Molecular Cell

Article

Alternative Capture of Noncoding RNAsor Protein-Coding Genes by Herpesvirusesto Alter Host T Cell FunctionYang Eric Guo,1 Kasandra J. Riley,2,5 Akiko Iwasaki,3,4 and Joan A. Steitz2,4,*1Department of Cell Biology2Department of Molecular Biophysics and Biochemistry3Department of Immunobiology4Howard Hughes Medical Institute

Yale University School of Medicine, New Haven, CT 06536, USA5Present address: Department of Chemistry, Rollins College, Winter Park, FL 32789, USA

*Correspondence: joan.steitz@yale.eduhttp://dx.doi.org/10.1016/j.molcel.2014.03.025

SUMMARY

In marmoset T cells transformed by Herpesvirussaimiri (HVS), a viral U-rich noncoding (nc) RNA,HSUR 1, specifically mediates degradation of hostmicroRNA-27 (miR-27). High-throughput sequencingof RNA after crosslinking immunoprecipitation(HITS-CLIP) identified mRNAs targeted by miR-27as enriched in the T cell receptor (TCR) signalingpathway, including GRB2. Accordingly, transfectionof miR-27 into human T cells attenuates TCR-induced activation of mitogen-activated proteinkinases (MAPKs) and induction of CD69. MiR-27also robustly regulates SEMA7A and IFN-g, keymod-ulators and effectors of T cell function. Knockdownor ectopic expression of HSUR 1 alters levels of theseproteins in virally transformed cells. Two other T-lym-photropic g-herpesviruses, AlHV-1 and OvHV-2, donot produce a noncoding RNA to downregulatemiR-27 but instead encode homologs of miR-27target genes. Thus, oncogenic g-herpesviruseshave evolved diverse strategies to converge on com-mon targets in host T cells.

INTRODUCTION

g-herpesviruses establish latent infection in lymphocytes that

persists for the life of the host. Lymphocyte activation accom-

panies infection, and it is well known that activation of infected

lymphocytes requires expression of latent viral genes (Ensser

and Fleckenstein, 2005; Russell et al., 2009). Yet the mechanism

by which latent genes control T-lymphocyte activation is poorly

understood.

Herpesvirus saimiri (HVS) is an oncogenic g-herpesvirus that

belongs to the rhadinovirus family. HVS undergoes asymptom-

atic lytic replication in its natural host, the squirrel monkey (Sai-

miri sciureus), whereas latent infection progresses to acute

T cell lymphomas and leukemias in other New World primates,

such as the common marmoset (Callithrix jacchus) (Ensser and

Fleckenstein, 2005). HVS-transformed marmoset cells are pre-

dominantly activated CD8 cytotoxic T cells (Johnson and Jondal,

1981; Kiyotaki et al., 1986). HVS is also capable of transforming

human T cells in vitro (Ensser and Fleckenstein, 2005).

Noncoding (nc) RNAs play important roles in gene regulation.

Like their host cells, viruses sometimes produce ncRNAs to

modulate gene expression to benefit the viral life cycle or to

counteract host antiviral defense mechanisms (Skalsky and

Cullen, 2010; Steitz et al., 2011). The most abundant transcripts

in HVS-infected marmoset T cells are seven small U-rich

ncRNAs, known as HSURs, which share biogenesis and other

features with the cellular Sm class U-rich RNAs (Albrecht and

Fleckenstein, 1992; Lee et al., 1988; Wassarman et al., 1989).

Although HSURs are not required for in vitro transformation,

T cells transformed by an HVS strain lacking HSUR 1 and

HSUR 2 (D2A cells) grow significantly slower than cells trans-

formed by wild-type virus (WT cells) (Murthy et al., 1989).

MicroRNAs (miRNAs) are �22 nucleotide (nt) endogenous

ncRNAs that complex with Argonaute (Ago) proteins and form

base-pairing interactions with messenger RNA (mRNA) targets

to regulate protein production (Bartel, 2009). Cellular miR-27 is

a highly conserved vertebrate miRNA with several known

mRNA targets (summarized in Table S1, available online). MiR-

27 is ubiquitously expressed in many tissues and cell types.

However, T cells express the highest levels of miR-27 (Kuchen

et al., 2010), suggesting that miR-27 functions in regulating

T cell responses.

T cell receptor/CD3 complex (TCR) signaling is important for

proliferation, differentiation, and cell death during T cell develop-

ment; it also contributes to clonal expansion and effector cyto-

kine secretion during T cell activation (Murphy et al., 2008).

Ligand binding and crosslinking of the TCR activate the TCR

signaling pathway through adaptor proteins, such as the growth

factor receptor-bound protein 2 (GRB2), leading to the phos-

phorylation of mitogen-activated protein kinases (MAPKs)

(Jang et al., 2009). T cell activation induces many cell-surface

and secreted molecules, such as semaphorin 7A (SEMA7A)

and interferon-g (IFN-g), which are critical for T cell-mediated

Molecular Cell 54, 67–79, April 10, 2014 ª2014 Elsevier Inc. 67

Molecular Cell

Viruses Co-Opt ncRNA or Protein-Coding Genes

immune responses (Schroder et al., 2004; Suzuki et al., 2008).

IFN-g has been shown to block reactivation of a g-herpesvirus

from latency (Steed et al., 2006), and SEMA7A homologs are

found in the genomes of g-herpesviruses and poxviruses (Co-

meau et al., 1998; Russell et al., 2009). However, the general

importance of TCR signaling, SEMA7A, and IFN-g in the biology

of g-herpesviruses remains unclear.

In HVS-transformed marmoset T cells, the most conserved

HSUR, HSUR 1, base pairs with miR-27, targeting it for rapid

decay in a sequence-specific and binding-dependent manner

(Cazalla et al., 2010). However, the biological significance of

miR-27 downregulation remained unknown. Since genes that

are hallmarks of T cell activation are selectively upregulated by

HSUR 1 and/or HSUR 2 in HVS-infected marmoset T cells

(Cook et al., 2005) and constitutive activation of TCR signaling

molecules has been observed in HVS-transformed human

T cells (Noraz et al., 1998), we asked whether miR-27 might be

the missing link between HVS infection and T cell activation.

RESULTS

Identification of miR-27 TargetsTo identify miR-27 mRNA targets genome-wide in HVS-trans-

formed marmoset T cells, we performed high-throughput

sequencing of RNA after crosslinking immunoprecipitation

(HITS-CLIP) (Chi et al., 2009). We used D2A cells, which have

higher levels of miR-27 due to the lack of HSUR 1 (Cazalla

et al., 2010) and performed four replicates using two different

anti-Ago antibodies. Ago binding sites, composed of overlap-

ping Ago-bound mRNA fragments that contain 7-mer miR-27

seed (nt 2–8) binding sites, are referred to as miR-27-Ago clus-

ters. The Ago-bound mRNA fragments and miR-27 binding sites

were plotted relative to the centers of the miR-27-Ago clusters,

revealing that the peaks of the two distributions overlap at the

centers of the miR-27-Ago clusters (Figure 1A), as reported for

miRNA-mediated Ago footprints (Chi et al., 2009). UV crosslink-

ing-induced mutation sites (CIMSs) are generated during the

reverse transcription step in HITS-CLIP because of the cross-

linked amino-acid-RNA adduct. Analyses of statistically signifi-

cant (false discovery rate [FDR] < 0.001) CIMS revealed high

frequencies of miR-27 binding sites near deletions (Figure 1B),

evidence of in vivo Ago-mRNA interactions (Zhang and Darnell,

2011).

