ACJC_H2_BIO_P1

Class Candidate Number

Name

ANGLO-CHINESE JUNIOR COLLEGE

Preliminary Examination 2009

BIOLOGY 9747 / 01 HIGHER 2 02 SEPT 2009 Paper 1 Multiple Choice

1 hour 15 minutes Additional Materials: Multiple Choice Answer Sheet INSTRUCTIONS TO CANDIDATES Write your name, Centre number and candidate number on the multiple choice answer sheet provided. There are forty questions in this paper. Answer all questions. For each question there are four possible answers, A, B, C and D. Choose the one you consider correct and record your choice in soft pencil on the separate answer sheet. Read very carefully the instructions on the answer sheet. INFORMATION FOR CANDIDATES Each correct answer will score one mark. A mark will not be deducted for a wrong answer. Any rough working should be done in this booklet. Calculators may be used.

This document consists of 19 printed pages and 1 blank page.

Anglo-Chinese Junior College 9747/01/Prelim 09 [Turn over

2 1 The diagram shows a cell found in an organ in the human body.

From its structure, what are the functions of this cell?

A Intracellular digestion and storage of granules of product B Phagocytosis, pinocytosis and secretion C Secretion and transport of protective mucus D Uptake and transport of ions and molecules

2 An enzyme is a globular protein held together by several different types of bonds, giving

the enzyme primary, secondary and tertiary levels of structure.

Which combination correctly summarises the types of bond involved in each level of structure?

Disulphide bonds Hydrogen bonds Ionic bonds Peptide bonds

A Primary Tertiary Secondary Tertiary B Primary,

tertiary Primary Secondary,

tertiary Secondary

C Secondary Secondary Tertiary Primary D Tertiary Secondary,

tertiary Tertiary Primary


3 3 In an experiment using starch and amylase, the concentrations of starch and maltose

present in the reacting mixture are measured every minute for 20 minutes. 1% hydrochloric acid is added after 10 minutes and the mixture is heated to 60C at 14 minutes.

Which graph represents the results of this experiment?

4 Which of the following is not a characteristic of cancer cells?

A Anchorage independence B Contact inhibition C Metastasis D Stimulate angiogenesis


4 5 The figure below shows a hypothetical diploid cell with six chromosomes.

Which of the following statements are true?

I This cell is at prophase I of meiosis as bivalents have formed and nuclear membrane is disintegrating.

II This cell is at prophase of mitosis as the chromosomes are distinct and nuclear membrane is disintegrating.

III New combination of alleles may arise between R and S during meiosis.

IV R and T have the same genes and same number of genes. V R and S have the same alleles and same number of genes. VI Crossing over may occur between non-sister chromatids of bivalent Q.

A I and IV only B I, V and VI only C II and III only D II, III and V only


5 6 The figure below represents the relative amount of DNA per nucleus during several cell

divisions in a plant tissue.

DNA per nucleus/ arbitrary units

From the graph, when does the cell become haploid?

7 Transcription initiation in eukaryotes requires several molecules. The diagram below

shows some of the molecules involved in the transcription process.

Which is the correct combination for labels 1 4?

1

2 3 4

A Enhancer Activator DNA bending protein RNA polymerase B Promoter Activator DNA bending protein RNA polymerase C Enhancer Activator DNA bending protein Mediator D Promoter Silencer DNA bending protein Mediator


6


Analysis of DNA produced the following ratios of nitrogenous bases.

Source of DNA Ratio of purines to pyrimidines

8

bean seeds 0.99 cow heart 1.01

human liver 1.02 rat bone marrow 1.00

Which of the following statements is true?

A Animal DNA contains more purines than pyrimidines.

portions of purines and

C thymine instead of uracil. alytical techniques.

Five different amino acids (numbered 1 to 5 below) form the following sequence in part

2------3------4------1------3------5------2

Messenger RNA (mRNA) codons which correspond to these amino acids are:

amino acid 1 UGU

Which one of the following DNA base sequences could provide the code for the given

A TTACAGTGTTCCTA

B Different parts of an organism contain different propyrimidines.

