Advances on the understanding of Spongospora subterranea

development disease in Colombia Elena Paola González Jaimes

Ing. Agr. MSc. Dr.

Politécnico Colombiano JIC – Colombia.

Spongospora subterranea in America

Potato and Spongospora subterranea

in Colombia

• Production of Solanumtuberosum sp andigena (18 varieties), and Solanumpurheja (5 varieties)

• Tropical country (5° SL- 12°NL)• 90.000 farmers• 3 millions of ton year-1

• 125.000 ha year-1

• 20 ton ha-1

• First report 1965.• New report 90´s• Antioquia, Boyacá,

Cundinamarca, Nariño.

Why Spongospora subterranea is a growing problem?

• Susceptible Varieties: Parda Pastusa, DiacolCapiro, ICA Puracé (S. tuberosum) and papacriolla (S. phureja)

• Cold and wet weather every day.

• Absent or few crop rotation

• Tools and soil contaminated

• No legal tuber seed production or sanityinspection for seed tubers.

• Reduction of 23% plants lenght, 32% foliar dryweight, 30% tuber weight.

Symptoms and root structuresidentification

ROOT SYMTOMS

Fotos: Grupo SAT (2010)

TUBER SYMPTOMS

Fotos: Grupo SAT (2010)

Is Spongospora subterranea using alternative host plant for resting

potato periods?

1. Inoculated species: 33 species, (22 are crops related topotato, 11 weeds of potato crops)

Type Specie

Crops Allium cepa L., Allium sativum L., Apium graveolens L., Beta vulgaris L., Brassica oleraceae L., Cyphomandra betacea Cav., Coriandrum sativum L., Cucumis sativus L., Daucus carota L., Pennisetum clandestinum Hochst. Ex Chiov., Pennisetum sp., Petroselinum crispum (Mill.) Nyman ex A.W. Hill, Phaseolusvulgaris L., Physalis peruvianum L., Pisum sativum L., Raphanus sativus L., Rubus glaucus Benth., Solanumlycopersicum Mill., Solanum quitoense Lam., Zea mays L.

Weeds Brassica campestris L., Brassica napus L., Datura stramonium L., Hypochaeris radicata L., Polygonum nepalense Meisn., Polygonum segetum Kunth, Rumex crispus L., Solanum nigrum L., Sonchus oleraceus L., Taraxacum officinale Weber ex F.H. Wigg., Trifolium repens L.

Potato varieties Solanum tuberosum cv. DIACOL Capiro y Solanum tuberosumcv. ICA Puracé.

Nutritive solution by 12 days.Soil inoculum at 1x106 cistosoriml-1.

• Bioassays inoculation:

Turf

Two real leafs weretranslate to inoculationpots

Germination Inoculation Plots

1 m2, plots artifitialyinoculated

Evaluation:

AT: 100X y 400X)

20 plant: 10inoculated and 10no inoculated.Evaluations at 15days, 1, 2, 3 y 4months

Roots washing withtop water

5 roots plant-1

Stayned: Trypan blue0.05%

Results

Species clasification by S. subterranea f. sp. subterranea

structure observed inside roots:

Type Q Z Specie

No host Absence Absence Trifolium repens L., Beta vulgaris L., Allium sativum L.,

Hypochaeris radicata L., Brassica napus L., Brassica

campestris L.

Trap Plant Absence Presence Polygonum segetum Kunth, Solanum nigrum L.

Host Plant (Type I) Presence Absence Cyphomandra betacea Cav., Solanum quitoense Lam.,

Rumex crispus L., Coriandrum sativum L., Phaseolus

vulgaris L., Pennisetum sp., Cucumis sativus L., Rubus

glaucus Benth.

Host Plant (Type II) Presence Presence Physalis peruvianum L., Petroselinum crispum (Mill.)

Nyman ex A.W. Hill, Daucus carota L., Pennisetum

clandestinum Hochst. Ex Chiov., Zea mays L., Allium

cepa L., Raphanus sativus L., Solanum lycopersicum

Mill., Pisum sativum L., Polygonum nepalense Meisn.,

Sonchus oleraceus L., Apium graveolens L., Brassica

oleraceae L., Taraxacum officinale Weber ex F.H. Wigg.,

Datura stramonium L.