In total, we identified 67 statistically significant (p ( 0.05)

miR-27-Ago clusters with a minimum of 10 Ago-bound mRNA

fragments per cluster (peak height [PH] R 10) in at least three

replicates (biological complexity [BC] R 3) (Table S2). Of these,

51%mapped to the 30 UTRs and 27%mapped to the coding se-

quences (CDSs) of 58 annotated host mRNAs (Figure 1C). We

did not find any significant miR-27-Ago clusters that mapped

to the HVS genome (data not shown). To confirm the selectivity

of HITS-CLIP and whether our analysis might be erroneously de-

tecting abundant mRNAs, we plotted the PH of miR-27-Ago

clusters against the abundance of mRNA transcripts to which

these clusters mapped (Figure 1D); no correlation was observed,

indicating specific enrichment of miR-27 targets. Moreover, we

collectively validated HITS-CLIP-identified miR-27 targets using

an independent approach. Transcripts containing statistically

68 Molecular Cell 54, 67–79, April 10, 2014 ª2014 Elsevier Inc.

significant miR-27-Ago clusters showed expression changes

based on mRNA-Seq analysis after HSUR 1 knockdown or

miR-27 inhibition in HVS-infected T cells. Specifically, mRNA

levels of identified miR-27 targets were lower relative to nontar-

gets upon HSUR 1 knockdown in WT cells (Figure S1A) and

higher upon transfection of a locked nucleic acid (LNA) inhibitor

of miR-27 in D2A cells (Figure S1B). These analyses indicate that

Ago HITS-CLIP identified high-quality miR-27 targets.

Gene Ontology Analyses Reveal that miR-27 RegulatesTCR Signaling and Downstream Effector CytokinesWe used Gene Ontology (GO) analyses to identify cellular path-

ways regulated by miR-27 in HVS-transformed T cells. A total of

58 unique mRNA targets containing statistically significant miR-

27-Ago clusters (p ( 0.05, BC R 3, and PH R 10) in their 50

UTRs, 30 UTRs, or CDSs were included in the query gene list;

all transcripts in D2A cells identified by mRNA-Seq with frag-

ments per kilobase of exon per million fragments mapped

(FPKM) R1 were used as background. Among the top ten en-

riched pathways, the TCR signaling pathway (Figure 2A),

including the PTPRC/CD45, PLCG1, PIK3CD, GRB2, and IFNG

genes, was the most highly enriched (p = 4.6 3 10�7) (Figures

S2A, S2B, and S3A–S3C). Comparable analyses demonstrated

that the TCR pathway or T cell-specific genes were not targeted

by a control miRNA, miR-30 (Figures S2C and S2D), which has

an unrelated seed sequence and is expressed at levels similar

to miR-27 (Figure S2E).

In addition to the HITS-CLIP-identified targets, many other

components of the TCR signaling pathway are predicted targets

with conserved miR-27 binding sites (Figure S2B). Ras and LCK,

two additional TCR signaling molecules (Figure S2B), are acti-

vated by HVS-encoded proteins (Ensser and Fleckenstein,

2005), underscoring the importance of this pathway to HVS. It

is interesting that T cell activation genes previously documented

as upregulated by HSUR 1 and/or HSUR 2 in HVS-transformed

T cell lines (Cook et al., 2005) do not have confirmed or predicted

miR-27 binding sites; they may be indirect targets, or their upre-

gulation may be due to other causes.

MiR-27 Represses T Cell ActivationTo test directly miR-27’s role in T cell activation, we compared

MAPK activation and CD69 induction in human Jurkat T cells

transiently transfected with synthetic miR-27 or a scrambled

control after TCR crosslinking by anti-CD3 antibody. Despite

relatively minor changes in TCR-induced total tyrosine phos-

phorylation (Figures S4A and S4B), miR-27 significantly

repressed activation of MAPKs. Activation of the p46 isoforms

of c-Jun N-terminal kinases (JNKs) was significantly weaker in

cells transfected with synthetic miR-27 relative to the scrambled

control 2 min poststimulation, when activation peaks (Figure 3A).

Similarly, p38 activation was attenuated in T cells transfected

with miR-27 at 2, 5, and 10 min after stimulation compared to

the control (Figure 3B). In contrast, the extent and kinetics of

activation of the extracellular signal-regulated kinase (ERK)

were similar in cells transfected with miR-27 versus the scram-

bled control (Figure S4C). Further, upregulation of CD69, a

cell-surface marker induced early upon T cell activation, was

decreased after TCR crosslinking of cells transfected with

A

D

B

C

Figure 1. Identification of miR-27 Targets by HITS-CLIP

(A) Distribution of Ago-boundmRNA fragments correlates with miR-27 seed (7-mer) binding sites. Ago-bound mRNA fragments andmiR-27 (7-mer) binding sites

were plotted relative to the centers (set to 0 nt) of 2279 miR-27-Ago clusters (PH R 2).

(B) Enrichment of miR-27 binding sites around Ago-mRNA crosslinking sites. MiR-27 7-mer seed binding sites were plotted relative to statistically significant

(FDR < 0.001) CIMS including deletion and insertion sites. Insertions are not induced by Ago-mRNA crosslinks (Zhang and Darnell, 2011), serving as a control.

(C) Genomic locations of the 67 statistically significant miR-27-Ago clusters (p value( 0.05, BCR 3, and PHR 10). 50 UTR/CDS indicates clusters mapping to

the junctions of 50 UTRs and CDSs. 30 UTR/CDS clusters mapped to the junctions of 30 UTRs and CDSs.

(D) Peak height (PH) values for miR-27-Ago clusters were plotted against transcript levels.

See also Figure S1.

Molecular Cell

Viruses Co-Opt ncRNA or Protein-Coding Genes

Molecular Cell 54, 67–79, April 10, 2014 ª2014 Elsevier Inc. 69

A

B C

Figure 2. MiR-27 Regulates TCR Signaling

Components and Effector Molecules of T

Cell Activation

(A) The TCR signaling pathway is significantly en-

riched among HITS-CLIP-identified miR-27 tar-

gets. Percent of miR-27 mRNA targets in each GO

pathway is indicated. FDR, false discovery rate.

(B) Genes containing the ten most robust miR-27-

Ago clusters in their 30 UTRs. *Genes of unknown

biological function. Genes studied further are

highlighted in red.

(C) Schematic depicting miR-27 as a repressor of

three key modulators or effectors of T cell activa-

tion, SEMA7A, GRB2, and IFN-g. Diagram drawn

based on (Suzuki et al., 2008). ? denotes a

possible interaction between SEMA7A and in-

tegrin (Liu et al., 2010). Images of IFN-g and TCR/

MHC/CD8 were adapted from David S. Goodsell

(RCSB PDB).

See also Figures S2 and S3.

Molecular Cell

Viruses Co-Opt ncRNA or Protein-Coding Genes

miR-27 relative to the scrambled control (Figure 3C). Together,

these results indicate that miR-27 is a pleiotropic repressor of

TCR-mediated activation.

Key Modulators and Effectors of T Cell Activation AreRegulated by HSUR 1 via miR-27Genes possessing the ten most robust miR-27-Ago clusters in

their 30 UTRs are shown in Figure 2B. Included are two transcrip-

tion factors associated with human leukemias—nuclear factor

(erythroid-derived 2)-like 2 (NRF2/NFE2L2) (Rushworth et al.,

2012) and AF4/FMR2 family member 4 (AFF4) (Lin et al., 2010)

(Figures S3D and S3E). Three targets—SEMA7A, GRB2, and

IFNG—were selected for validation because they are key regula-

tors or effectors of T cell activation (Jang et al., 2009; Schroder

et al., 2004; Suzuki et al., 2008) (Figure 2C). The two miR-27-

Ago clusters in the SEMA7A 30 UTR each contain a conserved

8-mer (nt 1–8) target site (Figures 4A and S5A); the GRB2

30 UTR possesses one miR-27-Ago cluster, with a conserved

8-mer (nt 1–8) target site (Figures 5A and S5B); and the miR-

27-Ago cluster in the IFNG 30 UTR corresponds to a 7-mer (nt

2–8) target site (Figure 5F).

Luciferase reporter assays using the full-length WT 30 UTRs ofSEMA7A, GRB2, and IFNG mRNAs showed repression after

transient transfection of synthetic miR-27, but not scrambled

miR-27, into HEK293T cells; mutations in the miR-27 binding

sites abolished the repression, whereas an Epstein-Barr virus

(EBV) miRNA BART-13, complementary to the mutated seed

binding sites, repressed the mutant reporters (Figures 4B, 5B,

and 5G). Synthetic miR-27 induced decreases of typical magni-

tude (Bartel, 2009) in endogenous SEMA7A and GRB2 protein

70 Molecular Cell 54, 67–79, April 10, 2014 ª2014 Elsevier Inc.

levels in Jurkat T cells compared to

scrambled miR-27 (Figures 4C and 5C).