DNA contains

D There are variations in the accuracy of an

9

of a polypeptide chain:

amino acid 2 GAU amino acid 3 CAC amino acid 4 CAA amino acid 5 AAG section of polypeptide?

CTAGTGG

B CTAGTGGTTACAGTGTTGCTA C CTAGTGGTTTCTGTGTTGCTA D CTAGTGGTTACAGTGTTCCTT

7 10 Tamiflu is an antiviral drug used to treat influenza A (H1N1) patients. It works by preventing progeny virions from detaching from infected cells. Which of the following components of the influenza virus does Tamiflu act on?

A Hemagglutinin B Matrix protein C Neuraminidase D Nucleoproteins

11 The diagram represents the structure of the human immunodeficiency virus (HIV).

Which combination correctly identifies the functions of the lettered components?

V W X Z A Attaches virus

to target cells Fuses with membrane of target cells

Protects the viral genetic material

Synthesises single-stranded DNA from viral genetic material

B Attaches virus to target cells

Fuses with membrane of target cells


Synthesises double-stranded DNA from viral genetic material

C Attaches virus to target cells


Fuses with membrane of target cells

Synthesises single-stranded RNA from viral genetic material

D Fuses with membrane of target cells


Attaches virus to target cells

Synthesises double-stranded RNA from viral genetic material


8 12 Two strains of the bacterium Streptococcus pneumoniae were used in an experiment on mice. The smooth (S) strain is a virulent strain whereas the rough (R) strain is a non- virulent strain. The diagram below shows the results of the experiment.

Which of the following accounts for the living S cells in the mouse blood sample, even though the original injection mixture contained only heat-killed S cells and living R cells?

A Binary fission B Conjugation C Transduction D Transformation

13 A scientist inserts the gene for human growth factor into the Escherichia coli lac operon, replacing the structural genes with the gene for human growth factor. What substance must be added to the culture of bacteria in order to cause them to produce the human growth factor?

A Human growth factor B Lactose C Operator protein D Repressor protein


9 14 The role of telomerase is to maintain the length of telomeres in germline cells. Which statement is true about how telomerase works?

A It has RNA polymerase that can add ribonucleotides to the parental strand. B It has reverse transcriptase that can add deoxyribonucleotides to the parental

strand.

C It has a DNA template that acts as a template to add deoxyribonucleotides to the parental strand.

D It has DNA polymerase that can add deoxyribonucleotides to the parental strand.

15 The table shows a comparison between the genomes of a prokaryote and eukaryote.

Which feature of eukaryotes accounts for the differences in the number of

proteins with roles in protein synthesis?

A The DNA of a eukaryote has histones. B The DNA of a eukaryote has introns. C The DNA of a eukaryote has more base pairs. D The DNA of a eukaryote is separated from the ribosomes by membranes.

16 Which of the following is not a requirement for the mechanism of RNA splicing?

A Introns B Small nuclear ribonucleoproteins C 5 and 3 splice sites D 5 modified guanosine cap


10 17 An investigator wanted to determine the function of protein X. He cloned the gene X into plasmid 1. He then set up another plasmid (plasmid 2) with a binding site for the product of gene X plus a reporter gene. A reporter gene codes for the synthesis of a product that is easily measured. The two plasmids (shown below) were then introduced into the nucleus of a host cell.


He noted that there was an increase in the number of reporter gene transcripts. Which of

A Gene X is an enhancer sequence.

r.

8 Which of the following is a method of post-translational control in eukaryotic cells?

A Inactivation of essential translational factors.

cripts.

they are transported to targeted

the following statements is a valid conclusion regarding gene X or product X?

B Gene X is the promoter sequence. C Product X is RNA polymerase. D Product X is a transcription facto

1

B Prevention of ribosome attachment. C Selective degradation of mRNA transD Selective degradation of the proteins when

destinations.

11 19 A girl has blood group A and her brother has blood group B. Which combination of genotypes cannot belong to their parents? Mother Father

A IA IA IB IO B IA IB IA IB C IO IO IA IB D IB IO IA IO

20 In one of the experiments to test the 3:1 ratio of Mendels laws, 705 plants are

observed to have red flowers and 224 had white flowers. The P (probability) value, associated with the calculated chi-square value of 2.668, is 0.10, under the 95% (P=0.05) confidence level. The P refers to

A the chance that there is a 10% probability that any deviation from the expected

result is due to a random event only.

