Article No. mb982039 J. Mol. Biol. (1998) 282, 789±800

An Arginine Residue (Arg101), which is Conserved inmany GroEL Homologues, is Required for Interactionsbetween the two Heptameric Rings

Susan Jones, Emma J. Wallington, Roger George and Peter A. Lund*

School of Biological SciencesUniversity of BirminghamBirmingham B15 2TT, UK

Present address: S. Jones, SchooMolecular Biology, University ofUK.

E-mail address of the corresponp.a.lund@bham.ac.uk

0022±2836/98/390789±12 $30.00/0

Homologous recombination was used to construct a series of hybrid cha-peronin genes, containing various lengths of Escherichia coli groELreplaced by the equivalent region from the homologous cpn60-1 gene ofRhizobium leguminosarum. Analysis of proteins produced by these hybridsshowed that many of them formed structures with properties consistentwith their being single heptameric rings under some conditions, asopposed to the double ring form in which both the GroEL and theCpn60-1 proteins are found. By determining precise cross-over points,two regions in Cpn60-1 were de®ned which appeared to be critical forring-ring interactions. Within one of these regions is a highly conservedarginine residue (Arg101), which we hypothesised to interact with a resi-due or residues toward the C terminus of the protein, this contact beingrequired for double rings to form. To test this hypothesis, we mutagen-ised this residue from arginine to threonine in chaperonin genes fromtwo different species of Rhizobium. In both cases, proteins which ran onnon-denaturing gels as single rings were produced. Conversion ofArg101 to serine also had the same effect, whereas conversion of Arg101to lysine did not. Two different single rings created by homologousrecombination could be converted back to double rings by changing thethreonine, which naturally occurs at this position in E. coli GroEL, backto arginine. The in vivo properties of the proteins were investigated bycomplementation following deletion of the chromosomal copy of thegroEL gene, and by monitoring the ability of cells expressing the hybridproteins to plate bacteriophage. Most of the hybrid and mutant proteinswere functional in these assays, despite their altered properties comparedto wild-type GroEL.

# 1998 Academic Press

Keywords: GroEL; molecular chaperone; Cpn60; hybrid proteins

*Corresponding author

Introduction

Protein folding in the cell is assisted by the ubi-quitous and abundant group of proteins, termedmolecular chaperones (Hendrick & Hartl, 1993;Hartl 1996). Particular attention has been focusedon the chaperonin (cpn-60) family of molecularchaperones because of their ability to mediateATP-dependent folding of polypeptides to thenative state. GroEL, the chaperonin from Escheri-chia coli, is the best characterised protein of the

l of Biochemistry andLeeds, Leeds LS2 9JT,

ding author:

cpn-60 group (reviewed recently by Fenton &Horwich, 1997). The crystal structure of a GroELdouble mutant (Arg13 to glycine; Ala126 to valine)has been resolved to 2.8 AÊ . The crystal structureshows GroEL to be a cylindrical tetradecamer with7-fold symmetry, composed of two heptamericrings of 57 kDa subunits stacked back-to-back,with each ring containing a central cavity (Braiget al., 1994). The protein folding function of GroELis dependent on ATP hydrolysis, and on theGroEL cofactor GroES. The structure for wild-typeGroEL complexed with GroES and ADP has alsobeen described (Xu et al., 1997).

An important factor in the reaction cycle of theGroEL molecule is the binding and hydrolysis ofATP. Co-operativity has been demonstrated forboth the binding and hydrolysis of ATP by GroEL

# 1998 Academic Press

790 Ring-ring Interactions in GroEL Homologues

(Gray & Fersht, 1991) both within each heptamericring (where it is positive) (Bochkareva &Girschovich, 1992; Todd et al., 1993), and betweenthe two rings of the molecule (where it is negative)(Yifrach & Horovitz, 1994). Co-operativity in ATPbinding and hydrolysis may have evolved so thatsmall changes in the local ATP concentrationduring the GroEL cycle can trigger the conversionbetween two functional states, thus promoting co-ordinated release of protein substrates. Non-foldedprotein binds preferentially to GroEL in the statewhich has low ATP af®nity and binds less well toGroEL in the high ATP af®nity state (Staniforthet al., 1994; Yifrach & Horovitz, 1996). It is pro-posed that the release of protein can be triggeredby the subtle conformational changes that occurwithin the rings when nucleotide is bound to thetrans ring (Chen et al., 1994; Roseman et al., 1996;Rye et al., 1997). GroES may have several roles inthe GroEL-mediated folding reaction including: thedisplacement of bound substrate into the cavity,where it can fold without contacting other hydro-phobic regions with which it might tend to aggre-gate (Hartl, 1994; Mayhew et al., 1996; Weissmanet al., 1995); the capping of the cavity which pre-vents diffusion away of the substrate proteinbefore folding has had a chance to take place(Mayhew et al., 1996; Weissman et al., 1995); andthe co-ordination of ATP hydrolysis (Todd et al.,1994, 1996).

The existence of negative co-operativity betweenthe two rings of GroEL requires that information istransmitted between the two rings via confor-mational changes. In order for this information tobe transferred, speci®c inter-ring contacts must bepresent. Two contacts were identi®ed in GroEL byanalysis of the crystal structure (Braig et al., 1994).One contact site involves residues Lys105, Ala109and Glu434, the other consists of Glu461, Arg452,Ser463 and Val464. The same contacts are observedin the structure of the wild-type GroEL-GroES-ADP complex (Xu et al., 1997). The contacts arepreserved on the binding of nucleotide to the cisring of the complex. As this binding producesmovement of the domains in the cis ring, the ten-dency of the domains in the trans ring must be tomove in the complementary direction in order forthe inter-ring contacts to be maintained: this pro-vides a structural interpretation for the negativeco-operativity observed between the two rings.