Transfection of a miR-27 antisense LNA

into D2A cells increased levels of

SEMA7A and GRB2 protein relative to a

control LNA (Figures 4D and 5D). Impor-

tantly, RNase-H targeted knockdown of

HSUR 1 in WT cells using an antisense oligonucleotide (ASO)

increased miR-27 levels and decreased the levels of SEMA7A,

GRB2, and IFN-g proteins relative to an ASO against HSUR 2

or GFP (Figures 4E, 5E, and 5H).

Conversely, a lentiviral vector expressingWTHSUR1 (at levels

similar to those inWTcells [data not shown]), but not HSUR1with

itsmiR-27 binding sitemutated (MutHSUR1), decreasedmiR-27

levels inboth Jurkat andD2Acells (Figures6A–6D). Likewise, only

WT HSUR 1 increased levels of SEMA7A and GRB2 proteins in

lentiviral infected D2A cells (Figures 6E and 6F). IFN-g levels

were also tested but no difference observed, possibly because

lentiviral infection induces IFN-g, which masks any change due

to miR-27 degradation (data not shown). This rescue approach

is preferable to confirming the effects of HSUR1 by generating

multiple HVS-transformed cell lines; it eliminates the possibility

that secondary alterations acquiredby theWTorD2Acells during

propagation in culture could account for any gene expression dif-

ferences. Together, the HSUR 1 knockdown (Figures 4E, 5E, and

5H) and rescue (Figure 6) experiments argue that HVS upregu-

lates SEMA7A, GRB2, and IFN-g by producing HSUR1 to induce

miR-27 degradation.

Alternative Capture of miR-27 Targets by Other VirusesTo determine whether similar strategies are used by g-herpesvi-

ruses of other genera, we examined Herpesvirus ateles (HVA), a

rhadinovirus related to HVS, and two macaviruses, Alcelaphine

herpesvirus 1 (AlHV-1) and Ovine herpesvirus 2 (OvHV-2). Like

the rhadinoviruses, the macaviruses AlHV-1 and OvHV-2

cause apathogenic infections in their natural hosts (wildebeest

and sheep, respectively), but in related ruminants cause a fatal

A

Scrambled miR-270 1 2 5 10 30 0 1 2 5 10 30 min

p38

P-p38

P-p38

0 10 20 300

1

2

3

4

Time (min)

Re

lativ

e Q

ua

ntit

y

ScrambledmiR-27

*

***

P-JNK (p46)

0 10 20 300

10

20

30

Time (min)

Re

lativ

e Q

ua

ntit

y

ScrambledmiR-27

*

P-JNK

JNK

p54

p46

p54

p46

Scrambled miR-270 1 2 5 10 30 0 1 2 5 10 30 min

100 101 102 103 1040

20

40

60

80

100

Non ScrambledNon miR-27Act ScrambledAct miR-27

CD69 expression

Cel

l cou

nt (

% o

f max

)

Scram

bled

miR

-27

0

50

100

150

200

250

CD

69 e

xpre

ssio

n (M

FI) Non-Activated

Activated

p = 0.004

B

C

Figure 3. MiR-27 Attenuates Activation of

JNKs and p38, as well as Induction of CD69

(A) Jurkat T cells transfected with miR-27 or a

scrambled control were stimulated by anti-CD3

antibody for the indicated times. The JNK activa-

tion profile was determined by western blot anal-

ysis (WB) for phosphorylated JNKs (P-JNK) and

total JNKs (JNK). Relative quantity = (phosphory-

lated kinase signal intensity)/(total kinase signal

intensity). Nonstimulated sample (i.e., 0 min time

point) was set to 1. In repeat experiments, the p54

isoform of JNKs was only slightly activated, and no

significant difference in activation was observed

between miR-27 and the scrambled control (data

not shown).

(B) The p38 activation profile was determined as

described in (A).

(C) FACS data and histogram show CD69

expression in Jurkat cells transfected with miR-27

or the scrambled control with (Act) and without

(Non) activation by anti-CD3 and anti-CD28. MFI,

median fluorescence intensity.

Values are means ± SD in three experiments;

p values were determined by Student’s t test. *p <

0.05; **p < 0.01. See also Figure S4.

Molecular Cell

Viruses Co-Opt ncRNA or Protein-Coding Genes

T-lymphoproliferative disease called malignant catarrhal fever

(Ensser and Fleckenstein, 2005; Russell et al., 2009). All four of

these g-herpesviruses (highlighted in red in Figure 7B) establish

latency in host CD8 T cells, promoting constitutive activation

of TCR signaling molecules, clonal expansion, and expression

of activation markers, including high levels of IFN-g secretion

(Dewals and Vanderplasschen, 2011; Johnson and Jondal,

1981; Kiyotaki et al., 1986; Nelson et al., 2010; Noraz et al., 1998).

HVA encodes homologs of HSUR 1 and HSUR 2, called HAUR

1 and HAUR 2 (Figure 7A), with the miR-27 binding sites

conserved between HSUR 1 and HAUR 1 (Cazalla et al., 2010).

The macaviruses AlHV-1 and OvHV-2 do not appear to encode

HSUR homologs. Instead, in the syntenic region of their ge-

nomes, homologs of the host miR-27 target genes SEMA7A,

ATF3, and IL10 appear (Figure 7A). Although our HITS-CLIP

did not reveal miR-27-Ago clusters in the marmoset ATF3 or

IL10 30 UTRs (probably because of low mRNA expression),

both mRNAs are predicted miR-27 targets with conserved bind-

ing sites in their 30 UTRs (Figures S6A–S6C and S6E). The use of

diverse mechanisms by different g-herpesviruses to enhance

expression of the same genes underscores the importance of

these genes to the viral life cycle and T cell function.

DISCUSSION

Here we have addressed the question of why an oncogenic

g-herpesvirus HVS produces the ncRNA HSUR 1 to induce

Molecular Cell 54, 67

degradation of a conserved host miRNA,

miR-27. We have shown that miR-27 is

a pleiotropic repressor of T cell activation

that targets TCR signaling pathway com-

ponents and downstream effector cyto-

kines. These results provide a molecular

mechanism whereby the degradation of miR-27 by HSUR 1 con-

tributes to the constitutive activation of HVS-infected T cells.

The unexpected finding that we further present involves two

other oncogenic g-herpesviruses, the macaviruses AlHV-1 and

OvHV-2. These viruses, instead of making a ncRNA to degrade

miR-27, encode in the syntenic region viral homologs of miR-

27 target genes. Thus, our findings reveal that g-herpesviruses

evolved diverse mechanisms—host miRNA degradation or

acquisition of miRNA target genes—to regulate common targets

to ensure activation of virally transformed T cells.

A few miRNAs, such as miR-146a, miR-155, miR-17-92, and

miR-181a, have been shown to regulate genes important for

T cell development and function (Baumjohann and Ansel, 2013).

Here, we have shown that miR-27 regulates key modulators and

effectors of T cell activation, includingSEMA7A,GRB2, and IFN-g.

SEMA7A is a glycosylphosphatidylinositol (GPI)-anchored cell-

surface protein that is upregulated in activated lymphocytes and

plays important roles in T cell-mediated inflammatory responses

(Czopik et al., 2006; Suzuki et al., 2008). Both soluble and mem-

brane-associated forms of SEMA7A stimulate monocytes/mac-

rophages (Holmes et al., 2002; Suzuki et al., 2008). For cellular

SEMA7A, two receptors have been identified, PlexinC1 (Tamag-

none et al., 1999) and a1b1 integrin (Suzuki et al., 2008), although

the human SEMA7A X-ray crystal structure suggests that integrin

interacts indirectly (Liu et al., 2010). A viral SEMA7A homolog en-

coded by a poxvirus, Vaccinia virus (VACV) A39R, also stimulates

human monocytes and promotes secretion of proinflammatory

–79, April 10, 2014 ª2014 Elsevier Inc. 71

A

B C E

D

(legend on next page)

Molecular Cell

Viruses Co-Opt ncRNA or Protein-Coding Genes

72 Molecular Cell 54, 67–79, April 10, 2014 ª2014 Elsevier Inc.

Molecular Cell

Viruses Co-Opt ncRNA or Protein-Coding Genes

cytokines by binding PlexinC1 (Comeau et al., 1998). The amino

acids that confer high-affinity PlexinC1 binding are particularly

well conserved between A39R and human SEMA7A (Liu et al.,

2010). Sequence alignment reveals that the same residues are

also conserved in macaviral SEMA7A homologs (A3 and Ov3)

(Figures S7A and S7B), and homology modeling of A3 to the hu-

man SEMA7A crystal structure suggests comparable binding to

PlexinC1 (FiguresS7C–S7G). Thus, theseviral homologsare likely

to function similarly to cellular SEMA7A.

