Alternative Splicing of Transcripts from crtI and crtYB Genesof Xanthophyllomyces dendrorhous
P. Lodato, J. Alcaino, S. Barahona, P. Retamales, and V. Cifuentes*Departamento de Ciencias Ecologicas, Facultad de Ciencias,
Universidad de Chile, Santiago, Chile
Received 18 November 2002/Accepted 5 May 2003
Xanthophyllomyces dendrorhous is one of the relevant sources of the carotenoid astaxanthin. In this paper, wedescribe for the first time cloning of unexpected cDNAs obtained from the crtI and crtYB genes of X. dendrorhousstrain UCD 67-385. The cDNA of the crtI gene conserves 80 bp of the first intron, while the cDNA of the crtYBgene conserves 55 bp of the first intron and lacks 111 bp of the second exon. The crtI and crtYB RNAs couldbe spliced in alternative splice sites, which produced alternative transcripts which could not be translated toactive CRTI and CRTYB proteins since they had numerous stop codons in their sequences. The ratio of maturemRNA to alternative mRNA for the crtI gene decreased as a function of the age of the culture, while the cellularcontent of carotenoids increased. It is possible that splicing to mature or alternative transcripts could regulatethe cellular concentrations of phytoene desaturase and phytoene synthase-lycopene cyclase proteins, dependingon the physiological or environmental conditions.
Carotenoids are terpenoid pigments that are synthesized inbacteria, algae, fungi, and green plants (5). They provide pro-tection against photooxidation and inactivate free radicals dueto their highly conjugated double-bond systems (11, 28, 29).Astaxanthin, produced primarily by phytoplankton, is the prin-cipal carotenoid responsible for the orange-red color of marineinvertebrates, fish, and birds. Since animals are not capable ofastaxanthin synthesis, this xanthophyll must be added to thefeed of aquacultured organisms like salmonids to obtain theappropriate pigmentation for consumer appeal (19, 38). Todate, one of the few microbial sources of astaxanthin is the redbasidiomycetous yeast Xanthophyllomyces dendrorhous (3, 20,24).
As in other organisms, the condensation of two molecules ofgeranylgeranyl pyrophosphate (GGPP) to phytoene is the firstspecific step in the biosynthesis of astaxanthin. Subsequently,the pathway to lycopene involves the introduction of doublebonds by four desaturations of phytoene. Finally, after cycliza-tion of lycopene to �-carotene, hydroxylation occurs at the 3and 3� carbons, and keto groups are added at positions 4 and4� of �-rings. Recently, the phytoene desaturase-encoding gene(crtI) was isolated by heterologous complementation in anEscherichia coli strain accumulating phytoene. To do this, acDNA library from X. dendrorhous was introduced into an E.coli strain carrying genes encoding GGPP synthase (crtE) andphytoene synthase (crtB) from Erwinia uredovora (40). By usinga similar approach, the first lycopene cyclase gene (crtYB)described in a fungus was isolated from X. dendrorhous (41).The product of the crtYB gene is a bifunctional enzyme withtwo catalytic activities, as it converts GGPP into phytoene andlycopene into �-carotene. A related phytoene synthase-lyco-
pene cyclase has been cloned from other fungi belonging to thetaxonomic groups ascomycota and zygomycota (6, 7, 39).
Additionally, numerous studies on the expression at themRNA level of carotenogenic genes in ascomycetes and zygo-mycetes have established that expression increases in responseto environmental conditions, such as blue light illumination(12, 27, 31, 33, 34). The synthesis of alternative spliced mRNAsis a well-known process in eukaryotic organisms like the fruitflyDrosophila melanogaster, the nematode Caenorhabditis elegans,and mammals (22, 26, 35). With regard to yeasts and filamen-tous fungi, there have been some reports of alternative splicing(8, 9, 15, 17, 37, 44, 45), but as far as we know, alternativesplicing has not been described in carotenogenic genes yet. InX. dendrorhous, neither the presence of alternative splicedtranscripts of carotenogenic genes nor the expression of thesegenes in relation to the culture conditions has been described.The main goal of this study was isolation of crtI and crtYBtranscripts which could be processed in alternative spliced sitesin X. dendrorhous strain UCD 67-385. Also, the levels of tran-scripts for both genes were determined as a function of theculture age.
MATERIALS AND METHODS
DNA techniques and sequence analysis. General procedures for plasmid DNApurification, gel electrophoresis, cloning, and other standard molecular biologytechniques were carried out as described by Sambrook et al. (32). Restrictionendonuclease digestion and ligation with T4 DNA ligase were performed asrecommended by the enzyme suppliers (New England Biolabs and Gibco-BRL).Reverse transcription (RT)-PCR products for cloning were recovered from aga-rose gels and purified by using glassmilk as described previously (10). PlasmidpBluescript SK was used in cloning experiments. This vector was digested withEcoRV, and nucleotide T overhangs were added at the 3� ends to facilitatecloning of RT-PCR products. X. dendrorhous DNA was isolated as describedpreviously (23) from protoplasts prepared from cells grown at 22°C for 4 days inliquid MMv medium (30). Nucleotide sequences were determined by using a BigDye Terminator v3.0 DNA sequencing kit (Applied Biosystems). The sequencedata were analyzed by using the University of Wisconsin Genetics ComputerGroup package, version 10.0 (16), and the program CLUSTAL W, version 1.8(36).