In the course of constructing a series of hybridproteins between the E. coli GroEL and the Rhizo-bium leguminosarum homologue Cpn60-1, with var-ious lengths of the 50 end of E. coli groEL fused tothe 30 end of the R. leguminosarum cpn60-1 gene, weobserved a distinct pattern of protein sizes, includ-ing some apparently single ring species (E.J.W.et al., unpublished results). An hypothesis consist-ent with the distribution of single ring and doublering species is that different amino acid residuesare responsible for the ring-ring contacts in the twoparental proteins used to construct the hybrids.The regions of inter-ring contacts can be de®ned

by the position of the cross-over sites which resultin the transition from double to single rings, andvice versa. By this analysis, the ®rst putative contactregion contains the left contact site as de®ned inthe crystal structure, and is close to the N terminusof the hybrid proteins. Within this region there areonly three non-conserved residues between GroELand Cpn60-1: Ile100, Thr101 and Leu104 in GroEL,which are Val100, Arg101 and Asn104 in R. legumi-nosarum Cpn60-1. Here we have used site-directedmutagenesis to analyse the roles of residues 101and 104. Our data show that the arginine residueat 101 (which is highly conserved in bacterialCpn60 proteins) is critical in the formation ofdouble ring structures in two different chapero-nins. Because of the importance of ring-ring inter-actions in models of GroEL function, we analysedthe ability of various hybrid proteins to function asthe sole GroEL in the cell. In vivo data indicate thatthe hybrid proteins with reduced ring-ring inter-actions are capable of functioning as molecularchaperones under normal growth conditions.

Results

Construction and analysis of hybridgroEL genes

We generated hybrid groEL genes by homolo-gous recombination between the E. coli groEL geneand the R. leguminosarum cpn60-1 gene, using aplasmid that contained both genes, two origins ofreplication, and two selective markers (E.J.W. et al.,unpublished results). By selecting for plasmids thatconferred an ampR kanS phenotype on cells, weidenti®ed cross-over events that led to the for-mation of hybrid genes with the 50 end derivedfrom groEL and the 30 end from cpn60-1. Cross-over points are shown in Figure 1. To investigatethe oligomeric state of GroEL proteins producedfrom these plasmids, we ran non-denaturing gradi-ent acrylamide gels of whole cell extracts. Surpris-ingly, several of the hybrid GroEL proteins hadhigher mobilities than the puri®ed E. coli GroELcomplex (Figure 2(a)). Western blot analysis of thesame proteins con®rmed the identity of the bandsas GroEL hybrid proteins (Figure 2(b)). Compari-son with native protein standards suggested thatthese proteins had molecular masses of approxi-mately 400 kDa. Under identical conditions, GroELand some of the hybrids migrated with a molecularmass of 800 kDa, as expected from the knownGroEL tetradecameric structure. One of the func-tional hybrid proteins that ran with a higher mobi-lity was chosen for more detailed characterisation,as non-denaturing gels do not always give areliable measurement of molecular mass. This wasthe protein produced by plasmid pPOD211; werefer to it here as P211. P211 was determined fromthe DNA sequence to be a hybrid protein withGroEL residues from the N terminus to residueArg368, then Cpn60-1 to the C terminus. Puri®-cation of P211 and analysis by a variety of physical

Figure 1. Cross-over points in the hybrid proteins pro-duced by homologous recombination. Lines denoteregions within which cross-overs occurred as mappedusing restriction enzymes, crosses denote precise end-points determined by DNA sequence analysis. All thehybrid proteins produced started with GroEL at their Ntermini and subsequently changed to Cpn60-1. Hybridproteins are named in the right hand column; the num-ber after the name of each hybrid indicates whether itruns as a double ring (14) or single ring (7) on non-denaturing PAGE.

Figure 2. Non-denaturing polyacrylamide gel electro-phoresis of GroEL, Cpn60-1 and hybrid proteins.(a) Extracts from strains expressing truncated GroEL,full length GroEL, or some of the different hybrid pro-teins shown in Figure 1, run on a non-denaturing gelstained with Coomassie brilliant blue. GroEL proteins(or derivatives thereof) are visible as abundant highmolecular mass bands on these gels, and are indicatedwith double arrow-heads for double rings, and singlearrowheads for putative single rings. Lanes 1, 9 and 16:native molecular mass markers (669 kDa, 440 kDa,232 kDa, 140 kDa, 67 kDa). Lane 2, pPOD50 (wild-typeGroEL); lane 3, GroEL from pPOD101 (C-terminal trun-cation); lane 4, pPOD204; lane 5, pPOD243; lane 6,pPOD212; lane 7, pPOD225; lane 8, pPOD252; lane 10,pPOD211; lane 11, pPOD202; lane 12, pPOD231; lane13, pPOD310; lane 14, pKB3; lane 15, pPOD313.(b) Immunoblots with anti-GroEL monoclonal antibodyof extracts from some of the above strains run on anon-denaturing gradient gel. The plasmids present inthe strains were: lane 1, pPOD247; lane 2, pPOD243;lane 3, pPOD217; lane 4, pPOD225; lane 5, pPOD211;lane 6, pPOD202; lane 7, pPOD231; lane 8, pPOD101;lane 9, pPOD50; lane 10, puri®ed GroEL protein. (Thedouble band seen in lane 8 is occasionally seen in blotsof GroEL protein; its signi®cance is not known.)

Ring-ring Interactions in GroEL Homologues 791

techniques (non-denaturing gradient gel electro-phoresis, negative stain electron microscopy, gel®ltration, and kinetics of ATP hydrolysis) indicatedthat it behaves as a single ring under some but notall conditions (E.J.W. et al., unpublished results;A. H. Erbse et al., unpublished results). This showsthat the interactions which normally hold the twoheptameric rings of sub-units together in GroELhomologues must be substantially weakened inthis hybrid protein.

As Figure 1 shows, the relationship of the pos-ition of the cross-over to whether a given hybridprotein ran as a single or a double ring on non-denaturing gels was simple. Proteins which wereeither mostly GroEL or mostly Cpn60-1 ran withthe same mobility as GroEL, whereas all the inter-mediate hybrids ran with the same mobility asP211. Cpn60-1 also runs with the same mobility asGroEL. A model for double ring formation consist-ent with this pattern is that interactions which arerequired for this formation to occur exist betweentwo different regions (proximal and distal) on theCpn60-1 chaperone protein. These interactions maynot necessarily be direct inter-ring contacts, butthey must have a role in the formation of actualcontacts between the two rings. By this model, aslong as a given hybrid protein has both the inter-acting regions from the same protein, double ringsare formed. However, if one of these is replaced bythe equivalent region from the other protein, thering-ring interaction is weakened, and the proteinoligomer runs with a lower molecular mass onnon-denaturing gels. The regions between whichthese interactions occur can be deduced from thepositions of the cross-overs in the hybrid genes.

