AKT Antagonist AZD5363 Inﬂuences Estrogen Receptor ......R. Ribas, S. Pancholi, and S.K. Guest...

Small Molecule Therapeutics

AKT Antagonist AZD5363 Influences EstrogenReceptor Function in Endocrine-Resistant BreastCancer and Synergizes with Fulvestrant(ICI182780) In VivoRicardo Ribas1, Sunil Pancholi1, Stephanie K. Guest1, Elisabetta Marangoni2, Qiong Gao1,Aur�elie Thuleau2, Nikiana Simigdala1, Urszula M. Polanska3, Hayley Campbell3,Aradhana Rani1, Gianmaria Liccardi1, Stephen Johnston4, Barry R. Davies3,Mitch Dowsett1,4, and Lesley-Ann Martin1

Abstract

PI3K/AKT/mTOR signaling plays an important role in breastcancer. Its interaction with estrogen receptor (ER) signalingbecomes more complex and interdependent with acquiredendocrine resistance. Targeting mTOR combined with endocrinetherapy has shown clinical utility; however, a negative feedbackloop exists downstream of PI3K/AKT/mTOR. Direct blockadeof AKT together with endocrine therapy may improve breastcancer treatment. AZD5363, a novel pan-AKT kinase catalyticinhibitor, was examined in a panel of ERþ breast cancer cell lines(MCF7, HCC1428, T47D, ZR75.1) adapted to long-term estro-gen deprivation (LTED) or tamoxifen (TamR). AZD5363 causeda dose-dependent decrease in proliferation in all cell lines tested(GI50 < 500 nmol/L) except HCC1428 and HCC1428-LTED.T47D-LTED and ZR75-LTED were the most sensitive of the lines(GI50 �100 nmol/L). AZD5363 resensitized TamR cells totamoxifen and acted synergistically with fulvestrant. AZD5363

decreased p-AKT/mTOR targets leading to a reduction in ERa-mediated transcription in a context-specific manner and con-comitant decrease in recruitment of ER and CREB-bindingprotein (CBP) to estrogen response elements located on theTFF1, PGR, and GREB1 promoters. Furthermore, AZD5363reduced expression of cell-cycle–regulatory proteins. Globalgene expression highlighted ERBB2-ERBB3, ERK5, and IGFIsignaling pathways driven by MYC as potential feedback-loops.Combined treatment with AZD5363 and fulvestrant showedsynergy in an ERþ patient-derived xenograft and delayed tumorprogression after cessation of therapy. These data support thecombination of AZD5363 with fulvestrant as a potential therapyfor breast cancer that is sensitive or resistant to E-deprivation ortamoxifen and that activated AKT is a determinant of response,supporting the need for clinical evaluation.Mol Cancer Ther; 14(9);2035–48. �2015 AACR.

IntroductionAround 80% of breast cancers express estrogen receptor a (ER)

anddependon estrogen (E) to grow. Strategies to target ER activityinclude depriving the hormone-dependent tumor cells of E by theuse of aromatase inhibitors (1) or the use of antiestrogens such astamoxifen or fulvestrant, both ofwhich competewith E for the ER.Despite the efficacy of these agents, many tumors exhibit de novoor develop acquired mechanisms of resistance.

Deregulated signaling through the PI3K/AKT/mTOR pathwayis a feature ofmost types of cancer cells (2) and has been linked toendocrine-resistant breast cancer (3–5). Activation of PI3K/AKToccurs via gain-of-function mutations in the catalytic domain ofPI3K (PIK3CA) and the regulatory subunit p85a (PIK3R1), ampli-fication of PIK3CA, PIK3CB and PDK1 or by reduced expression ofPTEN, an endogenous inhibitor of the PI3K/AKT pathway (6).Furthermore, mutation and amplification of AKT 1, 2, and 3together with ERBB2, FGFR1, MET, and IGFIR have also beenassociated with activation of this signaling axis.

It is clear that the ER can become involved with the PI3K/AKT/mTOR pathway in breast cancer cells, with evidence for bothgenomic and nongenomic cross-talk between this signaling path-way and ER accounting for endocrine resistance (7–9). Growthfactor–mediated activation of AKT can potentiate ER classicaltranscriptional activity via phosphorylation at serine 167 inthe AF1 domain leading to ligand-independent transactivation(10–12). Similarly, elevated levels of AKT have been shownto change the genome-wide binding pattern of ER, effectivelyaltering the ER program (13). These bidirectional interactionsbetween hormonal and kinase signaling pathways create self-reinforcing synergistic loops that potentiate prosurvival signalsand may allow breast cancer cells to escape normal endocrineresponsiveness.

1Breakthrough Breast Cancer Research Centre, Institute of CancerResearch, London, United Kingdom. 2Department of TranslationalResearch, Institut Curie, Paris, France. 3Oncology Innovative Medi-cines, AstraZeneca, United Kingdom. 4Royal Marsden Hospital,London, United Kingdom.

Note: Supplementary data for this article are available at Molecular CancerTherapeutics Online (http://mct.aacrjournals.org/).

R. Ribas, S. Pancholi, and S.K. Guest contributed equally to this article.

Corresponding Author: Lesley-Ann Martin, The Breakthrough Breast CancerResearch Centre, Institute of Cancer Research, 237 Fulham Road, London, SW36JB, United Kingdom. Phone: 440-207-153-5329; Fax: 440-207-153-5340;E-mail: [email protected]

doi: 10.1158/1535-7163.MCT-15-0143

�2015 American Association for Cancer Research.

MolecularCancerTherapeutics

www.aacrjournals.org 2035

on June 20, 2021. © 2015 American Association for Cancer Research. mct.aacrjournals.org Downloaded from

Published OnlineFirst June 26, 2015; DOI: 10.1158/1535-7163.MCT-15-0143

http://mct.aacrjournals.org/

Targeting the PI3K/AKT/mTOR pathway in association withendocrine therapy has seemed a sensible strategy to explore.However, blockade of a single protein in a complex signalingcascade is unlikely to provide total or prolonged growth inhibi-tion. An important negative feedback loop exists downstreamin the PI3K/AKT/mTOR pathway that may limit the effectivenessof mTOR inhibitors in breast cancer. The mTOR-activatedkinase, S6K1, phosphorylates and destabilizes the IRS1 and IRS2proteins in IGF-responsive cells (14). In these cells, mTORC1inhibition can lead to a reduction in S6K1 activity, which in turnallows IRS1/2 expression to be increased with associatedenhanced activation of IGF1R-dependent AKT activity. Concernhas been raised that activation of this negative feedback loopmayovercome the antitumor activity of mTORC1 blockade and limitthe effectiveness of rapamycin analogs (14, 15).

In recent years, it has been suggested that direct blockade ofAKT in combination with endocrine therapy, may provide abetter rationale for treatment of endocrine-resistant breastcancer, affecting both cell survival/apoptosis and ER ligand–independent signaling. A novel pan-AKT kinase catalytic inhib-itor (AZD5363) has been developed and shown to inhibit thegrowth of a range of human tumor xenografts, either as mono-therapy or in combination with HER2 inhibitors or withdocetaxel (16). A recent study has also reported that combina-tions of AKT and IGFIR/InsR inhibitors can be effective in thetreatment of hormone-independent ERþ breast cancer (17). Onthe basis of these data, AZD5363 is currently being investigatedin phase I clinical trials.

Further investigations on intelligent combinations of signaltransduction inhibitors are urgently required both in preclinicalmodels and in clinical trials. In this article, we describe for thefirst time the effectiveness and molecular consequence of com-bining AZD5363 with the four most widely used approaches toendocrine therapy in the clinic, namely E-deprivation, tamox-ifen, fulvestrant, and AIs in preclinical models of endocrine-sensitive and -resistant ERþ breast cancer, as well as in a patient-derived xenograft (PDX) model of ERþ breast cancer resistant toE-deprivation.

Materials and MethodsAntibodies and reagents

Primary antibodies against phospho-AKTSer473, phospho-AKTThr308, total-AKT, phospho-p70S6Thr389, total-p70S6,phospho-S6 ribosomal protein (RP)Ser235/236, total-S6RP, phos-pho-EGFRTyr1068, total-EGFR, phospho-ERBB2Tyr1248, phospho-ERBB3Tyr1222, phospho-ERBB4Tyr1284, phospho-ERaSer167, phos-pho-4EBP1Thr37/46, total-4EBP1, phospho-RbSer807/811, total-Rb,phospho-RAFSer259, phospho-RAFSer338, total-RAF, phospho-PRAS40Thr246, total-PRAS40, Cyclin D1, Cyclin D3, total-ERK1/2, 14-3-3 were purchased from Cell Signaling Technology; total-IGF1R, cleaved-PARP, total-ERa, and total-ERBB3 were pur-chased from Santa Cruz Biotechnology; phospho-ERK1/2 andActin from Sigma; GAPDH (Abcam); PgR (Novocastro orDako); IRS-1 and total-ERBB2 (Millipore); IRS-2 (Upstate) andfinally total-ERBB4 (Neomarkers). Secondary antibodies (anti-mouse and anti-rabbit horseradish peroxidase) were obtainedfrom Dako or Cell Signaling Technology. Antibodies used forchromatin immunoprecipitation were purchased from SantaCruz Biotechnology: ERa clone HC20 and CBP clone A22. 17-b-estradiol and 4-hydroxytamoxifen (4-OHT) were purchased

from Sigma Aldrich; fulvestrant (ICI182780), letrozole, andexemestane from Tocris Bioscience; AZD5363 was synthesizedand supplied by AstraZeneca UK.

