Date post: | 11-May-2015 |
Category: |
Health & Medicine |
Upload: | bhoj-r-singh |
View: | 1,628 times |
Download: | 7 times |
Advances in Diagnosis of Salmonellosis and
Characterization of Salmonella
Dr. Bhoj R singh, Principal Scientist (VM)
I/C Epidemiology; Centre for Animal Disease Research and Diagnosis
Indian Veterinary Research Institute, Izatnagar-243122, Bareilly, UP, India. TeleFax +91-581-2302188
Why we need early diagnosis for salmonellosis ?
• Early diagnosis means nipping the problem in bud, which is of utmost significance because:
• Any level of Salmonella leads to decreased production. • Treatment of Sick Animals is expensive and uneconomic
in poultry industry. • Death of animals means loss of money and product. • Outbreak of salmonellosis results in public backlash and
decreased sales of the associated food.• Increased work force is required to control the outbreak.• Sampling and testing costs a lot.• Extra record keeping is necessary for certification and
validation.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Method Accuracy Detection limit cfu/ml
Analysis time in hours
Ease of handling
Standard high 1-10 48-120 Complex
Modified conventional
High 10-100 24-60 Complex
Impedimetry Good 105-106 24-60 Easy
Immunological high 105-106 48-60 Intermediate
DNA probes high 103-105 22-60 Intermediate
PCR high 102-103 22-24 Intermediate
Real time PCR high 102-103 2-15 Intermediate
Different methods of Salmonella Detection and their sensitivity
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Salmonella Antibody detection
• Whole blood agglutination test• Rapid plate agglutination test (RPAT)• Standard tube agglutination test (STAT)• Passive haemagglutination test (PHAT)• Antiglobulin test (AGT) • Radioimmunoassay (RIA) • Counter immuno-electrophoresis (CIE) & • ELISA • dot-ELISA• AGPT
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Enzyme-linked immunosorbent assays for Salmonella Enteritidis and other Salmonella serovars
Two main basic systems are available for detection of IgG (IgY) specific for S. Enteritidis: the indirect ELISA and the competitive ‘sandwich type’ ELISA
The indirect ELISA involves the use of a detecting antigen coated on to the wells of a microtitre plate. After the application of a blocking reagent to reduce nonspecific binding, test samples are applied to the wells. Specifically bound antibody in the sample is detected by an antibody/enzyme conjugate. A variety of antigens, including LPS, flagella, SEF14 fimbriae, Salmonella cytotoxin I, outer membrane proteins and cruder antigen preparations have been used. The competitive sandwich ELISA employs a specific reagent - a monoclonal antibody (MAb) - for coating antigen to wells. This is then followed by a pure or crude antigen preparation. Test samples are applied followed by conjugated MAb, which will not bind to the antigen if the sample contained specific antibodies. The assay time can be shortened by adding both test sample and conjugate together. MAbs have been prepared for LPS, flagella and SEF14 for S. Enteritidis.There are advantages and disadvantages to both systems. The indirect assay is simpler and reagents are available for all Salmonella serotypes of chickens, turkeys, ducks and mammalian hosts. The competitive ELISA can be applied to all animal species and in general shows higher specificity. However, reagents are not available commercially for all serotypes. There are also some affinity problems and it may be less sensitive than the indirect assays. In the field, both systems have produced false-positive reactions.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Salmonella cytotoxin I based ELISA (Genus specific)
• Indirect ELISA (I-ELISA) is performed to determine Salmonella cytotoxin-I specific antibodies to asses the infections with Salmonella irrespective of infecting serovars of the pathogens involved. Cytotoxin I has been reported in all pathogenic strains of Salmonella serovars (Singh and Sharma, 2000). Cytotoxin I antigens is prepared (Singh and Sharma, 1999) using a known cytotoxigenic reference culture of S. Weltevreden (S-13 and reference anti cytotoxin (Singh and Sharma, 2000) is used.
