56.66%) followed by moderately differentiated SCC, 18 cases (30%) and

poorly differentiated SCC, 08 cases (13.33%).

• The cases belonged to age group of 25-100 years while the controls belonged to age group of 0-100 years.

CHAPTER 6: SUMMARY & CONCLUSIONS 120

There were 75 males (75%) and 25 females (25%) in the cases while 115 males (76.66%) and 35 females (23.33%) in the controls.

• The mean age of male and female patients was 58 and 53 years respectively while mean age of male and female controls was 56 & 54 years respectively.

•

•

There was definite male preponderance with a male to female ratio of 3: 1 in cases and 3.28:1 in controls.

Most cases (68.97%) presented with some complaint within first 6 months of the start of the lesion.

• Maximum number of patients complained of dysphagia (80 cases) followed by pain in the lesion (50 cases), burning in the mouth & throat (45 cases) and pain during swallowing (29 cases).

• Tobacco and betel quid chewing was found to be very important risk factor for development of oral cancer by chi square test(x^ ~ 135.226, p=0.00).

• Maximum cases ,45 (45%) were having malignancy of buccal mucosa ,followed by tongue, 22 cases (22%) and floor of mouth ,17 cases (17%) respectively. Other malignancies were less common like lip (6%), hard palate (5%) and gingivia 3(%).

• Histopathology revealed squamous cell carcinomas in all oral cancer biopsy specimens.

Protein Expression

Sixty biopsies of oral cancer patients with tobacco and betel quid chewing habit and

10 normal biopsies were immunohistochemically evaluated for p53 and cyclin Dl

expression and the results were expressed as positive cases (%) and positivity.

p53 Expression

• p53 immunostaining was positive in 39 (65%) cases of oral cancer with a p53 positivity of 26.46±23.90 (mean+SD) while there was no detectable p53 expression in controls.


• The percentage of positive cases as well as p53 positivity showed an increase as the grade of differentiation advanced. Significant association was found between p53 positivity and degree of differentiation of tumors (p=.029).

• A significant difference in p53 positivity W£is noted on comparing well differentiated (20.0, ± 19.32) and poorly differentiated (47.5, ± 31.38) OSCC, p=.001.

p53 expression was more frequently seen in gingivia (100%), floor of mouth (71%), tongue (70%) and buccal mucosa (64.5% ) and less in sites like hard palate (50%) and retro molar region (50%).

There was no association between p53 expression and primary site of cancer (p=0.964) in tobacco and betel quid chewers from northern India.

Cyclin Dl Expression:

• Cyclin Dl immunostaining was positive in 35 cases of oral cancer with a Cyclin Dl positivity of 22.16±22.18 (mean ± SD) while there was no detectable Cyclin Dl expression in controls.

• The percentage of positive cases as well as Cyclin Dl positivity showed an increase as the grade of differentiation advanced.

• No Significant association was found between Cyclin Dl positivity and degree of differentiation of tumors (p=0.138).

• A significant difference in Cyclin Dl positivity was observed (p=.043) on comparing well differentiated (16.61 ±17.89) and poorly differentiated (37.0±32.51) OSCC, as well as between well differentiated (16.61 ±17.89) and moderately differentiate OSCC (24.38±21.93 ), p= .002 .Similarly significant difference in Cyclin Dl positivity was observed on comparing moderately differentiated (24.38±21.93) and poorly differentiated (37.0±32.51) OSCC, p =.043.

• Cyclin Dl expression was more frequently seen in hard palate (75%), buccal mucosa (67%) and lip (60%) while expression of Cyclin Dl was less in sites like gingiva (0%), tongue (40%) and floor of mouth (43%).

• There was no association between Cyclin Dl expression and primary site of oral cancer (p=0.528) in tobacco and betel quid chewers of northern India.



One hundred blood samples of oral cancer patients with tobacco and betel quid

chewing habit and 150 controls were evaluated by PCR-RFLP to study association of

XRCCI Arg^^^His, hOGGI Ser ^^Cys, CYP2E1 Oral and CYP2E1 Rsal

polymorphisms with oral cancer risk.

XRCCI Arg"'"His polymorphism

• XRCCI Arg^*°His Polymorphism was found to be associated significantly with risk of oral cancer in tobacco and betel quid chewers (p=.015).

• The individuals with variant genotypes (Arg/His, His/His) were at increased risk of oral cancer (0R= 1.63, 95% CI=1.1—2.413) as compared to individuals having wild type homozygous genotype (Arg/Arg).

hOGGI Ser326Cys polymorphism

• hOGGI Ser ^^Cys polymorphism was found to be significantly associated with the risk of oral cancer in tobacco and betel quid chewers (p=0.00).

• The individuals with the variant genotype (Ser/Cys or Cys/Cys) were at increased risk of oral cancer as compared to individuals having wild type genotype Ser/Ser (0R= 2.3, 95%C1= 1.5-3.61).

CYP2E1 Rsal Polymorphism

• CYP2E1 Rsal polymorphism was found to be significantly associated with the risk of oral cancer in tobacco and betel quid chewers (p=.001).

• The individuals with the variant genotype (C/C or A/C) were at increased risk of oral cancer as compared to individuals having wild type genotype A/A (0R= 2.0, 95% Cl= 1.3-2.9).


CYP2E1 Dral Polymorphism

• CYP2E1 Dral polymorphism was found to be significantly associated with the risk of oral cancer in tobacco and betel quid chewers (p=0.049)

• The individuals with the variant genotype (D/C or C/C) were at increased risk of oral cancer as compared to individuals having wild type genotype D/D (0R= 1.37, 95% C1 = 0.9-1.89).

Thus XRCCI Arg^*°His, hOGGI Ser ^^Cys, CYP2E1 Rsal and CYP2E1 Dral

polymorphisms were associated with increased risk of oral cancer in tobacco and betel

quid chewers in northern India.


References A Hildesheim, CJ Chen, NE Caporaso, YJ Cheng, RN Hoover, MM Hsu, PH Levine, IH

Chen, JY Chen and CS Yang. Cytochrome P450E1 genetic polymorphisms and risic of nasopharyngeal carcinoma: results from a case-control study conducted in Taiwan. Cancer Epidemol Biomarker Prev 1995; 416: 607-11.

Aaronson SA.Growth factors and cancer.Science. 1991 Nov 22;254(5035): 1146-53. Review.

Abul Elahi, Zhong Zheng, Jong Park, Kathy Eyring, Thomas McCaffrey and Philip Lazarus. The human OGGl DNA repair enzyme and its association with orolaryngeal cancer risk. Carcinogenesis 2000; 23(7): 1229-1234.

Aburatani, H., Hippo, Y., Ishida, T., Takashima, R., Matsuba, C, Kodama. T., Takao, M., Yasui, A., Yamamoto, K., Asano, M., Fukasawa. K., Yoshinari, T., Inoue, H., Ohtsuka, E., and Nishimura, S. Cloning and characterization of mammalian 8-hydroxyguanine-specific DNA glycosylase/apurinic/ apyrimidinic lyase, a functional mutM homologue. Cancer Res. 1997; 57: 2151-2156.

Acevedo HF, Tong JY, Hartsock RJ. Human chorionic gonadotropin-beta subunit gene expression in cultured human fetal and cancer cells of different types and origins. Cancer. 1995 Oct 15;76(8): 1467-75.

Ahmedin Jemal, DVM, Andrea Thomas, Taylor Murray and Michael Thun Cancer Statistics, 2002 CA Cancer J Clin 2002; 52:23-47.

Ah-See KW, Cooke TO, Pickford IR, Soutar D, Balmain A.An allelotype of squamous carcinoma of the head and neck using microsatellite markers. Cancer Res. 1994 Apr 1;54(7): 1617-21.

Akervall J, Borg A, Dictor M, Jin C, Jin Y, Tanner M, Isola J, Mertens F, Wennerberg J. Chromosomal translocations involving llql3 contribute to cyclin Dl overexpression in squamous cell carcinoma of the head and neck. : Int J Oncol. 2002 Jan;20(l):45-52.

Akervall JA, Michalides JU, Mineta H, Balm A, Borg A, Dictor MR, Jin Y, Loftus B, Mertens F, Wennerberg JP. Amplification of cyclin Dl in squamous cell carcinoma of the head and neck and the prognostic value of chromosomal abnormalities and cyclin Dl overexpression. Cancer. 1997 Jan 15; 79(2):380-9.

Allred DC, Clark GM, Elledge R, Fuqua SA, Brown RW, Chamness GC, Osborne CK, McGuire WL.Association of p53 protein expression with tumor cell proliferation rate and clinical outcome in node-negative breast cancer.J Natl Cancer Inst. 1993 Feb 3;85(3):200-6.

Ames BN, Gold LS, Willett WC. The causes and prevention of cancer. Proc Natl Acad Sci USA. 1995 Jun 6;92(12):5258-65.

REFERENCES 125

Angadi PV, Krishnapillai R. Cyclin Dl expression in oral squamous cell carcinoma and verrucous carcinoma: correlation with histological differentiation: Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2007 Mar; 103(3): 30-5. 2007.

Ariyawardana A, Sitheeque MA, Ranasinghe AW, Perera I, Tilakaratne WM, Amaratunga EA, Yang YH, Wamakulasuriya S. Prevalence of oral cancer and pre-cancer and associated risk factors among tea estate workers in the central Sri Lanka: J Oral Pathol Med. 2007 Nov;36(l0):581-7.

Arora S., N. Chakravarti, M. Mathur, N.K. Shukla and R. Ralhan Expressions of PTEN and FHIT in oral squamous cell carcinoma and their relations with cyclinDl modulators in oral cancer and cooreleation with tumor progression Proceedings of the 2004 Miami Nature Biotechnology WinterSymposiumVolume 15.

Attardi LD, Lowe SW, Brugarolas J, Jacks T. Transcriptional activation by p53, but not induction of the p21 gene, is essential for oncogene-mediated apoptosis. EMBO J. 1996 Jul 15;15(14):3693-701

Balaram P, Sridhar H, Rajkumar T, Vaccarella S, Herrero R, Nandakumar A, Ravichandran K, Ramdas K, Sankaranarayanan R, Gajalakshmi V, Mufloz N, Franceschi S. Oral cancer in southern India: the influence of smoking, drinking, paan-chewing and oral hygiene. Int J Cancer. 2002 Mar 20;98(3): 440-5.

Balasubrahmanyam M. and Thomas E.: Oral Cancer, Ind. Jr. of surg. 16: 260,1954.

Baral R, Patnaik S, Das BR.Co-overexpression of p53 and c-myc proteins linked with advanced stages of betel- and tobacco-related oral squamous cell carcinomas from eastern India.Eur J Oral Sci. 1998 Oct;106(5):907-13.

Barbacid M. ras genes. Annu Rev Biochem. 1987;56:779-827.

Bdrtek J, Bartkova J, Vojtesek B, Staskova Z, Lukas J, Rejthar A, Kovarik J, Midgley CA, Gannon JV, Lane DP.Aberrant expression of the p53 oncoprotein is a common feature of a wide spectrum of human malignancies.Oncogene. 1991 Sep;6(9): 1699-703.

Batra SK, Rasheed BK, Bigner SH, Bigner DD.Oncogenes and anti-oncogenes in human central nervous system tumors.Lab Invest. 1994 Nov;71(5):621-37. Review.

Benner SE, Pajak TF, Lippman SM, Earley C, Hong WK. Prevention of second primary tumors with isotretinoin in patients with squamous cell carcinoma of the head and neck: long-term follow-up. J Natl Cancer Inst. 1994 Jan 19;86(2): 140-1.

Bennett WP, Hollstein MC, He A, Zhu SM, Resau JH, Trump BF, Metcalf RA, Welsh JA, Midgley C, Lane DP, et al. Archival analysis of p53 genetic and protein alterations in Chinese esophageal cancer.Oncogene. 1991 Oct;6(10): 1779-84.

REFERENCES 126

Berenson JR, Yang J, Mickel RA.Frequent amplification of the bcl-1 locus in head and neck squamous cell carcinomas.Oncogene. 1989 Sep; 4(9):1111-6.

Bioteux, S. and Radicella, J.P. The human OGGl gene structure, functions and its implication in the process of carcinogenesis. Arch. Biochem. Biophys 2000; 377: 1-8.

Bishop JM. Molecular themes in oncogenesis.Cell. 1991 Jan 25;64(2):235-48. Review.