Tissue cultureHuman breast cancer cell lines MCF7, T47D, ZR75.1, and

HCC1428 were obtained from the ATCC between 2000 and2012 and were cultured in phenol red-free RPMI1640 mediumsupplemented with 10% FBS and 1 nmol/L estradiol (E2). All celllines were banked in multiple aliquots to reduce the risk ofphenotypic drift and identity confirmed using iPLEX-pro (AgenaBioscience). LTED cells modeling resistance to an AI were derivedfrom all four parental cell lines by long-term culture in thepresence of RPMI1640medium containing 10% dextran charcoalstripped serum (DCC), as described previously (18). The 1%MCF7 and TamR cell lines were cultured inDMEM/F-12medium,as previously stated (19). MCF7-2A and BT474-A3 cells stablyexpressing CYP19 (AROM)were derived fromparentalMCF7 andBT474 cells, respectively, andweremaintained in phenol red–freeRPMI1640 medium containing 10% FBS supplemented with1 nmol/L E2 and 1 mg/mL G-418 (Sigma-Aldrich; ref. 20). Allcell lines were stripped of steroids for 48 to 72 hours prior to thestart of experiments.

Proliferation and colony formation assaysCells were seeded in 10%DCC into 96-well tissue culture plates

and allowed to acclimatize overnight. Monolayers were thentreated with RPMI1640 þ 10% DCC containing increasing con-centrations of AZD5363, with or without the presence of0.01 nmol/L of E2. To assess the effects of AZD5363 in combi-nation with endocrine agents, cells were maintained in the pres-ence of GI50 values of AZD5363 along with increasing concentra-tions of endocrine agent 4-OHT, fulvestrant, or anastrozole. Themedium was replaced after 3 days and cells were cultured for atotal of 6 days. Each experimentwas performed at least three timeswith 8 replicates per treatment. Cell viability was determinedusing the CellTitre-Glo Luminescent Cell Viability Assay (Pro-mega), according to the manufacturer's protocol. Values wereexpressed as % viability relative to the untreated control.

For the colony formation assays, cells were seeded into 6-wellplates and allowed to acclimatize for 24hours. Subsequently, cellswere treated with the drug combinations indicated, every 3 to 4days, for the duration of 14 days until colonies were evident. Cellswere then fixed using ice-cold methanol and stained using 0.5%w/v crystal violet in 90% H20/10% methanol.

Drug interaction analysisTo determine the nature of the interaction between AZD5363

and endocrine agents, combination studies were carried out usingChou and Talalay constant ratio combination model (21). Cellswere treated with increasing doses of AZD5363 alone, endocrineagent alone, or an equipotent combination of AZD5363 andendocrine agent for 6 days. The GI50 for each drug alone wasused to define the ratio of equipotent doses and serial dilutions ofthe combinations used. Interactions were calculated using Calcu-syn software (BIOSOFT), based on the combination index (CI)equation of Chou and Talalay. The CIs for a growth inhibition of50%, 75%, and 90% were obtained using mutually nonexclusiveMonte Carlo CI simulations. Drug interaction was scored usingthe CI so that: CI ¼ 1 is additive, CI < 1 is synergistic, CI > 1 isantagonistic.

Ribas et al.

Mol Cancer Ther; 14(9) September 2015 Molecular Cancer Therapeutics2036




Transcriptional assaysCell lines were seeded in 24-well plates in 10% DCC medium

and left to acclimatize for 24 hours, following transfection withFugene 6 at a ratio of 6:1 (Promega) with 0.1 mg of estrogenresponse element linked luciferase (EREIItkluc) and 0.1 mg ofb-galactosidase (pCH110) reporter constructs. The following day,cells were treated with the drugs combinations specified and leftfor 24 hours. Luciferase (Promega) and b-galactosidase (Galac-toStar, AppliedBiosystems) activityweremeasured using a lumin-ometer. Each experiment was performed 3 times with 3 to 4replicates per treatment.

Real-time quantitative PCRmRNA from treated cells was extracted with RNeasy Mini

Kit (Qiagen), as per the manufacturer's instructions, and quan-tification performed using the Agilent 2100 Bioanalyzer(Expert Software version B.02.03) with RNA Nano LabChipKits (Agilent Technologies). Total RNA was reverse transcribedusing SuperScript III (Invitrogen) and random primers, inaccordance with the manufacturer's instructions. cDNA was sub-jected to quantitative PCR using 10 ng of cDNA in triplicate usingthe ABI Perkin-Elmer Prism 7900HT Sequence detection system(Applied Biosystems). TaqMan gene expression assays (App-lied Biosystems) were used to quantify TFF1 (Hs00907239_m1), PGR (Hs01556702_m1), CDK7 (Hs00361486_m1);EIF2A (Hs00230684_m1); FOXO3 (Hs00818121_m1); IGFIR(Hs00609566_m1); IRS2 (Hs00275843_s1); MAP2K5(Hs00177134);MYC (Hs00153408);NRIP1 (Hs00942766_s1);NR2F2 (Hs00819630_m1); PIK3R1 (Hs00381459_m1); PTEN(Hs02621230_s1), and GREB1 (Hs00536409_m1), togetherwith FKBP15 (Hs00391480_m1) as housekeeping gene, tonormalize the data. The relative quantity was determined usingDDCt, according to the manufacturer's instructions (AppliedBiosystems).

Chromatin immunoprecipitationMCF7-LTED cells were crosslinked in 1% formaldehyde at

room temperature for 10 minutes and then quenched with125 mmol/L glycine. Samples were then lysed, sonicated, andchromatin was immunoprecipitated by overnight incubation at4�C with ER, CBP, or IgG antibodies prebound with Protein Gmagnetic dynabeads (Invitrogen). Samples were then washedvigorously with RIPA buffer and reversed crosslinked by anovernight incubation in elution buffer at 65�C.DNAwas digestedwith RNase and Proteinase K, purify precipitated with phenolchloroform and eluted in Tris-HCl pH 8.0. Real-time qPCR wasperformed using the following oligonucleotides TFF1 forward(FWD): 50 GGCCATCTC TCACTA TGA ATC ACT TCTGCA 30 andreverse (REV): 50 GGCAGGCTCTGTTTGCTTAAAGAGCGTTAG30,GREB-1 FWD50 GAAGGGCAGAGCTGATAACG30,GREB-1REV50 GACCCAGTTGCCACACTTTT 30, PGR FWD 50 GCTCTG-CCTTGGAATGAGGT 30, and PGR REV 50 AAGAATTTGGGGG-TGTTGGT 30.

Western blottingCells were seeded into dishes and allowed to attach overnight.

Monolayers were treated with the desired drug combinations forthe required length of time.Whole-cell extracts were generated, asdescribed previously (18). For the xenograft samples, tumorswerelysed on ice, homogenized, and sonicated. The resulting proteinfractionwas subjected toWestern blotting as previously described

(18). The numerical data for each biomarker were determinedusing Genetools software and normalized to GAPDH control.

Cell-cycle analysisCells were seeded into 10 cm dishes and 24 hours later treated

with the drug combinations indicated for 48 hours. Cells werefixed 90% ethanol and stained with propidium iodide. Cell-cycleanalysis was carried out using fluorescence-activated cell sorting(FACS).

Gene expression data and microarray analysisGene expression analysiswas performed in triplicate usingRNA

derived from MCF7 and their LTED derivatives after treatmentwith or without AZD5363 for 24 hours. mRNA extraction andquantification was performed, as previously stated. The 12 RNAsamples were amplified, labeled, and hybridized on HumanHT-12_V4 Expression BeadChip, according to the manufacturer'sinstructions (Illumina). Raw expression data were extracted usingGenomeStudio (www.illumina.com) software; thedatawere thentransformed and normalized using variance-stabilizing transfor-mation and robust spline normalization method in the Lumipackage in R (http://www.bioconductor.org; ref. accession num-ber: GSE69893). Probes for which expression levels were notreliably detected in one of the samples (detection P > 0.01) werefiltered, the remaining differentially expressed genes were iden-tified by using the Class Comparison (http://linus.nci.nih.gov/BRB-ArrayTools.html) using the thresholds of FDR < 5%. Thesignificantly expressed gene lists were subject to further pathwayanalysis using Ingenuity Pathway Analysis (IPA) to identifyaltered pathways due to the AZD5363 treatment and the alteredpathways with P < 0.05 were considered as significant.

Human tumor xenograftsIn vivo efficacy studies were performed in 8- to 12-week-old

female Swiss nude mice implanted with the PDX HBCx22OvaR,as previously described (22), in accordance with the FrenchEthical Committee. First, a pharmacodynamic study was per-formed for 4 days to assess biomarker changes with samplesremoved 2 and 4 hours after treatment. Between 5 and 7 micewere included in each group. Second, a long-term study to assesschanges in tumor volume and progression over 90 days wasinitiated. To address the ability of the combination to delaytumor progression, mice were followed for a further 40 days afterdrug withdrawal. The treatment groups received AZD5363 solu-bilized in a 10%DMSO25%w/v KleptoseHPB (Roquette) bufferby oral gavage, or fulvestrant suspended in corn oil by subcuta-neous injection into the flank. For the combination groups,fulvestrant was dosed 2 hours before AZD5363. The controlgroups received both vehicles. In the combination study, treat-ments were started when tumors reached a volume of 40 to 65mm3. Each group included between 11 and 13 xenografts. Tumorvolumes (measured by caliper), animal body weight, and tumorcondition were recorded twice weekly for the duration of thestudy. Tumor volumes were calculated as V¼ a� b2/2, where "a"is the largest diameter and "b" is the smallest. Growth inhibitionfrom the start of treatment was assessed by comparison of thedifferences in tumor volume between control and treated groups.Because the variance in mean tumor volume data increasesproportionally with volume (and is therefore disproportionatebetween groups), data were log-transformed to remove any sizedependency before statistical evaluation. Tumor volumes were

Effect of AZD5363 in Endocrine-Resistant Breast Cancer

www.aacrjournals.org Mol Cancer Ther; 14(9) September 2015 2037




reported to the initial volume as relative tumor volume (RTV).Percent of tumor growth inhibition (TGI) was calculated at theend of treatments (day 88) as follow: (1-RTVtreated/RTVcontrol)� 100. Statistical significance was evaluated using a one-tailed,two-sample t test.