• To determine Salmonella cytotoxin I (SCI-I) antibodies in serum samples, ELISA plates are coated with anticytotoxin (dog) and then plates are washed thrice with PBST (Phosphate buffer saline with 0.05% Tween-20). Remaining sites are blocked with 300µl freshly prepared 5% (w/v) skim milk. After overnight incubation at 370C, plates are washed with PBST thrice. Then to the wells of ELISA plates, 100µl antigen prepared at the concentration of 10 μg protein/well in 1M Tris is added into the wells and incubated for 2 h at 370C. Wells are emptied and washed with PBST and to each well , a 100 µl of diluted (1: 200 in PBS with 0.1% BSA) test serum is applied in triplicate and incubated for 2 h at 370C as above. Wells are emptied and washed as earlier and to each well, a 100µl of suitably diluted (1:5000 in PBS with 0.1% BSA) anti IgG (against the test animal) HRPO conjugate is added and incubated for 2 h at 370C, plates are washed thrice with PBST and then apply100µl of freshly prepared substrate (Orthophenyline diamine) to each well made in citrate phosphate buffer (pH 4.6, 0.1M) and plates are incubated for 20 min at 370C in dark. The reaction is stopped with100µl of IM H2SO4 in each well. O.D. of each well is read at 492 nm with ELISA reader. Serum titre is calculated as
• Average test OD – Average Negative control OD• ELISA titre = —————————————————————
×100 Average Negative control O.D.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Salmonella Cytotoxin-I based dot-ELISA (Genus specific)
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Salmonella cytotoxin-I based AGPT (Genus specific)
P P
PN
N N
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Widal’s Test
• Common antigens used in Widal’s test• Bacteria `O` Antigens `H`
Antigens• Typhi 9,12 (Vi) d• Paratyphi A 1,2,12 a• Paratyphi B 1,4,12 b• Paratyphi C 6,7 (Vi) c
• `O` antigens- 1,2,4,6,7,9,12• Capsular antigen- Vi;• `H` antigens- a,b,c,d
• Diagnostic titres:- H- 1 : 20; O- 1:50, and Vi- 1:5.
• Incubation for tests:- H- 50oC for 2 hr then RT for >3 hrs.• O- 37oC for 2-4 hrs then RT overnight.• Vi- 37oC or RT overnight.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Commercially available test kits• TEK-ELISA (Organon Teknika, Cambridge UK)• IFR-ELISA (Wyatt et al. 1995)• Report-EIA & TECRA Salmonella Visual A (Wilson et al. 1990)• Dulcitol-1-phosphate dehydrogenase (DPD) mab based kit (Tian et
al. 1996)• Cytotoxin-1-antibodies based Salmonella detection protocol (Singh
et al. 2000)• Chekit-S-enteritidis (ELISA) kit (Baumgartner et al. 1993)• Polymyxin cloth enzyme immunoassay (Blais et al. 1997)• 1-2 Test (Bio-control, Bothel, USA)• Single step Salmonella (SSS) by Ampcor, Camden USA• Iso-Grid ® of Dynal, Oslo• Vi-TEK & Vi ELISA (Sharma et al. 1997)• Meat Juice ELISA kit (Steinbach et al. 1999)
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Factors affecting serological diagnosis
• Useful to identify infected flocks/herds rather than to identify infected individuals.• Serologically positive reactors may no longer be infected with Salmonella
organisms, similarly, actively excreting Salmonellae may be serologically negative. • Newborn animals are immunologically immature and do not respond serologically.• Chickens and neonates may also acquire Salmonella antibodies passively from
their parents without having any active infection.• Following Salmonella infections, immunoglobulin concentrations may be so high
that it may cause prozone phenomenon.• Necessitates differentiation between vaccine response & actual infection.• The effect of antibiotic therapy on the serological response remains unclear. • More than 2500 different Salmonella serovars exist. It is not easy to select an
antigen and test used.• Serological cross-reactions between different serovars could not be conclusive
about causative serovar.• In poultry, egg yolk may be tested for immunoglobulins to Salmonella and eggs
may provide a method to screen flocks. • Require readymade standard antigen: you need it from outside• Require bleeding• Sample are fragile and lost in transit• Sera sample may be having unknown pathogens of much more hazardous
disease for which we have never thought; Ebola, Marburg, Avian influenza, hepatitis B, HIV
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Antigen identification• Isolation• Electrical Impedance measurement• Antigen Capture Immunoassays• PCR (Saiki et al. 1985 reported First PCR)• Capillary PCR• Multiplex PCR• RT-PCRDraw backs: • Different routes of excretion of the pathogen from
host-difficult to decide the right kind of sample to be collected.