Thus, the position of the proximal site can be deter-mined by mapping the last cross-over which stillgives a double ring (P212), and the ®rst which stillgives a single ring (P217), as the cross-over pointsmove through the gene. Similarly, the distal regioncan be de®ned by mapping the last cross-over togive a single ring (P310) and the ®rst to give adouble ring (PKB3, a hybrid that was constructedusing the BamHI site near to the 30 end of thegroEL gene; see below). This analysis showed thatthe proximal site lies between residues 90 and 120,and the distal site between residues 455 and 497.These are the regions also shown to contain theinter-ring contact sites in the crystal structure ofGroEL. However, the crystal structure does notshow the proposed proximal±distal interactionsthat are suggested by this hypothesis: all contactsare proximal-proximal or distal-distal.

Figure 3. Alignment of GroEL (top line) and Cpn60-1(bottom line) in the region predicted to contain the prox-imal region required for ring-ring formation (amino acidresidues 90 to 119). Only non-conserved amino acids areshown in the Cpn60-1 sequence. Amino acids shown tobe responsible for ring-ring contacts in the structuregiven by Braig et al. (1994) are underlined.

792 Ring-ring Interactions in GroEL Homologues

We adopted two approaches to test our model:site-directed mutagenesis of speci®c amino acidresidues within the proposed proximal interactionregion, and construction of two pairs of reciprocalhybrid proteins with their cross-over points alsowithin this region. Analysis was carried out usingnon-denaturing gradient PAGE: on these gels, theband corresponding to the GroEL-Cpn60-1 hybridwas suf®ciently clear that Coomassie stainingalone was enough to see the protein clearly andunambiguously, although the identity of the bandswas generally con®rmed by Western blotting (asshown in Figure 2(a) and (b)).

Mutagenesis of critical residues in putativeinteraction regions

There are only three amino acid differencesbetween GroEL and Cpn60-1 within the putativeproximal contact region (Figure 3), suggesting thatone or more of these residues is involved in theinteractions under investigation. These three aminoacid residues are at position 100 (isoleucine inGroEL; valine in Cpn60-1), position 101 (threoninein GroEL; arginine in Cpn60-1) and position 104(leucine in GroEL; asparagine in Cpn60-1). As iso-leucine to valine is a conservative amino acid sub-stitution, only the residues at positions 101 and 104were analysed. All the mutations made are sum-marised in Table 1. Residues 101 and 104 weremutated in the P211 hybrid protein and in GroEL.P211 was utilised to investigate whether the resi-dues at positions 101 and 104 are critical forCpn60-1 proximal to distal interaction. If they are,then mutagenesis of the residues at positions 101and 104 from those found in GroEL to the corre-sponding residues found in Cpn60-1 should restorethe disrupted interactions in the heptameric P211

Table 1. Mutagenic oligonucleotides

Mutation introduced

Thr101 to Arg, novel NruI site in groEL and P211 50-Leu104 to Asn in groEL and P211 50-Pro137 to Lys, BglII site in groEL 50-Arg101 to Thr, removal of NruI site in cpn60-1 50-Arg101 to Ser, removal of NruI site in cpn60-1 50-Arg101 to Lys, removal of NruI site in cpn60-1 50-Arg101 to Thr, removal of NruI site in rhzA 50-Thr101 to Arg, novel NruI site in P310 50-

The oligonucleotides shown were used to mutate the groEL, P211,

hybrid protein and thus restore the tetradecamericstructure.

The Leu104 residues of GroEL and of P211 weremutated to the asparagine residue found in Cpn60-1. Analysis of the mutated proteins revealed nochange in their mobility of the proteins on non-denaturing PAGE (data not shown). Thus, the leu-cine or asparagine residues at position 104 are notcritical to the inter-ring contacts.

To test the role of the residue at position 101, theThr101 residue in wild-type GroEL and P211 wasconverted to an arginine residue, which is presentat the same position in Cpn60-1. This had no effecton the mobility of GroEL, but changed the mobilityof P211, with the P211 Thr101Arg protein havingthe same mobility on non-denaturing gels asGroEL (Figure 4). This result indicates that thearginine residue at position 101 is important inmaintaining the inter-ring contacts within the R.leguminosarum Cpn60-1 protein. To further test thishypothesis, we made the complementary mutationby changing the Arg101 in Cpn60-1 to threonine.As predicted by the model, this resulted in a pro-tein with the same apparent molecular mass as theP211 protein (Figure 4).

Further analysis into the role of the arginine resi-due at position 101 on the oligomeric state of theCpn60-1 protein from R. leguminosarum and asecond hybrid protein with reduced mobility(P310, containing GroEL to residue Ile454 andCpn60-1 to the C terminus) was carried out. Site-directed mutagenesis was used to change Thr101of P310 to arginine, and again the resulting proteinhad the same mobility as GroEL (Figure 5). InCpn60-1, Arg101 was mutated to serine or lysine.As predicted, the mutation of Arg101 in Cpn60-1to serine again produced an apparently heptamericprotein, as determined by gel mobility. However,replacement of arginine by lysine at position 101resulted in a protein with unchanged mobility onnon-denaturing gels, indicating that the contactusually made by arginine is maintained in thismutant (Figure 6).

Since arginine is frequently found at position 101in GroEL homologues (see Discussion), the effectof changing this residue in another GroEL homol-ogue, the RhzA protein from Rhizobium meliloti(Rusunganwa & Gupta, 1993), was investigated bymutating it to threonine. Again, this resulted in thedisruption of the inter-ring contacts within the pro-

Oligonucleotide

GACCTTCGCGAATGATAGC CTGAGCC-30GCCCGCAGCAACAGCTTTG TTACCTTC-30GCTTTAGAGTCAGAGATCTT TACGGACAGCGCTT-30TGCCTTCAGTGACGATCGCC TGGGC-30GCCTTCGCTAACGATCGCCT GGGC-30GCCTTCCTTAACGATCGCCTGGGC-30CGCACCTTCAGTAACGATCG CCTGGGC-30GGCTATCATTCGCGAAGGTCTG-30

P310, cpn60-1 and rhzA genes, introducing the changes shown.

Figure 4. Non-denaturing gradient gel of Arg101Thrand Thr101Arg mutants. Lane 1, puri®ed GroEL; lane 2,puri®ed P211; lanes 3 to 8, extracts from TG2 expressingthe following proteins in pMa5.8 derivatives: lane 3,GroEL; lane 4, GroELT101R; lane 5, P211; lane 6,P211T101R; lane 7, Cpn60-1; lane 8, Cpn601R101T.