Fluidigm analysisTumor samples were homogenized and RNA was extracted

as described above. cDNA was synthesized using a High-Capa-city cDNA Reverse Transcription Kit (Applied Biosystems).ER-dependent genes listed (AQP3 (Hs01105469_G1);AREG (Hs00950669_m1); BMF (Hs00372937_m1);C3 (Hs00163811_m1); CASP9 (Hs00609647_m1); CCND1(Hs00765553_m1); CCNG2 (Hs00171119_m1); CXCL12(Hs03676656_m1); ESR1 (Hs00174860_m1); GATA3(Hs00231122_m1); LAMB2 (Hs00158642_m1); MUC1(Hs00159357_m1); MYBL1 (Hs00277143_m1); RET(Hs01120030m_1); SPRY1 (Hs01083036_s1); TFF3(Hs00902278_m1) and ZEB1 (Hs00232783_m1)) were selectedand analysis was performed using the Fluidigm Biomark System,as permanufacturer's instructions (Fluidigm).Datawere analyzedusing a real-time PCR analysis software (version 3.1.3) and DDCtcalculated. All genes were normalized to the housekeeper PPIA(Hs04194521_s1). Linear fold changes were calculated on thebasis of the relativedifference inmRNAexpression comparedwithvehicle control. Statistical analysis was subsequently performedusing JMP 11.0 to determine significant changes with a P < 0.05.

ResultsEffect of AZD5363 on cell growth of endocrine-sensitive and-resistant breast cancer cell lines

A panel of endocrine-sensitive and -resistant breast cancer celllines were assessed for their sensitivity to the AKT inhibitorAZD5363, a pyrrolopyrimidine-derived compound (Fig. 1A).MCF7, ZR75, T47D, HCC1428 cell lines and their LTED deriva-tives were assessed both in the presence and absence of E2. TamRand their parental cell line (1%MCF7) were assessed in 1% FBSand aromatase transfectedMCF7-2A and BT474-A3 cell lines weretested in the presence of androstenedione.

The cell lines tested showed varying degrees of sensitivity toAZD5363. Of note, HCC1428 and their LTED derivative wereresistant to the antiproliferative effect of the drug, even at con-centrations in excess of 10 mmol/L (Fig. 1B and SupplementaryFig. S1). T47D and their LTED derivative together with ZR75-LTED showed the highest degree of sensitivity (GI50 �100 nmol/L). MCF7 in the absence of E2, showed over a 2-fold increase insensitivity to AZD5363 (GI50 200 nmol/L) compared with in thepresence of E2 (GI50 500nmol/L). Assessment ofMCF7-LTEDandZR75 showed little effect of E2 on the sensitivity to AZD5363(GI50 500 nmol/L). Of note, TamR cells, similar to MCF7-LTED,have a GI50 of � 400 nmol/L, showing less sensitivity comparedwith MCF7 cells in the absence of E2. MCF7-2A showed a slightlyhigher degree of sensitivity to MCF7 in the presence of E2 (400nmol/L vs. 500nmol/L, respectively). BT474-A3 revealed aGI50 ofapproximately 600 nmol/L (Fig. 1B and Supplementary Fig. S1).

Combination of AZD5363 and endocrine agents on cellproliferation

To assess the efficacy of combining AZD5363 with currentendocrine therapies, all cell lines were grown in the presence of

their specific GI50 values for AZD5363 and increasing doses of 4-OHT, fulvestrant, or anastrozole. HCC1428 and their LTEDderivatives were excluded from future studies due to their resis-tance to AZD5363.

In the presence of 4-OHT, MCF7, MCF7-LTED, and 1% MCF7demonstrated increased drug sensitivity when treated withAZD5363 compared with 4-OHT alone (�2-fold increase insensitivity; Fig. 2A). In contrast, ZR75, T47D, and their LTEDderivative cell lines demonstrated no added benefit when com-bining AZD5363 with 4-OHT, however, AZD5363 resensitizedthe TamR cell line to the antiproliferative effect of tamoxifen (GI5010 nmol/L). Combination of fulvestrant with AZD5363 alsoincreased drug sensitivity by �2-fold in MCF7 and 1% MCF7and by �10-fold in MCF7-LTED and TamR compared withfulvestrant alone. ZR75, T47D, and their LTEDderivatives showedno added benefit from the combination (Fig. 2B). Finally, weassessed the effect of the combination of AZD5363 with increas-ing doses of anastrozole in MCF7-2A and BT474-A3 cells. Hereagain, the combination of AZD5363 with anastrozole versusanastrozole alone was superior (�5–10-fold increase in sensitiv-ity to anastrazole; Fig. 2C). These data were further confirmedusing a colony formation assay as an orthogonal approach inMCF7 and MCF7-LTED cells (Fig. 2D).

Subsequently, we conducted formal assessment of the interac-tion between 4-OHT, fulvestrant, or anastrozole with AZD5363,using Calcusyn software (Supplementary Fig. S2). T47D-LTEDandZR75-LTEDwere precluded from this analysis, as they lose theexpression of ER. Furthermore, as the TamR cell line is resistant to4-OHT formal analyses could not be assessed in response to thecombination of AZD5363 with 4-OHT.

The combination of AZD5363 and 4-OHT was synergistic inMCF7,MCF7-LTED, and 1%MCF7, with CIs < 1, at 50%and 75%growth inhibition. In contrast, AZD5363 plus 4-OHT showedaddedbenefit only in T47Dat 50%and75%growth inhibition. Incontrast, ZR75 at 75% and 90% growth inhibition showed noadded benefit (CI > 1; Supplementary Fig. S2A).

Combination of fulvestrant with AZD5363was predominantlysynergistic in MCF7, MCF7-LTED, 1% MCF7 and TamR. Incontrast, the combination of fulvestrant and AZD5363 providedno further benefit in T47D and ZR75 cells (SupplementaryFig. S2B). TheMCF7-2A and BT474-A3 cells showed synergy withalmost all doses of anastrozole when combined with AZD5363(Supplementary Fig. S2C).

In summary, these results suggest that the combination ofAZD5363 with endocrine therapy is superior to monotherapy.

Analysis of the differential effects of AZD5363 � endocrinetherapy on PI3K/mTOR/AKT, ER signaling and cell-cycle arrest

To investigate the effect of AZD5363 in combinationwith endocrine agents on cellular signal transduction pathways(Fig. 3A), MCF7 and MCF7-LTED cells were treated withAZD5363 for 1, 8, 24, or 48 hours � E2, 4-OHT, or fulvestrant,to establish themost suitable timepoints for further investigation.As few early changes were evident between 1 and 8 hours aftertreatment, the 1-hour timepoint was selected to depict earlychanges. Furthermore, as 24 and 48 hours also showed similaralteration, the 48-hour timepoint was selected to show laterevents associated with AKT blockade, in particular changes asso-ciated with feedback loops discussed later in this study[Supplementary Fig. S3A and S3B (1-, 8-, and 24-hour timepoint)and Fig. 3B (48-hour timepoint). Addition of AZD5363 resulted

Ribas et al.





in increased phosphorylation of AKT (S473 and T308) as early as1-hour after treatment and was maintained even after 48 hours.Total AKT was suppressed in those cell lines showing the highestdegree of sensitivity to AZD5363, most notably T47D, T47D-LTED, ZR75-LTED, and TamR. Treatment with AZD5363 caused amarked reduction, or even complete loss, of pPRAS40 and S6kinase. Of particular note, total PRAS40 was suppressed in T47Dand their LTED. Phosphorylation of 4EBP1, a downstreammarkerof the PI3K/AKT/mTOR pathway, was reduced in T47D, T47D-LTED, and ZR75-LTED in response to AZD5363 either alone or incombination with endocrine therapy (Fig. 3B). AZD5363 alsoreduced expression of pRAF (S259), most noticeably in MCF7,T47D, and their LTED derivatives; in contrast, the TamR cell lineshowed an increase in pRAF (S338). We have previously shown

that inhibition of AKT can increase ERK signaling (19), therefore,we assessed the effect of AZD5363 on pERK1/2 and showeddifferential responses. For instance, AZD5363 suppressed phos-phorylation of ERK1/2 in T47D but caused an increase in ZR75-LTED and TamR cells after 48 hours (Fig. 3B). As pAKT, pS6, andpERK1/2 are known to phosphorylate and activate ER, we inves-tigated the effect of AZD5363 � endocrine therapy on ER phos-phorylation together with expression of the progesterone receptor(PGR), an endogenous E-regulated gene. Assessment of ER phos-phorylation indicated AZD5363 had the clearest impact onreducing phosphorylation of ERser167 in the MCF7 andMCF7-LTED and this associated with a slight but noticeablereduction in PGR expression in the MCF7 and MCF7-LTED,particularly in the presence of 4-OHT. Of note, while T47D-LTED

Figure 1.GI50 values for antiproliferative effect of AZD5363 inrelation to PTEN, PI3KCA and HER2 status inendocrine-resistant and -sensitive breast cancer celllines. A, chemical structure of AZD5363. B, cells weretreated in absence or presence of exogenous E2(0.01 nmol/L) and doubling concentrations ofAZD5363. Treatments were performed at day 1 andday 3 after seeding. After 6 days of treatment, cellviability was analyzed using a CellTitre-Glo assayand GI50 values were plotted. Genotype is depictedby greyscale for expression of PTEN, PI3KCA, andHER2.