Blot W. J., Devesa S. S.,McLaughlin, J, K., and Fraumeni Jr, J.F. Oral and pharyngeal cancers 1994. Cold Spring harbor, CSHL Press.

Blot WJ, McLaughlin JK, Winn Dm, et al. Smoking and drinking in relation to oral and pharyngeal cancer. Cancer Res 1988;48:3282-7.

Boiteux S, Radicella JP.The human OGGl gene: structure, functions, and its implication in the process of carcinogenesis.Arch Biochem Biophys. 2000 May l;377(l):l-8. Review.

Bookstein R, Lee WH. Molecular genetics of the retinoblastoma suppressor gene. Crit RevOncog. 1991;2(3):211-27.

Boring CC, Squires TS, Tong T (1992). Cancer statistics. 1992. CA J Clin Cancer 42:19-38.

Boring CC, Squires TS, Tong T. Cancer Statistics. 1993 Califomian Journal of Clinical Cancer 1993;43:7-26.

Bos JL.ras oncogenes in human cancer: a review. Cancer Res. 1989 Sep l;49(17):4682-9.

Bouchardy C, Hirvonen A, Coutelle C, Ward PJ, Dayer P, Benhamou S. Role of alcohol dehydrogenase 3 and cytochrome P-450E1 genotypes in susceptibility to cancers of the upper aerodigestive tract. Int. J Cancer 2000; 87 (5):734-40.

BOVERI T(1914) Zur frage der entstehung maligne:tumoren.Jena:Gustav Fischer.

Brachman DG. Molecular biology of head and neck cancer. Semin Oncol 1994; 21:320-9.

Brennan JA, Boyle JO, Koch WM, Goodman SN, Hruban RH, Eby YJ, Couch MJ, Forastiere AA, Sidransky D.Association between cigarette smoking and mutation of the p53 gene in squamous-cell carcinoma of the head and neck.N Engl J Med. 1995 Mar 16;332(ll):712-7.

Bruner SD, Norman DP, Verdine GL.Structural basis for recognition and repair of the endogenous mutagen 8-oxoguanine in DNA.Nature. 2000 Feb 24; 403(6772):859-66.

REFERENCES 127

Burt RK, Garfield S, Johnson K, Thorgeirsson SS. Transformation of rat liver epithelial cells with v-H-ras or v-raf causes expression of MDR-1, glutathione-S-transferase-P and increased resistance to cytotoxic chemicals. Carcinogenesis. 1988 Dec;9(12):2329-32.

Cai L, Zheng ZL, Zhang ZF. Cytochrome p450 2E1 polymorphisms and the risk of gastric cardia cancer. World J Gastroenterol. 2005 Mar 28; 11(12): 1867-71.

Caldecott KW, Tucker JD, Stanker LH, Thompson LH. Characterization of the XRCCl -DNA ligase III complex in vitro and its absence from mutant hamster cells. Nucleic Acids Res 1995; 23:4836-43.

Cantley LC, Auger KR, Carpenter C, Duckworth B, Graziani A, Kapeller R, Soltoff S. Oncogenes and signal transduction. Cell. 1991 Jan 25;64(2):281-302.

Carla H. van Gils, Robert M. Bostick, Mariana C. Stem, and Jack A. Taylor. Differences in Base Excision Repair Capacity May Modulate the Effect of Dietary Antioxidant Intake on Prostate Cancer Risk: An Example of Polymorphism in the XRCCI Gene. Cancer Epidemiology Biomarkers & Prevention, Vol.11, 1279-1284, Nov. 2002.

Carlos de Vicente J, Herrero-Zapatero A, Fresno MF, Lopez-Arranz JS. Expression of cyclin Dl and Ki-67 in squamous cell carcinoma of the oral cavity: clinicopathological and prognostic significance. Oral Oncol. 2002 Apr;38(3):301-8.

Cawson RA, Langdon JD, Eveson JW. Surgical Pathology of the Mouth and Jaws. Oxford: Wright, 1996.

Chang F, Syrjanen S, Kurvinen K, Syrjanen K.The p53 tumor suppressor gene as a common cellular target in human carcinogenesis.Am J Gastroenterol. 1993 Feb;88(2): 174-86. Review.

Chang KC, Su IJ, Tsai ST, Shieh DB, Jin YT. Pathological features of betel quid-related oral epithelial lesions in taiwan with special emphasis on the tumor progression and human papillomavirus association.: Oncology. 2002;63(4):362-9.

Chang LC, Chou MY, Chow P, Matossian K, McBride J, Tao CA, Gallagher GT, Wong DT. Detection of transforming growth factor-alpha messenger RNA in normal and chemically transformed hamster oral epithelium by in situ hybridization. Cancer Res. 1989 Dec l;49(23):6700-7.

Chang SE, Bhatia P, Johnson NW, Morgan PR, McCormick F, Young B, Hioms LRas mutations in United Kingdom examples of oral malignancies are infrequent. Int J Cancer. 1991 May 30;48(3):409-12.

REFERENCES 128

Chang SE, Lim Y, Lee H, Choi J, Sung K.Expression of p53, pRb, pi6 and proliferating cell nuclear antigen in squamous cell carcinomas arising on a giant porokeratosis.Br J Dermatol. 1999 Sep;141(3):575-6.

Chapman I, MALKIN M. Palatal leukoplakia in a female cigaret smoker. Contribution to study of tobacco-induced epithelial hyperplasia in human beings. N Y State J Med. 1961 Jun 15 ;61:2044-5.

Chaudhary K. Is Pan masala containing tobacco carcinogenic? The National Medical Journal of India. 1999; 12:21-27.

Chauvenet AR, Shashi V, Selsky C, Morgan E, Kurtzberg J, Bell B; Pediatric Oncology Group Study. Vincristine-induced neuropathy as the initial presentation of charcot-marie-tooth disease in acute lymphoblastic leukemia: a Pediatric Oncology Group study .J Pediatr Hematol Oncol. 2003 Apr;25(4):316.

Chen L, Elahi A, Pow-Sang J, Lazarus P, Park J. Association between polymorphism of human oxoguanine glycosylase 1 and risk of prostate cancer. J Urol. 2003; 170(6):2471-4.

Chen S, Tang D, Xue K, Xu L, Ma G, Hsu Y, Cho SS. DNA repair gene XRCCl and XPD polymorphisms and risk of lung cancer in a Chinese population. Carcinogenesis. 2002 Aug;23(8):1321-5.

Cheng, K.C, Cahill. D.S., Kasai. H., Nishimura. S. and Loeh J.A. 8-hydroxyguanine, an abundant from of oxidative DNA damage, Causes GT and AC substitutions, J. Biol. Chem.1992; 267: 166-172.

Chiang CP, Huang JS, Wang JT, Liu BY, Kuo YS, Hahn LJ, Kuo My Expression of p53 protein correlates with decreased survival in patients with areca quid chewing and smoking-associated oral squamous cell carcinomas in Taiwan.J Oral Pathol Med. 1999Feb;28(2):72-6.

Chiang CP, Huang JS, Wang JT, Liu BY, Kuo YS, Hahn LJ, Kuo MY. Expression of p53 protein correlates with decreased survival in patients with areca quid chewing and smoking-associated oral squamous cell carcinomas in Taiwan. : J Oral Pathol Med. 1999Feb;28(2):72-6.

Chiang CP, Lang MJ, Liu BY, Wang JT, Leu JS, Hahn LJ, Kuo MY.Expression of p53 protein in oral submucous fibrosis, oral epithelial hyperkeratosis, and oral epithelial dysplasia.J Formos Med Assoc. 2000 Mar;99(3):229-34.

Chiba I, Muthumala M, Yamazaki Y, Uz Zaman A, lizuka T, Amemiya A, Shibata T, Kashiwazaki H, Sugiura C, Fukuda H. Characteristics of mutations in the p53 gene of oral squamous-cell carcinomas associated with betel-quid chewing in Sri Lankaint J Cancer. 1998 Sep 11;77(6):839-42

REFERENCES 129

Cho EY, Hildesheim A, Chen CJ, et al. Nasopharyngeal carcinoma and genetic polymorphisms of DNA repair enzymes XRCCl and hOGGl. Cancer Epidemiol Biomarkers Prev 2003; 12:1100-4.

Choi JY, Abel J, Neuhaus T, Ko Y, Harth V, Hamajima N, Tajima K, Yoo KY, Park SK, Noh DY, Han W, Choe KJ, Ahn SH, Kim SU, Hirvonen A, Kang D. Role of alcohol and genetic polymorphisms of CYP2E1 and ALDH2 in breast cancer development. Pharmacogenetics. 2003 Feb;13(2):67-72.

Choi JY, Hamajima N, Tajima K, Yoo KY, Yoon KS, Park SK, Kim SU, Lee KM, Noh DY, Ahn SH, Choe KJ, Han W, Hirvonen A, Kang D. hOGGl Ser326Cys polymorphism and breast cancer risk among Asian women. Breast Cancer Res Treat. 2003; 79(l):59-62.

Christensen ME, Therkildsen MH, Poulsen SS, Bretlau P.Immunoreactive transforming growth factor alpha and epidermal growth factor in oral squamous cell carcinomas.J Pathol. 1993 Mar;169(3):323-8

Clapper ML. Genetic polymorphism and cancer risk. Curr Oncol Rep. 2000 May;2(3):251-6.

CMudia T. Sd; Linaena M. S. Fonseca;"Sergio V. Cardoso; "Maria Cassia F. Aguiar & Maria Auxiliadora V. do Carmo p53 Immunoexpression in Oral Squamous Cell

Carcinomas from Different Anatomical Sites: A Comparative Study: Int. J. Morphol., 24(2):231-238, 2006.

Coffey RJ Jr, Meise KS, Matsui Y, Hogan BL, Dempsey PJ, Halter SA. Acceleration of mammary neoplasia in transforming growth factor alpha transgenic mice by 7,12-dimethylbenzanthracene.CancerRes. 1994 Apr 1;54(7): 1678-83.

Contemporary Issues in Oral Cancer - D. Saranath (Ed.); Oxford University Press, New Delhi, India, 2000

Cooper GM (1995).Oncogenes.Cooper GM, editor.Boston:Jones and Bartlett Publishers.

Cordon-Cardo C. Mutations of cell cycle regulators. Biological and clinical implications for human neoplasia. Am J Pathol. 1995 Sep;147(3):545-60.

Cordova Perez FJ, Gonzalez-Keelan CI, Velez R. Epstein-Barr virus in biopsies from patients with Hodgkin and non-Hodgkin lymphoma at the University of Puerto Rico immunohistochemistry laboratory. P R Health Sci J. 2003 Jun;22(2): 125-9.

Cory G.H.: Observations on Malignant diseases in Ceylon based. Cox MF, Scully C, and Maitland N. Viruses in the aetiology of oral carcinoma? Examination of the evidence. British Journal of Oral and Maxillofacial Surgery 1991; 29:381-387.

Crissman JD, Kessis T, Shah KV, et al. squamous papillary neoplasia of the aduh upper aerodigestive tract. Hum Pathol 1988;19:1387-96.

REFERENCES 130

D.N. Rao, B. Ganesh, R.S. Rao and P.B. Desai. Risk assessment of tobacco, alcohol, and diet in oral cancer-A case control study. Int J. Cancer 1994; 58: 469-473.

Davis : Cancer Cheek, Jr. of Am. Med. Ass., 64 : 719, 1915.

De Araujo VC, Loyola AM, Pinto Junior DD, Borra RC, De Araiijo NS. p53 In biopsies of oral squamous cell carcinoma. A comparative study with a malignancy grading system. Oral Oncol. 1997 Jan; 33(l):5-9.

De Luca LM. Retinoids and their receptors in differentiation, embryogenesis, and neoplasia. FASEB J. 1991 Nov;5(14):2924-33.

Demple B, Harrison L.Repair of oxidative damage to DNA: enzymology and biology.Annu Rev Biochem. 1994;63:915-48. Review.

Derynck R. The physiology of transforming growth factor-alpha. Adv Cancer Res. 1992;58:27-52.

Dherin, C, Radicella, J.P., Dizdaroglu, M., and Boiteux, S. Excision of oxidatively damaged DNA bases by the human alpha-hOGGl protein and polymorphic alpha-hOGGl (Ser326Cys) protein which is frequently found in human populations. Nucl. Acids Res. 1999; 27: 4001-4007.

Di Fiore PP, Pierce JH, Fleming TP, Hazan R, Ullrich A, King CR, Schlessinger J, Aaronson SA.Overexpression of the human EGF receptor confers an EGF-dependent transformed phenotype to NIH 3T3 cells.Cell. 1987 Dec 24;51(6):1063-70.