Figure 6. Non-denaturing gradient gel of Cpn60-1Arg101Ser or Lys mutants. Lane 1, puri®ed GroEL; lane2, puri®ed P211; lane 3, extract from TG2 containingpMa5.8; lanes 4 to 7, extracts from TG2 expressing: lane4, Cpn60-1; lane 5, Cpn60-1R101K; lane 6, Cpn60-1R101S;lane 7, Cpn60-1 R101T.

Ring-ring Interactions in GroEL Homologues 793

tein and the production of a protein with a molecu-lar mass indistinguishable from that of P211(Figure 7).

As an additional test of our hypothesis, furtherhybrid proteins were designed such that therewere two reciprocal pairs of proteins with thesame cross-over site, but with either the N-terminalportion of GroEL fused to the C-terminal portionof Cpn60-1, or vice versa (Figure 8). Hybrid P501contained amino acid residues 1 to 100 fromGroEL fused to 101 to 548 from Cpn60-1 (as themutagenesis step changes the Thr at position 101in GroEL to Arg) while hybrid P502 containedamino acid residues 1 to 101 from Cpn60-1 fusedto 102 to 548 from GroEL. A second pair of recipro-cal hybrid proteins, P503 and P504, were engin-eered with their cross-over site at position 137. Inthese hybrids, the proposed proximal and distalinteracting regions from the same chaperone mol-ecule are separated. Hybrids P501, P502 and P504formed apparently tetradecameric species on non-denaturing gels, but hybrid protein P503 ran withthe same mobility as P211 (Figure 8). Hybrid P503(containing the N-terminal portion of GroEL toposition 137 fused to the C-terminal portion ofCpn60-1) was the only hybrid protein of this seriesto form an apparently heptameric ring structure(as predicted by our model, as this is the onlyhybrid that has a threonine residue at position

Figure 5. Non-denaturing gradient gel of the P310Arg101Thr mutant. Lane 1, puri®ed GroEL and P211mixed; lanes 2 to 4, extracts from TG2 expressing; lane2, GroEL; lane 3, P310; lane 4, P310T101R.

101). Thus, reciprocal hybrid proteins do notnecessarily have the same structural properties, asshown by the fact that the Thr101 to argininemutation in GroEL did not produce a change inmobility (see above, Figure 4). These results areconsidered in more detail in the Discussion.

Finally, we introduced a BamHI site into therhzA gene (the groEL homologue from R. melilotidescribed above) in the equivalent position to theBamHI site in E. coli GroEL and used this to pro-duce a hybrid that contained E. coli GroEL residuesto position 496, and RhzA residues to the C termi-nus (the RhzA and Cpn60-1 sequences are identicalin this region apart from two conservative changes,a leucine to valine at position 497 and asparagineto aspartate at position 506). This hybrid (PKB3)ran as a tetradecamer on non-denaturing gels (datanot shown).

In vivo analysis of Cpn60 proteins

Although there was no size change observed bygel analysis of the mutants in GroEL, they maycontain subtle structural changes that would affecttheir functional properties. The profound change inthe oligomeric state of the P211 hybrid and Cpn60-1 protein after introduction or removal of the argi-nine residue at position 101 might also be expectedto have a signi®cant effect on the functional prop-

Figure 7. Non-denaturing gradient gel of RhzAArg101Thr mutant. Lane 1, puri®ed GroEL and P211mixed; lane 2, extract from TG2 containing pMa5.8;lanes 3 to 5, extracts from TG2 expressing: lane 3,Cpn60-1; lane 4, RhzA; lane 5, RhzAR101T.

Figure 8. Non-denaturing gradient gel of hybrid pro-teins P501, P502, P503 and P504. Lane 1, puri®edGroEL; lane 2, puri®ed P211; lane 3, extract from TG2containing pMa5.8; lanes 4 to 7, extracts from TG2expressing: lane 4, P501; lane 5, P502; lane 6, P503; lane7, P504.

794 Ring-ring Interactions in GroEL Homologues

erties of the proteins. We therefore examined theability of the mutant proteins to function in vivo,by deletion of the chromosomal copy of groEL withconcomitant expression of the mutant proteinsfrom the arabinose promoter (pBAD).

There was a distinct difference in the amount ofgrowth seen at both 37�C and 42�C between cellsexpressing the various proteins (see Table 2). Themutated GroELs (GroEL Thr101Arg and GroELLeu104Asn) allowed growth at 37�C and 42�Cessentially the same as that seen for the wild-typeGroEL control. Cells expressing P211 and themutant P211 proteins showed some reduction ingrowth with fewer and smaller colonies at 37�Cand 42�C, although P211 has been shown to permitgrowth as well as wild-type GroEL in liquid med-ium at 37�C and at approximately half the rate at42�C (E.J.W. et al., unpublished results). Cpn60-1and the Cpn60-1 Arg101Thr mutant supported

Table 2. In vivo analysis of mutant and hybr

Strain Plasmid Ce

37�CAI90 pBAD50 ��AI90 pBAD50T101R ��AI90 pBAD50L104N �AI90 pBAD211 �a

AI90 pBAD211T101R �a

AI90 pBAD211L104N �AI90 pBADCpn60-1 �a

AI90 pBADCpn60-1 R101T �a

TG2 pMA501 �AI90 pBAD502 �AI90 pBAD503 �AI90 pBAD504 �

All growth was scored after 24 hours incubatioof viable cells mlÿ1, where (��) represents 108 tono growth at all. The ability of the Cpn60 mutantanalysis of the number and size of the plaques pra con¯uent lawn of cells of each strain tested, whdilution stock lambda lysate; (�) is a zone of slowvisible plaques at high dilution; and (ÿ) is noconcentration of added bacteriophage.

a Colonies small and slow growing.

growth at 37�C, but there were no coloniesdetected at 42�C, con®rming previous observationsthat Cpn60-1 cannot complement a groELts mutant(Wallington & Lund, 1994; Table 2). Of the fourhybrid proteins constructed in vitro in this study,expression of hybrid P501 was deleterious thoughnot completely lethal for growth of TG2, and plas-mids expressing this protein could not be trans-formed into a groELts strain SF103 (Table 2).Hybrid P503 (the apparently heptameric protein)permitted growth as the sole GroEL protein in thecell at 37�C and 42�C, as did the double ringhybrids P502 and P504 although growth was lessgood with P504.