0

150

300

450

600

750

0 0.01 0.1 1 10 100

Rela

�ve

lum

ines

cenc

e(×

1,00

0)

Fulvestrant (nmol/L)

0

100

200

300

400

0 0.01 0.1 1 10 100

Rela

�ve

lum

ines

cenc

e(×

1,00

0)


0

200

400

600

800

0 0.01 0.1 1 10 100

Rela

�ve

lum

ines

cenc

e(×

1,00

0)


0

100

200

300

400

0 0.01 0.1 1 10 100

Rela

�ve

lum

ines

cenc

e(×

1,00

0)


0100200300400500600

0 0.01 0.1 1 10 100

Rela

�ve

lum

ines

cenc

e(×

1,00

0)

4-OHT (nmol/L)

0

200

400

600

800

0 0.01 0.1 1 10 100

Rela

�ve

lum

ines

cenc

e(×

1,00

0)

4-OHT (nmol/L)

MCF7-2A

A

B

C

–AZD5363+AZD5363

BT474 A3

MCF7 LTED ZR75 LTED T47D LTED TamR

%1D74T57RZ7FCM MCF7

MCF7 LTED ZR75 LTED T47D LTED TamR

%1D74T57RZ7FCM MCF7

0

400

800

1,200

1,600

0 0.01 0.1 1 10 100

Rela

�ve

lum

ines

cenc

e(×

1,00

0)


0100200300400500600

Rela

�ve

lum

ines

cenc

e(×

1,00

0)

Anastrozole (nmol/L)

0

100

200

300

400

500

Rela

�ve

lum

ines

cenc

e(×

1,00

0)

Anastrozole (nmol/L)

0

100

200

300

400

0 0.01 0.1 1 10 100

Rela

�ve

lum

ines

cenc

e(×

1,00

0)

4-OHT (nmol/L)

0

100

200

300

400

0 0.01 0.1 1 10 100

Rela

�ve

lum

ines

cenc

e(×

1,00

0)

4-OHT (nmol/L)

0

400

800

1,200

1,600

0 0.01 0.1 1 10 100

Rela

�ve

lum

ines

cenc

e(×

1,00

0)

4-OHT (nmol/L)

0100200300400500600

0 0.01 0.1 1 10 100

Rela

�ve

lum

ines

cenc

e(×

1,00

0)

4-OHT (nmol/L)

0

150

300

450

600

750

0 0.01 0.1 1 10 100

Rela

�ve

lum

ines

cenc

e(×

1,00

0)

4-OHT (nmol/L)

0

200

400

600

800

0 0.01 0.1 1 10 100

Rela

�ve

lum

ines

cenc

e(×

1,00

0)

4-OHT (nmol/L)

0

150

300

450

600

750

0 0.01 0.1 1 10 100

Rela

�ve

lum

ines

cenc

e(×

1,00

0)


0100200300400500600

0 0.01 0.1 1 10 100

Rela

�ve

lum

ines

cenc

e(×

1,00

0)


0

150

300

450

600

750

0 0.01 0.1 1 10 100Re

la�v

elu

min

esce

nce

(×1,

000)


D

MCF

7M

CF7-

LTED

Figure 2.Antiproliferative effect of AZD5363 in combination with escalating doses of various endocrine agents. 4-OHT (A), fulvestrant (B), and anastrozole (C), inendocrine-sensitive and -resistant breast cancer cell lines. Cell lines were treated with vehicle or GI50 concentrations of AZD5363 and increasing amounts of 4-OHT,fulvestrant, and anastrozole. After 6 days of treatment, cell viability was analyzed using Cell Titre-Glo and data expressed as fold change relative to vehicle-treated control. Error bars, �SEM. D, colony-forming assay of MCF7 and MCF7-LTED, following treatment with AZD5363 in the presence or absence of endocrineagents. Cells were left for 14 days with treatment changes every 3 to 4 days.

Ribas et al.





MCF7 LTEDMCF7 T47D LTEDT47D ZR75 LTEDZR75 TamR

4EBP1

ER

pERK1/2

pPRAS40 (T246)

pAKT (S473)

S6RP

pAKT (T308)

pER (S167)

pRaf (S259)

Raf

AKT

ERK1/2

PRAS40

pS6RP (S235/236)

14-3-3

Ac�n

pRaf (S338)

p4EBP1 (T37/46)

PgR

pP70S6K (T389)

P70S6K

AZD5363 (1,000 nmol/L) E2 (0.01 nmol/L) 4-OHT (10 nmol/L)Fulvestrant (1 nmol/L)

----

+---

-+--

++--

-++-

+++-

-+-+

++-+

----

+---

-+--

++--

-++-

+++-

-+-+

++-+

----

+---

-+--

++--

-++-

+++-

-+-+

++-+

----

+---

-+--

++--

-++-

+++-

-+-+

++-+

----

+---

-+--

++--

-++-

+++-

-+-+

++-+

----

+---

-+--

++--

-++-

+++-

-+-+

++-+

----

+---

--+-

+-+-

---+

+--+

A

B

pRb (S807)

Rb

Parp total/Cleavage

Cyclin D1/D3

Ac�n

C

Figure 3.Effect of the combination of AZD5363with E-deprivation (DCC), 4-OHT, or fulvestrant on PI3K/mTOR/AKT, ER and cell-cycle signaling. A, schematic representationof the AKT signaling pathway and cross-talk with RTKs and ER. Endocrine-resistant and -sensitive breast cancer cell lines were treated for 48 hours withthe drug combinations indicated to assess effect on PI3K/AKT/mTOR and ER pathways (B) and cell cycle (C). Cyclin D3 was assessed for MCF7-derived celllines, while Cyclin D1 was tested in the remaining cell lines.






showed undetectable levels of ER, AZD5363 caused a markedsuppression of PGR in this cell line, suggesting some residual ERactivity may still be present.

To assess the effect of AZD5363 on cell-cycle arrest andapoptosis, we investigated changes in protein expression ofcyclin D1/D3, Rb, and induction of PARP cleavage (Fig. 3C).The combination of AZD5363 � endocrine therapy caused adecrease in expression of phosphorylated Rb and cyclin D inthe majority of cell lines tested, with a higher effect beingobserved in combination with fulvestrant. Furthermore, cell-cycle analysis showed a significant reduction in S-phase inresponse to AZD5363 in MCF7 and MCF7-LTED (Supplemen-tary Fig. S3C). Subtle increases in PARP-cleavage were evidentin MCF7 although this did not appear specific to treatment. Incontrast, T47D-LTED showed increases in PARP cleavage spe-cifically in response to AZD5363 addition (Fig. 3C).

In summary, these data show AZD5363 impedes downstreamAKT signaling and reduces ER phosphorylation in a context-specific manner, leading to an increase in cell-cycle arrest.

The effect of AZD5363 alone or in combination with endocrinetherapy on receptor tyrosine kinase activity and ERtransactivation

We further assessed the impact of AZD5363 on the expressionand phosphorylation of receptor tyrosine kinases (RTK) in thetarget cell lines (Fig. 4A). Inhibition of AKT with AZD5363resulted in upregulation and activation of RTKs, including EGFR,ERBB2, but also IRS2,whichwas cell line specific (Fig. 4A).MCF7-LTED, ZR75, andmost notably ZR75-LTED showed an increase inpEGFR; T47DandT47D-LTED showed an increase in pERBB2 andIRS2; TamR revealed increases pERBB3.

As cross-talk betweenERandRTKpathways iswell documented(12), we assessed alterations in ER-mediated transactivation afterperturbation with AZD5363 alone or in combination with endo-crine therapy. MCF7, MCF7-LTED, T47D, ZR75, and TamR cellswere transiently transfectedwith an ERE-linked luciferase reporterconstruct and treated with E2, 4-OHT, or fulvestrant � AZD5363(Fig. 4B). AZD5363 showed a significant effect on ER transactiva-tion ofMCF7,MCF7-LTED, and T47Dwhen in combination withall endocrine agents. In contrast, in ZR75 the effect on ER trans-activation was minimal, apart from when combined with fulves-trant. TamR cells similarly showed minimal impact on ER-medi-ated transcription. Further analyses of the expression of a panel ofendogenous E-regulated genes (TFF1, PGR, and GREB1), showedthat AZD5363 had a similar impact in keeping with the ERE-linked luciferase assay with the exception of T47D, which showedan increase in the expression of TFF1when treated with AZD5363but a decrease in PGR and GREB1 (Supplementary Fig. S4).

To address this further, chromatin immunoprecipitation wasperformed in MCF7-LTED cells. AZD5363 caused a reduction inrecruitment of ER, AIB1, andCBP to the EREs on the TFF1,GREB1,and PGR promoters (Fig. 4C), supporting the impact of AZD5363on ER-mediated transactivation.

Gene expression analysis of MCF7 and MCF7-LTED identifiedMYC as a potential regulator of resistance

Comparison of gene expression between MCF7 cells treatedwith or without AZD5363 in the absence of E2 showed a total of1,695 genes differentially downregulated and 1,751 genes differ-ential upregulated. MCF7-LTED cells showed fewer genes alteredin response to AZD5363 (983 genes differentially downregulated

vs. 842 genes differentially upregulated). The downregulatedgenes in both cell lines were mainly associated with metabolicand cell-cycle pathways (Table 1). The upregulated geneswere associated with EIF2, mTOR, and IGFI signaling. Of note,ERBB2–ERBB3 signaling and big MAPK1 (BMK1/ERK5) weresignificantly increased in both cell lines in response to AZD5363,together with ILK1 and integrin signaling. Furthermore, RARpathway activation was also significantly upregulated in bothMCF7-LTED and MCF7 cells in response to AZD5363. To inter-rogate these findings further, expression of selected genes repre-senting activation of the various pathways was tested using qRT-PCR and was shown to be significantly overexpressed (Supple-mentary Fig. S5). Of particular note, interrogation of genes withinthese pathways identified MYC, PIK3R1, PTEN, and FOXO3 ascommon elements (Supplementary Table S1; Supplementary Fig.S5). Further analysis revealed thatMYC is upregulated over 2-fold(P < 0.001) in the MCF7-LTED and over 1.2-fold (P < 0.05) in theMCF7 cell lines.