Di Marco E, Pierce JH, Fleming TP, Kraus MH, Molloy CJ, Aaronson SA, Di Fiore PP. Autocrine interaction between TGF alpha and the EGF-receptor: quantitative requirements for induction of the malignant phenotype. Oncogene. 1989 Jul;4(7):831-8.

Donehower LA, Bradley A. The tumor suppressor p53. Biochim Biophys Acta. 1993 Aug23;1155(2):181-205.

Downward J, Yarden Y, Mayes E, Scrace G, Totty N, Stockwell P, Ullrich A, Schlessinger J, Waterfield MD.Close similarity of epidermal growth factor receptor and v-erb-B oncogene protein sequences.Nature. 1984 Feb 9-15;307(5951):521-7.

Dyson N, Howley PM, Miinger K, Harlow E.The human papilloma virus-16 E7 oncoprotein is able to bind to the retinoblastoma gene product.

Eissa S, Ali-Labib R, Khalifa A.Deletion of pl6 and pl5 genes In schistosomiasis-associated bladder cancer (SABC).Clin Chim Acta. 2000 Oct;300( 1-2): 159-69.

REFERENCES 131

Elahi A, Zheng Z, Park J, Eyring K, McCaffrey T, Lazarus PThe human OGGl DNA repair enzyme and its association with orolaryngeal cancer risk. Carcinogenesis. 2002 Jul;23(7): 1229-34

Ellen L. Goode., Cornelia M., Ulrich and John D. Porter. Polymorphisms in DNA repair genes and association with Cancer Risk. Cancer Epidemiol Bio Prev 2002; Vol. 11,1513-1530.

Ellis GL, Corio RL. Spindle cell carcinoma of the oral cavity, a clinicopathologic assessment of fifty-nine cases. Oral Surg Oral Med Oral Pathol 1980;50:523-4.

Elovic A, Galli SJ, Weller PF, Chang AL, Chiang T, Chou MY, Donoff RB, Gallagher GT, Matossian K, McBride J, et al. Production of transforming growth factor alpha by hamster eosinophils. Am J Pathol. 1990 Dec;137(6):1425-34.

Elwood JM, Pearson JCG, Skippen DH, Jackson SM. Alcohol, smoking, social and occupational factors in the aetiology of cancer of the oral cavity, pharynx and larynx. International Journal of Cancer 1984, 34:603-612.

Emster,L., Esumi,H., Fujii,Y., Gelboin,H.V., Kato,R. and Sugimura,T. (1991) Xenobiotics and Cancer. Japan Scientific Societies Press, Tokyo, Japan, pp. 1-38.

Fan J, Otterlei M, Wong HK, Tomkinson AE, Wilson DM III. XRCCI colocalizes and physically interacts with PCNA. Nucleic Acids Res 2004; 32: 2193-201.

Ferreira PM, Medelros R, Vasconcelos A, Costa S, Pinto D, Morals A, Oliveira J, Lopes C. Association between CYP2E1 polymorphisms and susceptibility to prostate cancer. Eur J cancer Prev 2003; 12(3):205-11.

Field JK.Oncogenes and tumour-suppressor genes in squamous cell carcinoma of the head and neck.Eur J Cancer B Oral Oncol. 1992 Jul;28B(l):67-76. Review.

Franceschi S, Talameni R, Barra S, et al. Smoking and drinking in relation to cancers of the oral cavity, pharynx, larynx and esophagus in Northern Italy. Cancer Research 1990:50:6507.

Friedlander PL, Schantz SP, Shaha AR, Yu G, Shah JP. Squamous cell carcinoma of the tongue in young patients: a matched-pair analysis.Head Neck. 1998 Aug; 20(5):363-8.

Frixen UH, Behrens J, Sachs M, Eberle G, Voss B, Warda A, LSchner D, Birchmeier W. E-cadherin-mediated cell-cell adhesion prevents invasiveness of human carcinoma cells. J Cell Biol. 1991 Apr;l 13(l):173-85.

Gal TJ, Huang WY, Chen C, Hayes RB, Schwartz SM. DNA repair gene polymorphisms and risk of second primary neoplasms and mortality in oral cancer patients. Laryngoscope. 2005 Dec;115(12):2221-31.

REFERENCES 132

Garewal HS, Schantz S. Emerging role of B-Carotene and antioxidant nutrients in prevention of oral cancer. Archives of Otolaryngology and Head and Neck Surgery 1995; 121:141-144.

Gattas GJ, de Carvalho MB, Siraque MS, Curioni OA, Kohler P, Eluf-Neto J, Wunsch-Filho V. Genetic polymorphisms of CYPlAl, CYP2E1, GSTMl, and GSTTl associated with head and neck cancer. Head Neck. 2006 Sep;28(9):819-26

Gimenez-Conti IB, Collet AM, Lanfranchi H, Itoiz ME, Luna M, Xu HJ, Hu SX, Benedict WF, Conti CJ. p53, Rb, and cyclin Dl expression in human oral verrucous carcinomas: Cancer. 1996 Jul 1;78(1): 17-23.

Good DJ, Polverini PJ, Rastinejad F, Le Beau MM, Lemons RS, Frazier WA, Bouck NP.A tumor suppressor-dependent inhibitor of angiogenesis is immunologically and functionally indistinguishable from a fragment of thrombospondin. Proc Natl Acad Sci USA. 1990 Sep;87(17):6624-8.

Gopal K., Saxena O.N. and Singh A.K.: Oral Carcinoma. Ind. Jr. of Surg. 29: 229, 1967.

Graham S, Dayal H, Rohrer T. Dentition, diet, tobacco and alcohol in the epidemiology of oral cancer. Journal of the National Cancer Institute 1977;59:1611-1618.

Grandis JR, Tweardy DJ.Elevated levels of transforming grov h factor alpha and epidermal growth factor receptor messenger RNA are early markers of carcinogenesis in head and neck cancer.Cancer Res. 1993 Aug l;53(15):3579-84.

Greenblatt MS, Bennett WP, Hollstein M, Harris CC. Mutations in the p53 tumor suppressor gene: clues to cancer etiology and molecular pathogenesis. Cancer Res. 1994 Sep 15;54(18):4855-78.

Groden J, Thliveris A, Samowitz W, Carlson M, Gelbert L, Albertsen H, Joslyn G, Stevens J, Spirio L, Robertson M, et al. Identification and characterization of the familial adenomatous polyposis coli gene. Cell. 1991 Aug 9;66(3):589-600.

Guengerich FP, Shimada T.Oxidation of toxic and carcinogenic chemicals by human cytochrome P-450 enzymes.Chem Res Toxicol. 1991 Jul-Aug; 4(4):391-407.

Haldar P. K.: Carcinoma of oral cavity, Ind. J. Radiol., 3: 196, 1953.

Hall PA, Lane DP. p53 in tumour pathology: can we trust immunohistochemistry?--Revisited! J Pathol. 1994 Jan; 172(1): 1-4.

Hanahan D, Weinberg RA.The hallmarks of cancer.Cell. 2000 Jan 7;100(l):57-70. Review.

Hanaoka T, Sugimura H, Nagura K, Ihara M, Li XJ, Hamada GS, Nishimoto I, Kowalski LP, Yokota J, Tsugane S.hOGGl exon7 polymorphism and gastric cancer in case-

REFERENCES 133

control studies of Japanese Brazilians and non-Japanese Brazilians.Cancer Lett. 2001 Sep 10;170(1):53-61.

Hansen LS, Olson JA, Silverman S Jr. proliferative verrucous leukoplakia: a long-term study of thirty patients. Oral Surg oral Med Oral Pathol 1995; 60:285-98.

Hansen R, Saeb M, Skjelbred CF, Nex BA, Hagen PC, Bock G, Bowitz Lothe IM, Johnson E, Aase S, Hansteen IL, Vogel U, Kure EH. GPX Pro 198Leu and OGGl ser326Cys polymorphisms and risk of development of colorectal adenomas and colorectal cancer. Cancer Lett. 2005; 229(1): 85-91.

Hao B, Wang H, Zhou K, et al. Identification of genetic variants in base excision repair pathway and their association with risk of esophageal squamous cell carcinoma. Cancer Res 2004; 64:4378-84.

Harris CC.p53 tumor suppressor gene: at the crossroads of molecular carcinogenesis, molecular epidemiology, and cancer risk assessment.Environ Health Perspect. 1996 May; 104 Suppl 3:435-9. Review.

Hartwell L.Defects in a cell cycle checkpoint may be responsible for the genomic instability of cancer cells.Cell. 1992 Nov 13;71(4):543-6. Review.

Hartwell LH, Kastan MB. Cell cycle control and cancer. Science. 1994 Dec 16;266(5192):1821-8.

Hashimoto T, Uchida K, Okayama N, Imate Y, Suchiro Y, Hamanaka Y, Ueyama Y, Yamashita H, Hinoda Y. Interaction of OGGl Ser326Cys polymorphism with cigarette smoking in head and neck squamous cell carcinoma. Mol Carcino. 2006; 45(5):344-348.

Hayashi S, Watanabe J, Kawajiri K. Genetic polymorphisms in the 5'-flanking region change transcriptional regulation of the human cytochrome P450IIE1 gene. J Biochem (Tokyo). 1991 Oct;110(4):559-65.

Healy TM.The cellular reaction during carcinogenesis: variations in the numbers of mast cells, plasma cells and eosinophils.Ir J Med Sci. 1975 Jul;144(7):255-65.

Hebert JR, Landon J, Miller DR. Consumption of meat and fhiit in relation to oral and esophageal cancer: a cross-national study.Nutr Cancer. 1993; 19(2):169-79.

Hirano T, Steele PE, Gluckman JL.Low incidence of point mutation at codon 12 of K-ras proto-oncogene in squamous cell carcinoma of the upper aerodigestive tract.Ann Otol Rhinol Laryngol. 1991 Jul;100(7):597-9.

Hirohashi S.Inactivation of the E-cadherin-mediated cell adhesion system in human cancers.Am J Pathol. 1998 Aug;153(2):333-9. Review.

REFERENCES 134

Howe PH, Draetta G, Leof EB. Transforming growth factor beta 1 inhibition of p34cdc2 phosphorylation and histone HI kinase activity is associated with Gl/S-phase growth arrest. Mol Cell Biol. 1991 Mar;l 1(3): 1185-94.

Hsieh LL, Chien HT, Chen IH, Liao CT, Wang HM, Jung SM, Wang PF, Chang JT, Chen MC, Cheng AJ. The XRCCl 399Gln polymorphism and the frequency of p53 mutations in Taiwanese oral squamous cell carcinomas. Cancer Epidemiol Biomarkers Prev. 2003 May;12(5):439-43.

Hsin-Chia Hung, Jerry Chuang, Yin-Chu Chien, Hemg-Der Chem, Chun-Pin Chiang, Ying-Shiung Kuo, Allan Hildesheim, and Chien-Jen Chen. Genetic Polymorphisms of CYP2E1, GSTMl, and GSTTI; Environmental factors and Risk of oral cancer. Cancer Epidemiol Biomarker Prev 1997; 6: 901-905.

Huang J., Ho S., Chiang CP., Kuo YS., Kuo MYP. MDM2 expression in areca quid chewing associated oral squamous cell carcinomas in Taiwan. J Oral Pathol Med 2001;30:53-58.

Hung HC, Chuang J, Chien YC, Chem HD, Chiang CP, Kuo YS, Hildesheim A, Chen CJ. Genetic polymorphisms of CYP2E1, GSTMl, and GSTTI; environmental factors and risk of oral cancer. Cancer Epidemiol Biomarkers Prev. 1997 Nov;6(ll):901-905.

Hunter T, Pines J.Cyclins and cancer. II: Cyclin D and CDK inhibitors come of age.Cell. 1994 Nov 18;79(4):573-82. Review.

Hunter T.Cooperation between oncogenes. Cell. 1991 Jan 25; 64(2):249-70. Review.

Husain Z, Fei YB, Roy S, Solt DB, Polverini PJ, Biswas DK. Sequential expression and cooperative interaction of c-Ha-ras and c-erbB genes in in vivo chemical carcinogenesis. Proc Natl Acad Sci USA. 1989 Feb;86(4): 1264-8.