B the chance that there is a 10% probability that any deviation from the expected result is significant.

C the chance that there is no difference between the expected and observed results.

D the chance that there is a difference between the expected and observed results.

21 Fruit flies homozygous for long wings were crossed with flies homozygous for vestigial wings.

The F1 generation was raised at 3 different temperatures. The F1 flies were then

crossed with each other to produce the F2 generation. The results of the F1 and F2 generation are shown below.

Temperature F1 result F2 result 21C All long wings 3/4 long wings, 1/4 vestigial wings 26C All long wings 3/4 long wings, 1/4 intermediate wings 31C All long wings All long wings

Which of the following statements is correct?

A Heterozygous flies have vestigial wings only at 21C and below, but have long

wings at 31C and above.

B Long wing and vestigial wing alleles show codominance at 26C. C Long wing allele is dominant at higher temperatures, but vestigial wing allele is

dominant at lower temperature.

D Vestigial wing allele is recessive but causes a vestigial wing phenotype only at lower temperatures.


12 22 The coat colour of Labrador retrievers is controlled by two genes, B and E. Allele B (dominant) codes for black coat, while allele b (recessive) codes for brown coat. The coat colour of a Labrador retriever with genotype ee is yellow.

A cross between Labrador retrievers with the genotype EeBb and EeBB was performed. What is the expected phenotype in the offspring of this cross?

A 75% yellow, 25% black B 75% black, 25% yellow C 37.5% black, 37.5% brown, 25% yellow D 50% black, 25% brown, 25% yellow

23 Which of the following statements is true?

A Continuous variation shows a normal distribution and is only influenced by genetic factors.

B Continuous variation is controlled by two or more genes and the traits are qualitative.

C Discontinuous variation shows traits that follow discrete distribution and is mostly influenced by environmental factors.

D Discontinuous variation shows traits that are controlled by one or two genes and is not influenced by environmental factors.

24 14C-labelled carbon dioxide was supplied to photosynthesising algae. The relative amounts of three organic compounds were measured. The diagram shows the results.

Which of the following compounds correspond to the respective graphs 1, 2 and 3?

1 2 3 A GP RuBP Sugar B GP Sugar RuBP C RuBP GP Sugar D RuBP Sugar GP


13 25 When cyanide is bound to cytochrome oxidase, the cell can no longer produce ATP aerobically. Which statement below best explains this?

A It prevents NADPH from being oxidised to NADP+, hence preventing electron flow down the electron transport chain.

B It prevents oxygen from accepting electrons and protons to form water, hence preventing electron flow down the electron transport chain.

C It prevents photolysis from occurring to produce oxygen. D It prevents pyruvate from being synthesised in glycolysis, hence stopping the

Krebs cycle.

26 The diagram represents a cell membrane.

Which structure allows the diffusion of Cl ions between the outside and inside of the cell?

A A only B B only C A and B D C and D


14 27 The diagram below shows a normal action potential.

Which events are occurring at positions 2 and 4 to produce the illustrated action potential?

Position 2

Position 4

A Influx of potassium ions Efflux of sodium ions B Influx of sodium ions Efflux of potassium ions C Influx of sodium ions Influx of potassium ions D Efflux of potassium ions Influx of sodium ions

28 Which of the following will stop impulse transmission across a synapse?

A A mutation of the voltage-gated calcium ion channels. B Enzyme acetylcholinesterase inhibited by nerve gas DFP. C Increased fusion of neurotransmitter vesicles with pre-synaptic membrane. D The accumulation of acetylcholine vesicles in the pre-synaptic knob.


15 29 Which of the following represents the changes that insulin brings about in the

appropriate target cells?

Rate of glycogenolysis

Rate of glycogenesis

Level of cAMP

A Increase Decrease Increases B Decrease Increase Increases C Increase Decrease Decreases D Decrease Increase Decreases

30 The diagram below shows a general signal transduction pathway.

Cell surface membrane

Intermediate or relay molecules

Activation of cellular

responses

Which one of the following processes deviates from the chain of events as shown above?