Combination of AZD5363 and fulvestrant in the luminal breastcancer xenograft HBCx22OvaR

A high degree of redundancy in the kinase networks and cross-talkwithER iswell documented (23), suggesting destructionof ERwith fulvestrant may be a better strategy than antagonism withtamoxifen or blockade of estrogen biosynthesis with an AI.Therefore, we assessed the combination of fulvestrant andAZD5363 compared with monotherapy in a patient-derivedluminal breast cancer xenograft HBCx22OvaRmodeling acquiredresistance to E-deprivation (ref. 22; Fig. 5). Treatments were welltolerated. Fulvestrant monotherapy treatment caused a modestbut nonsignificant reduction in tumor growth compared with thevehicle control group (30% inhibition, P ¼ 0.11). Continuousdosing of AZD5363 at 50 mg/kg twice daily resulted in a signif-icant reduction in tumor growth (57% inhibition, P¼ 5.0E�03),compared with vehicle control. Combination of fulvestrant withAZD5363 resulted in almost complete inhibitionof tumor growth(80% inhibition P < 1E�05) compared with vehicle control. Thecombination dosing was significantly more active than AZD5363and fulvestrant monotherapy groups (P ¼ 3.75E�03 and6.3E�04, respectively; Fig. 5A). After 90 days of treatment, thetherapieswerewithdrawnand tumor volumeassessed to establishthe efficacy of the combination in delaying tumor progression.Removal of AZD5363 showed a dramatic rise in tumor volume asearly as 10 days after withdrawal (Fig. 5B), while the combinationof AZD5363 plus fulvestrant showed sustained antitumor effecteven after 50 days after cessation of treatment.

To assess dynamic changes in the PI3K/AKT/mTOR, ER,apoptotic, and cell-cycle pathways, a second xenograft exper-iment was carried out to study tumor pharmacodynamics.HBCx22OvaR were treated for 4 days with the combinationsindicated and samples resected 2 and 4 hours after dosing ofAZD5363. As expected, Western blot analysis showed signifi-cant increases in pAKT (S473) and pAKT (T308) and decreasesin pPRAS40 in response to AZD5363. Two hours after treat-ment with AZD5363 showed a significant rise in PGR expres-sion compared with vehicle control and was negated by theaddition of fulvestrant (Fig. 5C).

To assess the effect of AZD5363 on ER-mediated transcription,we used Fluidigm analysis of several ER-dependent target genes(Fig. 5D). Fulvestrant caused a significant reduction in expressionof the majority of the genes selected while AZD5363 showed a

Ribas et al.





0

1

2

3

4

ERE

luci

fera

seac

�vity

fold

chan

ge

T47D

0123456

ERE

luci

fera

seac

�vity

fold

chan

ge

MCF7

00.5

11.5

22.5

33.5

ERE

luci

fera

seac

�vity

fold

cha

nge

MCF7 LTED

**

***

****

**

****

**0

0.2

0.4

0.6

0.8

1

1.2

ERE

luci

fera

seac

�vity

fold

chan

ge

TamR

***

*

* *02468

1012

ERE

luci

fera

seac

�vity

fold

chan

ge

ZR75B

A

**

AZD5363 (1,000 nmol/L)

Fulvestrant (1 nmol/L)

4-OHT (10 nmol/L)

+---

-+--

++--

-++-

+++-

-+-+

++-+

----

E2 (0.01 nmol/L)

+---

-+--

++--

-++-

+++-

-+-+

++-+

----

+---

-+--

++--

-++-

+++-

-+-+

++-+

----

AZD5363 (1,000 nmol/L)

Fulvestrant (10 nmol/L)4-OHT (10 nmol/L)

---

+--

++-

--+

+-+

-+-

AZD5363 (1,000 nmol/L)

Fulvestrant (1 nmol/L)

4-OHT (10 nmol/L)

+---

-+--

++--

-++-

+++-

-+-+

++-+

----

E2 (0.01 nmol/L)

AZD5363 (1,000 nmol/L)

E2 (0.01 nmol/L)

4-OHT (10 nmol/L)Fulvestrant (1 nmol/L)

----

+---

-+--

++--

-++-

+++-

-+-+

++-+

----

+---

-+--

++--

-++-

+++-

-+-+

++-+

----

+---

-+--

++--

-++-

+++-

-+-+

++-+

----

+---

-+--

++--

-++-

+++-

-+-+

++-+

----

+---

-+--

++--

-++-

+++-

-+-+

++-+

----

+---

-+--

++--

-++-

+++-

-+-+

++-+

----

+---

--+-

+-+-

---+

+--+

p-ERBBB2

p-EGFR

EGFR

pERBB3

pERBB4

ERBB2

ERBB3

ERBB4

IGF-1R

IRS1

IRS2

Ac�n

MCF7 LTEDMCF7 T47D LTEDT47D ZR75 LTEDZR75 TamR

0102030405060

IgG AIB1 CBP ER IgG AIB1 CBP ER

DCC DCC+AZD5363

%of

inpu

t(TF

F1)

TFF1

0102030405060


DCC DCC+AZD5363

%of

inpu

t(G

REB1

)

GREB1C

**** **

***

**

0

10

20

30

40


DCC DCC+AZD5363

%of

inpu

t(Pg

R)

PGR

**

Figure 4.Effect of the combination of AZD5363 with E-deprivation (DCC), 4-OHT, or fulvestrant on RTK expression (A), ER-mediated transactivation (B), and recruitmentof the ER-transcriptional machinery to the TFF1, GREB1, and PGR promoters in response to AZD5363 in the absence of exogenous E2 (C). A, endocrine-resistantand -sensitive breast cancer cell lines were treated for 48 hours with the drug combinations indicated. Whole-cell extracts were assessed for expressionon RTK markers by immunoblotting. B, cell lines were cotransfected with EREIItkLuc and pCH110, and treated for 24 hours with the drug combinationsindicated. Luciferase activity was normalized by b-galactosidase from triplicate wells and fold changes expressed relative to the DCC control. C, MCF7-LTED cellswere treated for 24 hours in DCC in the presence or absence of AZD5363 and ER/CBP binding to TFF1, GREB1, and PgR assessed via chromatin immunoprecipitationstudies. Error bars, �SEM. � , P < 0.05; �� , P < 0.01; �� , P < 0.001.






trend towards an increase. The combination of fulvestrant plusAZD5363 negated this rise. Four hours after therapy, a signif-icant rise was shown in ER-regulated genes in response toAZD5363 monotherapy, and the addition of fulvestrant didnot suppress this effect with the exception of TFF1. Analysis ofCCND1 showed a decrease in response to fulvestrant and thecombination with AZD5363. However, 4 hours after treatmentshowed a rise in expression. In contrast, CCNG2, which blockscell-cycle entry and is negatively regulated by E-bound–ER andactivated PI3K (24, 25), was increased in all AZD5363 treat-ment groups, indicative of cell-cycle arrest. Furthermore,AZD5363 caused increases in CASP9 and BMF expressionindicating of a rise in apoptosis (Fig. 5D).

DiscussionActivation of PI3K/AKT/mTOR pathway has been shown to be

involved in endocrine resistance inbreast cancer,most notably via

interaction with ER (8, 10). Hence, AKT being a central mediatorwithin this pathway poses a rational therapeutic target in endo-crine resistant breast cancer. In support of this notion, we haveshown that suppression of AKT activity with the catalytic AKTinhibitor AZD5363 inhibited the growth of ERþ human breastcancer cells modeling acquired resistance to E deprivation andtamoxifen and prevented the emergence of hormone-indepen-dent cells in vivo.

The combination of AZD5363 with endocrine therapy showedthe greatest efficacy in both ERþ, endocrine-sensitive and -resis-tant cell lines,most notably those containing activatingmutationsin PIK3CA and/or loss of PTEN function (Fig. 1). In contrast,HCC1428, which are wild-type (wt) for both genes, were resistantto AKT inhibition (GI50 > 10000 nmol/L). The combination ofAZD5363 with fulvestrant provided the greatest combinationeffect, which was later confirmed in a PDX model. Nonetheless,the combination of AZD5363with an AIwas also highly effective.Moreover, ZR75-LTED and T47D-LTED, which have suppressed

Table 1. Top upregulated and downregulated canonical pathways after treatment with AZD5363 in MCF7-LTED and MCF7 cell lines in the absence of E2

A. MCF7-LTEDMCF7-LTED–upregulated pathways P MCF7-LTED–downregulated pathways P

EIF2 signaling 2.00E�07 Mitotic roles of Polo-like kinase 2.51E�11IGFI signaling 3.31E�04 Cell cycle: G2–M DNA damage checkpoint regulation 3.16E�11RAR activation 1.07E�03 Remodeling of epithelial adherens junctions 7.41E�10mTOR signaling 1.95E�03 ATM signaling 7.24E�09Diphthamide biosynthesis 4.37E�03 Hereditary breast cancer signaling 8.51E�09Endometrial cancer signaling 1.48E�02 Role of CHK proteins in cell-cycle checkpoint control 1.95E�08PTEN signaling 1.55E�02 Protein ubiquitination pathway 3.02E�08ErbB2–ErbB3 signaling 2.09E�02 GADD45 signaling 6.03E�08Insulin receptor signaling 2.57E�02 DNA damage–induced 14-3-3s signaling 6.03E�08Clathrin-mediated endocytosis signaling 2.63E�02 14-3-3–mediated signaling 8.13E�08Mouse embryonic stem cell pluripotency 3.09E�02 Cyclins and cell-cycle regulation 4.07E�07ERK5 signaling 3.24E�02 Role of BRCA1 in DNA damage response 4.79E�07Aryl hydrocarbon receptor signaling 3.39E�02 Sertoli cell–Sertoli cell junction signaling 1.70E�06Ketolysis 3.63E�02 Cell cycle control of chromosomal replication 2.19E�06HGF signaling 3.80E�02 Germ cell–Sertoli cell junction signaling 2.75E�06DNA methylation and transcriptional repression signaling 4.07E�02 Mismatch repair in Eukaryotes 3.72E�06Amyloid processing 4.37E�02 Estrogen-mediated S-phase entry 8.13E�06Calcium transport I 4.47E�02 Breast cancer regulation by Stathmin1 2.69E�05Growth hormone signaling 4.79E�02 Epithelial adherens junction signaling 4.07E�05ILK signaling 4.90E�02 Glycolysis I 4.27E�05