We also analysed the ability of the different pro-teins to support the growth of bacteriophage lamb-da when expressed as the sole GroEL protein inthe cell. The GroEL Thr101Arg mutant allowedef®cient plating of bacteriophage lambda, whereasGroEL Leu104Asn mutant did not plate bacterio-phage lambda at all (Table 2). P211, P211Thr101Arg, Cpn60-1 and Cpn60-1 Arg101Thrallowed only limited plating of bacteriophagelambda. Plating of bacteriophage lambda was alsoobserved in strains expressing either hybrid pro-tein P503 or P504 as the sole GroEL protein in thecell. Strains expressing hybrid P502 plated bacterio-phage lambda but only poorly.

The failure of strains expressing GroELLeu104Asn to plate bacteriophage lambda wasunexpected, as this protein showed no otherobvious differences to wild-type GroEL. We there-fore also analysed the ability of these strains toplate bacteriophage T4 and T5, both of which aredependent on functional GroEL. This was alsodone with a wild-type control, with strain expres-sing only P211, and with strains expressing P211Thr101Arg. No signi®cant differences were seen in

id proteins

ll growthAbility to plate

bacteriophage lambda

42�C�� ��� ��� ÿ�a ��a ��a �ÿ �ÿ �� N.D.� �� �� �

n, and number of colonies scored as the number109 cells mlÿ1; (�) 105 to 107 cells mlÿ1; and (ÿ)

s to plate bacteriophage lambda was assessed byoduced after 24 hour incubation of the phage onere (�) represents large plaques at 10ÿ4 to 10ÿ6

growth at the lower dilution of lysate, but novisible lysis seen on the strain tested at any

Ring-ring Interactions in GroEL Homologues 795

the abilities of these strains to plate bacteriophagesT4 and T5 (data not shown).

Discussion

GroEL, the Cpn60 protein from E. coli, is adouble toroid containing 14 subunits. The structureof the tetradecameric molecule has been studiedusing cryo-electron microscopy (Chen et al., 1994;Roseman et al., 1996) and X-ray crystallography(Braig et al., 1994; Xu et al., 1997). Each subunitconsists of three distinct domains: apical, inter-mediate and equatorial, with respect to the inter-ring interface. Mobility of the domains occurs inthe presence of nucleotides (ATP and ADP) andthe GroEL cofactor GroES (Roseman et al., 1996).The mobility of the three domains forms a networkof allosteric communication between the nucleotidebinding site and other parts of the molecule(Lorimer & Todd, 1996). The ®rst allosteric net-work is intra-toroidal, and transmits signalsbetween the equatorial domains of the subunitswithin the ring, which results in positive co-opera-tivity of ATP binding. Co-operativity within theGroEL ring is thought to follow the Monod-Wyman-Changeux representation (Monod et al.,1965) with the T state having low af®nity for ATP,and the R state having high ATP af®nity. Thesecond allosteric network involves communicationbetween the two toroids. In agreement with thehypothesis that inter-ring communication isimportant for the chaperone function of GroEL, asingle ring GroEL species, SR1, in which all inter-ring contacts are disrupted, can bind substrate pro-tein and GroES, but does not release them underin vitro conditions (Weissman et al., 1995). How-ever, the SR1 protein has been shown to functionin vitro as a molecular chaperone in the presence ofhigher salt concentrations (Hayer-Hartl et al., 1996).The current release mechanism proposed forGroEL involves transmission of informationbetween the two rings, as binding of ATP to onering causes release of GroES/substrate bound tothe opposite ring (Rye et al., 1997). The residuesproposed to be involved in this allosteric trans-mission are in two sites within each GroEL sub-unit: the left site containing Lys105, Ala109 andGlu434, the right site consisting of Arg452, Glu461,Ser463, and Val464 (Braig et al., 1994). The thirdallosteric network transmits information betweenthe apical and equatorial domains within the samering, with the binding of GroES to the apicaldomains proposed to stabilise the binding of ADPto the nucleotide binding sites in the equatorialdomains, and vice versa. Thus, the current mechan-ism of action of GroEL requires a complex trans-mission of information within the molecule, whichis dependant on the tetradecameric structure com-mon to most GroEL homologues.

In this laboratory, we have been studying aGroEL homologue from R. leguminosarum (Cpn60-1). Although Cpn60-1 has 68% identity and 81%

similarity to GroEL, it was unable to complement agroELts mutation at the non-permissive tempera-ture of 42�C (Wallington & Lund, 1994). SinceGroEL and Cpn60-1 had such a high level of hom-ology, they were used to construct a series ofhybrid proteins where different lengths of GroELleading to the C terminus were replaced by thecorresponding regions from Cpn60-1. This series ofhybrid proteins produced a distinct pattern of oli-gomeric sizes as determined by non-denaturingPAGE analysis, with some having a higher mobi-lity than either parent protein. Biochemical analysisof one of these hybrid proteins (P211) shows that itcan exist as a single ring under some conditions,and this in turn implies that ring-ring interactionsare signi®cantly weakened in those hybrids thatrun with higher mobility on non-denaturing gels(E.J.W. et al., unpublished results; A. H. Erbse et al.,unpublished results). For the purpose of the pre-sent work, we have used migration of protein onnon-denaturing gels as an assay for whether agiven hybrid or mutant protein forms a single ordouble ring. We assume that in all cases where asubstantial difference in mobility is observed, thisis due to weakening of the interactions betweenthe two rings, although we have not attempted toquantify this. All proteins examined gave clear anddistinct bands on non-denaturing gels, implyingthat they are either all double or all single ringsunder the conditions of electrophoresis, with nosubstantial conversion between double and singlering forms taking place during the gel run. Theposition of the junctions in the hybrid proteins thatproduced single ring species suggested a simplemodel where interactions between two regions onthe chaperone protein were required for doublerings to form. Although the regions identi®ed arethe same as those identi®ed in the crystal structureas being important for ring-ring interactions, thismodel differs from the crystal structure in that itrequires interactions to be made between the proxi-mal and distal regions, either through direct con-tacts or through other intermediate interactions.

All the experiments described in this paper areconsistent with such an interaction being requiredin the Cpn60-1 protein. Thus, alteration of Arg101to threonine or serine in Cpn60-1, but not to lysine,disrupts the double ring structure of the protein,showing that this residue has a key role in themaintenance of the double ring structure. Moretellingly, both the single ring proteins P211 andP310 can be converted back to the double ringform by alteration of the Thr101 residue to argi-nine. In these proteins, the Cpn60-1 part of thehybrid runs either from position 369 (P211) orfrom 455 (P310) to the end of the protein. In thecase of P310, this means that the entire left inter-ring contact site (residues Lys105, Ala109, andGlu434) from GroEL is present in the hybrid. Thus,it is unlikely that the change from Thr101 toArg101 is merely producing a local perturbationwhich makes contacts stronger. The fact thathybrid P503 forms a single ring whereas P501

796 Ring-ring Interactions in GroEL Homologues

forms a double ring is also consistent with thismodel, as P501 contains the Arg101 residuewhereas P503 does not.