GRB2 is an adaptor protein downstream of the TCR that is

crucial for the activating phosphorylation of MAPKs (Jang

et al., 2009). GRB2 haploinsufficiency causes defects in JNK

and p38 activation (Gong et al., 2001), similar to miR-27 overex-

pression (Figures 3A and 3B). JNK and p38 signaling are impor-

tant in proliferation and differentiation of T cells (Rincon and

Pedraza-Alva, 2003). It is possible that HVS exploits MAPK

signaling to ensure proliferation of transformed CD8 T cells to

maintain the virally infected pool. The macavirus AlHV-1 also

promotes activation and clonal expansion of a homogeneous

population of latently infected CD8 T cells in animal models

(Dewals and Vanderplasschen, 2011). The activation of JNKs

and p38 further promotes IFN-g production by CD8 T cells

(Manning and Davis, 2003; Rincon and Pedraza-Alva, 2003),

which should enhance viral latency, since IFN-g is a potent inhib-

itor of lytic reactivation of g-herpesviruses (Steed et al., 2006).

Consistent with this notion, our study found that IFN-g is a

target of miR-27, which is degraded by HSUR 1. In addition,

we found ATF3, a transcriptional activator that drives IFNG

expression (Filen et al., 2010), to be a predicted target of miR-

27. AlHV-1 infection has been reported to lead to high levels of

IFN-g secretion by infectedCD8 T cells in animalmodels (Dewals

and Vanderplasschen, 2011), but IFN-g levels are significantly

reduced upon infection by an A3 (SEMA7A homolog) knockout

strain (Myster et al., 2011). This observation is in agreement

with our demonstration that the knockdown of HSUR 1 reduces

levels of IFN-g (Figure 5H) and supports the conclusion that

degradation of miR-27 by HVS produces consequences similar

to expression of the miR-27 target homolog by AlHV-1. Thus,

we speculate that constitutive expression of IFN-g in trans-

formed T cells maintains the viral genome in latency and pro-

vides a long-term sustained viral infection within the host.

The rhadinoviruses, HVS and HVA, and the macaviruses,

AlHV-1 and OvHV-2, are similar in that they cause apathogenic

lytic infections in their natural hosts but latently infect cytotoxic

CD8 T cells in related species, causing T-lymphoproliferative

disease (Ensser and Fleckenstein, 2005; Russell et al., 2009).

The genomes of these viruses are composed of blocks of genes

Figure 4. HSUR 1 Regulates SEMA7A through miR-27 Degradation

(A) Ago-bound mRNA fragments from four HITS-CLIP replicates (different colo

marmoset SEMA7A 30 UTR. Base-pairing interactions betweenmiR-27 or EBV BA

(B) are shown. A gap in the marmoset reference genome (gray bar) was sequenc

(B) Luciferase reporter assays performed with full-length WT or Mut SEMA7A 30 UBART-13. RLU, relative luciferase units.

(C) WB of SEMA7A in Jurkat cells transfected with WT or scrambled miR-27.

(D) WB of SEMA7A in D2A cells transfected with a miR-27 LNA inhibitor or contr

(E)WT cells transfected with an ASOagainst HSUR 1 (a-H1), HSUR 2 (a-H2), or GF

miRNAs and HSURs.

Values are means ± SD in three experiments; p values were determined by Stud

highly conserved between the herpesvirus families in colinear or-

ganization, with a few genes unique to each virus interspersed

between the blocks. Among the open reading frames (ORFs) en-

coded by the four viruses (76 for HVS, 73 for HVA, 71 for AlHV-1,

and 73 for OvHV-2), at least 60 ORFs exhibit homology to those

of other herpesviruses (Ensser and Fleckenstein, 2005; Russell

et al., 2009). However, there is extensive diversity at a few ‘‘hot

spots’’ in the viral genomes. Genes unique to each virus tend

to cluster at the left end of the genome next to the terminal

heavy-DNA repeats (H-DNA) and in the region of the R transac-

tivator gene ORF50 and the glycoprotein gene ORF51 (Ensser

and Fleckenstein, 2005; Russell et al., 2009). Indeed, the viral

ncRNAs (HSURs and HAURs in HVS and HVA, respectively)

and miR-27-target gene homologs (v-SEMA7A, v-ATF3, and

v-IL10 in AlHV-1 and OvHV-2) all appear adjacent to the left

H-DNA terminus (see Figure 7A).

Interestingly, similar alternative approaches for enhancing

host-cell gene expression may also operate in b-herpesviruses.

Mouse cytomegalovirus (MCMV) degradesmiR-27 using an anti-

sense mechanism similar to HVS (Libri et al., 2012; Marcinowski

et al., 2012), while human cytomegalovirus (HCMV) does not

alter miR-27 levels. We noted that HCMV and OvHV-2 encode

viral IL10 homologs (Russell et al., 2009; Slobedman et al.,

2009) (see also Figure 7A). Luciferase reporter assay results

and sequence conservation argue that cellular IL10 is a miR-27

target (Figures S6C–S6E). Together, these results suggest that

MCMV upregulates cellular IL-10 by degrading miR-27, whereas

HCMV instead expresses a viral IL-10 homolog. HCMV IL-10

binds the same receptor as human IL-10, and the immunomod-

ulatory functions of human IL-10 are shared by HCMV IL-10.

Virus-encoded IL-10 homologs have been identified in many

herpesviruses and poxviruses and are likely to be exploited by

viruses for successful infection (Slobedman et al., 2009).

Our study highlights two completely separate strategies

evolved by viruses—miRNA degradation or viral co-option of

miRNA targets—to ensure overexpression of the same set of

genes. Such parallel mechanisms may be applicable to other

viral-host interactions.

EXPERIMENTAL PROCEDURES

Cell Culture and Transfection

T cells from common marmoset (Callithrix jacchus) immortalized by wild-type

HVS strain A11 (WT cells) or a deletion mutant lacking HSUR 1 and HSUR 2

(D2A cells) (Murthy et al., 1989) were cultured as described (Cook et al.,

2004). HEK293T cells and Jurkat T cells were grown in DMEM and RPMI

1640 medium supplemented with 10% fetal bovine serum, penicillin/strepto-

mycin, and 2 mM L-glutamine.

rs), mRNA-Seq reads, and predicted miRNA target sites are mapped on the

RT-13 and theWT (red) or mutant (Mut, blue) target sites in the reporters used in

ed.

TR in HEK293T cells transfected with synthetic WT, scrambled miR-27, or EBV

ol.

P (a-GFP)were subjected toWB for SEMA7A and northern blot analysis (NB) for

ent’s t test. See also Figure S5.

Molecular Cell 54, 67–79, April 10, 2014 ª2014 Elsevier Inc. 73

A

B C D

F

G

H

E

Figure 5. GRB2 and IFN-g Are Regulated by HSUR 1 via miR-27

(A) Ago-bound mRNA fragments, mRNA-Seq reads, and predicted miRNA binding sites are mapped on the marmosetGRB2 30 UTR as in Figure 4. Base-pairing

interactions between miR-27 or EBV BART-13 and WT or a Mut 8-mer target site are shown.

(B) Luciferase reporter assays were performed with the full-length WT or Mut GRB2 30 UTR as described in Figure 4.

(legend continued on next page)

Molecular Cell

Viruses Co-Opt ncRNA or Protein-Coding Genes

74 Molecular Cell 54, 67–79, April 10, 2014 ª2014 Elsevier Inc.

Molecular Cell

Viruses Co-Opt ncRNA or Protein-Coding Genes

One million Jurkat T cells were transfected with 200 pmol synthetic miR-27

or scrambled miR-27 (IDT) per cuvette using the 4D-Nucleofector SE cell line

kit (program CL-120) from Lonza. Cells were harvested 48 hr posttransfection

for western blot analyses.