B. MCF7MCF7-upregulated pathways P MCF7-downregulated pathways PHypoxia signaling in the cardiovascular system 1.26E�06 Mitotic roles of Polo-like kinase 2.88E�07Protein ubiquitination pathway 4.90E�06 Cell cycle: G2–M DNA damage checkpoint regulation 7.94E�07EIF2 signaling 3.39E�05 Cell-cycle control of chromosomal replication 4.07E�06Aryl hydrocarbon receptor signaling 1.29E�04 Role of CHK proteins in cell cycle checkpoint control 5.25E�06IGFI signaling 5.37E�04 GADD45 signaling 7.08E�06ERK5 signaling 1.05E�03 Estrogen-mediated S-phase entry 8.91E�06ILK signaling 1.20E�03 Mismatch repair in eukaryotes 1.41E�05Molecular mechanisms of cancer 1.35E�03 ATM signaling 1.41E�05Integrin signaling 1.51E�03 Remodeling of epithelial adherens junctions 1.62E�05NGF signaling 1.78E�03 Role of BRCA1 in DNA damage response 1.78E�05p53 signaling 1.86E�03 Sertoli cell–Sertoli cell junction signaling 6.92E�05Regulation of eIF4 and p70S6K signaling 2.00E�03 Hereditary breast cancer signaling 2.69E�04Neurotrophin/TRK signaling 2.19E�03 Cholesterol biosynthesis I 3.09E�04Estrogen receptor signaling 2.34E�03 Cholesterol biosynthesis II (via 24, 25-dihydrolanosterol) 3.09E�04PDGF signaling 2.88E�03 Cholesterol biosynthesis III (via desmosterol) 3.09E�04Renal cell carcinoma signaling 2.88E�03 Breast cancer regulation by Stathmin1 3.80E�04Colanic acid building blocks biosynthesis 3.55E�03 Cyclins and cell-cycle regulation 4.37E�04ErbB2–ErbB3 signaling 4.27E�03 DNA damage-induced 14-3-3s signaling 5.13E�04VEGF signaling 4.37E�03 Germ cell–Sertoli cell junction signaling 7.41E�04RAR activation 5.25E�03 Superpathway of cholesterol biosynthesis 1.07E�03NOTE: MCF7-LTED and MCF7 cells were treated in the presence or absence of AZD5363 for 24 hours, and RNA was submitted to microarray analysis.

Ribas et al.





pAKT

(S47

3)

pAKT

(T308

)

pPRA

S40(T

246)

PGR

p4EB

P1(T3

7/46)

0100200300400500600700800900

1,0001,1001,2001,300

Bio

mar

ker s

igna

l (%

con

trol

)

Vehicle 4 hFulvestrant 4 h

AZD5363 2 hAZD5363 4 h

AZD5363 + fulvestrant 2 h

AZD5363 + fulvestrant 4 h

02468

101214161820

90 100 110 120 130 140 15080706050403020100 90 100 110 120 130 140 15080706050403020100

Rel

ativ

e tu

mor

vol

ume

Rel

ativ

e tu

mor

vol

ume

Days after start of treatment


AZD5363stop

02468

101214161820

Rel

ativ

e tu

mor

vol

ume


AZD5363 + fulvestrant

stop

A

DC

B

ER-dependent transcrip�on

Apopto�c/cell-cycle-relatedtranscrip�on

Fulv4 h

AZD53632 h

AZD5363+fulv2 h

AZD53634 h

AZD5363+fulv4 h

CXCL12C3

TFF1MYBL1GREB1IGF1RPGR

SPRY1ZEB1

GATA3MUC1

LAMB2ESR1RETTFF3AQP3AREG

Fulv4 h

AZD53632 h

AZD5363+fulv2 h

AZD53634 h

AZD5363+fulv4 h

CCND1

CASP9

CCNG2

BMF

**

**

***

**

*

Control (vehicle)Ovariectomy (vehicle)Fulvestrant

AZD5363 + fulvestrantAZD5363

Figure 5.Effect of AZD5363 alone or in combination with fulvestrant on biomarker changes and tumor progression in HBCx22OvaR. Long-term study assessing changes intumor volume over 90 days of treatment (A) and assessment of tumor volume after drug withdrawal (B). Pharmacodynamic study performed for 4 days wasconducted to assess biomarker changes in protein expression of pertinent targets (C)within the PI3K/AKT/mTORpathway andER signaling viameasurement of PgRexpression by semiquantitative Western blotting and mRNA analysis of ER-regulated, cell cycle, and apoptosis target genes using Fluidigm heatmap showsLog2 expression of samples extracted 2 and 4 hours after final administration of AZD5363 (D). Bars, �SEM. � , P < 0.05; �� , P < 0.01; �� , P < 0.001.






expression of ER comparedwith their parental cells, were themostsensitive to the antiproliferative effects of single-agent AZD5363,with GI50 values less than 100 nmol/L. It is noteworthy, thatPIK3CA mutation may not be the only governing feature ofsensitivity to AKT inhibition. For instance, both MCF7 andT47D cells and their derivatives express mutant PIK3CA andwt-PTEN, yet T47Dwere at least 2-foldmore sensitive thanMCF7,and this is most pronounced when comparing T47D-LTED withMCF7-LTED, where there is a 5-fold difference in sensitivity.Furthermore, ZR75, which are wt-PIK3CA and PTEN null, are5-fold less sensitive than ZR75-LTED, suggesting that while muta-tion within the pathway may delineate sensitivity in some cir-cumstances, cell context remains a defining feature.

Treatment with AZD5363 reduced phosphorylation of 4EBP1,a downstream mediator of the mTOR pathway, and increasedphosphorylation of AKT itself. The latter has been shown to occurwith several ATP-competitive inhibitors of AKT, as a result of theprotein being maintained in a hyperphosphorylated but catalyt-ically inactive form (26). In all cell lines tested, AZD5363 causedcell-cycle arrest,most notably via suppression of phosphorylationof Rb and reduction in Cyclin D and in several cell lines thiswas associated with elevated apoptosis, most notably in theT47D-LTED. Furthermore, fluidigm analysis of our HBCx22OvaRPDX showed increased expression of CASP9 and BMF in responseto AZD5363. These data are in keeping with previous studies inwhich AKT-dependent phosphorylation of BAD suppresses apo-ptosis (27).

Previous studies have shown that AKT can phosphorylate ER atserine 167 in a ligand-independentmanner and is associatedwithresistance to endocrine therapy (10, 19); furthermore, elevatedAKT has been associated with an altered ER transcriptional pro-gram (13). In this current study, we provided further supportfor these observations and showed that inhibition of AKT inMCF7-LTED reduced recruitment of ER, AIB1, and CBP to EREs.Furthermore, the combination of endocrine therapy withAZD5363 suppressed ER-mediated transcription to a greaterextent than either agent alone. In contrast, however, althoughAZD5363 suppressed the proliferation of the TamR cell line andresensitized it to the antiproliferative effects of tamoxifen, littleimpact on ER-mediated transcription in the presence of 4-OHTwas evident compared with 4-OHT alone. One explanation forthis finding may be due to the high degree of redundancy in thesignal transduction pathways within the TamR cell line. We havepreviously shown that phosphorylation of ERser167 can occur viapAKT or pERK1/2/pp90rsk. This was confirmed in the currentstudy where AZD5363 had no impact on ERser167 phosphory-lation. It could be postulated, that continued signaling via thepERK1/2 pathway may, in the long-term, negate the initial anti-proliferative effect of AZD5363 in this setting. Previous studieshave shown that targeting a single protein in a complex pathwaycan cause feedback loops resulting in increased ER-mediatedtranscription (28). Here, we assessed expression of several ER-mediated target genes both in our cell linemodels and in our PDXin response to AZD5363. Increased expression of ER-target genesappeared context specific and time dependent. One explanationfor these contrasting observations is the nature of the cross-talkbetween ER and AKT. For instance, increased AKT signaling maylead to ligand-independent ER activity in which the cell still relieson ER function for proliferation. Alternatively, increased AKT cansuppress ER expression circumventing the need for ER-driventranscription. In the latter setting, perturbation of AKT would

therefore increase ER-mediated transcription. Taken together,these data indicate that the combination of AZD5363 with aselective ER downregulator, such as fulvestrant, may alleviatethese potential ER-mediated feedback loops.

Studies have suggested that inhibition of kinases within thePI3K/mTOR/AKT pathway can lead to upregulation of severalRTKs impacting on their potential clinical utility (17, 29–31). Toaddress this, we assessed the impact of AZD5363 on expressionand phosphorylation of type I/II growth factor receptors.AZD5363 caused a cell-type–specific upregulation of variousRTKs, including IGFIR, EGFR, ERBB2, and ERBB3. It has beensuggested that altered expression of these RTKs may impede theeffectiveness of AZD5363 (17). To assess this further, we used aglobal gene expression approach to identify networks of genesthat were associated with response and resistance to AZD5363.The significantly downregulated canonical pathways, followingtreatment with AZD5363 were associated with cell-cycle progres-sion and metabolism, confirming our observation in both pro-liferation and protein assays. One of the most significantly upre-gulated pathways was EIF2 which was evident in both MCF7 andtheir LTED derivative. The PERK–eIF2aP pathway mediates sur-vival and facilitates adaptation to the deleterious effects of theinactivation of PI3K or AKT (32). The IGFI signaling pathway,which encompasses IGF1R, IRS2, and FOXO3 was also signifi-cantly upregulated. Previous studies have shown that upregula-tion of IGFIR maintains PI3K activity and PIP3 formation, tocounteract the inhibition of AKT which could potentially reducethe potency of AZD5363, via a FOXO-dependent transcriptionalmechanism (17).