Hye-Won Park, Jin Kim, Hio Chung Kang, Sang-Geun Jang,Sun-A Ahn, Jin Soo Lee, Hai-Rim Shin and Jae-Gahb Park. The hOGGl Ser326Cys polymorphism is not associated with colorectal cancer risk. Journal of Epidemiology 2007; 17(5): 156-60.

lARC Monographs on the Evaluation of Carcinogenic Risks to Humans lARC Monograph, lARC Scientific Publications. Vol. 56. Lyon: lARC, 1993.

lARC Monographson the Evaluation of Carcinogenic Risks to Humans lARC Monograph, lARC Scientific Publications. Vol60 pp. 321-346 Lyon: lARC, 1994.

lARC. 1992. Solar and Ultraviolet Radiation. lARC Monographs on the Evaluation of Carcinogenic Risk of Chemicals to Humans, vol. 55. Lyon, France: International Agency for Research on Cancer, 1992.

REFERENCES 135

Idle JR. Is environmental carcinogenesis modulated by host polymorphism? Mutat Res. 1991 Apr; 247(2):259-66.

Irish JC .Oncogenes, molecular biology and the head and neck surgeon.

Ishiyama A, Eversole LR, Ross DA, et al. Papillary squamous neoplasm of the head and neck .Laryngoscope 1994;104:1446-52.

Issing WJ, Wustrow TP, Heppt WJ.Oncogenes related to head and neck cancer.Anticancer Res. 1993 Nov-Dec;13(6B):2541-51. Review.

Itoga S, Nomura F, Makino Y, Tomonaga T, Shimada H, Ochiai T, lizasa T, Baba M, Fujisawa T, Harada S. Tandem repeat polymorphism of the CYP2E1 gene: an association study with esophageal cancer and lung cancer. Alcohol Clin Exp Res. 2002 Aug;26(8 Suppl):15S-19S. J Otolaryngol. 1992 Dec;21 Suppl 3:1-20. Review.

J. M. Ladero, JAG Agundez, A Rodriguez-lescure, M Diaz-Rubio, J Benitez. Rsal polymorphism at the cytochrome P4502E1 locus and risk of hepatocellular carcinoma. Gut 1996; 39:330-333.

Jae-II Kim, Young-Jin Park, Ki-Hong Kim, Ji-II Kim, Byung-Joo Song, Meung-Soo Lee, Chul-Num Kim, Seok-Hyo Chang. hOGGl Ser326Cys polymorphism modifies the significance of the environmental risk factor for colon cancer. World J Gastroenterol 2003; 9(5): 956-960.

Jasbir Kaur, Anurag Srivastava, and Ranju Ralhan. Prognostic significance of p53 protein overexpression in betel and tobacco-related oral oncogenesis. Int. J cancer (Pred. Oncol.) 1998; 79:370-375.

Jayant K, Balakrishnan V, Sanghvi LD, Jussawalla DJ.Quantification of the role of smoking and chewing tobacco in oral, pharyngeal, and oesophageal cancers.Br J Cancer. 1977 Feb;35(2):232-5.

Jayant K, Yeole BB. Cancers of the upper alimentary and respiratory tracts in Bombay, India: a study of incidence over two decades.Br J Cancer. 1987 Dec;56(6):847-52.

Jayasurya R, Sathyan KM, Lakshminarayanan K, Abraham T, Nalinakumari KR, Abraham EK, Nair MK, Kannan S. Phenotypic alterations in Rb pathway have more prognostic influence than p53 pathway proteins in oral carcinoma. Mod Pathol. 2005 Aug; 18(8): 1056-66.

Jhappan C, Stable C, Harkins RN, Fausto N, Smith GH, Merlino GT. TGF alpha overexpression in transgenic mice induces liver neoplasia and abnormal development of the mammary gland and pancreas. Cell. 1990 Jun 15;61(6):1137-46.

REFERENCES 136

Jiang WG. E-cadherin and its associated protein catenins, cancer invasion and metastasis. Br J Surg. 1996 Apr;83(4):437-46.

Jiao X, Huang J, Wu S, Lv M, Hu Y, Jianf U, Su X, Luo C, Ce B. hOGGl Ser326Cys polymorphism and susceptibility to gallbladder cancer in a Chinese population. Int J. Cancer. 2007; 121(3):501-5.

Jin Y, Mertens F. Chromosome abnormalities in oral squamous cell carcinomas.Eur J Cancer B Oral Oncol. 1993 Oct;29B(4):257-63

Johnson NW, Ranasinghe AW, Wamakulasuriya KAA. Epidemiology of oral cancer in the United Kingdom. Community Dental Health 1993;10 (Suppl 1): 13-29.

Juan Carlos de Vicente,Agustin Herrero-Zapatero, Manuel Florentino ,Fresno Jaun Sebastain Lopez-Arranz. Expression of cyclin Dl and Ki-67 in squamous cell carcinoma of the oral cavity: clinicopathological and prognostic significance. Oral Oncology 2002; 38: 301-308.

Jussawalla DJ, Deshpande VA.Evaluation of cancer risk in tobacco chewers and smokers: an epidemiologic assessment.Cancer. 1971 Jul;28(l):244-52.

Kamb A, Gruis NA, Weaver-Feldhaus J, Liu Q, Harshman K, Tavtigian SV, Stockert E, Day RS 3rd, Johnson BE, Skolnick MH. A cell cycle regulator potentially involved in genesis of many tumor types.Science. 1994 Apr 15;264(5157):436-40.

Kamiya, H., Miura, K., Ishikawa, H., Inoue, H., Nishimura, S. and Ohtsuka, E. C-Ha-ras containing 8-hydroxyguanine at codon 12 induces point mutations at the modified and adjacent positives. Cancer Res. 1992; 52: 3483-3485.

Kasid U, Pfeifer A, Weichselbaum RR, Dritschilo A, Mark GE.The raf oncogene is associated with a radiation-resistant human laryngeal cancer.Science. 1987 Aug 28;237(4818):1039-41.

Kato S, Shields PG, Caporaso NE, Sugimura H, Trivers GE, Tucker MA, Trump BF, Weston A, Harris CC.Analysis of cytochrome P450 2E1 genetic polymorphisms in relation to human lung cancer.Cancer Epidemiol Biomarkers Prev. 1994 Sep;3(6):515-8.

Kaur J, Srivastava A, Ralhan R Prognostic significance of p53 protein overexpression in betel- and tobacco-related oral oncogenesis. Int J Cancer. 1998 Aug 21;79(4):370-5.

Kaur J, Srivastava A, Ralhan R Overexpression of p53 protein in betel- and tobacco-related human oral dysplasia and squamous-cell carcinoma in India: Int J Cancer. 1994 Aug l;58(3):340-5.

Kawajiri K, Fujii-Kuriyama Y.P450 and human cancer.Jpn J Cancer Res. 1991 Dec;82(12): 1325-35. Review.

REFERENCES 137

Kenji Shibuya, Colin D Mathers, Cynthia Boschi-Pinto, Alan D Lopez, and Christopher JL Murray Global and regional estimates of cancer mortality and incidence by site: II. results for the global burden of disease 2000.BMC Cancer. 2002; 2: 37.

Kerdpon D, Sriplung H, Kietthubthew S. Expression of p53 in oral squamous cell carcinoma and its association with risk habits in southern Thailand. : Oral Oncol. 2001 Oct;37(7):553-7.

Khanolkar V.R. and Suryabai B. Role of tobacco in intra oral cancer in India., Arch. Path., 40 : 356, 1945.

Khanolkar V.R.: Oral Carcinoma in India, Cancer Res., 4: 313, 1944.

Khuri FR, Lippman SM, Spitz MR, Lotan R, Hong WK.Molecular epidemiology and retinoid chemoprevention of head and neck cancer.J Natl Cancer Inst. 1997 Feb 5;89(3): 199-211. Review.

Kietthubthew S, Sriplung H, Au WW, Ishida T. Polymorphism in DNA repair genes and oral squamous cell carcinoma in Thailand. Int J Hyg Environ Health. 2006 Jan;209(l):21-9.

Kim MS, Li SL, Bertolami CN, Cherrick HM, Park NH.State of p53, Rb and DCC tumor suppressor genes in human oral cancer cell lines.Anticancer Res. 1993 Sep-Oct;13(5A): 1405-13.

Kinni M.G. and Subbarao K.V.: The problem of Cancer, Ind. Med. Gaz, 72: 677,1937.

Knudson AG Jr.Genetics and etiology of human cancer.Adv Hum Genet. 1977;8:1-66. Review.

Kohno, T., Shinmura, K., Tosaka, M., Tani, M., Kim, S.R. Sugimura, H., Nohmi, T., Kasai, H., and Yokota, J. Genetic polymorphisms and alternative splicing of the hOGGI gene, that is involved in the repair of 8-hydroxyguanine in damaged DNA. Oncogene 1998; 16:3219-3225.

Kongruttanachok N, Sukdikul S, Setavarin S, Kerekhjanarong V, Supiyaphun P, Voravud N, Poovorawan Y, Mutirangura A. Cytochrome P450 2E1 polymorphism and nasopharyngeal carcinoma development in Thailand: a correlative study. BMC Cancer. 2001;1.4.

Koontongkaew S, Chareonkitkajom L, Chanvitan A, Leelakriangsak M, Amomphimoltham P. Alterations of p53, pRb, cyclin D(l) and cdk4 in human oral and pharyngeal squamous cell carcinomas.: Oral Oncol. 2000 Jul;36(4):334-9.

Krishnamurthy S.: Treatment of advanced oral cancer. Ind. Jr. of Surg. 21: 407-11, 1959.

REFERENCES 138

Kudo Y, Takata T, Ogawa I, Kaneda T, Sato S, Takekoshi T, Zhao M, Miyauchi M, Nikai H.p27Kipl accumulation by inhibition of proteasome function induces apoptosis in oral squamous cell carcinoma cells.Clin Cancer Res. 2000 Mar;6(3):9I6-23.

Kuo MY, Lin CY, Hahn LJ, Cheng SJ, Chiang CP. Expression of cyclin Dl is correlated with poor prognosis in patients with areca quid chewing-related oral squamous cell carcinomas in Taiwan. J. oral Pathol Med 1999; 28(4): 165-9.

Kuttan,N.A., Rosin.M.P., Ambika,K., Priddy.R.W., Bhakthan.N.M. and Zhang,L. (1995) High prevalence of expression of p53 oncoprotein in oral carcinomas from India associated with betel and tobacco chewing. Eur. J. Cancer B Oral Oncol., 31, 169-173.

Kwong YY, Husain Z, Biswas DK. c-Ha-ras gene mutation and activation precede pathological changes in DMBA-induced in vivo carcinogenesis. Oncogene. 1992 Aug;7(8):1481-9.

Kyomoto R, Kumazawa H, Toda Y, Sakaida N, Okamura A, Iwanaga M, Shintaku M, Yamashita T, Hiai H, Fukumoto M. Cyclin-Dl-gene amplification is a more potent prognostic factor than its protein over-expression in human head-and-neck squamous-cell carcinoma: Int J Cancer. 1997 Dec 19;74(6): 576-81.

La Vechia C, Franceschi S, Levi F, Negri E. Diet and human oral carcinoma in Europe. Oral Oncology, European Journal of Cancer 1993; 29B:17-22.

La Vechia C, Tavani A, Franceschi S, Levi F, Corrao G, Negri E. Epidemiology and prevention of oral cancer. Oral Oncology 1997;33:302-312.

Lain S, Xirodimas D, Lane DP.Accumulating active p53 in the nucleus by inhibition of nuclear export: a novel strategy to promote the p53 tumor suppressor function.Exp Cell Res. 1999 Dec 15;253(2):315-24. Review.

Lam KY, Ng lOL, Yuen APW, Kwong DLW, Wei W. Cyclin Dl expression in oral squamous cell carcinomas: clinicopathological relevance and correlation with p53 expression. J oral pathol Med. 2000; 29(4): 167-72.

Lamerdin, J. E., Montgomery, M.A., Stilwagen, S.A., Scheidecker, I.K., Tebbs, R.S,, Brookman, K.W., Thompson, L. H., and Carrano, A.V. Genomic sequence comparison of the human and mouse XRCCI DNA repair gene regions .Genomics 25: 547-557, 1995.

Lane DP, Benchimol S. p53: oncogene or anti-oncogene? Genes Dev. 1990 Jan;4(l):l-8.

Lane DP.Cancer. p53, guardian of the genome.Nature. 1992 Jul 2;358(6381):15-6.

Lane DP.Killing tumor cells with viruses~a question of specificity .Nat Med. 1998 Sep;4(9):1012-3.