• Irregularity in presence of antigen in host during disease process- antigen is present or excreted only for short time, and in different stages.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Samples
• Samples should not originate from birds or eggs that have recently been treated with antimicrobial drugs. They can be swabs or aseptically collected samples from affected tissues, or intestinal and cloacal contents. Other materials to sample include eggs, eggshell surfaces, embryos, faecal droppings and hatcher debris, especially fluff, dust and broken eggshells.
• The nature and quantity of the sample will depend on whether it is taken from live poultry or carcasses, and whether lesions or faecal contamination are present.
In case of delay, samples should be stored at 0-4°C.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Steps in isolation of Salmonella
For faecal and tissue samples• Pre-enrichment (1:10 in Buffered Peptone Water), at 35-37oC for 18-24 hours.• Selective enrichment broth (Tetrathionate broth, Rappaport Vassiliadis medium,
Selenite cystine medium; RV is much better, at room temp).• Plating after 24 hour and 48 hr: on Hektoen Enteric agar with novobiocin (HEN) or
Brilliant green agar with novobiocin (BGN) or Xylose lysine citrate agar (XLT-4).• If negative, transfer 0.1 ml to 10 ml RV after 120 hour and incubate at 37oC for 24-48
hour and then plate as above. • Pick up suspected colonies after 24 hour of plating on to Motility Indole Lysine (MIL)
stabs and triple sugar iron agar (TSI) slants.• Serological confirmation.
For blood cultures: 10 ml of blood should be added to enrichment media and incubated at 37oC and plated daily for up to 11 days. Addition of liquoid or bile in enrichment interferes with bactericidal action of blood and improves the Salmonella detection. Medium of choice is 0.5 % Taurocholate or ox bile broth. Blood clots give better results and require lesser medium. I.e. for clot from 10 ml blood 50 ml ox bile broth.
Draw backs: Take long time Ineffective when antibiotic treatment is on
Different methods of isolation for different serovarsIntermittent excretion
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Differentiation of Salmonella species and subspeciesCharacters Dulcitol Lactose Sorbitol Mucate D-Tartarate Citrate Malo
nateONPG
S. bongori + - + + - + - +
S. enterica ssp. enterica
+ - + + + + - -
S. enterica ssp. arizonae
- (-) + + - + + +
S. enterica ssp. diarizonae
- (+) + D (-) + + +
S. enterica ssp. houtenae
- - + - D + - -
S. enterica ssp. indica
D (-) - + + (+) - d
S. enterica ssp. salamae
+ + + + d + + (-)
D, delayed; ( ), variableOther common tests are:- Indole –ve, MR +ve, VP –ve, Urease –ve, nitrate reduction +ve, Phenylalanine –ve, glucose +ve, salicin –ve, adonitol –ve, inositol D, raffinose –ve, erythritol, esculin -ve, sucrose –ve, oxidase –ve, H2S +(-), gelatinase –ve, lysine, ornithine +ve, arginine +ve, KCN –ve,
alginate –ve. Common confusion occurs with Citrobacter which are lysine –ve and melibiose fermenter, a few Enterobacter may also cause some problems, they are also usually –ve in lysine (gregoviae and aerogenes + but are + for melibiose) and for H2S and +ve for ONPG test.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Differentiation of common Salmonella serovars
Characters H2S Lysine Ornithine D-tartrate
Gas in glucose
Dulcitol Maltose Rhamnose Sorbitol
Choleraesuis D + + (+) + - + + (+)
Paratyphi A - - + - + + + + +
Typhi + + + + - - + - +
Gallinarum + + - + - + + - -
Pullorum + + + - + - - + (-)
Common Sal + + + + + + + + +
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Common Non-isolation TechniquesImpedance/ conductance assays
Malthus assay:- based on antibiotic added pre-enrichment followed by selenite based enrichment and then measuring impedance in two cells one containing trimethylamine oxide (TMAO) and dulcitol, another cell contain lysine. Salmonella converts TMAO to TMA (trimethylamine). The test yields 12% false negatives and 10% false positives
BacTrac 4100 system: based on impedance splitting method measures impedance of medium and the electrode (M and E value respectively). Pre-enrichment is followed by novobiocin containing RV broth enrichment and then taking M and E value for next 22 h at 40oC. It yields 7.4% false negatives and 4.9% false positives.