RAR signaling was also associated with inhibition of AKTactivity. RAR transactivation is suppressed by phosphorylationvia AKT (33). Of note, RAR-a is required for efficient ER-mediated transcription and cell proliferation (34). Assessmentof the effect of AZD5363 on ER-mediated transactivation usingan artificial reporter construct showed suppression of transac-tivation. However, assessment of transcript levels of severalendogenous E2-regulated genes particularly in the T47D andTamR cell line as well as in our PDX model showed increases inTFF1 and GREB1 expression, in keeping with previous studieswith a dual mTOR/PI3K inhibitor (35). Of note, assessment ofgenes within the RAR signaling pathways showed increases inexpression of CDK7, which has previously been shown tophosphorylate and activate both ER (36) and RARa (37).Furthermore, high intratumoral RARa protein levels correlatewith reduced relapse-free survival in ERþ patients treatedwith neoadjuvant tamoxifen (38). Taken together, activationof RAR as a result of AKT inhibition may potentiate ER activityin certain settings.

ERK5 signaling pathway was significantly upregulated inresponse to AZD5363. ERK5, similar to ERK1/2, regulates EGF-induced cell proliferation, and is known to cross-talk with ERBB2and PDGFR. Both pathways were also elevated in response toAZD5363. ERK5 is also capable of phosphorylating the ERK1/2substrates MYC and AP1 (39). Moreover, ILK, HIF1, and VEGFpathways were upregulated in response to AKT inhibition. Pre-vious studies have shown that b-parvin, which is lost inmetastaticbreast cancer (40), leads to an upregulation of ILK/AKT–mediatedsignaling resulting in increased HIF1a and VEGF (41). BothHIF1a and VEGF contain internal ribosome entry sites (IRES),located in their 50 UTRs, allowing cap-independent translation,bypassing the requirement for mTOR/4EBP1 signaling (42). This


Ribas et al.




may provide a survival mechanism in response to chronic treat-ment with AZD5363. Of particular interest, MYC expression wasidentified as a potential driver in six of the upregulated pathwaysin response to AZD5363. MYC activity has been shown to abro-gate response to mTOR inhibition in prostate cancer via itsinteraction and upregulation of 4EBP1 (43). Notably, 4EBP1expression did not change in response to AZD5363 in our PDXmodel.

Overall, the transcriptional profiling revealed multiplemechanisms of compensation to AKT inhibition, highlightingthe complex interplay between ER and signal transduction path-ways. This global gene expression analysis did, however, use onlyone cell line model and its LTED counterpart.

In conclusion, the results provide mechanistic evidence for thecombination of AZD5363 and endocrine therapy to delay theonset of resistance, as well as resensitize endocrine-resistanttumors to the antiproliferative effects of endocrine therapy. Mostnotably the combination of AZD5363 with fulvestrant, suppres-sing both the ER and AKT signaling axes appeared superior toeither agent alone. The current study also highlights potentialroutes of escape via RTK, RAR, ERK5, MYC, and PERK–eIF2aPsignaling, that merit investigation for further improvements intreatment efficacy.

Disclosure of Potential Conflicts of InterestS. Johnston is a consultant/advisory board member for AstraZeneca. B.R.

Davies hasownership interest as a shareholderatAstraZeneca.M.Dowsett reportsreceiving a commercial researchgrant fromAstraZeneca andhas received speakersbureau honoraria from AstraZeneca. No potential conflicts of interest weredisclosed by the other authors.

Authors' ContributionsConception and design: S. Johnston, B.R. Davies, M. Dowsett, L.-A. MartinDevelopment ofmethodology: R. Ribas, S. Pancholi, S.K. Guest, E. Marangoni,N. Simigdala, L.-A. MartinAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): S. Pancholi, S.K. Guest, E. Marangoni, A. Thuleau,U.M. Polanska, H. Campbell, G. Liccardi, L.-A. MartinAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): R. Ribas, S. Pancholi, S.K. Guest, E. Marangoni,Q. Gao, A. Thuleau, N. Simigdala, U.M. Polanska, H. Campbell, A. Rani,G. Liccardi, B.R. Davies, M. Dowsett, L.-A. MartinWriting, review, and/or revision of the manuscript: R. Ribas, S. Pancholi,S.K. Guest, E. Marangoni, Q. Gao, U.M. Polanska, H. Campbell, G. Liccardi,S. Johnston, B.R. Davies, M. Dowsett, L.-A. MartinAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): R. Ribas, S. Pancholi, S.K. Guest, A. Thuleau,A. Rani, L.-A. MartinStudy supervision: M. Dowsett, L.-A. Martin

Grant SupportThis study was supported by the Mary-Jean Mitchell Green Foundation,

Breakthrough Breast Cancer funding to M. Dowsett and L.A. Martin and TheAstraZeneca Global Alliance to L.A. Martin, M. Dowsett, and S. Johnston.The authors also acknowledge NHS funding to the Royal Marsden Hospi-tal's NIHR Biomedical Research Centre received by M. Dowsett andS. Johnston.

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received February 13, 2015; revised June 18, 2015; accepted June 18, 2015;published OnlineFirst June 26, 2015.

References1. Dowsett M, Howell A. Breast cancer: aromatase inhibitors take on tamox-

ifen. Nat Med 2002;8:1341–4.2. ShawRJ, Cantley LC. Ras, PI(3)K andmTOR signalling controls tumour cell

growth. Nature 2006;441:424–30.3. Shoman N, Klassen S, McFadden A, Bickis MG, Torlakovic E, Chibbar R.

Reduced PTEN expression predicts relapse in patients with breast carcino-ma treated by tamoxifen. Mod Pathol 2005;18:250–9.

4. Clark AS, West K, Streicher S, Dennis PA. Constitutive and inducible Aktactivity promotes resistance to chemotherapy, trastuzumab, or tamoxifenin breast cancer cells. Mol Cancer Ther 2002;1:707–17.

5. Yu K, Toral-Barza L, Discafani C, Zhang WG, Skotnicki J, Frost P, et al.mTOR, a novel target in breast cancer: the effect of CCI-779, an mTORinhibitor, in preclinical models of breast cancer. Endocr Relat Cancer2001;8:249–58.

6. Saal LH, Holm K, Maurer M, Memeo L, Su T, Wang X, et al. PIK3CAmutations correlate with hormone receptors, node metastasis, and ERBB2,and are mutually exclusive with PTEN loss in human breast carcinoma.Cancer Res 2005;65:2554–9.

7. Simoncini T, Hafezi-Moghadam A, Brazil DP, Ley K, Chin WW, Liao JK.Interaction of oestrogen receptor with the regulatory subunit of phospha-tidylinositol-3-OH kinase. Nature 2000;407:538–41.

8. Miller TW, Hennessy BT, Gonzalez-Angulo AM, Fox EM,Mills GB, ChenH,et al. Hyperactivation of phosphatidylinositol-3 kinase promotes escapefrom hormone dependence in estrogen receptor-positive human breastcancer. J Clin Invest 2010;120:2406–13.

9. Chen D, Washbrook E, Sarwar N, Bates GJ, Pace PE, Thirunuvakkarasu V,et al. Phosphorylation of human estrogen receptor alpha at serine 118 bytwo distinct signal transduction pathways revealed by phosphorylation-specific antisera. Oncogene 2002;21:4921–31.

10. Campbell RA, Bhat-Nakshatri P, Patel NM, Constantinidou D, Ali S,Nakshatri H. Phosphatidylinositol 3-kinase/AKT-mediated activation ofestrogen receptor alpha: a new model for anti-estrogen resistance. J BiolChem 2001;276:9817–24.

11. Kato S, Endoh H, Masuhiro Y, Kitamoto T, Uchiyama S, Sasaki H, et al.Activation of the estrogen receptor through phosphorylation by mitogen-activated protein kinase. Science 1995;270:1491–4.

12. Smith CL. Cross-talk between peptide growth factor and estrogen receptorsignaling pathways. Biol Reprod 1998;58:627–32.

13. Bhat-Nakshatri P,Wang G, Appaiah H, LuktukeN, Carroll JS, Geistlinger TR,et al. AKT alters genome-wide estrogen receptor alpha binding and impactsestrogen signaling in breast cancer. Mol Cell Biol 2008;28:7487–503.

14. O'Reilly KE, Rojo F, She QB, Solit D, Mills GB, Smith D, et al. mTORinhibition induces upstream receptor tyrosine kinase signaling and acti-vates Akt. Cancer Res 2006;66:1500–8.

15. Sun SY, Rosenberg LM,Wang X, ZhouZ, Yue P, FuH, et al. Activation of Aktand eIF4E survival pathways by rapamycin-mediatedmammalian target ofrapamycin inhibition. Cancer Res 2005;65:7052–8.

16. Davies BR, Greenwood H, Dudley P, Crafter C, Yu DH, Zhang J, et al.Preclinical pharmacology of AZD5363, an inhibitor of AKT: pharmaco-dynamics, antitumor activity, and correlationofmonotherapy activitywithgenetic background. Mol Cancer Ther 2012;11:873–87.

17. Fox EM, Kuba MG, Miller TW, Davies BR, Arteaga CL. Autocrine IGF-I/insulin receptor axis compensates for inhibition of AKT in ER-positivebreast cancer cellswith resistance to estrogendeprivation. BreastCancer Res2013;15:R55.

18. Martin LA, Farmer I, Johnston SR, Ali S, Marshall C, Dowsett M. Enhancedestrogen receptor (ER) alpha, ERBB2, and MAPK signal transductionpathways operate during the adaptation of MCF-7 cells to long termestrogen deprivation. J Biol Chem 2003;278:30458–68.

19. Pancholi S, Lykkesfeldt AE, Hilmi C, Banerjee S, Leary A, Drury S, et al.ERBB2 influences the subcellular localization of the estrogen receptor intamoxifen-resistant MCF-7 cells leading to the activation of AKT andRPS6KA2. Endocr Relat Cancer 2008;15:985–1002.

20. Banerjee S, Zvelebil M, Furet P, Mueller-Vieira U, Evans DB, Dowsett M,et al. The vascular endothelial growth factor receptor inhibitor PTK787/ZK222584 inhibits aromatase. Cancer Res 2009;69:4716–23.