REFERENCES 139

Langdon JD, Harvey PW, Rapidis AD, Patel MF, Johnson NW, Hopps R. Oral cancer: the behaviour and response to treatment of 194 cases. J Maxillofac Surg. 1977 Nov;5(4):221-37.

Langdon JD, Partridge M. Expression of the tumour suppressor gene p53 in oral cancer. Br J Oral Maxillofac Surg. 1992 Aug;30(4):214-20.

Largey JS, Meltzer SJ, Yin J, Norris K, Sauk JJ, Archibald DW. Loss of heterozygosity of p53 in oral cancers demonstrated by the polymerase chain reaction.Cancer. 1993 Mar 15; 71(6): 1933-7.

Le Marchand L, Sivaraman L, Pierce L, Seifried A, Lum A, Wilkens LR, Lau AF.Associations of CYPlAl, GSTMl, and CYP2E1 polymorphisms with lung cancer suggest cell type specificities to tobacco carcinogens.Cancer Res. 1998 Nov l;58(21):4858-63.

Le Marchand, L., Donlon, T., Lum-Jones, A., Seifried, A., and Wilkens, L.R. Association of hOGGl Ser326Cys Polymorphism with lung cancer risk. Cancer Epidemiol. Bio Prev 2002; 11:409-412.

Lechevrel, M., Casson. A.G., Wolf, C.R., Hardie, L.J., Flinterman, M.B., Motesano, R. and Wild, C.P. Characterization of Cytochrome P450 expression in human esophageal mucosa. Carcinogenesis (Lond.)1999; 20: 243-248.

Lee JM, Lee YC, Yang SY, Yang PW, Luh SP, Lee CJ, Chen CJ, Chen CJ, Wu MT. Genetic polymorphisms of XRCCl and risk of the esophageal cancer. Int. J Cancer2001; 95(4): 240-6.

Lee SG, Kim B, Choi J, Kim C, Lee I, Song K. Genetic polymorphisms of XRCCl and risk of gastric cancer. Cancer Lett 2002; 187:53-60.

Lee WH.Tumor suppressor genes-the hope.FASEB J. 1993 Jul;7(10):819.

Lemon FR, Walden RT, Woods RW. Cancer of the lung and mouth in Seventh Day Adventists. Preliminary report on a population study. Cancer 1964; 17:1891-1896.

Liloglou T, Scholes AG, Spandidos DA, Vaughan ED, Jones AS, Field JK.p53 mutations in squamous cell carcinoma of the head and neck predominate in a subgroup of former and present smokers with a low frequency of genetic instability.Cancer Res. 1997 Sep 15;57(18):4070-4.

Lindahl T, Wood RD. Quality control by DNA repair.Science. 1999 Dec3;286(5446): 1897-905. Review.

Lippman SM, Lee JS, Lotan R, Hittelman W, Wargovich MJ, Hong WK.Biomarkers as intermediate end points in chemoprevention trials.J Natl Cancer Inst. 1990 Apr 4;82(7):555-60.

REFERENCES 140

Liu S, Park JY, Schantz SP, Stem JC, Lazarus P. Elucidation of CYP2E1 5' regulatory Rsal/Pstl allelic variants and their role in risk for oral cancer. Oral Oncol. 2001 Jul;37(5):437-45.

Liu TJ, Zhang WW, Taylor DL, Roth JA, Goepfert H, dayman GL. Growth suppression of human head and neck cancer cells by the introduction of a wild-type p53 gene via a recombinant adenovirusCancer Res. 1994 Jul 15;54(14):3662-7.

Lo Muzio L, Pannone G, Mignogna MD, Staibano S, Mariggio MA, Rubini C, Procaccini M, Dolci M, Bufo P, De Rosa G, Piattelli A.P-cadherin expression predicts clinical outcome in oral squamous cell carcinomas.Histol Histopathol. 2004 Oct; 19(4): 1089-99.

London SJ, Daly AK, Cooper J, Carpenter CL, Navidi WC, Ding L, Idle JR. Lung cancer risk in relation to the CYP2E1 Rsa I genetic polymorphism among African-Americans and Caucassians in Los Angeles County. Pharmacogenetics 1996; 6(2):151-8.

R, Xu XC, Lippman SM, Ro JY, Lee JS, Lee JJ, Hong WK.Suppression of retinoic acid receptor-beta in premalignant oral lesions and its up-regulation by isotretinoin.N Engl J Med. 1995 May 25;332(21):1405-10.

Loic Le Marchand, Lakshmi Sivaraman, Lisa Pierce, Ann Seifreid, Annette Lum, Lynne R. Wilkens, and Alan F. Lau. Association of CYPlAl, GSTMl, and CY2E1 Polymorphisms with Lung Cancer Suggest Cell Type specificities to tobacco Carcinogens Cancer Research 1998; 58,4858-4863.

Lucas D., Menez, C, Girre. C, Berthou, F., Bodenez, P., Joannet, L, Hispard, E., Bardou L-G., and Menez, J.F. Cytochrome P450E1 genotype and chlorzoxazone metabolism in healthy and alcoholic Caucasian subjects. Pharmacogenetics, 1995; 5: 298-394.

Lunn RM, Langlois RG, Hsieh LL, Thompson CL, Bell DA. XRCCI polymorphisms: effects on aflatoxin Bl-DNA adducts and glycophorin A variant frequency. Cancer Res 1999; 59: 2557-61.

Majumder M, Sikdar N, Ghosh S, Roy B. Polymorphisms at XPD and XRCCI DNA repair loci and increased risk of oral leukoplakia and cancer among NAT2 slow acetylators. Int. J Cancer 2007; 120(10): 2148-56.

Majumder M, Sikdar N, Paul RR, Roy B.Increased risk of oral leukoplakia and cancer among mixed tobacco users carrying XRCCI variant haplotypes and cancer among smokers carrying two risk genotypes: one on each of two loci, GSTM3 and XRCCI (Codon 280).Cancer Epidemiol Biomarkers Prev. 2005 Sep;14(9):2106-12.

REFERENCES 141

Mareel M, Vleminckx K, Vermeulen S, Yan G, Bracke M, van Roy F.Downregulation in vivo of the invasion-suppressor molecule E-cadherin in experimental and clinical cancer.Princess Takamatsu Symp. 1994;24:63-80. Review.

Masson M, Niedergang C, Schreiber V, MuUer S, Menissier-de Murcia J, de Murcia G. XRCCl is specifically associated with poly(ADP-ribose) polymerase and negatively regulates its activity following DNA damage. Mol Cell Biol. 1998 Jun;18(6):3563-71.

Matsui Y, Halter SA, HoU JT, Hogan BL, Coffey RJ.Development of mammary hyperplasia and neoplasia in MMTV-TGF alpha transgenic mice.Cell. 1990 Jun 15;61(6):1147-55.

Matthias C, Bockmuhi U, Jahnke V, Jones PW,Hayes JD, Alderson J, Gilford J, Bailey L, Bath J, Warrall SF, Hand P, Frver AA, Strange RC .Polymorphisms in cytochrome P450,CYP2D6, CYPlAl, CyP2El and glutathione S- transferase, GSTMI, GSTM3, GSTTl and susceptibility to tobacco-related cancers:studies in upper aerodigestive tract cancers. Pharmacogenetics, 1998; 8 (2):91-100.

McCoy GD, Wynder EL. Etiological and preventive implications in alcoholic carcinogens. Cancer Research 1979; 39:2844-2850.

Mehrotra R, Singh M, Kumar D, Pandey AN, Gupta RK, Sinha US.Age specific incidence rate and pathological spectrum of oral cancer in Allahabad.Indian J Med Sci. 2003 Sep;57(9):400-4.

Mehta FS, Daftary DK, Shroff BC, Sanghvi LD.Clinical and histologic study of oral leukoplakia in relation to habits. A five-year follow-up.Oral Surg Oral Med Oral Pathol. 1969 Sep;28(3):372-88.

• Mehta FS, Gupta PC, Daftary DK, Pindborg JJ, Choksi SK.An epidemiologic study of

oral cancer and precancerous conditions among 101,761 villagers in Maharashtra, India.Int J Cancer. 1972 Jul 15; 10(1):134-41.

Mehta FS, Shroff BC, Gupta PC, Daftary DK.Oral leukoplakia in relation to tobacco habits. A ten-year follow-up study of Bombay policemen.Oral Surg Oral Med Oral Pathol. 1972 Sep;34(3):426-33.

Merritt WD, Weissler MC, Turk BF, Gilmer TM. Oncogene amplification in squamous cell carcinoma of the head and neck. Arch Otolaryngol Head Neck Surg. 1990 Dec; 116(12): 1394-8

Metsola K, Kataja V, Sillanp P, Siilvola P, Heikinheimo L, Eskelinen M, Kosma VM, Uusitupa M, Hirvonen A. XRCCI and XPD genetic polymorphisms, smoking and breast cancer risk in a Finnish case-control study. Breast Cancer Res. 2005; 7(6): 987-997.

REFERENCES 142

Michalides R, van-Veelen N, Hart A, Loftus B, Wientjens E, Balm A. Overexpression of Cyclin Dl correlates with recurrence in a group of forty-seven operable squamous cell carcinomas of the head and neck. Cancer Res.1995; 55: 975-8.

Michalides RJ, van Veelen NM, Kristel PM, Hart AA, Loftus BM, Hilgers FJ, Balm AJ. Overexpression of cyclin Dl indicates a poor prognosis in squamous cell carcinoma of the head and neck: Arch Otolaryngol Head Neck Surg. 1997 May;123(5):497-502.

Michalides RJ.Cell cycle regulators: mechanisms and their role in aetiology, prognosis, and treatment of cancer. J Clin Pathol. 1999 Aug;52(8):555-68.

Million RP, Cassisi NJ. Management of head and neck cancer: a multidisciplinary approach. 2nd ed, Philadelphia: Lippincott, 1993.

Mincer HH, Coleman SA, Hopkins KP. Observation on the clinical characteristics of oral lesions showing histologic epithelial dysplasia. Oral Med Oral Pathol 1972; 33:389-99.

Mishra RR, Ratnasinghe D, Tangrea JA, Virtamo J, Andersen MR, Barrett M, Taylor PR, Albanes D. Polymorphisms in the DNA repair genes XPD, XRCCI, XRCC3, and APE/ref-1, and the risk of lung cancer among male smokers in Finland. Cancer Letters 2003; 191 (2): 171-8.

Monteiro E, Varzim G, Silva R, Da Costa B, Lopes C. Polymorphism of the human OGGI gene in laryngeal cancer: implications in radiotherapy response and survival. Rev. Laryngol Otol Rhinol 2005; 126(3): 135-40.

Moroco JR, Soh DB, Polverini PJ.Sequential loss of suppressor genes for three specific functions during in vivo carcinogenesis.Lab Invest. 1990 Sep; 63(3):298-306.

Morton RA, Ewing CM, Nagafuchi A, Tsukita S, Isaacs WB: Reduction of E-cadherin levels and deletion of the a-catenin gene in human prostate cancer cells. Cancer Res 1993, 53:3585-3590.

Moses HL, Yang EY, Pietenpol JA. TGF-beta stimulation and inhibition of cell proliferation: new mechanistic insights. Cell. 1990 Oct 19;63(2):245-7.

Motokura T, Arnold A.Cyclins and oncogenesis.Biochim Biophys Acta. 1993 May 25;1155(l):63-78. Review.

Moullan N, Cox DG, Angele S, Romestaing P, Gerard JP, Hall JX. Polymorphisms in the DNA repair gene XRCCI, breast cancer risk, and response to radiotherapy. Cancer Epidemiol BiomarkerPrev 2003; 12: 1168-74.

Murti PR, Wamakulasuriya KA, Johnson NW, Bhonsle RB, Gupta PC, Daftary DK, Mehta FS. p53 expression in oral precancer as a marker for malignant potential.J Oral Pathol Med. 1998 May;27(5):191-6.

B

REFERENCES 143

Muwonge R, Ramadas K, Sankila R, Thara S, Thomas G, Vinoda J, Sankaranarayanan R.Role of tobacco smoking, chewing and alcohol drinking in the risk of oral cancer in Trivandrum, India: A nested case-control design using incident cancer cases.Oral Oncol. 2007 Oct 12.

Nair UJ, Nair J, Mathew B, Bartsch H. Glutathione S-transferase Ml and Tl null genotypes as risk factors for oral leukoplakia in ethnic Indian betel quid/tobacco chewers.Carcinogenesis. 1999 May; 20(5):743-8.