Although our original formulation of thehypothesis suggested that both GroEL and Cpn60-1 would need the proximal-distal interactions toform double rings, two lines of evidence in particu-lar now argue against this. First, no such contactsare observed in the crystal structure. Second, chan-ging the Thr101 residue to Arg101 in GroEL hadno effect on the oligomeric structure or in vivoproperties of the protein, implying that this aminoacid is not signi®cant in the GroEL structure. Thefact that hybrid P503 forms a single ring, but thereciprocal hybrid P504 does not, shows that formolecules of GroEL that contain the C-terminalpart of Cpn60-1, Arg101 is essential for double ringformation under the conditions used for this assay.Molecules of Cpn60-1 that contain the equivalentC-terminal part of GroEL form double rings,implying that Arg101 is able to make a suitablecontact (directly or indirectly) with the C-terminalpart of GroEL as well as with the C-terminal partof Cpn60-1, even though such a contact cannotbe required for the native structure of GroEL,which does not contain an arginine residue atthis position.

There are currently 74 complete sequences ofprokaryotic GroEL homologues in the Swiss-Protdatabase, of which 28 have an arginine and 11 alysine at the equivalent position to 101 in Cpn60-1(see Table 3). If this analysis is extended to includehomologues from eukaryotic organelles, the total is112, of which 29 have an arginine and 31 a lysineat this position. We con®rmed that Arg101 isimportant in GroEL homologues other thanCpn60-1 by changing it to threonine in theRhizobium meliloti GroEL homologue RhzA(Rusanganwa & Gupta 1993), whereupon we againobserved a species with mobility consistent with asingle ring structure on non-denaturing PAGE. Wepredict that the same result would be seen withother GroEL homologues. However, the fact thatresidues other than basic ones are also seen in thisposition does suggest that the importance of thisresidue is not universal. It is not yet clear what

Table 3. Frequency of occurrence of different aminoacid residues at position 101 in prokaryotic GroEL hom-ologues in the Swiss-Prot database

Amino acidresidue

Number of occurrences at positionequivalent to 101 in Cpn60-1

Arg 28Lys 11Asn 10Gln 6Thr 5Vla 4Ser 3Ala 3Glu 2His 1Gly 1

precise role this residue may have in those proteinswhere it is a basic residue, but it is interesting tonote that it is part of the long a-helix (helix 3) thatlinks the ATP binding pocket with the equatorialinterface between the two rings in GroEL, and thatit has already been proposed (Roseman et al., 1996)that this helix is responsible for transmitting allo-steric information between the two rings. Our datasuggest that there may be different ways in whichthis information is transmitted structurallybetween different GroEL homologues, and we arecurrently purifying and characterising the Cpn60-1protein and some of the hybrid proteins in order toaddress this issue more directly.

If the hypothesis of proximal±distal interactionsis indeed correct, it should be possible to identifyan amino acid or amino acids in the distal regionwhich interact with the Arg101 residue. The distalregion is de®ned by the hybrid protein approachthat we have used here, and our results suggestthat the interactions with the proximal region mustlie between residues 455 and 497. There is substan-tial divergence between the E. coli and R. legumino-sarum sequences in this region, but there is noreason from the available data to rule out thepossibility that the amino acid used for this inter-action is conserved in both species. In fact, the datathat show that hybrid P504 (which containsCpn60-1 to position 136 and GroEL to the C termi-nus) is a tetradecamer makes this quite likely.There are no obvious candidates based on inspec-tion of the crystal structure of GroEL, where resi-due 101 is not in the proximity of any residues inthis region. Site-directed mutagenesis to changeglutamate and aspartate residues in this regionand analysis of the behaviour of such mutantsboth singly and in combination with theArg101Thr mutant in Cpn60-1 will enable us totest our model of a proximal-distal interaction inCpn60-1. However, determining whether the pro-posed contact is between subunits in the same ringor in different rings, or indeed within a single sub-unit, will require structural information on theCpn60-1 protein. The possibility also exists that theinteraction between Arg101 and the distal site inCpn60-1 is not a direct one; in this case an inter-action between residues may still be demonstrableeven though no direct contact is made (as shownto be the case, for example, with Cys137 andCys518 in GroEL; Horovitz et al., 1994). Modellingan arginine residue into position 101 in the GroELstructure using the programme TURBO did notreveal any obvious residues that might be involvedin interacting with it (S.J., data not shown).

We also examined the in vivo properties of themutants constructed here, to see whether alterationof the interactions between the rings has conse-quences for their properties in the cell. Theinterpretation of the results is complicated by thefact that there are several variables present: notonly is the equilibrium between the two ringsaltered but also many of the proteins are hybridproteins between GroEL and a protein which is

Ring-ring Interactions in GroEL Homologues 797

already known not to function completely in E. coli(Wallington & Lund, 1994). However, some pre-liminary conclusions can be drawn. Most impor-tantly, the ``single ring'' species clearly retain somefunction, since they are able to permit growth ofE. coli when there is no other GroEL protein pre-sent in the cell, and they permit the plating of bac-teriophage that absolutely depend on GroEL forfunction. As these experiments were done in thepresence of arabinose, the levels of the chaperoninproteins in the cell would be above that normallyseen at 37�C, which may help explain why proteinswith altered ring-ring interactions are still able tocomplement. However, we have observed thatgrowth of strains containing P211 as the soleGroEL homologue in the cell expressed from thepBAD promoter also occurs well in liquid mediumin the absence of arabinose, where the level of thechaperone is similar to that found in normal cellsat 37�C (E.J.W. et al., unpublished results; Ivic et al.,1996). We are currently determining the glucosesensitivity of strains expressing these differentmutants (as glucose represses the pBAD promoter,this will provide a relative measure of how muchof each different protein is required for the cell togrow). It is of course not possible to determinewhat the oligomeric state of the proteins is in vivo,and given the effects of ``macromolecular crowd-ing'' on the association constants of weakly inter-acting oligomers (Ellis & Hartl, 1996) it is possiblethat the proteins are only present in the doublering form in vivo. Detailed biochemical characteris-ation is the only way to relate oligomeric state tofunctionality, and this is currently in progress.Together with our in vitro data on properties ofhybrid GroEL proteins, our results may shedfurther light on the interactions required for allo-steric transitions in the GroEL protein and theimportance of such transitions in understanding itsin vivo function. It may be for example that thehybrid proteins are altered in their equilibriumbetween T and R states, similarly to the Arg197Alamutant which has been studied (Yifrach &Horovitz, 1994; White et al., 1997).