21. Chou TC, Talalay P. Quantitative analysis of dose-effect relationships: thecombined effects of multiple drugs or enzyme inhibitors. Adv EnzymeRegul 1984;22:27–55.

22. Cottu P, Bieche I, Assayag F, El Botty R, Chateau-Joubert S, Thuleau A, et al.Acquired resistance to endocrine treatments is associated with tumor-specific molecular changes in patient-derived luminal breast cancer xeno-grafts. Clin Cancer Res 2014;20:4314–25.

23. Ali S, Coombes RC. Endocrine-responsive breast cancer and strategies forcombating resistance. Nat Rev Cancer 2002;2:101–12.

24. Stossi F, Likhite VS, Katzenellenbogen JA, Katzenellenbogen BS. Estrogen-occupied estrogen receptor represses cyclin G2 gene expression and recruitsa repressor complex at the cyclin G2 promoter. J Biol Chem 2006;281:16272–8.

25. Martinez-Gac L, Alvarez B, Garcia Z, Marques M, Arrizabalaga M, CarreraAC. Phosphoinositide 3-kinase and Forkhead, a switch for cell division.Biochem Soc Trans 2004;32:360–1.

26. Okuzumi T, Fiedler D, Zhang C, Gray DC, Aizenstein B, Hoffman R, et al.Inhibitor hijacking of Akt activation. Nat Chem Biol 2009;5:484–93.

27. Zha J, Harada H, Yang E, Jockel J, Korsmeyer SJ. Serine phosphorylation ofdeath agonist BAD in response to survival factor results inbinding to 14-3-3not BCL-X(L). Cell 1996;87:619–28.

28. Bosch A, Li Z, Bergamaschi A, Ellis H, Toska E, Prat A, et al. PI3K inhibitionresults in enhanced estrogen receptor function and dependence in hor-mone receptor-positive breast cancer. Sci Transl Med 2015;7:283ra51.

29. Chakrabarty A, Sanchez V, Kuba MG, Rinehart C, Arteaga CL. Feedbackupregulation of HER3 (ErbB3) expression and activity attenuates antitu-mor effect of PI3K inhibitors. Proc Natl Acad Sci U S A 2012;109:2718–23.

30. Chandarlapaty S, Sawai A, Scaltriti M, Rodrik-Outmezguine V, Grbovic-Huezo O, Serra V, et al. AKT inhibition relieves feedback suppression ofreceptor tyrosine kinase expression and activity. Cancer Cell 2011;19:58–71.

31. Rodrik-Outmezguine VS, Chandarlapaty S, Pagano NC, Poulikakos PI,Scaltriti M, Moskatel E, et al. mTOR kinase inhibition causes feedback-dependent biphasic regulation of AKT signaling. Cancer Discov 2011;1:248–59.

32. Mounir Z, Krishnamoorthy JL, Wang S, Papadopoulou B, Campbell S,Muller WJ, et al. Akt determines cell fate through inhibition of the PERK-eIF2alpha phosphorylation pathway. Sci Signal 2011;4:ra62.

33. Srinivas H, Xia D, Moore NL, Uray IP, Kim H, Ma L, et al. Akt phosphor-ylates and suppresses the transactivation of retinoic acid receptor alpha.Biochem J 2006;395:653–62.

34. Ross-Innes CS, Stark R, Holmes KA, Schmidt D, Spyrou C, Russell R, et al.Cooperative interaction between retinoic acid receptor-alpha and estrogenreceptor in breast cancer. Genes Dev 2010;24:171–82.

35. Creighton CJ, Fu X, Hennessy BT, Casa AJ, Zhang Y, Gonzalez-Angulo AM,et al. Proteomic and transcriptomic profiling reveals a link between thePI3K pathway and lower estrogen-receptor (ER) levels and activity in ERþbreast cancer. Breast Cancer Res 2010;12:R40.

36. Chen D, Riedl T, Washbrook E, Pace PE, Coombes RC, Egly JM, et al.Activation of estrogen receptor alpha by S118 phosphorylation involves aligand-dependent interaction with TFIIH and participation of CDK7. MolCell 2000;6:127–37.

37. Bour G, Gaillard E, Bruck N, Lalevee S, Plassat JL, Busso D, et al. Cyclin Hbinding to the RARalpha activation function (AF)-2 domain directs phos-phorylation of the AF-1 domain by cyclin-dependent kinase 7. Proc NatlAcad Sci U S A 2005;102:16608–13.

38. Johansson HJ, Sanchez BC, Mundt F, Forshed J, Kovacs A, Panizza E, et al.Retinoic acid receptor alpha is associated with tamoxifen resistance inbreast cancer. Nat Commun 2013;4:2175.

39. Nishimoto S,Nishida E.MAPK signalling: ERK5 versus ERK1/2. EMBORep2006;7:782–6.

40. Mongroo PS, Johnstone CN, Naruszewicz I, Leung-Hagesteijn C, Sung RK,Carnio L, et al. Beta-parvin inhibits integrin-linked kinase signaling and isdownregulated in breast cancer. Oncogene 2004;23:8959–70.

41. Kimura M, Murakami T, Kizaka-Kondoh S, Itoh M, Yamamoto K, Hojo Y,et al. Functional molecular imaging of ILK-mediated Akt/PKB signalingcascades and the associated role of beta-parvin. JCell Sci 2010;123:747–55.

42. Morfoisse F, KuchnioA, FrainayC,Gomez-Brouchet A,DelisleMB,Marzi S,et al. Hypoxia induces VEGF-C expression in metastatic tumor cells viaa HIF-1alpha-independent translation-mediated mechanism. Cell Rep2014;6:155–67.

43. Balakumaran BS, Porrello A, Hsu DS, Glover W, Foye A, Leung JY, et al.MYC activity mitigates response to rapamycin in prostate cancer througheukaryotic initiation factor 4E-binding protein 1-mediated inhibition ofautophagy. Cancer Res 2009;69:7803–10.


Ribas et al.




2015;14:2035-2048. Published OnlineFirst June 26, 2015.Mol Cancer Ther Ricardo Ribas, Sunil Pancholi, Stephanie K. Guest, et al.

In VivoFulvestrant (ICI182780) Endocrine-Resistant Breast Cancer and Synergizes with AKT Antagonist AZD5363 Influences Estrogen Receptor Function in

Updated version

10.1158/1535-7163.MCT-15-0143doi:

Access the most recent version of this article at:

Material

Supplementary

http://mct.aacrjournals.org/content/suppl/2015/06/25/1535-7163.MCT-15-0143.DC1

Access the most recent supplemental material at:

Cited articles

http://mct.aacrjournals.org/content/14/9/2035.full#ref-list-1

This article cites 43 articles, 25 of which you can access for free at:

Citing articles

http://mct.aacrjournals.org/content/14/9/2035.full#related-urls

This article has been cited by 6 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mct.aacrjournals.org/content/14/9/2035To request permission to re-use all or part of this article, use this link



http://mct.aacrjournals.org/lookup/doi/10.1158/1535-7163.MCT-15-0143http://mct.aacrjournals.org/content/suppl/2015/06/25/1535-7163.MCT-15-0143.DC1http://mct.aacrjournals.org/content/14/9/2035.full#ref-list-1http://mct.aacrjournals.org/content/14/9/2035.full#related-urlshttp://mct.aacrjournals.org/cgi/alertsmailto:[email protected]://mct.aacrjournals.org/content/14/9/2035http://mct.aacrjournals.org/

/ColorImageDict > /JPEG2000ColorACSImageDict > /JPEG2000ColorImageDict > /AntiAliasGrayImages false /CropGrayImages false /GrayImageMinResolution 200 /GrayImageMinResolutionPolicy /Warning /DownsampleGrayImages true /GrayImageDownsampleType /Bicubic /GrayImageResolution 300 /GrayImageDepth -1 /GrayImageMinDownsampleDepth 2 /GrayImageDownsampleThreshold 1.50000 /EncodeGrayImages true /GrayImageFilter /DCTEncode /AutoFilterGrayImages true /GrayImageAutoFilterStrategy /JPEG /GrayACSImageDict > /GrayImageDict > /JPEG2000GrayACSImageDict > /JPEG2000GrayImageDict > /AntiAliasMonoImages false /CropMonoImages false /MonoImageMinResolution 600 /MonoImageMinResolutionPolicy /Warning /DownsampleMonoImages true /MonoImageDownsampleType /Bicubic /MonoImageResolution 900 /MonoImageDepth -1 /MonoImageDownsampleThreshold 1.50000 /EncodeMonoImages true /MonoImageFilter /CCITTFaxEncode /MonoImageDict > /AllowPSXObjects false /CheckCompliance [ /None ] /PDFX1aCheck false /PDFX3Check false /PDFXCompliantPDFOnly false /PDFXNoTrimBoxError true /PDFXTrimBoxToMediaBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXSetBleedBoxToMediaBox true /PDFXBleedBoxToTrimBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXOutputIntentProfile (None) /PDFXOutputConditionIdentifier () /PDFXOutputCondition () /PDFXRegistryName () /PDFXTrapped /False

/CreateJDFFile false /Description > /Namespace [ (Adobe) (Common) (1.0) ] /OtherNamespaces [ > /FormElements false /GenerateStructure false /IncludeBookmarks false /IncludeHyperlinks false /IncludeInteractive false /IncludeLayers false /IncludeProfiles false /MarksOffset 18 /MarksWeight 0.250000 /MultimediaHandling /UseObjectSettings /Namespace [ (Adobe) (CreativeSuite) (2.0) ] /PDFXOutputIntentProfileSelector /NA /PageMarksFile /RomanDefault /PreserveEditing true /UntaggedCMYKHandling /LeaveUntagged /UntaggedRGBHandling /LeaveUntagged /UseDocumentBleed false >> > ]>> setdistillerparams> setpagedevice

Date post:	02-Feb-2021
Category:	Documents
Upload:	others
View:	0 times
Download:	0 times

AKT Antagonist AZD5363 Inﬂuences Estrogen Receptor ......R. Ribas, S. Pancholi, and S.K. Guest...

Documents