* Corresponding author. Mailing address: Departamento de Cien-cias Ecologicas, Facultad de Ciencias, Universidad de Chile, Casilla653, Santiago, Chile. Phone: 56-2-6787346. Fax: 56-2-2727363. E-mail:[email protected].
Strains and plasmids. All strains and plasmids used in this study are listed inTable 1. The atxS2 strain was obtained after treatment of UCD 67-385 withN-methyl-N�-nitro-nitrosoguanidine (40 �g/ml) under the conditions describedpreviously (14). A highly pigmented colony was selected by visual inspection, andit was resuspended in distilled water. This suspension was plated on YM medium(2), and a highly pigmented colony, designated strain atxS2, was analyzed forcarotenoid production and pigment composition. The atxS2 cultures producedabout 2.230 �g of total carotenoid per g (dry weight) of yeast, and high-perfor-mance liquid chromatography analysis of carotenoids indicated that the principalpigment was astaxanthin.
E. coli growth conditions. Electrocompetent E. coli cells were transformedwith DNA from ligation reactions of RT-PCR products and pBluescript. Thetransformed cells were plated on selective Luria-Bertani agar plates (32) andincubated at 37°C overnight. These plates contained ampicillin (100 �g/ml) forselection of the plasmid and 40 �l of a 2% solution of X-Gal (5-bromo-4-chloro-3-indolyl-�-D-galactopyranoside) per plate to select for white colonies.
X. dendrorhous growth conditions. X. dendrorhous wild-type and mutant strainswere grown in fermentor batch cultures, and samples were withdrawn from eachculture at different times to collect cells for carotenoid extraction, biomassdetermination, and total RNA isolation. For each strain, a preculture was pre-pared in a 1-liter baffled flask containing 400 ml of YM medium (2) by adding 4ml of a 2 day-culture in YM medium. All cultures were grown with shaking at 100rpm for baffled flasks and at 150 rpm for nonbaffled flasks in an orbital shaker ata constant temperature of 22°C. A 12-liter jar fermentor (New Brunswick)containing 8.8 liters of YM medium with 450 �l of silicone antifoam agent (1520EU; Dow Corning) was inoculated with 200 ml of a 2-day preculture of thewild-type or mutant strain. The temperature was controlled at 22 � 1°C, and theculture was agitated at 300 rpm. Sterile air was injected at a flow rate of 8liters/min. The antifoam agent was automatically added when it was needed.Samples for carotenoid and RNA extraction were centrifuged at 1,300 � g for 10min to obtain cell pellets. The cell pellets were immediately frozen in liquidnitrogen and then stored at �70°C until they were processed.
Purification of total RNA from X. dendrorhous. RNA extraction was performedby using the method described by Chomczynski and Sacchi (13) and modified forX. dendrorhous as follows. To the cellular material, 3 to 5 ml of Chomczynskisolution in phenol (Ch-P solution) was added, and then 1 volume of glass beads(diameter, 425 to 600 �m; Sigma) was added. Cells were broken by shaking witha vortex at the maximum speed for 10 min. The mixture was incubated for 10 minat room temperature, and this was followed by addition of 0.2 ml of chloroformper ml of Ch-P solution with shaking and incubation at room temperature for 5min. After centrifugation at 12,100 � g, the RNA in the aqueous phase wastransferred to a sterile tube, and 1 volume of isopropanol was added. Afterincubation for 10 min at room temperature, the RNA was precipitated bycentrifugation at 12,100 � g for 10 min at 4°C. The RNA pellet was washed with1 ml of 75% ethanol. The RNA was resuspended in water (diethyl pyrocarbonatetreated) and then stored at �20°C. The total RNA concentration was deter-
mined spectrophotometrically at 260 nm, and aliquots of the extracts weresubjected to denaturing agarose gel electrophoresis to check RNA integrity.
RT. The RNA samples were treated with 1 U of DNase I (RNase free; Roche)per �l in 2.5 mM MgCl2 for 30 min at 25°C. The reaction was stopped by additionof EDTA at a final concentration of 2.5 mM and heating at 65°C for 15 min. TheRT reaction was performed in a 25-�l (final volume) mixture containing 3 �g oftotal RNA, 75 pmol of oligo(dT15-18), each deoxynucleoside triphosphate(dNTP) at a concentration of 0.5 mM, and 200 U of Moloney murine leukemiavirus reverse transcriptase (Promega). The reaction mixture was incubated for 60min at 42°C and then heated for 10 min at 65°C.