Tenmillion D2A cells were transfected with 300 pmol tiny LNAs against miR-

27 (Exiqon; designed according to Obad et al., 2011) per cuvette using the 4D-

Nucleofector SE cell line kit (program CM-138) from Lonza. Transfected cells

were then transferred to complete media and incubated at 37�C. After 48 hr,

cells were harvested for western blot analyses.

TenmillionWT cells were transfected, as described above forD2A cells, with

300 pmol chimeric ASOs against GFP (a-GFP), HSUR 1 (a-H1), and HSUR 2

(a-H2) (IDT; designed according to Cazalla et al., 2010). After 24 hr, cells

were harvested and split into two aliquots, one for western blot analysis and

the other for RNA extraction and northern blot analysis.

Ago HITS-CLIP

Four biological replicates of the HITS-CLIP experiment were performed inD2A

cells according to Chi et al. (2009), using two anti-Argonaute antibodies, clone

2A8 (Nelson et al., 2007) (a gift from Z. Mourelatos), and 11A9 (Rudel et al.,

2008) (Sigma), each in duplicate. For each library, 5 million D2A cells were irra-

diated with 600 mJ/cm2 254 nm UV on ice in a Stratalinker 2400 (Stratagene),

lysed, and digested with RNase A (USB 70194Y). Ago-mRNA complexes were

isolated, reverse transcribed, and PCR amplified to prepare cDNA libraries. In

total, four Ago-mRNA cDNA libraries were deep-sequenced by the Yale Stem

Cell Center Genomics Core on an Illumina HiSeq 2000 instrument using 50 bp

runs. About 100 and 250million reads were generated for the two libraries pre-

pared with 2A8 antibody; 170 million reads were generated for each of the two

11A9 libraries. Raw sequencing reads were filtered by quality, collapsed, and

selected for 7-mer miR-27 seed nt 2–8 binding sites using tools on the Galaxy

server (http://galaxyproject.org/) (Blankenberg et al., 2010; Giardine et al.,

2005; Goecks et al., 2010). The miR-27 reads and total reads were mapped

onto the marmoset reference genome (version caljac 3.2) with Bowtie (Lang-

mead et al., 2009), allowing a maximum of two mismatches. Uniquely mapped

reads were collapsed again based on their genome coordinates and the

degenerate barcode to obtain unique Ago-bound mRNA fragments. This anal-

ysis was performed using Dr. Robert Darnell’s lab server (Rockefeller Univer-

sity) as described in the Extended Experimental Procedures in Darnell et al.

(2011). Total Ago and miR-27-Ago clusters were formed by grouping overlap-

ping unique Ago-bound mRNA fragments with a minimum of 1 nt overlap.

Clusters were visualized on the UCSC genome browser (http://genome.

ucsc.edu) and ranked based on BC and PH. To identify target sites for other

miRNAs, 8-mer, 7-mer, and 6-mer seed binding sites were searched for

among robust Ago clusters.

To evaluate the robustness of the miR-27-Ago clusters in multiple experi-

ments, the chi-square test was used considering both BC and the number

of Ago-boundmRNA fragments in individual experiments; p value (before mul-

tiple test correction) was determined from chi-square test scores according to

Darnell et al. (2011). Details on plotting the distribution of Ago-bound mRNA

fragments relative to cluster peaks are given in the Figure 1A legend. The

CIMS analysis was performed as described in Zhang and Darnell (2011); see

Figure 1B legend for details.

mRNA-Seq

An mRNA-Seq library from D2A cells was prepared and sequenced at the Yale

Center forGenomicAnalysis. About 100million rawreadswereobtained froman

(C) WB of GRB2 after transfection of WT or scrambled miR-27 into Jurkat cells.

(D) WB of GRB2 in D2A cells transfected with a miR-27 LNA inhibitor or control.

(E) WB of GRB2 in WT cells after transfection with a-H1, a-H2, or a-GFP ASO.

(F) Ago-bound mRNA fragments, mRNA-Seq reads, and predicted miRNA bindin

interactions between miR-27 or EBV BART-13 and the WT or a Mut 7-mer targe

(G) Luciferase reporter assays were performed with the full-length WT or Mut IFN

(H) Enzyme-linked immunosorbent assay (ELISA) measured extracellular IFN-g co

cell number was determined before harvesting.

The 6-mer miR-27 sites (redC) in both theGRB2 and IFNG 30 UTRs were not activ

are means ± SD in at least three experiments; p values were determined by Stud

Illumina Genome Analyzer II. The raw data were processed and mapped to the

marmoset reference genome (version caljac 3.2) usingBowtie (Langmead et al.,

2009) on the Galaxy server (http://galaxyproject.org/) and visualized on the

UCSCgenome browser. Transcript levels were quantified by Cufflinks (Trapnell

et al., 2010) using 55,137 transcripts annotated by Ensembl as a reference.

Luciferase Reporter Assays

HEK293T cells were seeded in 24-well plates 24 hr before transfection and co-

transfected with 5 ng of pmiRGLO luciferase reporter, 0.8 mg pBlueScript II,

and 20 pmol of synthetic miRNA per well using Lipofectamine 2000 (Invitro-

gen). Synthetic miRNA duplexes contained a 50-phosphorylated mature

miRNA with a 2 nt 30-overhang and a complementary passenger stand, which

were annealed according to Tuschl (2006). Twenty-four hours posttransfec-

tion, Firefly and Renilla luciferase activities were measured in dual-luciferase

reporter assays performed on a GloMax-Multi+ Microplate Multimode Reader

(Promega) according to the manufacturer’s instructions. Firefly luciferase

activity was first normalized to Renilla luciferase activity, and then the ratios

were corrected against that of an empty reporter. SD for each condition was

calculated based on a minimum of three independent experiments. p values

were calculated using one-tailed Student’s t test.

Western Blot Analysis

Cell pelletswere lysed inRIPAbuffer (50mMTris-Cl [pH7.5], 150mMNaCl, 1%

NP-40, 0.5% sodium deoxycholate, 0.1% SDS, supplemented with complete

EDTA-free proteinase inhibitor cocktail tablet [Roche]), and quantified byBrad-

ford assays using the Coomassie Plus Assay Kit (Pierce). Typically, 10 mg total

protein was separated on a 12%SDS-PAGE gel, then transferred to nitrocellu-

lose membrane (BioRad). After blocking with 5% milk in 13 TBST, the mem-

brane was probed with the appropriate antibody, detected with SuperSignal

West Femto Maximum Sensitivity Substrate (Thermo Scientific) according to

themanufacturer’s protocol, imaged using aGBox (SYNGENE), and quantified

by GeneTools v. 4.02 (SYNGENE). We obtained standard curves for SEMA7A

and GRB2 by making serial dilutions of total cell lysate. Both curves show a

strong linear relationship between signal and the amount of cell lysate (data

not shown). The western blots presented in the paper were performed within

the linear range. Primary antibodies used were anti-SEMA7A (sc-376149,

Santa Cruz Biotech), anti-GRB2 (#3972, Cell Signaling), anti-GAPDH (#2118,

Cell Signaling), and anti-TUBULIN (#CP06, DM1A, Calbiochem). GAPDH and

TUBULIN were provided as normalization controls. Data shown in the figures

are representative of at least three independent experiments.

Enzyme-Linked Immunosorbent Assay

Ten million WT cells were transfected with 300 pmol anti-HSUR 1 and anti-

HSUR 2 oligonucleotides. At 48 hr posttransfection, cell numbers were quan-

tified using a hemocytometer after staining with trypan blue (GIBCO), and the

growth media were harvested for enzyme-linked immmunosorbent assay

(ELISA). The IFN-g concentration was measured using the Human IFN-g

Screening Set (Thermo Scientific) following the manufacturer’s protocol. SD

for each data point was calculated based on three experiments. p values

were calculated using two-tailed Student’s t test.

Lentiviral Rescue of miR-27 Targets in D2A Cells with Wild-Type or

Mutant HSUR 1

Wild-type and miR-27 binding site-mutated HSUR 1 expression cassettes

were made as described in Cazalla et al. (2010) and inserted into the PacI

g sites are mapped on the marmoset IFNG 30 UTR as in Figure 4. Base-pairing

t site are shown.

G 30 UTR as described in Figure 4.

ncentration after knockdown of HSUR 1with a-H1 compared to a-H2 ASO. The

e enough to be detected in luciferase reporter assays (data not shown). Values

ent’s t test. See also Figure S5.