Other systems are RABIT and BACTOMETER.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Other methods
Antigen capture immunoassays: Sensitivity is 103 to 106 cfu per ml and most of the commercially available ones are serovar specific.
Commercially available systems are: PATHSTICK, EIAFOSS, VIDAS SLM, TECRA OPUS DIPSTICKS, DYANA Beads, Magna Beads and VICAM beads (serovar specific).
• Genus specific Antigen Capture ELISA based on Salmonella cytotoxin-I (Singh and Sharma, 2000)
• FAT (Singh and Sharma, 2000)• Biken test (Singh and Sharma, 2000)Identification of antigen with these method is less sensitive
due to requirement of large number of antigen particles in the clinical samples.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Salmonella Cytotoxin-I based FAT (Genus specific)
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Salmonella cytotoxin-I based Biken test (Genus specific)
NN
PP
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Serobact Salmonella TestA simple one step latex slide agglutination test for both
clinical and food laboratories. Serobact Salmonella is a rapid latex slide agglutination test for the identification of Salmonella from selective enrichment broths. Serobact latex technology is more sensitive than direct agglutination methods and the use of Serobact Salmonella early presumptive identification of Salmonella spp. saving about 24 hours than using conventional techniques.
The test exploit Polyvalent H antisera prepared against a comprehensive range of Salmonella flagella antigens is coated onto latex particles.
False Positive: Specificity 97.2%. Predictive negative value 100%False Negative: Sensitivity 100%. Predictive positive value 98.2%
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
REVEAL for SalmonellaThe test can handle one or several samples concurrently.
Contents of the sample are wicked through the pad to a specimen reaction zone containing colloidal gold-labeled antibodies specific to Salmonella. Reactive Salmonella combine with the gold-labeled antibodies and migrate through the support until they encounter a binding reagent zone which includes a second antibody specific to Salmonella. When this occurs, a line appears in the test window indicating a positive result. The rest of the sample continues to migrate until it encounters a second binding reagent zone. This results in the formation of a line in the control window.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Transia Card Salmonella
This test is used directly on an enrichment broth. It is on a sandwich - type, immunochromatographic reaction using highly- specific antibodies immobilised onto a membrane and conjugated to a dye. This allows the detection of all Salmonella serotypes present in sample. It is based on lipopolysaccharide (LPS) detection
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Genus specific PCR- primers• 1. Product 163bp
P1 : TTATTAGGATCGCGCCAGGC
P2 : AAAGAATAACCGTTGTTCAC• 2. inv product 284 bp (Oliveira et al., 2002)
139 : GTGAAATTATCGCCACGTTCGGGCAA141 : TCATCGCACCGTCAAAGGAACC
• 3. Random genomic product 429 bp ST 11: AGCCAACCATTGCTAAATTGGCGCAST 15 : GGTAGAAATTCCCAGCGGGTACT
• 4. Hin H2 flagellin gene (236 bp)Hin 1750 L : CTAGTGCAAATTGTGACCGCAHin 1750 R : CCCCATCGCGCTACTGGTATC
• 5. H-li flagellin gene (173 bp)H-li 1788 : AGCCTCGGCTACTGGTCTTG
H-li1789 R : CCGCAGCAAGAGTCACCTCA• 6. GVV PQ fimbriae agf, product (261 bp)
TAF 3 : TCCGGCCCGGACTCAACG
TAF 4 : CAGCGCGGCGTTATACCG• 7. inv A and inv gene (457 bp product)
S1: TGCTACAAGCATGAAATGGS2: AAACTGGACCACGGTGACAA
• 8. Spv A gene based 450 bp product.382: CAGACCACCAGTCCGGCAC
383: CAGTCAATGCTCTCTCGCTG• 9. hisJ gene (Cohen et al. 1994) 496 bp product
Cohen 1: ACT GGC GTT ATC CCT TTC TCT GGT G Cohen 2: ATC TTG TCC TGC CCC TGG TAA GAG A
• 10. invA product (Ferretti, et al., 2001) of 389 bpSal F GCTGCGCGCGAACGGCGAAG Sal R TCCCGGCAGAGTTCCCATT
• 11. Fli-Typ 620 bp. F CGGTGTTGCCCAGGTTGGTAAT R ACTGGTAAAGATGGCT
• 12. A0 488 bpAO1 GATACTGCTGAACGTAGAAGG
AO2 GCGTAAATCAGCATCTGCAGTAGC
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Serogroup specific PCR : Important diagnostic tool particularly in identification of
rough strains (Hoorfar et al. 1999).