PCR amplification. The sequences of all the primers used in this study areshown in Table 2, and their locations in gene sequences are indicated in Table 2and Fig. 1. To clone crtI and crtYB cDNAs, specific primers upstream of trans-lation initiation sites and downstream of translation termination sites were de-signed by using the sequences of strains CBS 6938 (accession numbers Y15007and AJ133646, respectively) and UCD 67-385 (1, 21). PCR amplification wasperformed with 1 U of VentR DNA polymerase (New England Biolabs) in a25-�l (final volume) mixture containing 2.5 �l of 10� VentR DNA polymerasebuffer, 0.5 �l of a solution containing each dNTP at a concentration of 10 mM,1 �l of a solution containing each primer at a concentration of 25 �M, 2 �l of anRT reaction mixture containing the single-stranded cDNA, and 18 �l of water.PCR was performed with a 2400 DNA thermal cycler (Perkin-Elmer) by usingthe following program: 95°C for 3 min, 35 cycles of 94°C for 30 s, 55°C for 30 s,and 72°C for 3 min, and a final extension at 72°C for 10 min. The PCR productswere electrophoresed on 0.7 or 1% agarose gels and stained with ethidiumbromide. To quantify RT-PCR products, 28 cycles of amplification were em-ployed with annealing temperatures of 60°C for amplification of crtI cDNAs and55°C for amplification of crtYB cDNAs. PCR amplification was performed with2 U of Taq polymerase (Promega) in a 25-�l (final volume) mixture containing2.5 �l of 10� Taq buffer, 0.5 �l of a solution containing each dNTP at aconcentration of 10 mM, 1 �l of a solution containing 50 mM MgCl2, 1 �l of asolution containing each primer at a concentration of 25 �M, 2 �l of an RTreaction mixture containing the single-stranded cDNA, and water. All PCRamplifications were performed at least by duplicate and were standardized forthe concentration of single-stranded cDNA used and the number of amplifica-tion cycles. Equal volumes containing the PCR products were loaded on 3%agarose gels containing ethidium bromide for the quantification of RT-PCRproducts from the crtI gene, while 4.5% polyacrylamide gels were used in the caseof the crtYB gene. After agarose gel electrophoresis, the masses of the bandswere quantified by using a 100-bp DNA ladder containing known concentrationsof compounds (Fermentas) and Kodak Digital Science 1D image analysis soft-ware. Only those bands whose intensity was not oversaturated were used forquantification. To normalize for sample-to-sample variation due to RT and PCRefficiency, relative values were obtained by comparing the intensities of thecarotenogenic gene amplification bands with the intensity of the actin (act)amplification product. The primers used for amplification of the act gene were
TABLE 1. Plasmids and strains used in this study
Strain or plasmid Genotype or relevant features Source or reference
X. dendrorhous (Phaffia rhodozyma)UCD 67-385 or ATCC 24230
Wild type
atxS2 Astaxanthin-overproducing strain after N-methyl-N�-nitro-nitrosoguanidinetreatment of strain UCD 67-385
Unpublished data
PlasmidspL25 pBluescript carrying a 3.6-kb PCR product containing the complete crtI gene 21pC13 pBluescript with a 18.5-kb BamHI fragment which contains the crtI gene,
isolated from a genomic library of X. dendrorhous21
pl43 Clone carrying a crtl cDNA insert which conserves 80 bp of the first intron inpBluescript
This study
pl41 Contains a cDNA insert encoding phytoene desaturase of X. dendrorhous inpBluescript
This study
pYBm Contains a cDNA insert encoding phytoene synthase-lycopene cyclase of X. den-drorhous in pBluescript
This study
pYBa Clone carrying a crtYB cDNA insert which conserves 55 bp of the first intronand 96 bp of the second exon in pBluescript
This study
VOL. 69, 2003 ALTERNATIVE SPLICING OF TRANSCRIPTS 4677
designed by using previously described sequences (43). The level of expression ofthe act gene is constant throughout the yeast growth cycle.
Biomass determination and carotenoid extraction. The cell concentration wasmeasured by determining the turbidity of the culture at 560 nm or by cellcounting in a Neubauer chamber. For dry cell weight determinations, cells from3- to 5-ml cultures were pelleted, washed with distilled water, and then dried at80°C overnight. The acetone extraction method described by An et al. (2) wasemployed to extract carotenoids from cellular pellets. Total carotenoid concen-trations were calculated by using the absorption coefficient (A1% � 2,100) (2). All
analyses were carried out in duplicate or triplicate, and the average values andstandard deviations are reported below.
Nucleotide sequence accession numbers. The cDNA nucleotide sequences ofthe mature mRNA of the crtI gene (crtI mmRNA), the alternative mRNA of the crtIgene (crtI amRNA), the mature mRNA of the crtYB gene (crtYB mmRNA), andthe alternative mRNA of the crtYB gene (crtYB amRNA) from X. dendrorhousstrain UCD 67-385 have been deposited in the GenBank database under acces-sion numbers AY177424, AY177425, AY177204, and AY174117, respectively.