Nakajima, T., Wang, R.S., Nimura. Y., Pin, Y-M., He, M., Vainio, H., Murayama, N., Aoyama, T., and lida, F. Expression of cytochrome P450s and glutathione S-transferases in human esophagus with squamous carcinomas. Carcinogenesis (Lond) 1996; 17: 1477-1481.

Nam J, McLaughlin JK, Blot WJ. Cigarette smoking,alcohol and nasopharyngeal carcinoma: a case control study among U.S. whites. J Natl Cancer Inst 1992; 84:619-22.

Nandakumar A, Thimmasetty KT, Sreeramareddy NM, Venugopal TC, Rajanna, Vinutha AT, Srinivas, Bhargava MK.A population-based case-control investigation on cancers of the oral cavity in Bangalore, India.Br J Cancer. 1990 Nov; 62(5):847-51.

Nash RA, Caldecott KW, Barnes DE, Lindahl T.XRCCl protein interacts with one of two distinct forms of DNA ligase III.Biochemistry. 1997 Apr 29; 36(17):5207-11.

Nawroz H, van der Riet P, Hruban RH, Koch W, Ruppert JM, Sidransky D. Allelotype of head and neck squamous cell carcinoma. Cancer Res. 1994 Mar 1;54(5):1152-5.

Neves Ada C, Mesquita RA, Novelli MD, Toddai E, De Sousa So Comparison between immunohistochemical expression of cyclin Dl and p21 and histological malignancy graduation of oral squamous cell carcinomas. Braz Dent J. 2004;15(2):93-8.

Notani PN. Role of alcohol in cancers of the upper alimentary tract: use of models in risk assessment. J Epidemiol Community Health. 1988 Jun; 42(2): 187-92

Notani, P.N. and Jayant. K. Role of diet in upper aerodigestive tract cancers. Nutr. Cancer 1987; 10:103-113.

Nylander K, Dabelsteen E, Hall PA.The p53 molecule and its prognostic role in squamous cell carcinomas of the head and neck.J Oral Pathol Med. 2000 Oct;29(9):413-25. Review.

Owens W, Field JK, Howard PJ, Stell PM.Muhiple cytogenetic aberrations in squamous cell carcinomas of the head and neck.Eur J Cancer B Oral Oncol. 1992 Jul;28B(l): 17-21.

REFERENCES 144

Pack G.T. and LcFevere R.G.: The racial and age incidence of oral cancer and other malignant tumors, Am. J of cancer 14: 167, 1930.

Pande P, Soni S, Kaur J, Agarwal S, Mathur M, Shukla NK, Ralhan R. Prognostic factors in betel and tobacco related oral cancer: Oral Oncol. 2002 Jul;38(5):491-9.

Park BZ, Kohn WG, Malvitz DM. Preventing and controlling oral and pharyngeal cancer- recommendations from a national strategic planning conference. Morbidity & Mortality Weekly Report 1998; 47:1-12.

Park J, Chen L, Tockman MS, Elahi A, Lazarus P. The human 8-oxoguanine DNA N-glycosylase 1 (hOGGl) DNA repair enzyme and its association with lung cancer risk. Pharmacogenetics. 2004 Feb; 14(2): 103-9.

Park K: Text Book of Preventive and Social Medicine. Pb Banarsidas Bhanot, Jabalpur 18th Edition, 2005.

Parkin SM, Laara E, Muir CS. Estimates of the worldwide frequency of sixteen major cancers. International Journal of Cancer 1988; 41:184-197.

Partridge M, GuUick WJ, Langdon JD, Sherriff M. Expression of epidermal growth factor receptor on oral squamous cell carcinoma.Br J Oral Maxillofac Surg. 1988 Oct;26(5):381-9.

Paymaster JC.The problem of oral, oropharyngeal, and hypopharyngeal carcinoma in India.Br J Surg. 1957 Mar; 44(187):467-71.

Perera FP. Molecular epidemiology: insights into cancer susceptibility, risk assessment, and prevention. J Natl Cancer Inst. 1996 Apr 17; 88(8):496-509.

Peto J. Cancer epidemiology in the last century and the next decade. Nature. 2001 May 17;411(6835):390-5.

Pindborg JJ.Epidemiological studies of oral cancer.Int Dent J. 1977 Jun 2;27(2): 172-8.

Polverini PJ.The pathophysiology of angiogenesis.Crit Rev Oral Biol Med. 1995;6(3):230-47. Review.

Poplawski T, Arabski M, Kozirowska D, Blasinska-Morawiec M, Morawiec Z, Morawiec-Bajda A, Klupinska G, Jeziorski A, Chojnacki J, Blasiak J. DNA damage and repair in gastric cancer-correlation with the hOGGl and RAD51 genes polymorphism. Mutat Res. 2006; 601(l-2):83-91.

R.A.WILLS ,In pathology of tumors ,3' ''. Edition,Butterworths, London,ppl.

Radicella, J. P.,Dherin. C, Desmaze, C, Fox. M.S. and Bioteux S. Cloning and characterization of hOGGl, a human homolog of the OGGl gene of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA.1997;94: 8010-8015.

REFERENCES 145

Rajkumar T, Sridhar H, Balaram P, Vaccarella S, Gajalakshmi V, Nandakumar A, Ramdas K, Jayshree R, Munoz N, Herrero R, Franceschi S, Weiderpass E. Oral cancer in Southern India: the influence of body size, diet, infections and sexual practices.Eur J Cancer Prev. 2003 Apr; 12(2): 135-43.

Ralhan R, Chakravarti N, Kaur J, Sharma C, Kumar A, Mathur M, Bahadur S, Shukla NK, Deo SV. Clinical significance of altered expression of retinoid receptors in oral precancerous and cancerous lesions: relationship with cell cycle regulators. Int J Cancer. 2006 Mar 1; 118(5): 1077-89.

Ramachandran S, Ramadas K, Hariharan R, Rejnish Kumar R, Radhakrishna Pillai M. Single nucleotide polymorphisms of DNA repair genes XRCCl and XPD and its molecular mapping in Indian oral cancer. Oral Oncol. 2006 Apr;42(4):350-62.

Ranasinghe AW, Wamakulasuriya KA, Johnson NW. Low prevalence of expression of p53 oncoprotein in oral carcinomas from Sri Lanka associated with betel and tobacco chewing.: Eur J Cancer B Oral Oncol. 1993 Apr;29B(2): 147-50.

Rao DN, Ganesh B, Rao RS, Desai PB.Risk assessment of tobacco, alcohol and diet in oral cancer~a case-control study .Int J Cancer. 1994 Aug 15;58(4):469-73.

Rastinejad F, Polverini PJ, Bouck NP. Regulation of the activity of a new inhibitor of angiogenesis by a cancer suppressor gene. Cell. 1989 Feb 10;56(3):345-55

Ratnasinghe D, Yao SX, Tangrea JA, et al. Polymorphisms of the DNA repair gene XRCCI and lung cancer risk.Cancer Epidemiol Biomarkers Prev 2001; 10:119 -23.

Raubenheimer EJ, DE Villiers PIA.Clinical manifestations of oral precancer and cancer. Journal of the Dental Association of South Africa 1989; 11-14.

Ravi D, Nalinakumari KR, Rajaram RS, Nair MK, Pillai MR. Expression of programmed cell death regulatory p53 and bcl-2 proteins in oral lesions. Cancer Lett. 1996 Aug 2; 105(2): 139-46.

Raybaud-Diogene H, Tetu B, Morency R, Fortin A, Monteil RA. p53 overexpression in head and neck squamous cell carcinoma: review of the literature. Eur J Cancer B Oral Oncol. 1996 May;32B(3): 143-9.

Regelson W. Have we found the "definitive cancer biomarker"? The diagnostic and therapeutic implications of human chorionic gonadotropin-beta expression as a key to malignancy. Cancer. 1995 Oct 15;76(8):1299-301.

Rikimaru K, Tadokoro K, Yamamoto T, Enomoto S, Tsuchida N. Gene amplification and overexpression of epidermal growth factor receptor in squamous cell carcinoma of the head and neck. Head Neck. 1992 Jan-Feb;14(l):8-13.

REFERENCES 146

Riviere A, Wilckens C, Loning T.Expression of c-erbB2 and c-myc in squamous epithelia and squamous cell carcinomas of the head and neck and the lower female genital tract.J Oral Pathol Med. 1990 Oct;19(9):408-13.

Rosenquist K, Wennerberg J, Schildt EB, Bladstrom A, G5ran Hansson B, Andersson G.Oral status, oral infections and some lifestyle factors as risk factors for oral and oropharyngeal squamous cell carcinoma. A population-based case-control study in southern Sweden. Acta Otolaryngol. 2005 Dec;125(12):1327-36.]

Rothman K, Keller A.The effect of joint exposure to alcohol and tobacco on risk of cancer of the mouth and pharynx.J Chronic Dis. 1972 Dec;25(12):711-6.

Rumsby G, Carter RL, Gusterson BA. Low incidence of ras oncogene activation in human squamous cell carcinomas.Br J Cancer. 1990 Mar;61(3):365-8.

Sacchi M, Klapan I, Johnson JT, Whiteside TL.Antiproliferative effects of cytokines on squamous cell carcinoma. Arch Otolaryngol Head Neck Surg. 1991 Mar;117(3):321-6.

Sambrook J, Gething MJ.Protein structure. Chaperones, paperones. Nature. 1989 Nov 16;342(6247):224-5.

Sandgren EP, Luetteke NC, Palmiter RD, Brinster RL, Lee DC. Overexpression of TGF alpha in transgenic mice: induction of epithelial hyperplasia, pancreatic metaplasia, and carcinoma of the breast. Cell. 1990 Jun 15;61(6):1121-35.

Sandgren EP, Luetteke NC, Qiu TH, Palmiter RD, Brinster RL, Lee DC.Transforming growth factor alpha dramatically enhances oncogene-induced carcinogenesis in transgenic mouse pancreas and liver. Mol Cell Biol. 1993 Jan;13(l):320-30

Sandhya Agarwal, Meera Mathur, Anurag Srivastava, Ranju Ralhan.MDM2/p53 co-expression in oral premalignant and malignant lesions: potential prognostic implications. Oral Oncology 1999; 35: 209-216.

Sanghvi LD, Rao KC, Khanolkar VR. Smoking and chewing of tobacco in relation to cancer of the upper alimentary tract.Br Med J. 1955 May 7;1(4922):1111-4.

Sanghvi LD. Cancer epidemiology: the Indian scene. J Cancer Res Clin Oncol. 1981;99(l-2): 1-14.

Sankaranarayanan R, Duffy SW, Day NE, Nair MK, Padmakumary G. A case-control investigation of cancer of the oral tongue and the floor of the mouth in southern India. Int J Cancer. 1989 Oct 15;44(4):617-21.

Sankaranarayanan R, Duffy SW, Padmakumary G, Day NE, Krishan Nair M.Risk factors for cancer of the buccal and labial mucosa in Kerala, southern India.J Epidemiol Community Health. 1990 Dec; 44(4):286-92.

REFERENCES 147

Sankaranarayanan,R.,Duffy,S.W.,Day,N.E.,Nair,M.K.,Padmakumary, G. A Case control investigation of cancers of the tongue and the floor of the mouth in Southern India. Int. J Cancer 1989: 617-621.

Santini J, Formento JL, Francoual M, Milano G, Schneider M, Dassonville O, Demard F.Characterization, quantification, and potential clinical value of the epidermal growth factor receptor in head and neck squamous cell carcinomas.Head Neck. 1991 Mar-Apr; 13(2): 132-9.

Sanyal S, Festa F, Sakano S, et al. Polymorphisms in DNA repair and metabolic genes in bladder cancer. Carcinogenesis 2004; 25:729-34.

Saranath D, Bhoite LT, Deo MG. Molecular lesions in human oral cancer: the Indian scene. Eur J Cancer B Oral Oncol. 1993 Apr;29B(2): 107-12.

Saranath D, Chang SB, Bhoite LT, Panchal RG, Kerr IB, Mehta AR, Johnson NW, Deo MG.High frequency mutation in codons 12 and 61 of H-ras oncogene in chewing tobacco-related human oral carcinoma in India.Br J Cancer. 1991 Apr;63(4):573-8.