Molecular Cell 54, 67–79, April 10, 2014 ª2014 Elsevier Inc. 75

A

DCB

E

WTMutUninfect

Lenti HSUR 1

GRB2

GAPDH

0.9 1 1.6

zsGREEN

HSUR 1

miR-27

miR-16

0.4 1 1.0 0.9

WT Mut VectorUninfectLenti HSUR 1

U6

F

HSUR 1

U6

WTMutUninfectLenti HSUR 1

UUGCUGACCAAUUUUUGUAG

GUAAUG

U

UU

CA

UUGUUGGU

AAAUC

A

AC

C

UU

AA C

CUA

AACUA

AAAGUCUCA AAC

AACC

CGUUAC

AAGUUCC

——

——

GC

U—CG

GU

G —ACA

CU

U

HSUR 1 mutant(Mut)

miR-27

2,2,7M3GPPPACACUACAUAUUUAUUUAUUUAUUUCUUA

GGUCAUG

CCGGUACCA

GU

GUA

AA U A

UGAUGA

3′

3′

5′

Sm

UUGCUGACCAAUUUUUGUAG

GUAAUG

U

UU

CA

UUCAAGGU

AAAUC

U

UG

G

UA

AA C

CUA

AACUA

AAAGUCUCA AAC

AACC

CGUUAC

AAGUUCC

———————GC

U—CG

GU

G —ACA

CU

U

HSUR 1 wildtype(WT)

miR-27

2,2,7M3GPPPACACUACAUAUUUAUUUAUUUAUUUCUUA

GGUCAUG

CCGGUACCA

GU

GUA

AA U A

UGAUGA

3′

3′

5′

Sm

—————

WTMutUninfect

Lenti HSUR 1

SEMA7A

GAPDH

zsGREEN

1.1 1 1.7

BNBN

BWBW

Lenti HSUR 1Uninfe

ctM

ut WT

0.0

0.5

1.0

1.5

Rel

ativ

e m

iRN

A le

vels

miR-27miR-181a

miR-16miR-27 ratio

Figure 6. Wild-Type, but Not a miR-27 Binding Site-Mutated HSUR 1, Rescues Levels of miR-27 Target Proteins in D2A Cells

(A) Sequence of the WT and Mut HSUR 1, with nucleotides conserved between HVS strains in bold. Mutations introduced into the miR-27 binding site are

highlighted in red; the miR-27 seed is in yellow.

(B) NB shows that Jurkat T cells infected with lentiviruses carrying WT HSUR 1 have lower levels of miR-27 compared to cells infected with lentiviruses carrying

Mut HSUR 1. Quantifications of miR-27 levels relative to miR-16 are given below.

(C) NB shows levels of WT and Mut HSUR 1 expressed by lentiviruses in D2A cells.

(D) Levels of miR-27 and a control, miR-181a, in D2A cells infected with lentiviruses carrying WT or Mut HSUR 1, determined by Q-PCR. Endogenous U6 snRNA

was the normalization control for the quantifications.

(E) WB of SEMA7A in D2A cells infected with lentiviruses carrying WT or Mut HSUR 1. zsGREEN is a marker protein expressed by the pAGM lentiviral transfer

vector. GAPDH provided a loading control for the quantifications below.

(F) GRB2 levels in D2A cells rescued with WT or Mut HSUR 1 as described above.

Values are means ± SD in two experiments.

Molecular Cell

Viruses Co-Opt ncRNA or Protein-Coding Genes

site of the lentiviral transfer vector pAGM (Mayoral and Monticelli, 2010). Tran-

scription of the HSUR 1 expression cassette is opposite to the zsGREEN

expression cassette. A total of 25 mg transfer vector, 25 mg packaging vector

(psPAX2), and 5 mg VSVG pseudo-typing vector (pMD2.G) were transfected

76 Molecular Cell 54, 67–79, April 10, 2014 ª2014 Elsevier Inc.

into HEK293T cells in 150 mm tissue culture plates using ProFection Mamma-

lian Transfection System (Promega) according to the manufacturer’s instruc-

tions. Supernatant was harvested 48 hr after transfection, filtered through

0.45 mm low protein binding membrane, and then ultracentrifuged at

EBV

AlHV-1

OvHV-2

MHV-68

HVA

HVS

KSHV

Rhadinovirus

Macavirus

Lymphocryptovirus

B

2 kb

HVS

HVA

AlHV-1

OvHV-2

H−DNA A1 A2 A3 A4 ORF3

H−DNA Ov2 Ov2.5 Ov3 Ov3.5 ORF3

H−DNA Tio 2 ORF3HAUR1

v-ATF3 v-SEMA7A

A

v-IL10

H−DNA STP−A11 1 5 DHFR 3 6 ORF3HSUR HSUR

72 4

Figure 7. GeneMaps and Phylogenetic Tree

of T-Lymphotropic g-Herpesviruses

(A) Syntenic regions flanked by H-DNA and ORF3

(formylglycineamide ribotide amidotransferase,

FGARAT) are shown (Ensser and Fleckenstein,

2005; Russell et al., 2009). STP-A11, Saimiri

transformation protein of HVS strain A11; DHFR,

dihydrofolate reductase; Tio, two-in-one protein of

HVA; HSUR and HAUR, HVS- and HVA-encoded

URNA, respectively; A1, A2, A3, and A4, AlHV-1

ORFs; Ov2, Ov2.5, Ov3, and Ov3.5, OvHV-2

ORFs; v-ATF3, v-IL10, and v-SEMA7A, viral ho-

mologs of cellular proteins.

(B) Phylogenetic tree of commonly studied g-her-

pesviruses with T-lymphotropic viruses in red.

EBV, Epstein-Barr virus; KSHV, Kaposi’s sar-

coma-associated herpesvirus; MHV-68, Murid

herpesvirus 68.

See also Figures S6 and S7.

Molecular Cell

Viruses Co-Opt ncRNA or Protein-Coding Genes

25,000 rpm for 2 hr at 4�C. The concentrated viruses were stored at �80�Cuntil use. Viral titers were determined by transduction of HEK293T cells and

counting GFP+ colonies.

About 23 105 Jurkat cells orD2A cells were infected at amultiplicity of infec-

tion (moi) of 30 in the presence of 10 mg/ml polybrene (Millipore), and the total

RNA was extracted 16 or 7 days, respectively, after infection for northern blot

analyses (Figures 6B and 6C). About 23 105 D2A cells were infected at an moi

of 100 in the presence of 10 mg/ml polybrene; cells were harvested 3 days after

infection for western blot analyses (Figures 6E and 6F). Anti-zsGREEN anti-

body was purchased from Clontech (#632475). In addition, 2 3 105 D2A cells

were infected at moi 15 in the presence of 10 mg/ml polybrene, and the GFP+

cells were sorted 3 days after infection, and subjected to quantitative real-time

PCR analysis (Figure 6D). Levels of mature miR-27 and miR-181a were deter-

mined using Taqman miRNA assays (#4427975, #4427975, Applied Bio-

systems) following the manufacturer’s instructions. U6 snRNA (#4427975,

Applied Biosystems) was used as a normalization control. Amplification was

performed with a StepOnePlus Real-Time PCR system (Applied Biosystems),

and data were analyzed using StepOne software v2.2.2.

T Cell Activation and MAPK Phosphorylation

Jurkat cells were transfected with synthetic miR-27 or a scrambled control as

describedabove,andharvestedafter 48hr.Transfectedcellswereactivatedac-

cording toSawasdikosol (2010), lyseddirectly in 13Laemmli samplebuffer, and

separated on a 10% SDS-PAGE gel, then transferred to nitrocellulose mem-

brane. Anti-CD3 antibody (OKT3) was from eBiosciences (#16-0037), and sec-

ondary rabbit anti-mouse IgG antibody was from Southern Biotech (#6170).

Typically 100,000 cells were loaded in each lane. Primary antibodies used for

western blot (Cell Signaling) include anti-phospho-JNK (#4668), anti-total-JNK

(#9258), anti-phospho-p38 (#4511), anti-total-p38 (#9212), anti-phospho-ERK

(#4370), anti-total-ERK (#4695), and anti-phospho-tyrosine (#9416).