RESULTS
Isolation of alternative spliced mRNAs of crtI and crtYBgenes. To clone the cDNA from the crtI and crtYB genes, wecarried out RT-PCR assays with total RNA samples isolatedfrom stationary-phase cultures of X. dendrorhous grown in YMmedium. Primers upstream from the translation initiationcodon and downstream from the stop codon were designed foreach gene to amplify the entire coding region (Table 2 and Fig.1). The first-strand cDNA synthesis was performed with totalRNA samples previously treated with DNase by using oli-go(dT). Then crtYB and crtI cDNAs were amplified by using aTaq DNA polymerase with proofreading activity. RT-PCRwith primers 1 and 5 for the crtI gene gave rise to a product ofapproximately 2 kb (Fig. 2A), which was extracted from theagarose gel and cloned in pBlueskript SK. Restriction analysisof 28 recombinant clones indicated that 16 of them had cDNAinserts of about 2.1 kb, while 12 clones had inserts of about 2.0kb (Fig. 2B, lanes 1 and 2). The nucleotide sequences of threeclones, two with 2.1-kb inserts and one with a 2.0-kb insert,were determined. Comparison of these nucleotide sequenceswith the previously published genomic sequence revealed thatone cDNA product had been synthesized from an mRNAwhich had conserved 80 bp of the first intron (crtI amRNA).The other cDNA insert corresponded to the mmRNA of thecrtI gene without any introns (crtI mmRNA). Nucleotide se-quence translation of the crtI amRNA resulted in stop codonsalong the entire sequence.
The crtI amRNA could have been synthesized from an RNA
FIG. 1. Structure of the genomic DNA, mmRNA, and amRNA ofthe crtI gene (A) and the crtYB gene (B). E, exon; I, intron; AG,alternative splicing acceptor site; GT, alternative splicing donor site.The horizontal arrows indicate the locations of the primers used inPCR, which are described in Table 2. (A) The dotted lines indicate the80 bases of the first intron present in the crtI amRNA. (B) The dottedlines indicate the 55 bases of the first intron present in the crtYBamRNA, while the 96 bases of the second exon conserved in thistranscript are highlighted. The diagram is not to scale.
TABLE 2. Primers used in this study
Gene Primer Directiona Sequence (5�33�) Location
act ACT3 F ACTCCTACGTTGGTGACGAG Spanning exon 4 and exon 5ACT4 R TCAAGTCTCGACCGGCCAAG Exon 5
crtI 1 F CCTCGCCGAATCTAACTTGA Upstream translation initiation2 F AGCTATCATCGTGGGATGTGGb Spanning exon 1 and exon 23 F GTATCGGTGGAATCGCCACT Exon 24 F AGCTATCATCGTGGTTTAATCCc Spanning exon 1 and intron 15 R AACGAATAAAAAAGATGATGAACA Downstream translation termination6 R GACCCAATCTTCCATCTTCTCT Exon 57 R TTCTCGAACACCGTGACCT Exon 28 R AACGGATCGAGCGATCACGG Exon 12
crtYB 9 F CCGATCTCGGATAGACATCA Upstream translation initiation10 F TACCCAACTCGTATCATCCC Upstream translation initiation11 F GCATATTACCAGATCCATCTGb Spanning exon 1 and exon 212 F GTGTGCATATGTGTTGCAACCc Spanning intron 1 and exon 213 R AGGAAGATGGGGGGAAGA Downstream translation termination14 R AGTCTTTATGGTCTATAACCT Downstream translation termination15 R TCTAGAAACGTTCCAAACACG Exon 2
a F, forward; R, reverse.b Specific for mmRNA.c Specific for amRNA.
which followed an alternative splicing pathway by using anunexpected acceptor site (AG in Fig. 1A). Another possibilityis that a crtI gene with the new structure may have been presentin the genome of X. dendrorhous. To test the latter proposal,we designed a forward primer (primer 4 in Fig. 1) specific forcrtI amRNA spanning the first exon and the first intron se-quence absent in the crtI mmRNA. As templates for PCR weemployed genomic DNA, RT reaction mixtures, and DNAfrom plasmids pL25 and pC13, both of which carry the crtIgene (Table 1). Figure 3 shows that when genomic or plasmidDNA was used as the template, PCR performed with primers3 and 8 (Fig. 1A) resulted in a principal product whose ex-pected size was about 2.6 kb (lanes 1, 2, and 3). In contrast,when PCR was performed with genomic or plasmid DNA andprimers 4 and 8, there was no amplification product (Fig. 3,lanes 5, 6, and 7). In the same experiment, RT-PCR performedwith primers 3 and 8 resulted in an approximately 1.7-kb prod-uct due to the absence of introns, while an approximately1.8-kb product was amplified by using primers 4 and 8 (Fig. 3,lanes 4 and 8). These results suggest that the crtI amRNAcould have been the result of an alternative splicing pathwayand not the transcription product of a new crtI gene with adifferent structure, as has been described previously (40).
Next, we carried out RT-PCR assays to amplify crtYBcDNA, and as a result, two different products were cloned inpBlueskript SK. Nucleotide sequence analysis indicated thatone of these products was synthesized from crtYB mmRNA.The other cloned cDNA product had an unexpected sequenceas it had 55 bp of the first intron conserved and had lost 111 bpof the second exon. As shown in Fig. 1B, the new isolatedcDNA could have been synthesized from an mRNA whichfollowed a splicing pathway in alternative 5� and 3� splice sites(GT and AG in Fig. 1B), producing crtYB amRNA. Similarly,
as established for the crtI amRNA, translation of the crtYBamRNA yielded several stop codons along the complete se-quence.
Expression of crtI and crtYB messengers as a function of theage of the culture. X. dendrorhous strains UCD 67-385 andatxS2 (atxS2 was an astaxanthin-overproducing mutant derivedfrom the wild type) were grown in fermentor batch cultures,and the levels of crtI and crtYB gene transcripts were deter-mined by RT-PCR. Primers 2 and 6 were employed for analysisof the crtI mmRNA levels, while for crtI amRNA we usedprimers 4 and 7 (Table 1). To analyze crtYB mmRNA levels,primers 11 and 15 were used, while crtYB amRNA levels wereanalyzed with primers 12 and 15 (Table 1). In addition, wedesigned primers for amplification of the act gene, which wasused as an internal standard in RT-PCR assays. The levels ofcrtI messengers in relation to the act mRNA level for each timepoint were quantified, and the ratio of crtI mmRNA to crtIamRNA (M/A ratio) was calculated. The M/A ratio decreasedwith the age of culture for the wild-type strain (Fig. 4A).However, the cellular concentration of carotenoids began toincrease after 27 h of culture. After 13 h of growth, crtIamRNA was detectable, but the level was too low to be deter-mined, while the level of crtI mmRNA was high enough to bequantified. This means that in the early stage of the growthcycle a high proportion of crtI RNA was processed tommRNA, which could be translated to phytoene desaturaseprotein, but the level of mmRNA decreased with the age of theculture. With the atxS2 strain, the M/A ratio also decreasedwith the age of culture (Fig. 4B). As in the wild-type strain, thecellular concentration of carotenoids increased during the sta-tionary phase even though the proportion of mmRNA was lessthan the proportion in the exponential phase.
With regard to the crtYB gene, Fig. 5 shows that themmRNA and the amRNA were detected at different culturetimes and that there were variable levels for both strains. Inthis case, the levels of amRNA and mmRNA at many timepoints were too low to be quantified by the methodology em-ployed previously.
FIG. 2. (A) Amplification of the crtI mRNA by RT-PCR with prim-ers 1 and 5. (B) The amplification band was cloned, and ampicillin-resistant transformants had plasmids with different inserts (lanes 1 and2). Lane M contained the �/HindIII molecular size marker.
FIG. 3. Amplification of the crtI gene with primers 3 and 8 (lanes 1,2, 3, and 4) and with primers 4 and 8 (lanes 5, 6, 7, and 8). Thesubstrates used for PCR were DNA of plasmid pL25 (lanes 1 and 5),DNA of plasmid pC13 (lanes 2 and 6), genomic DNA (gDNA) (lanes3 and 7), and RT reaction products (lanes 4 and 8). Lanes M containedthe 29/HindIII DNA ladder.
VOL. 69, 2003 ALTERNATIVE SPLICING OF TRANSCRIPTS 4679
In this paper we describe isolation of amRNAs of the crtIand crtYB genes, whose predicted translation yielded numer-
ous stop codons. However, the correct reading frame of thesetranscripts was restored downstream from the proper initialAUG. In this way, a phytoene desaturase without 81 aminoacids of the N-terminal part of the protein could be synthesizedfrom the crtI amRNA if translation could be initiated at aninternal in-frame AUG. Similarly, the crtYB amRNA could betranslated to a phytoene synthase-lycopene cyclase without 153amino acids of the N-terminal part of the protein. Vittorioso etal. (42) reported al-3 mRNA translation from two internalin-frame AUG codons, which produced a shortened but stillactive version of GGPP synthase protein as it conserved thedomains shared by prenyltransferase enzymes. In the phytoenedesaturase from X. dendrorhous, the N-terminal part of theprotein has a dinucleotide [flavin adenine dinucleotide orNAD(P)] binding motif that is conserved in phytoene desatu-rases from bacteria, algae, plants, and fungi (4, 18, 40). Thisindicates that it is unlikely that a shortened phytoene desatu-rase lacking 81 N-terminal amino acids would still be active.Similarly, a phytoene synthase-lycopene cyclase enzyme with-out 153 N-terminal amino acids would be inactive becausetruncation at the 5� end of the crtYB cDNA at nucleotideposition 514 not only resulted in a total loss of lycopene cy-clization activity but also affected about 70% of the phytoenesynthesis activity (41).
Analysis of the intron positions in phytoene desaturase- andphytoene synthase-lycopene cyclase-encoding genes from fungiindicates that the first intron of these genes is located in thesame relative sequence position in basidiomycetes (X. dendro-rhous) and ascomycetes (Neurospora crassa and Gibberella fu-jikuroi) (Fig. 6). The first intron in both genes could have beenacquired by the ancestor of the basidiomycetes and ascomyce-tes after separation of the zygomycetes, since the fungi Mucorcircinelloides and Phycomyces blakeesleanus lack these introns.Additionally, a nucleotide sequence comparison of the firstintron showed that the alternative splicing sites of the crtI andcrtYB genes of X. dendrorhous are absent in N. crassa andG. fujikuroi (Fig. 6). Therefore, phytoene desaturase andphytoene synthase-lycopene cyclase RNAs from ascomyce-tes would not follow an alternative splicing pathway, as de-
FIG. 4. Kinetics of expression of crtI mmRNA and crtI amRNA forX. dendrorhous strains UCD 67-385 (A) and atxS2 (B). The level ofeach crtI messenger was normalized by using the level of the actmessenger. Each value is relative to the highest value of the curve(which was defined as 1). Symbols: F, number of cells; Œ, carotenoidconcentration; �, M/A ratio.
FIG. 5. Amplification by RT-PCR of act mRNA, crtYB mmRNA, and crtYB amRNA of X. dendrorhous strains UCD 67-385 (A) and atxS2 (B).Total RNA samples were isolated from cells of cultures at various times (in hours), as indicated at the top of each gel. The same RT reactionmixtures were amplified with primers for the act gene and primers for the crtYB gene. The same reaction volume was loaded in each lane. In thecase of the crtYB gene, the total reaction mixture was loaded.
scribed in this study. The nucleotide sequence of the first crtIintron from strain UCD 67-385 has two mutations, C3A andT3G, compared to the nucleotide sequence of strain CBS6938 (Fig. 6A). There are also nucleotide changes in a genomicDNA clone derived from strain UCD 67-385 (21). These mu-tations could be responsible for the splicing in the alternative3� site and the high proportion of clones with alternativecDNA compared to clones with proper cDNA (16 and 12clones, respectively). It remains to be determined whetherstrain CBS 6938 synthesizes a crtI amRNA and, if it does, whatthe proportion of alternative and productive mRNAs is.
Analysis of expression of the crtI and crtYB genes indicatedthat crtI mRNA and crtYB mRNA levels decreased during thestationary phase. In addition, the level of the crtI mRNAspliced in a proper form in relation to the amRNA decreasedas a function of the age of the culture. It could be hypothesizedthat splicing of the crtI RNA to an unproductive form could bea way to descrease the concentration of the phytoene desatu-
rase protein even though carotenoid synthesis increases afterthe late exponential phase (Fig. 5). In the nematode C. eleganssplicing of the RNA encoding the ribosomal protein RPL-12 isa regulated process for productive or unproductive transcripts(25). Therefore, protein RPL-12 appears to autoregulate itsown rpl-12 RNA splicing to an unproductively spliced mRNAdepending on the cellular concentration of the protein. Re-cently, two cytochrome P450 monooxygenease genes (pc-1 andpc-2) and two splice variants of pc-1 in the basidiomycetousfungus Phanerochaete chrysosporium have been cloned and se-quenced (44). Translation of one of the splice products indi-cated that there was a frameshift and that stop codons werepresent. The physiological significance of these splice variantsin P. chrysosporium is unknown. In X. dendrorhous, the M/Aratios for both genes could vary depending on environmentalor physiological conditions, such as the age of the culture, asfound with the crtI gene. It remains to be established whether
FIG. 6. Phytoene desaturase protein (A) and phytoene synthase-lycopene cyclase protein (B) from the fungi M. circinelloides (Mc), P.blakesleeanus (Pb), X. dendrorhous (Xd), N. crassa (Nc), and G. fujikuroi (Gf). The arrowheads indicate the relative positions of introns in thenucleotide sequences. In each panel alignment of the first intron for both genes is shown. Identical bases in X. dendrorhous and/or N. crassa andG. fujikuroi are shaded. The alternative splice signals inside the introns are enclosed in boxes. The asterisks indicate the C3A and T3G mutationsin the X. dendrorhous UCD 67-385 sequence compared with the previously published sequence of strain CBS 6938 (accession number Y15007).
VOL. 69, 2003 ALTERNATIVE SPLICING OF TRANSCRIPTS 4681
production of unproductive transcripts is a regulated processand, if it is, what the effect on carotenoid biosynthesis is.
ACKNOWLEDGMENTS
This work was supported by grant DID ENL-2000/17 from theUniversity of Chile. Deutscher Akademischer Austanschdienst pro-vided a graduate scholarship to P. Lodato.
We thank Carlos Medina for discussions concerning the structureand origin of the first intron of the crtI and crtYB genes, Carlos Jerezfor critical reading of the manuscript, and Antonio Jimenez for pro-viding primers.
REFERENCES
1. Alcaıno, J. 2002. Engineer in Biotechnology thesis. University of Chile,Santiago.
2. An, G.-H., D. B. Schuman, and E. Johnson. 1989. Isolation of Phaffiarhodozyma mutants with increased astaxanthin content. Appl. Environ. Mi-crobiol. 55:116–124.
3. Andrewes, A. G., H. J. Phaff, and M. P. Starr. 1976. Carotenoids of Phaffiarhodozyma, a red-pigmented fermenting yeast. Phytochemistry 15:1003–1007.
4. Armstrong, G. A. 1994. Eubacteria show their true colors: genetics of carot-enoid pigment biosynthesis from microbes to plants. J. Bacteriol. 176:4795–4802.
5. Armstrong, G. A. 1997. Genetics of eubacterial carotenoid biosynthesis: acolorful tale. Annu. Rev. Microbiol. 51:628–659.
6. Arrach, N., R. Fernandez-Martın, E. Cerda-Olmedo, and J. Avalos. 2001. Asingle gene for lycopene cyclase, phytoene synthase, and regulation of car-otene biosynthesis in Phycomyces. Proc. Natl. Acad. Sci. USA 98:1687–1692.
7. Arrach, N., T. J. Schmidhauser, and J. Avalos. 2002. Mutants of the carotenecyclase domain of al-2 from Neurospora crassa. Mol. Genet. Genomics 266:914–921.
8. Birch, P. R. J., P. F. G. Sims, and P. Broda. 1995. Substrate-dependentdifferential splicing of introns in the regions encoding the cellulose bindingdomains of two exocellobiohydrolase I-like genes in Phanerochaete chryso-sporium. Appl. Environ. Microbiol. 61:3741–3744.
9. Boel, E., I. Hjort, B. Svensson, F. Norris, K. E. Norris, and N. P. Fiil. 1984.Glucoamylases G1 and G2 from Aspergillus niger are synthesized from twodifferent but closely related mRNAs. EMBO J. 3:1097–1102.
10. Boyle, J. S., and A. M. Lew. 1995. An inexpensive alternative to glassmilk forDNA purification. Trends Genet. 11:8.
11. Canfield, L. M., J. W. Forage, and J. G. Valenzuela. 1992. Carotenoids ascellular antioxidants. Proc. Soc. Exp. Biol. Med. 200:260–265.
12. Carattoli, A., N. Romano, P. Ballario, G. Morelli, and G. Macino. 1991. TheNeurospora crassa carotenoid biosynthetic gene (Albino 3) reveals highlyconserved regions among prenyltransferases. J. Biol. Chem. 266:5854–5859.
13. Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolationby acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Bio-chem. 162:156–159.
14. Cifuentes, V., G. Hermosilla, C. Martınez, R. Leon, G. Pincheira, and A.Jimenez. 1997. Genetics and electrophoretic karyotyping of wild-type andastaxanthin mutant strains of Phaffia rhodozyma. Antonie Leeuwenhoek72:111–117.
15. Davis, C. A., L. Grate, M. Spingola, and M. Ares, Jr. 2000. Test of intronpredictions reveals novel splice sites, alternatively spliced mRNAs and newintrons in meiotically regulated genes of yeast. Nucleic Acids Res. 28:1700–1706.
16. Devereux, J., P. Haeberli, and O. Smithies. 1984. A comprehensive set ofsequence analysis programs for the VAX. Nucleic Acids Res. 12:387–395.
17. Habara, Y., S. Urushiyama, T. Tani, and Y. Ohshima. 1998. The fission yeastprp10� gene involved in pre-mRNA splicing encodes a homologue of highlyconserved splicing factor, SAP155. Nucleic Acids Res. 26:5662–5669.
18. Hirschberg, J. 1998. Molecular biology of carotenoid biosynthesis, p. 149–191. In G. Britton, S. Liaaen-Jensen, and H. Pfander (ed.), Carotenoids:biosynthesis and metabolism. Birkhauser Verlag, Basel, Switzerland.
19. Johnson, E., D. E. Conklin, and M. J. Lewis. 1977. The yeast Phaffiarhodozyma as dietary pigment source for salmonids and crustaceans. J. Fish.Res. Board Can. 34:2417–2421.
20. Johnson, E., and M. Lewis. 1979. Astaxanthin formation by the yeast Phaffiarhodozyma. J. Gen. Microbiol. 115:173–183.
21. Leon, R. 2000. Ph.D. thesis. University of Chile, Santiago.22. Lopez, J. A. 1998. Alternative splicing of pre-mRNA: developmental conse-
quences and mechanisms of regulation. Annu. Rev. Genet. 32:279–305.23. Martınez, C. 1995. Ph.D. thesis. University of Chile, Santiago.24. Miller, M. W., M. Yoneyama, and M. Soneda. 1976. Phaffia, a new yeast
genus in the Deuteromycotina (Blastomycetes). Int. J. Syst. Bacteriol. 26:286–291.
25. Mitrovich, Q. M., and P. Anderson. 2000. Unproductively spliced ribosomalprotein mRNAs are natural targets of mRNA surveillance in C. elegans.Genes Dev. 14:2173–2184.
26. Modrek, B., A. Resch, C. Grasso, and C. Lee. 2001. Genome-wide detectionof alternative splicing in expressed sequences of human genes. Nucleic AcidsRes. 29:2850–2859.
27. Navarro, E., V. L. Ruiz-Perez, and S. Torres-Martınez. 2000. Overexpressionof the crgA gene abolishes light requirement for carotenoid biosynthesis inMucor circinelloides. Eur. J. Biochem. 267:800–807.
28. Nigoyi, K. N., O. Bjorkman, and A. R. Grossman. 1997. The roles of spe-cific xanthophylls in photoprotection. Proc. Natl. Acad. Sci. USA 94:14162–14167.
29. Palozza, P., and N. I. Krinsky. 1992. Astaxanthin and cantaxanthin arepotent antioxidants in a membrane model. Arch. Biochem. Biophys. 297:291–295.
30. Retamales, P., G. Hermosilla, R. Leon, C. Martınez, A. Jimenez, and V.Cifuentes. 2002. Development of the sexual reproductive cycle of Xantho-phyllomyces dendrorhous. J. Microbiol. Methods 48:87–93.
31. Ruiz-Hidalgo, M. J., E. P. Benito, G. Sandmann, and A. P. Eslava. 1997. Thephytoene dehydrogenase gene of Phycomyces: regulation of its expression byblue light and vitamin A. Mol. Gen. Genet. 253:734–744.
32. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, N.Y.
33. Schmidhauser, T. J., F. R. Lauter, V. E. A. Russo, and C. Yanofsky. 1990.Cloning, sequence and photoregulation of al-1, a carotenoid biosyntheticgene of Neurospora crassa. Mol. Cell. Biol. 10:5064–5070.
34. Schmidhauser, T. J., F. R. Lauter, M. Schumacher, W. Zhou, V. E. A. Russo,and C. Yanofsky. 2066. 1994. Characterization of al-2, the phytoene synthasegene of Neurospora crassa. J. Biol. Chem. 269:12060–12061.
35. Spike, C. A., J. E. Shaw, and R. K. Herman. 2001. Analysis of smu-1, a genethat regulates the alternative splicing of unc-52 pre-mRNA in Caenorhabditiselegans. Mol. Cell. Biol. 21:4985–4995.
36. Thompsom, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W:improving the sensitivity of progressive multiple sequence alignment throughsequence weighting, position-specific gap penalties and weight matrix choice.Nucleic Acids Res. 22:4673–4680.
37. Thornewell, S. J., R. B. Peery, and P. L. Skatrud. 1997. Cloning and char-acterization of CneMDR1: a Cryptococcus neoformans gene encoding a pro-tein related to multidrug resistance proteins. Gene 201:21–29.
38. Torrissen, O. J., R. W. Hardy, and K. D. Shearer. 1989. Pigmentation ofsalmonids carotenoid deposition and metabolism. Aquat. Sci. 1:209–225.
39. Velayos, A., A. P. Eslava, and E. A. Iturriaga. 2000. A bifunctional enzymewith lycopene cyclase and phytoene synthase activities is encoded by thecarRP gene of Mucor circinelloides. Eur. J. Biochem. 267:5509–5519.
40. Verdoes, J. C., N. Misawa, and A. J. J. van Ooyen. 1999. Cloning andcharacterization of the astaxanthin biosynthetic gene encoding phytoenedesaturase of Xanthophyllomyces dendrorhous. Biotechnol. Bioeng. 63:750–755.
41. Verdoes, J. C., P. Krubasik, G. Sandmann, and A. J. J. van Ooyen. 1999.Isolation and functional characterisation of a novel type of carotenoid bio-synthetic gene from Xanthophyllomyces dendrorhous. Mol. Gen. Genet. 262:453–461.
42. Vittorioso, P., A. Carattoli, P. Londei, and G. Macino. 1994. Internal trans-lational initiation in the mRNA from the Neurospora crassa albino-3 gene.J. Biol. Chem. 269:26650–26654.
43. Wery, J., M. J. M. Dalderup, J. ter Linde, and A. J. J. van Ooyen. 1996.Structural and phylogenetic analysis of the actin gene from the yeast Phaffiarhodozyma. Yeast 12:641–651.
44. Yadav, J. S., M. B. Soellner, J. C. Loper, and P. K. Mishra. 2003. Tandemcytochrome P450 monooxygenase genes and splice variants in the white rotfungus Phanerochaete chrysosporium: cloning, sequence analysis, and regu-lation of differential expression. Fungal Genet. Biol. 38:10–21.
45. Ye, D., C.-H. Lee, and S. F. Queener. 2001. Differential splicing of Pneumo-cystis carinii f. sp. carinii inosine 5�-monophosphate dehydrogenase pre-mRNA. Gene 263:151–158.