A Epinephrine, released in response to stress, increases the availability of energy

sources by stimulating glycogen hydrolysis in muscle and the liver.

B Testosterone, released by the testes, stimulates development of secondary sex characteristics at target tissues.

C Growth factors, protein molecules released by actively growing cells, stimulate cell growth and cell division in adjacent cells.

D Glucagons, released by alpha cells of the islets of Langerhans, stimulate expression of certain genes to bring about an increase in rate of gluconeogenesis.


16 31 In which of the following scenarios would allopatric speciation occur most quickly?

A A population of cheetahs undergoing little or no evolutionary change. B A population of fishes undergoing directional selection due to the introduction of

a new predator.

C A population of giraffes free to roam the entire nature reserve after the artificial removal of all predators.

D A population of snails separated by a new fast-flowing river. 32 The table below shows the number of amino acid differences in the alpha haemoglobin chains between the crocodile and various organisms.

Lungfish

Coelacanth

Shark

Goldfish

Crocodile

85

78

77

70

Which organism is most closely related to the crocodile?

A Coelacanth B Goldfish C Lungfish D Shark


17 33 During the drought years on the island of Daphne Major, small seeds became rare, leaving behind only large seeds as a food source for birds. In the event of a prolonged drought lasting several years, which of the following could be a possible observation?

A Large-beaked birds eating less, leaving food available for the small-beaked birds. B Small-beaked birds developed large beaks to feed on the large seeds. C Small-beaked birds dying, with subsequent generations having a higher percentage

of large-beaked birds.

D Small-beaked birds mutating their genes to grow large beaks. 34 Which of the following characteristics is undesirable in cloning vectors used in genetic engineering?

A Ability to replicate in the host cell. B Have at least two gene markers. C Have at least two restriction sites of a particular restriction enzyme. D Small in size.

35 If the first three nucleotides in a six-nucleotide restriction site are CTG, what would the next three nucleotides most likely be?

A CAG B CTG C GAC D GTC


18 36 In an investigation of a gene suspected to be involved in a genetic disease, separate PCR procedures were done using genomic DNA and RNA isolated from healthy (wild-type WT) and diseased cells (mutant). The PCR products were analysed on polyacrylamide gels. The sizes of the bands in the molecular weight marker (M) are indicated in base-pairs.


Genomic DNA RNA

Which of the following best explains the results obtained?

A Deletion of an exon in the mutant. B Deletion of a splice site in the mutant. C Deletion of several codons in the mutant. D Deletion of several introns in the mutant.

37 Which of the following technique does not involve any nucleic acid hybridisation?

A DNA fingerprinting B Gel electrophoresis C Polymerase Chain Reaction D Southern blotting

MM

600

468

442

411

368

267

600

468

442

411

368

267

WT mutant WT mutant

19


38 Which of the following is not an example of genetically modified organisms?

A AquaAdvantage Salmon that grow to adult size quickly. B Bt corn plants that are insect-resistant. C Golden Rice that produce high levels of beta-carotene. D Milk-producing cows injected with bovine somatotrophin (BST).

39 Which of the following statements about hematopoietic stem cells is false?

A They are able to reproduce continually. B They are easy to isolate and propagate. C They are present in minute quantities in the human body. D They can be induced to differentiate under appropriate conditions.

40 Gene therapy is the insertion of a therapeutic gene into a target cell with non- functional genes. Which of the following are techniques of gene therapy to treat a genetic disease?

I A therapeutic gene is inserted into a non-specific location within the genome.

II A therapeutic gene is inserted into a specific location within the genome.

III A therapeutic gene enters the cell, but is not inserted into the genome.

IV A therapeutic gene is inserted in reverse orientation with respect to the promoter (antisense technology).

A I, II and III only B I, II and IV only C I and II only D II and IV only

- End of paper -
ANGLO-CHINESE JUNIOR COLLEGEINSTRUCTIONS TO CANDIDATESINFORMATION FOR CANDIDATES

Date post:	01-Sep-2015
Category:	Documents
Upload:	dd97
View:	2 times
Download:	0 times

ACJC_H2_BIO_P1

Documents