• Serogroup Primers (5’-3’) Amplicon size bps
• B B1 : AGAATATGTAATTGTCAG 882• B2 : TAACCGTTTCAGTAGTTC
• C 1 C1 : GGTTCCATAAGTATATCT 471C2 : CTGGATACGAACCCGTAT
• C2-C3 C21 : ATGCTTGATGTGAATAAG 820• C31 : CTAATCGAGTCAAGAAAG• A&D D1 : TCACGACTTACATCCTAC 720• D2 : CTGCTATATCAGCACAAC
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Multiplex PCR for Salmonella in faecesAmplifies 491 bp product for inv (chromosomal) gene segment,
795 bp product for spvA gene segment on virulence plasmid
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Various probes for Salmonella genus1. Random chromosomal fragemnt• TS11: GTCACGGAAGAAGAGAAATCCGTACG Tsen et al. 1991
• TS21: TACATCGTAAAGCACCATCGCAATA• TS31: AGACCACTGACCCAGCCTAATCAA2. Random chromosomal fragment• ST15 rev: GAGTACCCGCTGGGAATTTCTAC Olsen et al.
1995• InvA gene S3: CTGGTTGATTTCCTGATCGC Stone et al. 1994
3. IS200 is not present in S. Agona, S. Arizonae, S. Dar-es-Salam, S. Panama, S. Infantis, S. Virchow and S. I.9, 12 : Z. Detection limit for S. Typhi is 103-4 cfu/ml. In IS 200 a tandem repeat of 0.3 kb I used for cross hybridization (Gilbert et al. 1990). Colorimetric single phase hybridization assay (CdorDNAH) can detect Salmonella by use of 16S and 23 S rRNA based probes but it can not detect S. subspp. V. and gave 7% false positive due to cross reaction with Citrobacter freundii (Curiale et al. 1990) and detection limit is 108-109cfu/ml. It is produced by Genetrack (earlier used radiolabelled probe but now enzyme labelled probes are used) AOAC approved (Flowors et al., 1987). Specificity and sensitivity of non-radioactive rRNA based oligonucleotide probs are comparable with culture method and results are given usually in 48 hr.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Salmonella BAX System (Automated PCR)
Time to Perform: 1-hour-to-1-day An automated system to quickly and accurately. The BAX system cycler/detector is used to load the
prepared samples. In less than four hours, computer-generated results are clearly displayed on the screen. A single tablet of integrated PCR reagents combines sample and control primers, plus reagents that overcome inhibition in chocolate and other challenging food types. There is no need to run a separate control. Process up to 96 samples in one batch. BAX for screening Salmonella can work with even the most difficult samples.
Specificity 98%; Sensitivity 98%
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Commercial probe based tests
• Gene-Trak Salmonella Microwell and tube assays: Test is based on microtiter colorimetric absorbance reading. The DNA hybridization test employs Salmonella-specific DNA probes which are directly labeled with horseradish peroxidase. A colorimetric endpoint is then used for the detection of Salmonella in food samples following broth culture enrichment.
• Sensitivity: 1-5 CFU/25g. Testing time: 1.5 hours (after 40 to 48 hour enrichment).
• Tests per kit: Up to 98
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Real time PCRQuantitative real-time polymerase chain reaction (PCR) provides an accurate
method for determination of levels of specific DNA and RNA sequences in tissue and clinical samples. It is based on detection of a fluorescent signal produced proportionally during amplification of a PCR product. Data acquisition and analysis by real-time PCR is short due to automation. DNA and RNA can be quantified using this detection system without laborious post-PCR processing.