• S. subterranea f. sp. subterranea

Incidence of cistosory and zoosporangia onhost root plants

Confidence interval at 95%Specie Estimate

IncidenceLowerLimit Upper limite

Pennisetum clandestinum Hochst. Ex Chiov. 0,6170 0,4638 0,7549Datura stramonium L. 0,3478 0,1638 0,5727Apium graveolens L. 0,3000 0,1656 0,4653Solanum quitoense Lam. 0,1800 0,0858 0,3144Zea mays L. 0,1800 0,0858 0,3144Solanum lycopersicum Mill. 0,1600 0,0717 0,2911Allium cepa L. 0,1600 0,0717 0,2911Raphanus sativus L. 0,1333 0,0376 0,3072Physalis peruvianum L. 0,1200 0,0453 0,2431Sonchus oleraceus L. 0,1143 0,0320 0,2674Pennisetum sp. 0,0208 0,0005 0,1107Petroselinum crispum (Mill.) Nyman ex A.W. Hill. 0,0750 0,0157 0,2039Phaseolus vulgaris L. 0,0400 0,0049 0,1371Pisum sativum L. 0,0600 0,0125 0,1655Polygonum nepalense Meisn. 0,0526 0,0064 0,1775Polygonum segetum Kunth. 0,0690 0,0085 0,2277Rubus glaucus Benth. 0,0286 0,0007 0,1492Rumex crispus L. 0,0313 0,0008 0,1622Cyphomandra betacea Cav. 0,0303 0,0008 0,1576Solanum nigrum L. 0,0645 0,0079 0,2142Brassica oleraceae L. 0,0800 0,0222 0,1923Coriandrum sativum L. 0,0500 0,0061 0,1692Taraxacum officinale Weber ex F.H. Wigg. 0,0500 0,0061 0,1692Cucumis sativus L. 0,0286 0,0007 0,1492Daucus carota L. 0,0600 0,0125 0,1655

Rev.Fac.Nal.Agr.Medellín 67(2): 7261-7269.

2. Effect of the de Spongospora subterranea f.

sp. subterranea infection on alternatives hosts

during tree consecutive harvest period

Elevation : 2500 m, 14°C.

• Place: Centro Agrario Paysandú, Universidad Nacional deColombia (Medellín).

www.corregimientosantaelena.org

Alternative Host plant evaluated: (19 species)

Common name Cientific name

Onion Allium cepa L.

Celery Apium graveolens L.

Cabbage Brassica oleraceae L.

Coriander Coriandrum sativum L.

Carrot Daucus carota L.

Tomato Solanum lycopersicum Mill.

Grass Pennisetum clandestinum

Hochst. ex Chiov.

Parsley Petroselinum crispum

(Mill.) Nyman ex A.W. Hill

Common name Cientific name

Beens Phaseolus vulgaris L.

Uchuva Physalis peruvianum L.

Green beens Pisum sativum L.

Corazón herido Polygonum nepalense

Meisn.

Radish Raphanus sativus L.

Lengua de vaca Rumex crispus L.

Tamarillo Cyphomandra betacea Cav.

Black nightshade Solanum nigrum L.

Lulo Solanum quitoense Lam.

Sonchus sp Sonchus oleraceus L.

Corn Zea mays L.

Sowing and Harvest:

- Efect of soil inoculum- Presence of Sss structures on and inside roots by microscopy and detection by Real Time

PCR during tree consecutives harvest .

AT: 10X y 40X

Roots forstainedand forqPCR

www.usb.edu.co

DNA extraction and qPCR:

Roots with S. subterranea f. sp.subterranea structuresSamples without structures wereevaluted on bulks of 5 plants. KitDNeasy Plant mini (Qiagen, EEUU).

qPCR: kit Maxima Probe/ROX qPCRMaster Mix (2X).SponF(5´CTTTGAGTGTCGGTTTCTATTCTCCC3´)SponR (5´GCACGCCAATGGTTAGAGACG3´)Sonda TaqMan probe SponP (5´ FAM-TCTTTC AAG CCA TGG ACC GAC CAG A- BHQ-13’)Fragment of 138 pb from the ITS2 regiónof ADNr (Qu et al. 2011).

Programm: Rotor-Gene Q 5plex Platform(Qiagen):Inicial activation: 95ºC by 5 min.45 cycles at 95ºC by 25s and 60ºC by 1 min.Positives at cycle 40 (Shena et al., 2004).

• Statistical Analysis:

Exponential Model

Monomolecular Model

Yi: Incidence of S. subterranea f. sp. subterranea structures (Cistosory (Q),Zoosporangia (Z) or qPCR detection (M)).

: Intercept.

: Relative taxa of epidemic progress for the exponential andmonomolecular model

ei residual error

• Analized on R (R Development Core Team, 2012) statisticalenvironment among MCMCpack (Martin et al., 2011) and Coda (Plummer et al., 2006).

A posteriori estimative for the S. subterranea f. sp. subterranea incidence.

C. betacea, S. nigrum y S. lycopersicum were estimated by the Monomolecular

model, others by Exponential model.

0

0,1

0,2

0,3

0,4

0,5

0,6

0,7

0,8

0 1 2 3 4

C. betacea Cav.

P. peruviana L.

P. crispum (Mill.) Nyman exA.W. HillSolanum sp.

P. clandestinum Holchst. ExChiov.Z. mays L.

A. cepa L.

R. sativus L.

S. lycopersicum Mill.

S. quitoense Lam.

R. crispus L.

Harvest

Inc

ide

nc

e

• D. carota reduced infection on cabagge (P. brassicae) (Macfarlane, 1952).

• D. stramonium reduced severity on powdery scab on 79% (White, 1954).

• R. sativus dicrease the incidence of S. subterranea f. sp. subterranea on 19-39%(Larkin y Griffin, 2007).

• Raphanus sativus var. longipinnatus reduced the inoculum in 71% on plots. Onfield reduced the inoculum in 94% (Murakami et al., 2000).

• Oats (62%), spinach Atlas variety(41%), spinach Baltic variety (29%), radish FR-1

variety (36% ), and radish CR-1 variety (45%), reduction on clubroots severity(Murakami et al., 2001).

• Trap Plants to S. subterranea f. sp. subterranea from microscopical observation indiferent root species. (Qu y Christ, 2006).

• Is possible to asume another trap plant concept: “Plant that even they are planthost they are able to reduce the S. subterranea f. sp. subterranea infection duringthe time, as C. betacea, P. peruviana, S. nigrum, A. cepa, S. Quitoense and R.

sativus can be used as natural control of the patogen.

Results of concordance analysis• Comparation of Microscopy observation vs. qPCR using

SsF/SsR and specific SponP lead.

• 840 samples by microscopy and 280 samples by qPCR

• Using the Kappa index : 0.196

Molecular Microscopy

Negative Positive Total

Negative 196 25 221

Positive 42 17 59

Total 238 42 280

ISSN 1900-4699 • Volumen 9 • Número 2 • Páginas 214-227 • 2013

Genetics Spongospora subterranea

variability in Colombia • 553 samples from Roots, tubers and soil: 150

Carreño 2009. MSc. Tesis

Type I + 1 mutation on 29 samples

Type II + 2 mutation on IT1 + 2 mutation on ITS 2

ITS1-5.8S-ITS2 amplificationwith primers Spo8-Spo9, having fragments of 391pb

Type I - II5 Different haplotypes in Colombia in 2009

Variability….• 210 samples from

tuber, roots and soil : 127

• New variants wereidentified by a PCR-RFLPs test using the Spo8 y Spo9 and SsF/SsRspecific primersand Hin6I y Bsp143I restrictionenzime

Bioagro 24(3): 151-162. (2014)

RFLPs of ITS1, 5.8S and ITS2 from ADN ribosomal of Spongospora subterranea

f.sp. subterranea (Sss) with the restriction enzimes Bsp143I and Hin6I

15,7% soil and tubers

18,9%

65,4%

Development of SSR to Spongospora

subterranea

Bioagro [online] 25(2): 91-100. ISSN 1316-3361, 2013

ADN mitocondrial sequence of S. subterranea

isolated from S. tuberosum ssp. andigena (DiacolCapiro)

• 16 proteins of respiratory chain, 11 ribosomal proteins, 3 RNAs ribosomal, 24 tRNAs and 2 unknow function proteins.

• Were created the Ss_mit_segb_F/R, Ss_mit_segf_F/R y Ss_mit_segg_F/R primers, which has a divergency of 4, 5 and 9% respectively in the identity analisys.

• First report of a ADNmit genomic sequence of a Plasmodiophoridae

Mitochondrial DNA 1736: 1- 2.(2014)

What about our germoplasmresistance variability ?

Solanum phureja germplasm bank of 115 accession

Solanum tuberosum ssp andigena germplasm bank of 1500

Genes differential expression on S. phureja

Rev. Protección Veg. 29(1): 20-32.

Upper expressedgenes codify to metalotioneine(3297 times), fosfatase 2C (2128 times) pectinmetilesteraseinhibitor (2127 times).

Upperexpressed anputative gene and α-Galactosidase(+1000 times)

Management strategies evaluated• Biological control:

– Trichoderma asperellum (Rev.Fac.Nal.Agr.Medellín 62(1): 4783-4792. 2009)

– Trichoderma harzianum, Pseudomonas fluorescents, sawdust from pinus

– Bacteria with chitin and indol activity (Rev. Colomb. Biotecnol. Vol. XIV No. 1 Julio 2012 157-170 157)

• Cultural control:– Different soil type (Andisol, Entisol, Inceptisol) (ACTA

AGRONÓMICA. 61 (2) 2012, p 111-116)

– Crop rotation (Acta biol. Colomb., Vol. 18 n.o 1, 2013 121 – 136;Rev.Fac.Nal.Agr.Medellín 66(2):6987-6998. 2013)

– Resistant varieties (ICA registry, 2015)

Acknowledgements

• Politécnico Colombiano Jaime Isaza Cadavid

• Ministerio de Agricultura y Desarrollo Rural de Colombia

• Asohofrucol

• Universidad Nacional de Colombia, sedeMedellin.

Thanks you!!!Elena Paola González Jaimesepgonzalez@elpoli.edu.co