CD69 Induction and FACS Analysis

Jurkat cells were transfected with synthetic miR-27 or a scrambled control as

described above, and harvested after 46 hr. Transfected cells were activated

by immobilized OKT3 (5 mg/ml) in the presence of soluble anti-CD28 (2 mg/ml;

eBiosciences #16-0289) for 2 hr at 37�C. Activated cells were stainedwith anti-

CD69 conjugated R-phycoerythrin (PE) (eBiosciences #12-0699) according to

the manufacturer’s instructions, then analyzed on a FACSCalibur at the Yale

FACS Core Facility. The data were analyzed using FlowJo (http://www.

flowjo.com/) to generate the histogram and calculate the median fluorescence

intensity (MFI).

ACCESSION NUMBERS

Gene expression data (i.e., mRNA-Seq) have been deposited in NCBI’s Gene

Expression Omnibus (GEO) and are accessible through GEO Series accession

number GSE55185.

SUPPLEMENTAL INFORMATION

Supplemental Information includes seven figures, two tables, and Supple-

mental Experimental Procedures and can be found with this article at http://

dx.doi.org/10.1016/j.molcel.2014.03.025.

AUTHOR CONTRIBUTIONS

Y.E.G. performed the experiments and analyses. K.J.R. helped with HITS-

CLIP. A.I. helped with immunology-related experiments. Y.E.G. and J.A.S

wrote the manuscript.

ACKNOWLEDGMENTS

We thank R. Darnell, C. Zhang, and J. Luna for help with bioinformatic analyses

of HITS-CLIP data; D. Bartel for suggestions on miR-27 target prediction; D.

Cazalla, K. Tycowski, and other members of the Steitz laboratory for helpful

discussion; Z. Mourelatos for anti-Ago antibodies (2A8); P. Kumar and S. Zeller

for the pAGM vector; S. Zeller, N. Lee, and S. Liu for protocols to make lenti-

virus; S. Takyar and T. Yarovinsky for advice on T cell activation assays; J.

Brown, D. DiMaio, G. Miller, E. Ullu, and J. Withers for critical commentary

on the manuscript; and A. Miccinello for editorial assistance. This work was

supported by grant CA16038 from the NIH. The content is solely the responsi-

bility of the authors and does not necessarily represent the official views of the

NIH. J.A.S is an investigator at the Howard Hughes Medical Institute.

Molecular Cell 54, 67–79, April 10, 2014 ª2014 Elsevier Inc. 77

Molecular Cell

Viruses Co-Opt ncRNA or Protein-Coding Genes

Received: December 2, 2013

Revised: February 10, 2014

Accepted: March 1, 2014

Published: April 10, 2014

REFERENCES

Albrecht, J.C., and Fleckenstein, B. (1992). Nucleotide sequence of HSUR 6

and HSUR 7, two small RNAs of herpesvirus saimiri. Nucleic Acids Res. 20,

1810.

Bartel, D.P. (2009). MicroRNAs: target recognition and regulatory functions.

Cell 136, 215–233.

Baumjohann, D., and Ansel, K.M. (2013). MicroRNA-mediated regulation of T

helper cell differentiation and plasticity. Nat. Rev. Immunol. 13, 666–678.

Blankenberg, D., Von Kuster, G., Coraor, N., Ananda, G., Lazarus, R., Mangan,

M., Nekrutenko, A., and Taylor, J. (2010). Galaxy: a web-based genome

analysis tool for experimentalists. Curr. Protoc. Mol. Biol., Chapter 19, Unit

19.10.1-21.

Cazalla, D., Yario, T., and Steitz, J.A. (2010). Down-regulation of a host

microRNA by a Herpesvirus saimiri noncoding RNA. Science 328, 1563–1566.

Chi, S.W., Zang, J.B., Mele, A., and Darnell, R.B. (2009). Argonaute HITS-CLIP

decodes microRNA-mRNA interaction maps. Nature 460, 479–486.

Comeau, M.R., Johnson, R., DuBose, R.F., Petersen, M., Gearing, P.,

VandenBos, T., Park, L., Farrah, T., Buller, R.M., Cohen, J.I., et al. (1998). A

poxvirus-encoded semaphorin induces cytokine production from monocytes

and binds to a novel cellular semaphorin receptor, VESPR. Immunity 8,

473–482.

Cook, H.L., Mischo, H.E., and Steitz, J.A. (2004). The Herpesvirus saimiri small

nuclear RNAs recruit AU-rich element-binding proteins but do not alter host

AU-rich element-containing mRNA levels in virally transformed T cells. Mol.

Cell. Biol. 24, 4522–4533.

Cook, H.L., Lytle, J.R., Mischo, H.E., Li, M.J., Rossi, J.J., Silva, D.P.,

Desrosiers, R.C., and Steitz, J.A. (2005). Small nuclear RNAs encoded by

Herpesvirus saimiri upregulate the expression of genes linked to T cell activa-

tion in virally transformed T cells. Curr. Biol. 15, 974–979.

Czopik, A.K., Bynoe, M.S., Palm, N., Raine, C.S., and Medzhitov, R. (2006).

Semaphorin 7A is a negative regulator of T cell responses. Immunity 24,

591–600.

Darnell, J.C., Van Driesche, S.J., Zhang, C., Hung, K.Y., Mele, A., Fraser, C.E.,

Stone, E.F., Chen, C., Fak, J.J., Chi, S.W., et al. (2011). FMRP stalls ribosomal

translocation on mRNAs linked to synaptic function and autism. Cell 146,

247–261.

Dewals, B.G., and Vanderplasschen, A. (2011). Malignant catarrhal fever

induced by Alcelaphine herpesvirus 1 is characterized by an expansion of acti-

vated CD3+CD8+CD4� T cells expressing a cytotoxic phenotype in both

lymphoid and non-lymphoid tissues. Vet. Res. 42, 95.

Ensser, A., and Fleckenstein, B. (2005). T-cell transformation and oncogenesis

by gamma2-herpesviruses. Adv. Cancer Res. 93, 91–128.

Filen, S., Ylikoski, E., Tripathi, S., West, A., Bjorkman, M., Nystrom, J., Ahlfors,

H., Coffey, E., Rao, K.V., Rasool, O., and Lahesmaa, R. (2010). Activating tran-

scription factor 3 is a positive regulator of human IFNG gene expression.

J. Immunol. 184, 4990–4999.

Giardine, B., Riemer, C., Hardison, R.C., Burhans, R., Elnitski, L., Shah, P.,

Zhang, Y., Blankenberg, D., Albert, I., Taylor, J., et al. (2005). Galaxy: a plat-

form for interactive large-scale genome analysis. Genome Res. 15, 1451–

1455.

Goecks, J., Nekrutenko, A., and Taylor, J.; Galaxy Team (2010). Galaxy: a

comprehensive approach for supporting accessible, reproducible, and trans-

parent computational research in the life sciences. Genome Biol. 11, R86.

Gong, Q., Cheng, A.M., Akk, A.M., Alberola-Ila, J., Gong, G., Pawson, T., and

Chan, A.C. (2001). Disruption of T cell signaling networks and development by

Grb2 haploid insufficiency. Nat. Immunol. 2, 29–36.

78 Molecular Cell 54, 67–79, April 10, 2014 ª2014 Elsevier Inc.

Holmes, S., Downs, A.M., Fosberry, A., Hayes, P.D., Michalovich, D.,

Murdoch, P., Moores, K., Fox, J., Deen, K., Pettman, G., et al. (2002).

Sema7A is a potent monocyte stimulator. Scand. J. Immunol. 56, 270–275.

Jang, I.K., Zhang, J., and Gu, H. (2009). Grb2, a simple adapter with complex

roles in lymphocyte development, function, and signaling. Immunol. Rev. 232,

150–159.

Johnson, D.R., and Jondal, M. (1981). Herpesvirus ateles and herpesvirus

saimiri transform marmoset T cells into continuously proliferating cell lines

that can mediate natural killer cell-like cytotoxicity. Proc. Natl. Acad. Sci.

USA 78, 6391–6395.

Kiyotaki, M., Desrosiers, R.C., and Letvin, N.L. (1986). Herpesvirus saimiri

strain 11 immortalizes a restricted marmoset T8 lymphocyte subpopulation

in vitro. J. Exp. Med. 164, 926–931.

Kuchen, S., Resch, W., Yamane, A., Kuo, N., Li, Z., Chakraborty, T., Wei, L.,

Laurence, A., Yasuda, T., Peng, S., et al. (2010). Regulation of microRNA

expression and abundance during lymphopoiesis. Immunity 32, 828–839.

Langmead, B., Trapnell, C., Pop, M., and Salzberg, S.L. (2009). Ultrafast and

memory-efficient alignment of short DNA sequences to the human genome.

Genome Biol. 10, R25.

Lee, S.I., Murthy, S.C., Trimble, J.J., Desrosiers, R.C., and Steitz, J.A. (1988).

Four novel U RNAs are encoded by a herpesvirus. Cell 54, 599–607.

Libri, V., Helwak, A.,Miesen, P., Santhakumar,D., Borger, J.G., Kudla,G.,Grey,

F., Tollervey, D., and Buck, A.H. (2012). Murine cytomegalovirus encodes a

miR-27 inhibitor disguisedas a target. Proc.Natl. Acad.Sci.USA109, 279–284.

Lin, C., Smith, E.R., Takahashi, H., Lai, K.C., Martin-Brown, S., Florens, L.,

Washburn, M.P., Conaway, J.W., Conaway, R.C., and Shilatifard, A. (2010).

AFF4, a component of the ELL/P-TEFb elongation complex and a shared sub-

unit of MLL chimeras, can link transcription elongation to leukemia. Mol. Cell

37, 429–437.

Liu, H., Juo, Z.S., Shim, A.H., Focia, P.J., Chen, X., Garcia, K.C., and He, X.

(2010). Structural basis of semaphorin-plexin recognition and viral mimicry

from Sema7A and A39R complexes with PlexinC1. Cell 142, 749–761.

Manning, A.M., and Davis, R.J. (2003). Targeting JNK for therapeutic benefit:

from junk to gold? Nat. Rev. Drug Discov. 2, 554–565.

Marcinowski, L., Tanguy, M., Krmpotic, A., Radle, B., Lisni�c, V.J., Tuddenham,

L., Chane-Woon-Ming, B., Ruzsics, Z., Erhard, F., Benkartek, C., et al. (2012).

Degradation of cellular mir-27 by a novel, highly abundant viral transcript is

important for efficient virus replication in vivo. PLoS Pathog. 8, e1002510.

Mayoral, R.J., and Monticelli, S. (2010). Stable overexpression of miRNAs in

bone marrow-derived murine mast cells using lentiviral expression vectors.

Methods Mol. Biol. 667, 205–214.

Murphy, K., Travers, P., Walport, M., and Janeway, C. (2008). Janeway’s

Immunobiology, Seventh Edition. (New York: Garland Science).

Murthy, S.C., Trimble, J.J., and Desrosiers, R.C. (1989). Deletion mutants of

herpesvirus saimiri define an open reading frame necessary for transformation.

J. Virol. 63, 3307–3314.

Myster, F., Palmeira, L., Vanderplasschen, A., and Dewals, B. (2011).

Investigation on the Role of the viral semaphorin encoded by the A3 gene of

Alcelaphine Herpesvirus 1 in the induction of malignant catarrhal fever. 36th

Annual International Herpesvirus Workshop (Gdansk, Poland), http://orbi.ulg.

ac.be/handle/2268/106943.

Nelson, P.T., De Planell-Saguer, M., Lamprinaki, S., Kiriakidou, M., Zhang, P.,

O’Doherty, U., andMourelatos, Z. (2007). A novel monoclonal antibody against

human Argonaute proteins reveals unexpected characteristics of miRNAs in

human blood cells. RNA 13, 1787–1792.

Nelson, D.D., Davis, W.C., Brown, W.C., Li, H., O’Toole, D., and Oaks, J.L.

(2010). CD8(+)/perforin(+)/WC1(�) gammadelta T cells, not CD8(+) alphabeta

T cells, infiltrate vasculitis lesions of American bison (Bison bison) with

experimental sheep-associated malignant catarrhal fever. Vet. Immunol.

Immunopathol. 136, 284–291.

Noraz, N., Saha, K., Ottones, F., Smith, S., and Taylor, N. (1998). Constitutive

activation of TCR signalingmolecules in IL-2-independent Herpesvirus saimiri-

transformed T cells. J. Immunol. 160, 2042–2045.

Molecular Cell

Viruses Co-Opt ncRNA or Protein-Coding Genes

Obad, S., dos Santos, C.O., Petri, A., Heidenblad, M., Broom, O., Ruse, C., Fu,

C., Lindow, M., Stenvang, J., Straarup, E.M., et al. (2011). Silencing of

microRNA families by seed-targeting tiny LNAs. Nat. Genet. 43, 371–378.

Rincon, M., and Pedraza-Alva, G. (2003). JNK and p38 MAP kinases in CD4+

and CD8+ T cells. Immunol. Rev. 192, 131–142.

Rudel, S., Flatley, A., Weinmann, L., Kremmer, E., and Meister, G. (2008). A

multifunctional human Argonaute2-specific monoclonal antibody. RNA 14,

1244–1253.

Rushworth, S.A., Zaitseva, L., Murray, M.Y., Shah, N.M., Bowles, K.M., and

MacEwan, D.J. (2012). The high Nrf2 expression in human acute myeloid leu-

kemia is driven by NF-kB and underlies its chemo-resistance. Blood 120,

5188–5198.

Russell, G.C., Stewart, J.P., and Haig, D.M. (2009). Malignant catarrhal fever: a

review. Vet. J. 179, 324–335.

Sawasdikosol, S. (2010). Detecting tyrosine-phosphorylated proteins by

Western blot analysis. Curr. Protoc. Immunol., Chapter 11, Unit 11 13 11-11.

Schroder, K., Hertzog, P.J., Ravasi, T., and Hume, D.A. (2004). Interferon-

gamma: an overview of signals, mechanisms and functions. J. Leukoc. Biol.

75, 163–189.

Skalsky, R.L., and Cullen, B.R. (2010). Viruses, microRNAs, and host interac-

tions. Annu. Rev. Microbiol. 64, 123–141.

Slobedman, B., Barry, P.A., Spencer, J.V., Avdic, S., and Abendroth, A. (2009).

Virus-encoded homologs of cellular interleukin-10 and their control of host

immune function. J. Virol. 83, 9618–9629.

Steed, A.L., Barton, E.S., Tibbetts, S.A., Popkin, D.L., Lutzke, M.L., Rochford,

R., and Virgin, H.W., 4th. (2006). Gamma interferon blocks gammaherpesvirus

reactivation from latency. J. Virol. 80, 192–200.

Steitz, J., Borah, S., Cazalla, D., Fok, V., Lytle, R., Mitton-Fry, R., Riley, K., and

Samji, T. (2011). Noncoding RNPs of viral origin. Cold Spring Harb. Perspect.

Biol. 3, 3.

Suzuki, K., Kumanogoh, A., and Kikutani, H. (2008). Semaphorins and their

receptors in immune cell interactions. Nat. Immunol. 9, 17–23.

Tamagnone, L., Artigiani, S., Chen, H., He, Z., Ming, G.I., Song, H., Chedotal,

A., Winberg, M.L., Goodman, C.S., Poo, M., et al. (1999). Plexins are a large

family of receptors for transmembrane, secreted, and GPI-anchored sema-

phorins in vertebrates. Cell 99, 71–80.

Trapnell, C., Williams, B.A., Pertea, G., Mortazavi, A., Kwan, G., van Baren,

M.J., Salzberg, S.L., Wold, B.J., and Pachter, L. (2010). Transcript assembly

and quantification by RNA-Seq reveals unannotated transcripts and isoform

switching during cell differentiation. Nat. Biotechnol. 28, 511–515.

Tuschl, T. (2006). Annealing siRNAs to produce siRNA duplexes. Cold Spring

Harb. Protoc. http://dx.doi.org/10.1101/pdb.prot4340.

Wassarman, D.A., Lee, S.I., and Steitz, J.A. (1989). Nucleotide sequence of

HSUR 5 RNA from herpesvirus saimiri. Nucleic Acids Res. 17, 1258.

Zhang, C., and Darnell, R.B. (2011). Mapping in vivo protein-RNA interactions

at single-nucleotide resolution from HITS-CLIP data. Nat. Biotechnol. 29,

607–614.

Molecular Cell 54, 67–79, April 10, 2014 ª2014 Elsevier Inc. 79