The key to the detection is estimation of fluorescence emitted either from fluorescent probes, primers or dyes binding to dsDNA. A probe (ie, TaqMan) is designed to anneal to the target sequence between the traditional forward and reverse primers. The probe is labeled at the 5' end with a reporter fluorochrome (usually 6-carboxyfluorescein [6-FAM]) and a quencher fluorochrome (6-carboxy-tetramethyl-rhodamine [TAMRA]) added at any T position or at the 3' end.3 The probe is designed to have a higher Tm than the primers, and during the extension phase, the probe must be 100% hybridized for success of the assay. As long as both fluorochromes are on the probe, the quencher molecule stops all fluorescence by the reporter. However, as Taq polymerase extends the primer, the intrinsic 5' to 3' nuclease activity of Taq degrades the probe, releasing the reporter fluorochrome. The amount of fluorescence released during the amplification cycle is proportional to the amount of product generated in each cycle. Although, primers originally designed for end-point PCR, works well for real time PCR, needs standardization to have adequate specificity or sensitivity.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Sources:Chen S, Yee A, Griffiths M, et al. Int J Food Microbiol 1997;35:239-250. Eyigor AA, and Tayfun K, Carli B. Avian Diseases: Vol. 47, No. 2, pp. 380–386
Some primers and probes used in RT-PCR of Salmonella: Although same probes and primers can be used for diagnosis with RT-PCR as used otherwise in PCR, some people have tried other probes and primers too
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Characterization of Salmonella isolates
Virulence markers
• In vitro tests-– Conventional &– Molecular
• In vivo tests-– Conventional & – New biomodels
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Conventional in vitro tests
Congo red dye binding assay
P
N
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Conventional in vitro tests
DNase test
P
P
P
P
P
P
P
N
N
NN
N
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Conventional in vitro tests
Rings around mercuric chloride disk
Golden hallo around acriflavine disks,
Ring around crystal violet disk
(All three are believed to be plasmid mediated characterts)
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Effect of plasmid curing on golden hallo reaction around acrifalavine disk
Original A14 strainA14 strain after curing
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Detection of Haemolysins
Haemolysis of washed goat RBCs by S. Paratyphi E436 (A), E44b (B) and S. Typhi, E206(C), (D) E345 strains. After incubation at 37OC for 24 hours.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Haemolysis of washed goat RBCs by S. Gallinarum S54 (A), and B haemolytic strains of Streptococcus aureus (B, C, D). After incubation at 37OC for 24 hours.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Molecular in vitro tests• Virulence plasmid detection by isolation of plasmid
– Detection by PCR– Detection by Probes
• Detection of stn gene for enterotoxin, hly/ sly gene for haemolysins
– cytolysin gene (sly A)Sal L 1 AGG AGA TGA AAT TGG AAT CGC CA Sal L 2 TGC CCC TGC ACC TCA ATC GTG AGstm-O1 CGC AGG TTC TGA ATG CGG AASTM-O2 TAA TAC CTG CTG TAG CAA GG
– Detection of stn (Product size 617 bp) gene for enterotoxin, hly/ sly gene for haemolysins etc.Stn-1 5’ TTG TGT CGC TAT, CAC TGG CAA CC 3’STN-2 5’ ATT CGT AAC CCG CTC TCG TCC 3’
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Plasmid profiling(Many different kinds of plasmids are there in Salmonella strains)
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Conventional in vivo modelsMouse model
Retention of urine in chronic salmonellosis
Loss of hair, necrosis of tail
Control
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Conventional in vivo models
• 12 day old chick embryo inoculation
HealthyIntra-allantoic S. Gallinarum inoculated on 12th day
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Conventional in vivo modelsRabbit ligated ileal loop assay
Inoculated with cytotoxic enterotoxin
Inoculated with cytotonic enterotoxin
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
Conventional in vivo models
Vasopermeability factor test assay
Dermonecrosis associated with Salmonella cytotoxin Red zone associated with Salmonella enterotoxin
Negative
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
New in vivo models
Germinating maize seed model
Inoculated with non-pathogenic rough S. Typhimurium
Inoculated with pathogenic S. Typhimurium
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar