1
SUPPLEMENTARY INFORMATION
Supplementary Materials and Methods
Supplementary References
Supplementary Tables
Supplementary Figures
2
SUPPLEMENTARY MATERIALS AND METHODS
Patient samples
Bone marrow (BM) diagnosis of AML was performed according to the French-American-British
criteria and the WHO classification.1,2
Detection of t(8;21) was routinely accomplished by
standard cytogenetic techniques and (or) by FISH using commercially available AML1/ETO
(A/E) probe (Vysis Inc.). Molecular genetic analysis for A/E transcripts and KIT mutation was
carried out by using RT-PCR. Patients were treated with cytarabine 100 mgm2day continuous
infusion on days 1 to 7 plus daunorubicin (60 mgm2day, DA) or idarubicin (10 mgm
2day, IA)
or mitoxantrone (10 mgm2day, MA) on days 1 to 3 for induction therapy, followed by
intermediate/high dose cytarabine (1.5-2 gm2, every 12 hours on days 1 to 3) or standard-dose
cytarabine-based chemotherapy (DA/IA/MA) for consolidation. Allogeneic and autologous
hematopoietic stem-cell transplantations were performed in a risk-adapted and priority-based
manner. Mononuclear cells from BM samples of patients and 15 healthy donors were prepared
by Ficoll-Hypaque (Sigma-Aldrich, St Louis, MO) gradient centrifugation. Fresh primary blasts
were obtained from BM samples of 3 newly diagnosed AML patients with >80% blasts and
cultured as previously described3 for subsequent clonogenic assays.
Cell lines
Human AML cell line Kasumi-1 [carrying t(8:21) (q22;q22) and mutKIT], murine myelogenous
leukemia cell line C1498 and human embryonic kidney cell line 293T were purchased from
American Type Culture Collection (Manassas, VA). SKNO-1PGK [carrying t(8:21) (q22;q22)
and mutKIT], SKNO-1siA/E, U937MT and U937A/E cell lines were kindly provided by Dr.
Clara Nervi.4 Kasumi-1, SKNO-1PGK, SKNO-1siA/E, U937MT and U937A/E cell lines were
3
maintained in RPMI 1640 medium supplemented with 50 µg/ml streptomycin, 50 IU/ml
penicillin plus 20% (Kasumi-1) or 10% (others) FBS (Life Technology). C1498 and 293T cell
lines were maintained in DMEM medium supplemented with 50 µg/ml streptomycin, 50 IU/ml
penicillin and 10% FBS.
Plasmids
The following mammalian expression plasmids were purchased from Addgene (Cambridge,
USA): pCMV-AML1/ETO (Addgene ID 12428),5 HA-HIF1a-pcDNA3.0 (Addgene ID 18949).
6
A 1000-2000 bp of sequence upstream of the transcription start site of the human AML1, HIF1
or DNMT3a gene was subcloned into the KpnI and HindIII sites of the luciferase reporter vector
pGL3-basic (Promega, Madison, WI). Various mutants were generated by QuikChange
Lightning Site-Directed Mutagenesis Kit according to manufacturer’s instruction (QuikChange,
Agilent Technologies). All constructs were verified by DNA sequencing. Primer sequences are
listed in Supplemental Table S5.
Cell transfection and drug treatment
For siRNA-mediated gene knockdown, 1×106 of Kasumi-1, SKNO-1PGK or C1498 cells were
seeded into 6-well plate for overnight before transfection. siRNAs used in this study were ON-
TARGETplus SMARTpool purchased from Thermal Scientific Dharmacon RNAi Technologies
(Thermo Scientific, MA): siHIF1 (L-004018-00), siRUNX1T1 (L-011824-00), siDNMT3a (L-
065433-01) and ON-TARGETplus Non-targeting Pool (D-001810-10-05). A total of 100 nM of
siRNAs or the corresponding negative control was transfected into cells using Lipofectamine™
RNAiMAX Reagent (Life Technologies, Grand Island, NY) according to the manufacturer’s
instruction. For plasmid overexpression, 2×105 of 293T or C1498 cells were seeded into 6-well
4
plate for overnight before transfection. A total of 2.5 μg of expression plasmids or the
corresponding empty vectors were transfected into cells using Lipofectamine™ 2000 reagent
(Life Technologies) according to the manufacturer’s instruction. For electroporation, 1×107 of
C1498 cells were resuspended in 380 L serum- and antibiotic-free DMEM medium. The cells
were mixed with 30 μg of plasmids in a 0.4 cm gap sterile electroporation cuvette and
electroporated using Gene Pulser Xcell electroporation system (Bio-Rad, Hercules, CA). For co-
transfection experiments, the total amount of the transfected DNA or siRNA in the individual
agent group was kept constant with the co-transfection group by adding equal amount of empty
vector or negative control. Note, in co-expression and co-knockdown experiments determining
the cooperation between A/E and HIF1, the amount of expression plasmids or siRNAs was
reduced to half of those used as single agents. Regarding the drug treatment, Kasumi-1, SKNO-
1PGK, SKNO-1siA/E or A/E-positive primary blasts isolated from patients were treated with
indicated concentrations of Echinomycin Streptomyces sp. (Calbiochem-Novabiochem, San
Diego, CA) or vehicle (DMSO, 0.1% v/v) for 24 hours.
Reporter assays
293T cells were seeded into 24-well plates at a concentration of 5×104 per well and grown
overnight. The transfection mixtures, contained 400 ng of firefly luciferase reporter plasmid, 2
ng of pRL-TK Renilla luciferase plasmid (Promega) and 0 to 100 ng of indicated expression
vectors were transfected into 293T using Lipofectamine™ 2000 reagent (Life Technologies)
according to the manufacturer’s instructions. For co-transfection experiments, the total amount
of the transfected DNA was kept constant by adding empty vector. Firefly luciferase activity was
measured 48 hours after transfection by using a dual luciferase reporter assay system (Promega).
5
Clonogenic assays
The Methylcellulose colony-forming assays were performed in triplicate using human or mouse
methylcellulose media (R&D Systems, Minneapolis, MN) according to the manufacturer's
instructions. Briefly, 6 hours after transfection with siRNAs or exposure to drugs when the cells
did not undergo apoptosis, the cells were harvested, diluted with cell resuspension solution and
mixed with human or mouse methylcellulose complete media. For the colony-forming assays
determining the biologic significance of DNMT3a in A/E and HIF1 cooperation, C1498 cells
were transfected with A/E or HIF1 expression vector using Lipofectamine™ 2000 reagent (Life
Technologies) for 24 hours, and then DNMT3a siRNA or scramble using Lipofectamine™
RNAiMAX Reagent (Life Technologies) for another 24 hours before subjected to
methylcellulose media. Colonies were scored in 7 to 10 days.
Dot blot
Genomic DNA was purified from the treated cells using DNeasy Blood & Tissue Kit (QIAGEN,
Valencia, CA). A total of 0.5 to 1 μg of DNA was denatured in 1buffer (0.4 M NaOH, 20 mM
EDTA) at 100°C for 10 minutes and mixed with an equal volume of cold 2 M ammonium acetate
(pH 7.0). Pre-wet Nylon membrane (Hybond-N, Amersham, Buckinghamshire, UK) with
6Nucleic acid transfer buffer and then assembled the membrane onto a Bio-Dot apparatus (Bio-
Rad) connected to the vacuum. After the membrane was rehydrated with 500 μl H2O, the
denatured DNA in a 200 μl solution was loaded onto the membrane. When the sample has been
filtered through, the membrane was washed by 2Nucleic acid transfer buffer, baked at 80°C for
2 hours and blocked with 5% nonfat milk for 1 hour. The DNA spotted membrane was incubated
with mouse anti-5m
C antibody listed in Supplemental Table S6 and the signal was detected by
6
horseradish peroxidase-conjugated secondary antibody and enhanced chemiluminescence. Equal
DNA loading was verified by staining the membranes with 0.2% methylene blue (Sigma-Aldrich)
(Supplementary Figure S5e). Densitometric analysis was performed using ImageJ (NIH Image,
Bethesda, MD) for quantification.
RNA isolation, cDNA preparation, and qPCR
RNA was isolated using miRNeasy Mini Kit (Qiagen) according to the manufacturer's
instructions. RT for obtaining cDNA was performed SuperScript® III First-Strand Synthesis
System (Invitrogen) according to the manufacturer’s instructions. The expression of A/E, HIF1a,
DNMT1, DNMT3a or DNMT3b was detected by qPCR using TaqMan® Gene Expression Assay
(Applied Biosystems, Foster City, CA). Expression of the target genes was determined by the
comparative Ct method using ABL1 levels for normalization.7 The expression of p15
INK4b gene
was measured by qPCR with Power SYBR® Green PCR Master Mix (Applied Biosystems) using
GAPDH levels for normalization. The sequences for the primers and probes are listed in
Supplemental Table S5.
Bisulfite sequencing analysis
About 1 g of genomic DNA was modified with sodium bisulfite using an EpiTect Bisulfite Kit
(QIAGEN). The 5' upstream flanking sequence from p15INK4b
gene was amplified by PCR using
the bisulfite-treated DNA as template. Primer sequences are shown in Supplemental Table S5.
PCR products were subcloned and then sequenced.
Chromatin immunoprecipitation (ChIP)
7
ChIP assays were performed as described previously using EZ-ChIP Assay Kit (Millipore,
Billerica, MA).8 Briefly, about 210
6 cells/assay were cross-linked with 1% formaldehyde
(Sigma-Aldrich), washed and resuspended in 1% SDS lysis buffer for sonication, in order to
yield DNA fragments with an average size of 300 to 500 bp. After being precleared with protein
G agarose, the lysates were immunoprecipitated by 5 µg of anti-HIF1 or anti-ETO antibody.
Aliquots (1%) were reserved for the negative control (input DNA). ChIP DNA was quantified by
qPCR with Power SYBR® Green PCR Master Mix. Fold change in binding was compared using
the corresponding input DNA. The primers specific for HIF1, A/E or DNMT3a gene promoter
and the antibodies used are respectively listed in Supplemental Table S5 and Supplemental Table
S6.
Western blot
The whole cellular lysates were prepared by harvesting the cells in 1cell lysis buffer [20 mM
HEPES (pH 7.6), 150 mM NaCl and 0.1% NP40] supplemented with 1Phosphatase Inhibitor
Cocktail 2 (Sigma-Aldrich), 1Phosphatase Inhibitor Cocktail 3 (Sigma-Aldrich), 1 mM PMSF
(Sigma-Aldrich) and 1Protease Inhibitor Cocktail Set III (Calbiochem-Novabiochem). The
Western blot was performed with whole cell lysates as previously described.8 The antibodies
used are listed in Supplemental Table S6. Equivalent gel loading was confirmed by probing with
-actin antibody. Densitometric analysis was performed using ImageJ for quantification.
H&E and IHC staining
Tumor tissues were fixed in 10% neutral-buffered formalin, deparaffinized, hydrated and stained
with H&E (Thermo-Scientific) or subjected to IHC Staining with the primary antibodies listed in
8
Supplemental Table S6. A horseradish peroxidase-conjugated goat anti-rabbit antibody was used
as the secondary antibody. After developing with 3, 3’-diaminobenzidine, the sections were
counterstained with hematoxylin. Images were acquired using Nikon Eclipse Ti microscope and
the immunohistochemical signal was quantified by using Image-Pro Plus software (v.4) program
(Media Cybernetics).
FACS analysis
Cells were fixed in ethanol and stained with propidium iodide and Annexin V-FITC (BD
Biosciences PharMingen, San Diego) before analyzed by FACS. FlowJo software (Version 7.6.1,
Treestar, Ashland, OR) was used for subsequent analysis.
Tumorigenesis assays
Athymic nude mice (female, 6-8 weeks old) and C57BL/6J mice (female, 6-8 weeks old) were
purchased from the Jackson Laboratory (Bar Harbor, ME) and maintained under conditions
based on the guidelines established by Research Animal Resources, University of Minnesota. For
xenograft mouse model, about 3106
of SKNO-1PGK cells were injected subcutaneously into the
bilateral flanks of the nude mice. Tumor diameters were measured with digital caliper and tumor
volume was calculated using the formula: tumor volume (mm3)=(lengthwidthheight /6).
9
Treatment was initiated on days 10 after the first injection when mean tumor volume was ~50
mm3. The mice were divided into 2 groups of 3 animals each with an average body weight of 30
g. Echinomycin (10 µg/kg) in PEG400 and saline (ratio 15:38:47) or vehicle was administered
by i.p. injection, three doses in week 1 and two doses in weeks 2 for five dosages in total. Mice
were sacrificed on days 21 after the first leukemia cell inoculation and the tumors were harvested.
The samples were immediately fixed in 10% neutral-buffered formalin and processed for H&E
9
and IHC staining. For experimental A/E and HIF1 co-transfection C1498 leukemia mouse
model, a total of 1×107
of C1498 cells, a murine myelogenous leukemia, were mixed with 12.5
g of A/E or (and) HIF1 expression plasmid and electroparated in a 0.4 cm cuvette (Bio-Rad)
using a Bio-Rad Gene Pulser II™ set to 250V, 950 µF. The total amount of the transfected DNA
was kept constant by adding empty vector. After 48 hours, about 0.1×106 of viable cells were
injected into the lateral tail vein of each C57BL/6J mouse. Mice were sacrificed on days 20 after
injection. For experimental HIF1 overexpression or knock-down in A/E9a transgenic leukemia
mouse model,10
1×106 of A/E9a primary cells were transfected with 2.5 μg of HIF1 expression
vector or 100 nM of HIF1 siRNA using Lipofectamine™ RNAiMAX Reagent (Life
Technologies). Then about 0.1×106 (HIF1α expression or empty vector) or 0.5×10
6 (HIF1α
siRNA or scramble) of viable cells were injected into the lateral tail vein of each C57BL/6J
mouse. Mice were sacrificed 7 weeks after injection. Cytospin preparations of BM cells were
processed for Giemsa staining. Lungs, spleens and livers were harvested and immediately fixed
in 10% neutral-buffered formalin and stained with H&E (Thermo-Scientific).
Statistical analysis
SPSS 20.0 software was used to process the data. Wilcoxon signed-rank test was selected to
determine the difference of AE, HIF1, DNMT1, DNMT3a or DNMT3b expression levels among
clinical samples. Spearman’s correlation coefficient (r) was used to access the correlation of
mRNA levels between genes. To compare clinical outcome of patients with different HIF1
expression levels, the cohort was stratified using the quartile grouping method described
previously.11
Patients were grouped into quartiles according to HIF1 expression levels (Q1-Q4,
each quartile containing 25% of patients) and divided into high HIF1 (Q4; n=33) and low
10
HIF1 (Q1-Q3; n=99) based on the trend observed in clinical outcome after performing a Cox
regression analysis for EFS with HIF1 quartile grouping as the independent variable. HIF1
expression ranged between 0.1965 and 10.7182 with the following median expression for each
quartile: 0.3942 (Q1), 0.8725 (Q2), 1.3020 (Q3), and 3.0218 (Q4). In this model, AE-patients in
the highest HIF1 quartile showed a significantly different EFS compared with the remaining
patients with lower HIF1 expression levels. The differences in regression coefficients with SE
for each quartile were as follows: Q1 versus Q4, -1.571 (SE 0.744), P=0.035; Q2 versus Q4, -
0.867 (SE 0.404), P=0.032; Q3 versus Q4, -0.912 (SE 0.400), P=0.023. Survival curves were
generated using the Kaplan-Meier method and the log-rank test was used to compare survival
between groups. Clinical features across groups were compared using the 2-sided Fisher exact
test for categorical data and the nonparametric Mann-Whitney U test for continuous variables.
The Cox proportional hazards model with stepwise forward selection were constructed to
determine whether HIF1 expression was associated with outcome when adjusting for other
prognostic variables. The full multivariate model used the variables significant at a 10% level in
univariate analysis, including HIF1 expression (low vs. high), KIT mutation status (mutation vs.
wild-type), WBC count (10109/L increase), BM blasts (10% increase), Age (10-year increase),
Cytarabine-based chemotherapy (high- vs. standard-dose), HSCT (allo- vs. no, auto- vs. no) and
complete remission achievement (1 vs. 2 courses). The possible influence of sample bias on the
results and the stability of the model were examined by bootstrap resampling method.12
A total
of 1000 bootstrap samples were generated for each analysis. Cox regression was run separately
on these 1000 samples to obtain robust estimates of the standard errors of coefficients, and hence
the P values and 95% confidence intervals of the model coefficients. Student’s t test was applied
11
to compare gene overexpression- or knockdown-induced changes to respective controls. A P-
value of less than 0.05 was chosen as a threshold for statistical significance.
Complete remission was defined by recovery of morphologically normal BM, normal blood
counts and no circulating leukemic blasts or evidence of extramedullary leukemia. Relapse was
defined by >5% BM blasts, circulating leukemic blasts or development of extramedullary
leukemia. OS was measured from the beginning of therapy until date of death or last follow-up.
EFS was defined as the time from study entry to first event. An event was defined as failure to
achieve a complete remission, relapse after achieving a complete remission, or death.
SUPPLEMENTARY REFERENCES
1. Bennett JM, Catovsky D, Daniel MT, Flandrin G, Galton DA, Gralnick HR et al. Proposals
for the classification of the acute leukaemias. French-American-British (FAB) co-operative
group. Br J Haematol 1976; 33: 451-458.
2. Harris NL, Jaffe ES, Diebold J, Flandrin G, Muller-Hermelink HK, Vardiman J et al. World
Health Organization classification of neoplastic diseases of the hematopoietic and lymphoid
tissues: report of the Clinical Advisory Committee meeting-Airlie House, Virginia, November
1997. J Clin Oncol 1999; 17: 3835-3849.
3. Garzon R, Liu S, Fabbri M, Liu Z, Heaphy CE, Callegari E et al. MicroRNA-29b induces
global DNA hypomethylation and tumor suppressor gene reexpression in acute myeloid
leukemia by targeting directly DNMT3A and 3B and indirectly DNMT1. Blood 2009; 113:
6411-6418.
12
4. Fazi F, Racanicchi S, Zardo G, Starnes LM, Mancini M, Travaglini L et al. Epigenetic
silencing of the myelopoiesis regulator microRNA-223 by the AML1/ETO oncoprotein. Cancer
cell 2007; 12: 457-466.
5. Meyers S, Lenny N, Hiebert SW. The t(8; 21) fusion protein interferes with AML-1B-
dependent transcriptional activation. Mol Cell Biol 1995; 15: 1974-1982.
6. Kondo K, Klco J, Nakamura E, Lechpammer M, Kaelin WG, Jr. Inhibition of HIF is necessary
for tumor suppression by the von Hippel-Lindau protein. Cancer cell 2002; 1: 237-246.
7. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time
quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001; 25: 402-408.
8. Liu S, Wu LC, Pang J, Santhanam R, Schwind S, Wu YZ et al. Sp1/NFkappaB/HDAC/miR-
29b regulatory network in KIT-driven myeloid leukemia. Cancer cell 2010; 17: 333-347.
9. Tomayko MM, Reynolds CP. Determination of subcutaneous tumor size in athymic (nude)
mice. Cancer Chemother Pharmacol 1989; 24: 148-154.
10. Yan M, Kanbe E, Peterson LF, Boyapati A, Miao Y, Wang Y et al. A previously unidentified
alternatively spliced isoform of t(8;21) transcript promotes leukemogenesis. Nat Med 2006; 12:
945-949.
11. Kühnl A, Gökbuget N, Kaiser M, Schlee C, Stroux A, Burmeister T et al. Overexpression of
LEF1 predicts unfavorable outcome in adult patients with B-precursor acute lymphoblastic
leukemia. Blood 2011; 118: 6362-6367.
12. Sauerbrei W, Schumacher M. A bootstrap resampling procedure for model building:
application to the Cox regression model. Stat Med 1992; 11: 2093-2109.
13
SUPPLEMENTARY TABLES
Supplementary Table S1.
Clinical characteristics of AML patients in GEO database GSE6891.
Characteristic Total t(8;21) non-t(8;21) P value
Patients number 461 35 426
Median age, y (range) 43 (15-61) 37 (16-54) 45 (15-61) 0.000
Sex (male/female) 231/230 21/14 210/216 0.224
FAB subtypes, no. (%) 0.003
M0 16 (3.5) 0 (0) 16 (3.8)
M1 95 (20.6) 2 (5.7) 93 (21.8)
M2 106 (23.0) 30 (85.7) 76 (17.8)
M3 24 (5.2) 0 (0) 24 (5.6)
M4 84 (18.2) 3 (8.6) 81 (19.0)
M5 104 (22.6) 0 (0) 104 (24.4)
M6 6 (1.3) 0 (0) 6 (1.4)
MDS (RAEB/RAEB-t) 4 (0.9)/13 (2.8) 0 (0)/0 (0) 4 (0.9)/13 (3.1)
unknown 9 (2.0) 0 (0) 9 (2.1)
14
Supplementary Table S2
Comparison of clinical characteristics of AML patients according to HIF1 expression.
Characteristic
Overall cohort
(n=132) P value
A/E-positive
(n=73) P value
A/E-positive & wtKIT
(n=53) P value
HIF1high HIF1low
HIF1high HIF1low
HIF1high HIF1low
Patients no. 33 99 26 47 15 38
Age a 36 (13-60) 36 (11-84) 0.885
33.5 (13-
60) 25 (11-82) 0.500 34 (13-59)
30 (11-
62) 0.560
Sex, no. (%) 0.536
Male 22 (66.7) 60 (60.6) 15 (57.7) 28 (59.6) 9 (60) 25 (65.8)
Female 11 (33.3) 39 (39.4) 11 (42.3) 19 (40.4) 0.876 6 (40) 13 (34.2) 0.692
WBC ( 109/L)
a
13.1 (1.5-
290.0)
12.8 (0.3-
362.0) 0.898
12.9 (1.5-
53.6)
14.0 (2.1-
76.3) 0.489
12.2 (2.9-
37.4)
13.9 (2.1-
76.3) 0.447
BM blasts (%) a
65.0 (21.2-
92.0)
56.0 (7.4-
97.0) 0.194
67.8 (34.0-
92.0)
54.7 (7.4-
95.0) 0.065
70.0 (36.8-
92.0)
53.1 (7.4-
95.0) 0.058
FAB subtypes, no. (%)
0.127
M2 28 (24.3) 87 (75.7) 26 (35.6) 47 (64.4) 15 (28.3) 38 (71.7)
M3 0 (0) 2 (100)
M4 5 (55.6) 4 (44.4)
M5 0 (0) 4 (100)
M6 0 (0) 2 (100)
A/E status, no.
(%) 0.002
A/E positive 26 (78.8) 47 (47.5)
A/E negative 7 (21.2) 52 (52.5)
KIT mutation status
b, no. (%)
0.001 0.034
mutKIT 11 (42.3) 9 (12) 11 (42.3) 9 (19.1)
wtKIT 15 (57.7) 66 (88) 15 (57.7) 38 (80.9)
Chemotherapy b,
no. (%) 0.905
High-dose
cytarabine-
based
8 (32.0) 20 (33.3) 8 (42.1) 11 (50.0) 5 (38.5) 9 (50.0)
Standard-dose
cytarabine-
based
17 (68.0) 40 (66.7) 11 (57.9) 11 (50.0) 0.726 8 (61.5) 9 (50.0) 0.524
HSCT, no. (%) 0.497
Allo-HSCT 9 (27.3) 26 (26.3) 5 (19.2) 9 (19.1) 2 (13.3) 7 (18.4)
Auto-HSCT 4 (12.1) 6 (6.1) 4 (15.4) 5 (10.6) 3 (20.0) 3 (7.9)
No HSCT 20 (60.6) 67 (67.7) 17 (65.4) 33 (70.2) 0.834 10 (66.7) 28 (73.7) 0.443
CR b, no. (%) 0.211
1 course 16 (64.0) 30 (49.2) 12 (66.7) 13 (56.5) 10 (76.9) 10 (55.6)
2 courses 9 (36.0) 31 (50.8) 6 (33.3) 10 (43.5) 0.509 3 (23.1) 8 (44.4) 0.220 a Values represent median (range).
b Information is not available in some cases. WBC, white
blood cell; HSCT, hematopoietic stem cell transplantation; CR, complete remission.
15
Supplementary Table S3
Multivariate analysis for OS and EFS.
Patients Variable a
P value Hazard Ratio (95.0% CI)
overall cohort
OS I/HD vs. SD cytarabine-based chemotherapy 0.001 0.198 (0.076 - 0.514)
Allo- vs. No HSCT 0.001 0.270 (0.121 - 0.603)
EFS
HIF1 high vs. HIF1 low 0.015 2.181 (1.164 - 4.087)
I/HD vs. SD cytarabine-based chemotherapy 0.001 0.284 (0.130 - 0.618)
Allo- vs. No HSCT 0.008 0.410 (0.212 - 0.795)
A/E-positive patients
OS
HIF1 high vs. HIF1 low 0.014 3.574 (1.288 - 9.918)
I/HD vs. SD cytarabine-based chemotherapy 0.006 0.197 (0.062 - 0.628)
EFS
HIF1 high vs. HIF1 low 0.003 4.304 (1.621 - 11.431)
I/HD vs. SD cytarabine-based chemotherapy 0.004 0.229 (0.083 - 0.633)
A/E-positive & wtKIT patients
OS
HIF1 high vs. HIF1 low 0.012 3.409 (1.304 - 8.915)
EFS
HIF1 high vs. HIF1 low 0.002 3.708 (1.636 - 8.406) a Variables considered for model inclusion were: HIF1 expression (low vs. high), KIT mutation
status (mutation vs. wild-type), WBC count (10109/L increase), BM blasts (10% increase), age
(10-year increase), cytarabine-based chemotherapy (intermediate/high dose- vs. standard-dose),
HSCT (allo- vs. no, auto- vs. no) and CR achievement (1 vs. 2 courses). Only variables
significantly associated with outcomes in univariate analysis were included in the multivariate
model. SD, standard dose; I/HD, intermediate/high dose.
16
Supplementary Table S4
Bootstrap resampling for variable in the multivariate model.
Patients Variable a
Regression
Coefficient Std. Error
Bootstrapa
P value 95.0% CI
overall cohort OS
I/HD vs. SD cytarabine-based
chemotherapy -1.621 0.867 0.001 -3.176 - -0.874
Allo- vs. No HSCT -1.310 0.457 0.003 -2.322 - -0.552
EFS
HIF1 high vs. HIF1 low 0.780 0.345 0.013 0.095 - 1.446
I/HD vs. SD cytarabine-based
chemotherapy -1.260 0.401 0.001 -2.148 - -0.591
Allo- vs. No HSCT -0.891 0.344 0.005 -1.603 - -0.295
A/E-positive patients
OS
HIF1 high vs. HIF1 low 1.274 0.694 0.005 0.349 - 2.685
I/HD vs. SD cytarabine-based
chemotherapy -1.623 1.250 0.001 -3.427 - -0.586
EFS
HIF1 high vs. HIF1 low 1.460 0.538 0.004 0.518 - 2.685
I/HD vs. SD cytarabine-based
chemotherapy -1.475 0.732 0.002 -2.706 - -0.681
A/E-positive &
wtKIT patients
OS
HIF1 high vs. HIF1 low 1.227 0.528 0.005 0.300 - 2.326
EFS
HIF1 high vs. HIF1 low 1.311 0.372 0.002 0.604 - 2.106 a
bootstrap results are based on 1000 bootstrap samples. SD, standard dose; I/HD,
intermediate/high dose.
17
Supplementary Table S5
Sequence of primers used in experiments.
Name (Genebank Accession No.) Primer Sequence (5' to 3')
AML1 promoter (NM_001754)
Forward 1 GGGGTACCCATCACACAGGTTCTCTTGACCCTATGTGTCG
Forward 2 GGGGTACCAGAGTGCTATGGCGGATGTAGGCAGAG
Forward 3 GGGGTACCACCAAGGACTTAACTCTCCCGGAGCTG
Reverse CCCAAGCTTTTGGCTGTGGGTTGGTGATGCTCACCA
AML1 promoter-1-Mut
Forward GGTTCTCTTGACCCTATGTGTCGAAATTTCATAGACGCAGAGTGCT
ATGGC
Reverse GCCATAGCACTCTGCGTCTATGAAATTTCGACACATAGGGTCAAGA
GAACC
HIF1 promoter (NM_001530)
Forward 1 GGGGTACCCATTTACTGAGTGCTTACTATGCACCAG
Forward 2 GGGGTACCACTTAGTAGACAAGGTGAGTTCCCCTG
Forward 3 GGGGTACCGAGCATTACATTACTGCACCAAGAGTA
Forward 4 GGGGTACCTGACGCTGCCTCAGCTCCTCAGT
Reverse CCCAAGCTTCGACACACTGGCCGAAGCGACGAAGA
HIF1 promoter-3-Mut Forward GCGGCGTGGGCGGGGACTTGCC
Reverse GGCAAGTCCCCGCCCACGCCGC
DNMT3a promoter
(NM_175629)
Forward 1 GGGGTACCCGGGGTTTCACCATGTTAGCCAGGCTGGTC
Forward 2 GGGGTACCGTGATGTGGGGTGATTTCAGAGCCGGATG
Forward 3 GGGGTACCGGCCGTGTTATATGTAAGCCCTTGATGAAGGC
Forward 4 GGGGTACCGGGGTGAGGGCGGTGTGTAGGCACACAC
Reverse CCCAAGCTTAGAGCCCACTGCGCTCTGCCTGCCTCAG