The failure of strains expressing GroELLeu104Asn to plate bacteriophage lambda in spottests was unexpected. Failure to see lambda pla-ques in such an assay could be due to a variety ofcauses, including failure of lambda to infect thecells, failure of some stage of the lytic cycle, or avery small burst being produced such that no pla-ques are seen. Single burst experiments in liquidmedium (S.J., data not shown) indicated thatstrains expressing this mutant are able to absorblambda and produce a burst, so the inability ofphage to plate in spot tests remains unexplained.However, there is no evidence from our data thatthis residue is involved in ring-ring interactions.

In conclusion, we have produced a set of datathat strongly implies that a highly conserved basicresidue at position 101 in many GroEL homologueshas a key role in maintaining the structural integ-rity of the familiar double ring structure for this

oligomeric protein, and we further propose thatinteractions with sequences in the distal part of theprotein are required for this residue to exert itseffect. The fact that GroEL proteins where theseinteractions are disrupted by mutagenesis of thiskey residue can nevertheless support some growthshows that normal interactions between the ringsare not absolutely required for in vivo chaperoninfunction. This in turn calls into question theimportance of the allosteric interaction between thetwo rings in GroEL. Although this interactionappears to be essential for the complete chaperonereaction with stringent substrates such as rhoda-nese or malate dehydrogenase to occur underde®ned in vitro conditions, it may be that it is dis-pensable for many other substrates or under cer-tain conditions in vivo. The ability of ``mini-chaperones'' to function in vitro, where only theprotein-binding apical domains of GroEL are pre-sent, also supports this possibility (Zahn et al.,1996). Further detailed characterisation of the pro-teins described both in vivo and in vitro may helpto further illuminate this important aspect of cha-perone function.

Materials and Methods

All chemicals were purchased at the highest chemicalgrade from BBL, BDH Laboratory Supplies, BioRad,Boehringer Mannheim or Sigma. All restriction endonu-cleases and dilution buffers were purchased from NewEngland Biolabs or Gibco BRL and used as rec-ommended by the manufacturers.

Bacterial strains and plasmids

All bacterial strains were derivatives of E. coli K12.TG1 has the genotype supE hsdD5 thiD(lac-proAB). TG2 isTG1 (�srl-RecA)306::Tn10 (tetR), SF103 is TG1 groELts44zjd::Tn10 (tetR) (S. Fowell & P.A.L., unpublished work),and AI90 is TG1 �groEL::kanR (Ivic et al., 1997). Thestrain CJ236 (dut1 ung1 thi-1 relA1(pCJ105[camR])) wasused to prepare single-stranded DNA for site-directedmutagenesis (Kunkel et al., 1987). The entire series ofmutant and hybrid proteins were expressed from thegroE promoter in derivatives of the plasmid pMa5.8(Stanssens et al., 1989), and from the pBAD promoter inthe pBAD30 vector (Guzman et al., 1995), except forRhzA and RhzAR101T which were cloned in the plasmidpSU18 (Wallington & Lund, 1994) and expressed fromthe lac promoter. In the pSU18 and pBAD30 derivedplasmids, the groE promoter and almost all of the groESgene were removed. The series of pBAD vectors weresubsequently used in transduction to produce deriva-tives of strain AI90, which was then also used for in vivostudies.

In vivo construction of hybrid groEL/cpn60-1 genes

This will be described in detail by Wallington et al.(unpublished results). Brie¯y, a truncated groE wascloned into the recombination vector pPOD6, which con-tains two different origins of replication and selectivemarkers for ampicillin and kanamycin resistance (D. A.Rouch & N. L. Brown, unpublished results) to create theplasmid pPOD100. The R. leguminosarum groEL homol-

798 Ring-ring Interactions in GroEL Homologues

ogue (referred to as cpn60-1, Wallington & Lund, 1994)was then cloned into pPOD100 to create the plasmidpPOD101. Homologous recombination was allowed tooccur between the homologous groEL and cpn60-1 genesby growth of TG1 containing pPOD101. Plasmids werethen isolated, digested with XbaI (to linearise the par-ental plasmid and plasmids containing the unwantedproduct of the recombination), and transformed intostrain TG2. Candidate plasmids (detected on the basis oftheir antibiotic resistance phenotype) were preparedfrom TG2 and mapped with restriction enzymes; cross-over points were located precisely by DNA sequenceanalysis (Figure 1). Each plasmid was designatedpPODX, where X was a number given to represent a par-ticular experiment. This number was also used to desig-nate the particular hybrid protein produced by thisplasmid. The plasmid pPOD50 was made by cloning aClaI-HindIII fragment from pOF39 (Fayet et al., 1986)into pPOD100. This restored the 30-end of the groE oper-on in that plasmid, thus producing a functional GroELprotein.

Construction of plasmids for mutagenesis andexpression of hybrid GroEL-Cpn60-1 proteins

Mutagenesis experiments were carried out on single-stranded DNA, produced from derivatives of the plas-mid pMa5.8 (Stanssens et al., 1989). These were all con-structed by cloning EcoRI-HindIII fragments from theappropriate pPODX plasmid produced by in vivo recom-bination, which carried the groE promoter, the groESgene, and the hybrid groEL-cpn60-1 gene. The plasmidpMa50 contains the complete groE operon, which wascloned as an EcoRI-HindIII fragment from pPOD50 intopMa5.8. pMaCpn60-1 contains the groE promoter, thegroES gene, and the complete cpn60-1 gene, cloned as aBamHI-HindIII fragment from the plasmid pC15(Wallington & Lund, 1994) into BglII-HindIII-cut pMa50.Plasmids for expression of GroEL, Cpn60-1, and hybridsbetween them in a �groEL background were all deriva-tives of pBAD30 (Guzman et al., 1995). All were con-structed by cloning a MunI fragment from theappropriate pPODX or pMaX plasmid into EcoRI-cutpBAD30. MunI cuts near the 30 end of the groES geneand downstream of the cpn60-1 gene; thus, this fragmentwill contain the full length hybrid and a short non-trans-lated stretch of groES. pBAD50 (which expresses GroELalone) was made by cloning a MunI-HindIII fragmentfrom pMa50 into pBAD30, cut with EcoRI and HindIII.All these plasmids were designated pBADX, using thenomenclature described above.