Saranath D, Panchal RG, Nair R, Mehta AR, Sanghavi VD, Deo MG. Amplification and overexpression of epidermal growth factor receptor gene in human oropharyngeal cancer. Eur J Cancer B Oral Oncol. 1992 Oct;28B(2): 139-43

Saranath D, Tandle AT, Teni TR, Dedhia PM, Borges AM, Parikh D, Sanghavi V, Mehta AR. p53 inactivation in chewing tobacco-induced oral cancers and leukoplakias from India: Oral Oncol. 1999 May;35(3):242-50.

Sarmanova J, Benesova K, Gut I, Nedelcheva-Kristensen V, Tynkova L, Soucek P. Genetic polymorphisms of biotransformation enzymes in patients with Hodgkin's and non-Hodgkin's lymphomas. Hum Mol Genet. 2001 Jun 1; 10(12): 1265-73

Saxenan ON, Agarwal GR..Oral cancer, a statistical study of 963 cases.J Indian Med Assoc. 1965 febl; 44:119-22.

Schantz SP. Basic science advances in head and neck oncology: the past decade. Semin Surg Oncol. 1995 May-Jun;ll(3):272-9.

Scheffner M, Wemess BA, Huibregtse JM, Levine AJ, Howley PM. The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53. Cell. 1990 Dec 21;63(6): 1129-36.

Schneider J, Classen V, Bemges U, Phillipp M. XRCCl polymorphism and lung cancer risk in relation to tobacco smoking. Int. J Mol. Med. 2005; 16(4): 709-16. Science. 1989 Feb 17;243(4893):934-7.

Scully C.Oncogenes, tumor suppressors and viruses in oral squamous carcinoma.J Oral Pathol Med. 1993 Sep;22(8):337-47. Review.

REFERENCES 148

Serrano M, Hannon GJ, Beach D.A new regulatory motif in cell-cycle control causing specific inhibition of cyclin D/CDK4.Nature. 1993 Dec 16;366(6456):704-7.

Shafer WG, Wladron CA. Erythroplakia of the oral cavity. Cancer 1975; 36:1021-8. .

Sharma RN.Oral carcinoma: a clinical study of 122 cases.J Indian Med Assoc. 1964 Sep 16; 43:263-8.

Shen M, Hung RJ, Brennan P, Malaveille C, Donato F, Placidi D, Carta A, Hautefeuille A, Boffetta P, Porru S. Polymorphisms of the DNA repair genes XRCCl, XRCC3, XPD, interaction with environmental exposures, and bladder cancer risk in a case-control study in northern Italy. Cancer Epidemiol Biomarkers Prev. 2003 Nov; 12(11 Ptl): 1234-40

Shen, M. R., Jones, I.M., and Mohrenweiser, H. Nonconservative amino acid substitution variants exist at polymorphic frequency in DNA repair genes in healthy humans. Cancer Res., 58: 604-608, 1998.

Sheng ZM, Barrois M, Klijanienko J, Micheau C, Richard JM, Riou G. Analysis of the c-Ha-ras-1 gene for deletion, mutation, amplification and expression in lymph node metastases of human head and neck carcinomas. Br J Cancer. 1990 Sep;62(3):398-404.

Shih C, Padhy LC, Murray M, Weinberg RA.Transforming genes of carcinomas and neuroblastomas introduced into mouse fibroblasts.Nature. 1981 Mar 19;290(5803):261-4.

Shih TY, Papageorge AG, Stokes PE, Weeks MO, Scolnick EM. Guanine nucleotide-binding and autophosphorylating activities associated with the p21src protein of Harvey murine sarcoma virus. Nature. 1980 Oct 23;287(5784):686-91.

Shin DM, Gimenez IB, Lee JS, Nishioka K, Wargovich MJ, Thacher S, Lotan R, Slaga TJ, Hong WK.Expression of epidermal growth factor receptor, polyamine levels, ornithine decarboxylase activity, micronuclei, and transglutaminase I in a 7,12-dimethylbenz(a)anthracene-induced hamster buccal pouch carcinogenesis model.Cancer Res. 1990 Apr 15;50(8):2505-10.

Shinmura K, Yokota J.The OGGl gene encodes a repair enzyme for oxidatively damaged DNA and is involved in human carcinogenesis.Antioxid Redox Signal. 2001 Aug;3(4):597-609. Review.

Shinmura, K., Kohno. T., Teckeuchi-Sasaki, M., Maeda, M., Segawa T., Kamo. T., Sugimura, H. and Yokota, J. Expression of the OGGI type (nuclear form) protein in cancerous and non-cancerous human cells. Int. J Oncol. 2000; 16: 701-707.

Shintani S, Yoshihama Y, Emilio AR, Matsumura T.Overexpression of p53 is an early event in the tumorigenesis of oral squamous cell carcinomas.Anticancer Res. 1995 Mar-Apr; 15(2):305-8.

REFERENCES 149

Shklar G. Oral leukoplakia. N. Engl J Med 1986; 315:1544-5.

Sidransky D (1995). Molecular genetics of head and neck cancer. Curr Opin Oncol 7:229-233.

Sidransky D, Boyle J, Koch W.Molecular screening. Prospects for a new approach.Arch Otolaryngol Head Neck Surg. 1993 Nov;l 19(11):1187-90. Review.

Sidransky D, Hollstein M. Clinical implications of the p53 gene. Annu Rev Med. 1996;47:285-301.

Sikdar N, Mahmud SA, Paul RR, Roy B.Polymorphism in CYPlAl and CYP2E1 genes and susceptibility to leukoplakia in Indian tobacco users.Cancer Lett. 2003 May 30; 195(l):33-42.

Silverman S Jr, Gorsky M, Lozada F. Oral leukoplakia and malignant transformation. A follow up study of 257 patients. Cancer 1984;53:563-8.

Silverman S Jr, Gorsky M. Epidermiologic and demographic update in oral cancer: California and national data-1973 to 1985. J Am Dent Assoc 1990; 120:495-9.

Silverman S Jr.Early diagnosis of oral cancer. Cancer. 1988 Oct 15;62(8): 1796-9.

Smith TR, Miller MS, Lohman K, et al. Polymorphisms of XRCCI and XRCC3 genes and susceptibility to breast cancer. Cancer Lett 2003; 190: 183-90.

Somers KD, Cartwright SL, Schechter GL. Amplification of the int-2 gene in human head and neck squamous cell carcinomas. Oncogene. 1990 Jun;5(6):915-20.

Somerwell T.H.: Risk assessment of tobacco, alcohol and diet in oral cancer- a case control study, Brit. J. Surg. 32: 35, 1944.

Soni S, Kaur J, Kumar A, Chakravarti N, Mathur M, Bahadur S, Shukla NK, Deo SV, Ralhan R. Alterations of rb pathway components are frequent events in patients with oral epithelial dysplasia and predict clinical outcome in patients with squamous cell carcinoma. Oncology. 2005;68(4-6):314-25.

Spandidos DA, Lamothe A, Field JK.Multiple transcriptional activation of cellular oncogenes in human head and neck solid tumours.Anticancer Res. 1985 Mar-Apr; 5(2):221-4.

Spom MB, Todaro GJ.Autocrine secretion and malignant transformation of cells.N Engl J Med. 1980 Oct 9;303(15):878-80.

Staibano S, Mignogna MD, Lo Muzio L, Di Alberti L, Di Natale E, Lucariello A, Mezza E, Bucci E, DeRosa G.Overexpression of cyclin-Dl, bcl-2, and bax proteins, proliferating cell nuclear antigen (PCNA), and DNA-ploidy in squamous cell carcinoma of the oral cavity.Hum Pathol. 1998 Nov;29(l 1):1189-94.

REFERENCES 150

Stanbridge EJ, Flandermeyer RR, Daniels DW, Nelson-Rees WA.Specific chromosome loss associated with the expression of tumorigenicity in human cell hybrids.Somatic Cell Genet. 1981 Nov;7(6):699-712. Study of 2295 biopsies of malignant tumors, Ind. Jr. of Med. Res.32:l, 1944.

Sugimura T, Kumimoto H, Tohnai I, Fukui T, Matsuo K, Tsurusako S, Mitsudo K, Ueda M, Tajima K, Ishizaki KGene-environment interaction involved in oral carcinogenesis: molecular epidemiological study for metabolic and DNA repair gene polymorphisms. J Oral Pathol Med. 2006 Jan;35(l):l 1-8.

Sugimura, H., Kohno, T., Wakai, K., Nagura, K., Genka, K., Igarashi, H., Morris, B.J., Baba, S., Ohno, Y., Gao, C, Li, Z., Wang, J., Tekezaki., T., Tajima K., varga, T., Sawaguchi, T., Lum, J.K., Martinson, J.J., Tsugane, S., Iwamasa T., shinmura, K., and Yokota, J. hOGGI Ser326Cys polymorphism and lung cancer susceptibility. Cancer Epidemiol Bio Prev 1999; 8: 669-674.

Sun F, Tsuritani I, Honda R, Ma ZY, Yamada Y. Association of genetic polymorphisms of alcohol-metabolizing enzymes with excessive alcohol consumption in Japanese men. Hum Genet. 1999 Oct;105(4):295-300

Sunaga N, Kohno T, Shinmura K, Saitoh T, Matsuda T, Saito R, Yokota J.OGGl protein suppresses G:C~>T:A mutation in a shuttle vector containing 8-hydroxyguanine in human cells.Carcinogenesis. 2001 Sep;22(9): 1355-62.

Takes RP, Baatenburg. RJ, Schuuring E, Latvinov SV, Van Kreiken JH. Differences in expression of oncogenes and suppressor genes in different sites of head and neck squamous carcinoma. Anticancer Res 1998; 18: 4793-800.

Takezaki T, Gao CM, Wu JZ, Li ZY, Wang JD, Ding JH, Liu YT, Hu X, Xu TL, Tajima K, Sugimura H.hOGGl Ser(326)Cys polymorphism and modification by environmental factors of stomach cancer risk in Chinese.Int J Cancer. 2002 Jun l;99(4):624-7.

Takezaki T, Hirose K, Inoue M, Hamajima N, Kuroishi T, Nakamura S, Koshikawa T, Matsuura H, Tajima K. Tobacco, alcohol and dietary factors associated with the risk of oral cancer among Japanese Jpn J Cancer Res. 1996 Jun; 87(6):555-62.

Tan W, Song N, Wang GQ, Liu Q, Tang HJ, Kadlubar FF, Lin DX. Impact of genetic polymorphisms in cytochrome P450 2E1 and glutathione S-transferases Ml, Tl, and PI on susceptibility to esophageal cancer among high-risk individuals in China.Cancer Epidemiol Biomarkers Prev. 2000 Jun;9(6):551-6.

Tanaka F, Shiratori Y, Yokosuka O, Imazeki F, Tsukada Y, Omata M. Polymorphism of alcohol-metabolizing genes affects drinking behavior and alcoholic liver disease in Japanese men. Alcohol Clin Exp Res. 1997 Jun; 21(4):596-601.

Tanaka N, Ogi K, Odajima T, Dehari H, Yamada S, Sonoda T, Kohama G.pRb2/pl30 protein expression is correlated with clinicopathologic findings in patients with oral squamous cell carcinoma. Cancer. 2001 Oct 15;92(8):2117-25.

REFERENCES 151

The GLOBOCAN 2002 database, The International Agency for Research on Cancer (IARC), Lyon, France.

Thomas G, Hashibe M, Jacob BJ, Ramadas K, Mathew B, Sankaranarayanan R, Zhang ZF. Risk factors for multiple oral premalignant lesions.Int J Cancer. 2003 Nov 1;107(2):285-91.

Thompson LH, West MG. XRCCI keeps DNA from getting stranded. Mutat Res 2000; 459:1-18.

Thongsuksai P, Boonyaphiphat P. Lack of association between p53 expression and betel nut chewing in oral cancers from Thailand : Oral Oncol. 2001 Apr;37(3):276-8I.Todd R, Chou MY, Matossian K, Gallagher GT, Donoff RB, Wong DT.

TNM classification (TNM Classification of Malignant Tumours, Sixth Edition, 2002). Editors: L.H. Sobin, Ch. Wittekind Publisher: John Wiley & Sons, Hoboken, New Jersey, 2002.

Todd R, Chou MY, Matossian K, Gallagher GT, Donoff RB, Wong DT.Cellular sources of transforming growth factor-alpha in human oral cancer.J Dent Res. 1991 May;70(5):917-23.

Todd R, Donoff BR, Gertz R, Chang AL, Chow P, Matossian K, McBride J, Chiang T, Gallagher GT, Wong DT.TGF-alpha and EGF-receptor mRNAs in human oral cancers.Carcinogenesis. 1989 Aug; 10(8): 1553-6.