DNMT3a promoter-1-Mut-a Forward GCCTCCCAAAGTGCTACAGGCGTGAGCC
Reverse GGCTCACGCCTGTAGCACTTTGGGAGGC
DNMT3a promoter-1-Mut-b Forward GAGCAACTATGTTTCAAAAGGTGGGCTGGGCAC
Reverse GTGCCCAGCCCACCTTTTGAAACATAGTTGCTC
DNMT3a promoter-2-Mut Forward CCTCAGTTTCTTCATCTGTAAGGAGAGTACAAGCCA
Reverse TGGCTTGTACTCTCCTTACAGATGAAGAAACTGAGG
A/E expression (NM_001754)
Forward CAAGTCGCCACCTACCACAGA
Reverse AGCCTAGATTGCGTCTTCACATC
Probe FAM-CCATCAAAATCACAGTGGAT-NFQ-MGB
HIF1 expression
(NM_001530)
Forward GTACCCTAACTAGCCGAGGAAGAA
Reverse CTGAGGTTGGTTACTGTTGGTATCA
Probe FAM-TTGCACTGCACAGGCCACATTCAC-TAMRA
DNMT1 expression
(NM_001130823.1)
Forward CAAGTCCGATGGAGAGGCTAA
Reverse GTTTGCCTGGTGCTTTTCCTT
Probe FAM-CGTTCAAGAGACCCTCCTGCCTCAGC-TAMRA
DNMT3a expression
(NM_175629)
Forward CATGCCGAGGCTCACCTT
Reverse GTTTTCTTCCACAGCATTCATTCC
Probe FAM-ACCCCTACTACATCAGCAAGCGCAAGC-TAMRA
DNMT3b expression
(NM_175849.1)
Forward TCCGAGGTCTCTGCAGACAA
Reverse AGCTTTCTCCAGAGCATGGTACA
Probe FAM-CTGTTCAGCCAGCACTTTAATTTGGCCA-TAMRA
ABL1 expression (NM_007313)
Forward CTCCATTATCCAGCCCCAAA
Reverse CCCAGCTTGTGCTTCATGGT
Probe FAM-CGCAACAAGCCCACTG-NFQ-MGB
P15INK4b
expression
(NG_023297.1)
Forward CCAGATGAGGACAATGAG
Reverse AGCAAGACAACCATAATCA
18
GAPDH expression
(NM_002046.4)
Forward CTCTGCTCCTCCTGTTCGAC
Reverse GCCCAATACGACCAAATCC
P15INK4b
bisulfite sequencing
(NG_023297.1)
Forward GGTTGGTTTTTTATTTTGTTAGAG
Reverse ACCTAAACTCAACTTCATTACCCTC
HIF1 ChIP primer
(NM_001530)
Forward GCTAAACACAGACGAGCACGTG
Reverse TCACCTGAGGTGGAGGCGGGTT
AML1 ChIP primer
(NM_001754)
Forward CATTTACAACCCATCATCACA
Reverse CTCTGCTCTGCCTACATC
DNMT3a ChIP primer
(NM_175629) (P2)
Forward AACCTGGCTTTGAATCCT
Reverse TACTCTCCTCACGCTACA
DNMT3a ChIP negative control
primer (P1)
Forward ATTCCACTTCTGTCTCTATGA
Reverse AACCTTGAGGATACTATGCTAA
19
Supplementary Table S6
Antibodies used in experiments.
Antibody Application Company Catalog No. Source Dilution
DNMT3a Western blot
IHC
Santa Cruz
Biotechnology sc20703 Rabbit
Western blot:1:500
IHC: 1:250
DNMT1 Western blot Biolab M0231L Rabbit 1:500
DNMT3b Western blot Abcam ab13604 Mouse 1:500
AML1 Western blot
IHC
Cell Signaling
Technology 4334 Rabbit
Western blot: 1:500
IHC: 1:100
HIF1 Western blot
IHC
Cell Signaling
Technology 3716 Rabbit
Western blot: 1:500
IHC: 1:100
Cleaved
Caspase-3
Western blot
IHC
Cell Signaling
Technology 9664 Rabbit
Western blot: 1:500
IHC: 1:250
Cleaved
Caspase-8 Western blot
Cell Signaling
Technology 9496 Rabbit 1:500
Caspase-9 Western blot Cell Signaling
Technology 9502 Rabbit 1:500
-actin Western blot Santa Cruz
Biotechnology sc-1616 Goat 1:1000
Ki-67 IHC Abcam ab15580 Rabbit 1:250
5-m
C IHC
Dot blot Active Motif 39649 Mouse
IHC: 1:250
Dot blot: 1:1000
ETO ChIP Santa Cruz
Biotechnology sc-9737 Goat 5 µg
HIF-1 ChIP Novus Biologicals NB100-134 Rabbit 5 µg
20
SUPPLEMENTARY FIGURES
Supplementary Figure S1
Supplementary Figure S1. Selectively high expression of HIF1 in AML cell lines and patients
bearing t(8;21). (a) qPCR showing HIF1 mRNA expression in myeloid leukemia cell lines.
CML-BC, chronic myeloid leukemia in blast crisis. Bars indicate the mean±SEM from three
independent experiments. (b) Normalized HIF1 expression in pretreatment samples of 461
patients with de novo AML (GEO database, GSE6891). Patient characteristics are described in
Supplementary Table S1. The gene expression was determined using gene-expression arrays
(Affymetrix HGU133 Plus 2.0 GeneChips). Median values are depicted by the horizontal lines.
21
Supplementary Figure S2
Supplementary Figure S2. Overexpression of A/E induces HIF1 upregulation. (a, b) qPCR (a)
and Western blot (b) showing A/E and HIF1 levels in A/E-inducible U937 cells and control.
Bars indicate the mean±SEM from three independent experiments.
22
Supplementary Figure S3
Supplementary Figure S3. HIF1 functionally cooperates with A/E in promoting leukemia
growth. (a, b) Colony-forming assays showing growth inhibition in leukemia cells with
knockdown of A/E (a) or HIF1 (b). Representative colony morphologies were shown. Scale
bars represent 1 cm (red) or 200 µm (black). (c, d) C1498 leukemia cells were transfected with
A/E or/and HIF1 expression vector. Transfection efficiency was monitored by Western blot of
A/E and HIF1 protein levels in C1498 cells after transfection (c), and the growth stimulation in
23
C1498 cells upon A/E or/and HIF1 overexpression was assessed by colony-forming assays (d).
Scale bars represent 1 cm. Error bars indicate mean±SEM of duplicate samples from two
independent experiments. (e-g) A/E9a primary leukemia cells were transfected with HIF1
expression vector or siRNA and engrafted into C57BL/6J mouse. Transfection efficiency was
monitored by qPCR analysis of HIF1 mRNA levels in A/E9a cells before injection (e) and in
BM cells of A/E9a mice in 7 weeks after injection (f). The development of leukemic disease was
monitored by WBC count (g).
24
Supplementary Figure S4
Supplementary Figure S4. Selectively high expression of DNMT3a in A/E-positive AML. (a-c)
Normalized expression levels of DNMT3a (two probes, DNMT3a_1 and DNMT3a_2) (a),
DNMT1 (b) and DNMT3b (c) in pretreatment samples of 461 patients with de novo AML (GEO
database, GSE6891). Median values are depicted by the horizontal lines. (d, e) qPCR showing
the mRNA levels of DNMT1 (d) and DNMT3b (e) in BM samples of AML patients and healthy
donors (HD). Median values are depicted by the horizontal lines. NS: not statistically significant.
25
Supplementary Figure S5
Supplementary Figure S5. A/E and HIF1 induces DNMT3a expression. (a, b) qPCR (a) and
Western blot (b) showing DNMT3a levels in 293T and U937 cell lines upon A/E overexpression.
(c, d) qPCR (c) and Western blot (d) showing DNMT3a levels in Kasumi-1 cell line upon A/E
knockdown. (e, f) qPCR (e) and Western blot (f) showing DNMT3a levels in 293T cells upon
HIF1 overexpression. (g, h) qPCR (g) and Western blot (h) showing DNMT3a levels in
Kasumi-1 cells upon HIF1 knockdown. Bars in a, c, e and g indicate the mean±SEM from three
independent experiments.
26
Supplementary Figure S6
Supplementary Figure S6. A/E and HIF1 cooperatively modulate DNA methylation by
targeting DNMT3a transcription. (a) qPCR showing DNMT3a mRNA levels in A/E-negative
293T cells transfected with empty, A/E, HIF1 or both vectors. (b) qPCR showing DNMT3a
mRNA levels in Kasumi-1 cells transfected with scramble, A/E siRNA, HIF1 siRNA or both.
(c) Western blot showing DNMT3a protein levels in 293T cells upon DNMT3a overexpression
27
or knockdown. (d) Dot blot showing 5-m
C levels in 293T cells upon DNMT3a overexpression or
knockdown. Bars in a, b and d indicate the mean±SEM from three independent experiments. (e)
Top: The genomic DNA was extracted from U937MT or U937A/E cells after ZnSO4 treatment
and subjected to Dot blot using 5-m
C antibody; bottom: equal DNA loading was verified by
staining the membranes with 0.2% methylene blue. (f, g) Western blot showing the changes of
DNMT1 and DNMT3b protein levels in U937 or 293T cells upon overexpression of A/E (f) or
HIF1 (g). (h, i) Western blot showing the changes of DNMT1 and DNMT3b protein levels in
Kasumi-1 or SKNO-1 cells upon knockdown of A/E (h) or HIF1 (i).
28
Supplementary Figure S7
Supplementary Figure S7. Pharmacological inhibition of HIF1 disrupts A/E-HIF1-DNMT3a
axis and suppresses leukemic proliferation in vitro. (a) qPCR analysis of A/E, HIF1 and
DNMT3a mRNA levels in Kasumi-1 and SKNO-1 cells treated with echinomycin or vehicle.
Bars indicate the mean±SEM from three independent experiments. (b) FACS analysis of
apoptosis in Kasumi-1, SKNO-1PGK or SKNO-1siA/E cells treated with echinomycin or vehicle.
(c, d) Colony-forming assays showing the shape and size of A/E-positive cell lines (c) or patient-
derived leukemia blasts (d) upon echinomycin treatment. Scale bars represent 1 cm (red) or 200
µm (black).
29
Supplementary Figure S8
Supplementary Figure S8. Echinomycin induced no significant body weight loss in SKNO-1
xenograft tumor-bearing nude mice. Measurement of body weight of the mice at the indicated
time points post echinomycin treatment. Data represent mean±SEM (n=3 mice/group).