Todd R, McBride J, Tsuji T, Donoff RB, Nagai M, Chou MY, Chiang T, Wong DT. Deleted in oral cancer-1 (doc-1), a novel oral tumor suppressor gene. FASEB J. 1995 Oct;9( 13): 1362-70

Trichopoulos D, Li FP, Hunter DJ. What causes cancer? Sci Am. 1996 Sep;275(3):80-7.

Ullrich A, Coussens L, Hayflick JS, Dull TJ, Gray A, Tam AW, Lee J, Yarden Y, Libermann TA, Schlessinger J, et al.Human epidermal growth factor receptor cDNA sequence and aberrant expression of the amplified gene in A431 epidermoid carcinoma cells.Nature. 1984 May 31-Jun 6;309(5967):418-25.

Van Oijen MG., Tilanus MG, Medema RH, Slootweg PJ. Expression of p21 (Wafl/Cip) in head and neck cancer in relation to proliferation, differentiation, p53 status and cyclin Dl expression. J. Oral Pathol Med. 1998; 27: 367-75.

van der Riet P, Nawroz H, Hruban RH, Corio R, Tokino K, Koch W, SidranskyD. Frequent loss of chromosome 9p21-22 early in head and neck cancer Cancer Res. 1994 Mar 1;54(5): 1156-8.

Van Gils CH, Bostick RM, Stem MC, Taylor JA. Differences in base excision repair capacity may modulate the effect of dietary antioxidant intake on prostate cancer

REFERENCES 152

risk: An example of polymorphisms in the XRCCI gene. Cancer Epidemiol Biomarker Prev 2002; 11:1279-84.

van Wyk CW, Stander I, Padayachee A, Grobler-Rabie AF. The areca nut chewing habit and oral squamous cell carcinoma in South African Indians. A retrospective study. : S Afr Med J. 1993 Jun;83(6):425-9.

Vogelstein B, Kinzler KW. The multistep nature of cancer. Trends Genet. 1993 Apr;9(4): 138-41.

Yokes EE, Weichselbaum RR, Lippman SM, Hong WK. Head and neck cancer. N Engl J Med 1993;328:184-94.

Wahi PN, Kehar U, Lahiri B.Factors influencing oral and oropharyngeal cancers in India.Br J Cancer. 1965 Dec;19(4):642-60.

WAHI PN, SAXENA SN, WAHI . Pashpati Nath Carcinoma of the oral cavity. J Indian Med Assoc. 1958 Oct; 31(8):309-19.

Wahi PN.The epidemiology of oral anc oropharyngeal cancer. A report of the study in Mainpuri district, Uttar Pradesh, India.Bull World Health Organ. 1968;38(4):495-521.

Wahi, P.N., Kehar. U. and Lahiri, B. Factors influencing oral and oropharyngeal Cancers in India. Brit J. Cancer. 1966; 19: 642-660.

Waldron CA, Shafer WG. Leukoplakia revisited. A clinicopathologic study of 3,256 oral leukoplakias. Cancer 1975; 36:1386-92.

Watanabe J, Yang JP, Eguchi H, Hayashi S, Imai K, Nakachi K, Kawajiri K. An Rsal polymorphism in the CYP2E1 gene does not affect lung cancer risk in a Japanese population. Jpn J cancer Res. 1995; 86(3):245-8.

Weiner T, Cance WG.Molecular mechanisms involved in tumorigenesis and their surgical implications. Am J Surg. 1994 Apr;167(4):428-34. Review.

Wells A, Bishop JM, Helmeste D.Amplified gene for the epidermal growth factor receptor in a human glioblastoma cell line encodes an enzymatically inactive protein.Mol Cell Biol. 1988 Oct;8(10):4561-5.

Wen Tan, Nau Song. Gui-Qi Wang, Qing Liu, Huai-Jing Tang, Fred F. Kadlubad, and Dong. Xin Lin: Impact of Genetic polymorphisms in Cytochrome P450 2E1 and Glutathione S-Transferases Ml, Tl, and PI on Susceptibility to Esophageal Cancer among High-Risk Individuals in China. Cancer Epidemiol Biomarker Prev 2000;9:551-556.

Wemess BA, Levine AJ, Howley PM. Association of human papillomavirus types 16 and 18 E6 proteins with p53. Science. 1990 Apr 6;248(4951):76-9.

REFERENCES 153

Wikman H, Risch A, Klimek F, Schmezer P, Spiegelhalder B, Dienemann H, Kayser K, Schulz V, Drings P, Bartsch H.hOGGl polymorphism and loss of heterozygosity (LOH): significance for lung cancer susceptibility in a Caucasian population.Int J Cancer. 2000 Dec 15;88(6):932-7.

Williams HK. Molecular pathogenesis of oral squamous carcinoma.Mol Pathol. 2000 Aug;53(4): 165-72.

Wong DT, Gallagher GT, Gertz R, Chang AL, Shklar G.Transforming growth factor alpha in chemically transformed hamster oral keratinocytes.Cancer Res. 1988 Jun l;48(ll):3130-4.

Wong DT, Gertz R, Chow P, Chang AL, McBride J, Chiang T, Matossian K, Gallagher G, Shklar G.Detection of Ki-ras messenger RNA in normal and chemically transformed hamster oral keratinocytes.Cancer Res. 1989 Aug 15;49(16):4562-7.

Wong DT, Weller PF, Galli SJ, Elovic A, Rand TH, Gallagher GT, Chiang T, Chou MY, Matossian K, McBride J, et al.Human eosinophils express transforming growth factor alpha.J Exp Med. 1990 Sep 1;172(3):673-81.

Wu M, Putti TC, Bhuiya TA. Comparative study in the expression of p53, EGFR, TGF-alpha, and cyclin Dl in verrucous carcinoma, verrucous hyperplasia, and squamous cell carcinoma of head and neck region. : Appl Immunohistochem Mol Morphol. 2002 Dec;10(4):351-6.

Xanthoudakis S, Curran T.Analysis of c-Fos and c-Jun redox-dependent DNA binding activity.Methods Enzymol. 1994;234:163-74.

Xie X, Clausen OP, De Angelis P, Boysen M.The prognostic value of spontaneous apoptosis, Bax, Bcl-2, and p53 in oral squamous cell carcinoma of the tongue.Cancer. 1999 Sep 15;86(6):913-20.

Xing, D.Y., Tan, W., Song N., and Lin. D.X. Ser326Cys Polymorphism in hOGGl gene and risk of esophageal cancer in a Chinese population Int. J Cancer 2001; 95: 140-143.

Xu J, Gimenez-Conti IB, Cunningham JE, Collet AM, Luna MA, Lanfranchi HE, Spitz MR, Conti CJ. Alterations of p53, cyclin Dl, Rb, and H-ras in human oral carcinomas related to tobacco use: Cancer. 1998 Jul 15;83(2):204-12.

Xu, J., Zheng, S.L., Turner, A., Isaacs, S. D., Wilkey. K.E., Hawkins, G. A., Chang, B.L., Bleecker. E.R., Walsh, P. C, Meyers. D. A., and Isaacs, W.B. Association between hOGGl sequence variants and prostate cancer susceptibility. Cancer Res. 2002; 62: 2253-2257.

Van JJ, Tzeng CC, Jin YT.Overexpression of p53 protein in squamous cell carcinoma of buccal mucosa and tongue in Taiwan: an immunohistochemical and clinicopathological study.J Oral Pathol Med. 1996 Feb;25(2):55-9

REFERENCES 154

Yin Hu, Mikael Oscarson, Inger Johansson, Qun-Ying Yue, Marja-Lissa Dahal, Marco Tabone, Sarino Arinco, Emanuele Albano, and Magnus Ingelman-Sundberg. Genetic polymorphisms of human CyP2El: Characterization of two Variant alleles. Molecular Pharmacology 1997; 51:370-376.

Yokota J, Sugimura T.Multiple steps in carcinogenesis involving alterations of multiple tumor suppressor genes.FASEB J. 1993 Jul;7(10):920-5. Review.

Yonish-Rouach E, Resnitzky D, Lotem J, Sachs L, Kimchi A, Oren M.Wild-type p53 induces apoptosis of myeloid leukaemic cells that is inhibited by interleukin-6.Nature. 1991 Jul 25;352(6333)-.345-7.

Young LS, Murray PG. Epstein-Barr virus and oncogenesis: from latent genes to tumours. Oncogene. 2003 Aug U;22(33):5108-21.

Yu, Z., Chen, J., Ford, B. N., Brackley, M. E., and Glickman, B.W. Human DNA repair systems; and overview. Environ. Mol. Mutagen, 33: 3-20,1999.

Zarbo RJ, Crissman JD. The surgical pathology of head and neck cancer. Semin Oncol 1988;15:10-19.

Zariwala M, Schmid S, Pfaltz M, Ohgaki H, Kleihues P, Schafer R.p53 gene mutations in oropharyngeal carcinomas: a comparison of solitary and multiple primary tumours and lymph-node metastases.Int J Cancer. 1994 Mar 15;56(6):807-11.

Zhengdong Zhang, Quiling Shi, Li-E Wang, Wrich M. Sturgis, Margaret R. Spitz, Adel K. El-Naggar, Waun K. Hong, and Qingyi Wei. No Association between hOGGl Ser326Cys polymorphism and Risk of Squamous Cell Carcinoma of the Head and Neck. Cancer Epidemiol Bio Prev 2004; 13(6): 1081-3.

Zhibin Hu, Hongxia Ma, Feng Chen, Qingyi Wei, and Hongbing Shen. XRCCl polymorphisms and Cancer Risk: A Meta-analysis of 38 Case-Control Studies. Cancer Epidemiol Biomarkers Prev 2005; 14(7): 1810-16.

Znaor A, Brennan P, Gajalakshmi V, Mathew A, Shanta V, Varghese C, Boffetta P. Independent and combined effects of tobacco smoking, chewing and alcohol drinking on the risk of oral, pharyngeal and esophageal cancers in Indian men. Int J Cancer. 2003 Jul 10;105(5):681-6.

REFERENCES 155

Appendix I

S.No

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40.

Sex

M F M M M F M F M M M F M M M M M F M M F M M M M M M F M M M F M M F M M M F M

Site

T BM BM T H BM BM T F BM G H BM BM T R BM L F BM F BM T BM BM F BM T BM L BM F BM L BM F BM H L BM

DifTerentiation

Well Moderate Well Well Moderate Well Poor Moderate Well Moderate Well Well Moderate Well Poor Well Well Moderate Well Well Well Well Well Moderate Well Poor Well Well Moderate Well Well Moderate Well Poor Well Well Moderate Well Well Moderate

P53 Expression

Positivity

0 25 20 25 0 0 48 30 0 30 45 48 0 35 68 0 35 48 48 0 55 0 42 25 0 75 15 0 22 22 0 45 30 0 32 0 70 0 45 0

Grade

-+ + + --++ ++ -++ ++ ++ -++ +++ -++ ++ ++ -+++ -++ + -+++ + -+ + -++ ++ -++ -+++ -++ -

CyclinDlExpression

Positivity Grade

0 22 18 0 64 0 46 0 0 34 0 40 0 30 64 0 34 36 40 0 15 0 30 30 18 0 0 0 20 45 0 0 36 0 50 0 70 0 51 22

-+ +

-+++ -++ --++ -++ -++ -H-+ -++ ++ ++ -+ -++ ++ + ---+ ++ --++ -+++ -+++ -+++ +

APPENDIX I 156

41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60.

M M F M M M F M M M M F M M M M M F M F

T BM T BM BM T BM H BM T BM R BM BM BM L BM F BM BM

Well Poor Well Moderate Well Moderate Well Poor Well Moderate Well Poor Well Moderate Poor Moderate Well Moderate Well Moderate

28 0 52 42 0 66 0 72 22 0 38 45 0 35 72 0 18 64 25 26

++ -+++ ++ -+++ -+++ + -++ ++ -++ +++ -+ +++ ++ ++

0 0 20 38 0 32 22 74 0 0 28 42 20 26 70 0 42 45 26 0

--+ ++ -++ + +++ --++ ++ + ++ +++ -++ ++ ++ -

APPENDIX I 157

Date post:	02-Mar-2021
Category:	Documents
Upload:	others
View:	5 times
Download:	0 times

ABSTRACT - Aligarh Muslim Universityir.amu.ac.in/1455/1/T 6326.pdfChapter 1: Introduaion Chapter 2:...

Documents