Site directed mutagenesis

All oligonucleotides used in mutagenesis are shown inTable 1. Oligonucleotides were phosphorylated prior tomutagenesis using polynucleotide kinase (PNK; 10units/ml) in 70 mM Tris-HCl (pH 7.6), 10 mM MgCl2,5 mM DTT and 1 mM ATP at 37�C for 15 minutes. PNKwas then heat inactivated at 65�C for ten minutes. Muta-genesis was carried out essentially as described byKunkel et al. (1987). Brie¯y, uracil-containing DNA wasprepared by transformation of the required plasmid intostrain CJ236 (dutÿ ungÿ). The single-stranded uracil con-taining plasmid DNA was propagated by use of phageVCS M13, and extruded into the growth medium. Phagewere precipitated from the supernatant by 20% (w/v)polyethylene glycol 8000, 2.5 M NaCl. The DNA was

phenol extracted, ethanol precipitated, then resuspendedin TE buffer (pH 8.0). The mutagenesis reactions werecarried out as described in the BioRad Muta-gene M13in vitro mutagenesis kit, version 2. A 10 ml aliquot of themutagenesis mixture was transformed into the E. colistrain TG2, and the remaining 3 ml run on a 1% (w/v)agarose gel with the single-stranded DNA controls tocon®rm successful second strand synthesis. Mutatedgenes for hybrid proteins were designated XAyB, whereX was the number given to the original hybrid, and amutation had been made from residue A to residue B atposition y.

In vitro construction of further hybrid genes

NruI and BglII restriction sites were introduced intogroEL at the same positions as naturally occurring NruIand BglII sites in cpn60-1. Hybrids were produced utilis-ing the NruI site by ligation of fragments such that theresulting hybrid genes produced proteins containingamino acid residues 1 to 101 from GroEL fused to resi-dues 102 to 548 of Cpn60-1, and vice versa (hybrids P501and P502, respectively). The BglII site was used to pro-duce hybrids coding for amino acid residues 1 to 137from GroEL and 138 to 548 from Cpn60-1, and the reci-procal hybrid with Cpn60-1 residues 1 to 136 and resi-dues 137 to 548 from GroEL (hybrids P503 and 504,respectively). These hybrids were cloned into pBAD30 orpMa5.8 as described above, to give the plasmidspBAD501 to pBAD504, and pMa501 to pMa504 respect-ively.

Detection of mutants

Plasmid DNA was screened for the gain or loss ofrestriction sites by digestion with the respective restric-tion endonucleases. Mutants were con®rmed by DNAsequence analysis. Mutations which did not result in thegain or loss of a restriction site (position 104 of GroELand P211) were detected by DNA sequence analysis.

Analysis of protein expression

TG2 strains containing plasmids producing the mutantor hybrid proteins under investigation were grown over-night. Whole cell preparations were made by harvestingvolumes of overnight cultures with equivalent A600

values. To prepare non-denatured protein extracts, cellswere pelleted and resuspended in 125 ml TES (50 mMTris-HCl (pH 8.0), 5 mM EDTA, 20% (w/v) sucrose,600 g lysozyme mlÿ1) and incubated on ice for ten min-utes. Equilibration buffer (375 ml) (50 mM Tris-HCl(pH 8.0), 66 mM EDTA, 200 mM KCl) was added, andthe cells were lysed by three cycles of freeze-thawing inliquid nitrogen. Cell debris was pelleted by centrifu-gation at 13,000 g for ten minutes at 4�C. A 50 ml volumeof the supernatant was removed and 10 ml loading buffer(0.075 M Tris-HCl (pH 6.8), 50% (v/v) glycerol, 0.25%(w/v) bromophenol blue) added. Extracts were analysedinitially on 12.5% (w/v) acrylamide/SDS gels and sub-sequently on non-denaturing 4% to 20% gradient poly-acrylamide gels (BioRad). Proteins were visualised byCoomassie blue staining and by immunoblotting. Highmolecular mass native protein markers were obtainedfrom Pharmacia.

Ring-ring Interactions in GroEL Homologues 799

Immunoblotting

Following separation by non-denaturing gradient gelsproteins were detected by electroblotting (300 mA for2.5 hours) onto nitrocellulose and probing with a mono-clonal antibody (4-3F) raised against E. coli GroEL(A. Ivic, personal communication). Bound antibody wasdetected using 4-chloro-1-napthol via an anti-mousehorseradish peroxidase conjugate.

P1 transduction

The chromosomal groEL gene was deleted by P1 trans-duction using a P1 phage lysate derived from a strain inwhich there is a precise replacement of the chromosomalgroEL gene with the nptII gene from Tn5, conferringkanamycin resistance (Ivic et al., 1996). Candidate colo-nies were grown on 200 mg mlÿ1 carbenicillin, 0.2% (w/v) arabinose and 10 mg mlÿ1 kanamycin for two days.Approximately 100 colonies from each plate were thentransferred to 200 mg mlÿ1 carbenicillin, 0.2% arabinoseand 50 mg mlÿ1 kanamycin plates and grown overnight.Those colonies that showed good growth were trans-ferred to 5 ml of LB broth and incubated overnight, thenstreaked onto minimal plates containing glucose or ara-binose. All of the colonies that grew on arabinose butnot glucose were analysed by polymerase chain reactionto con®rm the replacement of the chromosomal groELgene with the nptII gene.

Complementation analysis

The strain AI90 with the chromosomal copy of thegroEL gene deleted (Ivic et al., 1996) containing variousplasmids were grown overnight in L-broth containing0.2% (w/v) arabinose. Overnight cultures were dilutedto a standard A600 of 0.1, and dilutions (10ÿ5 to 10ÿ7 in0.85% (w/v) saline) were plated in triplicate onto dupli-cate plates, which were incubated at 37�C or 42�C toidentify complementation of the temperature sensitivephenotype. Growth was scored after 24 hours. Resultswere recorded as number of viable cells mlÿ1.

Acknowledgements

We are grateful to Rachel Bowman, Kath Brocklehurst,Alex Connor, Jeremy Hartley, Duncan Nickless andBarnaly Pande; ®nal year project students in the lab whohelped constructing some of the mutants and hybridsdescribed here, and Neil Ranson, Steve Burston andTony Clarke who provided us with puri®ed P211 andGroEL protein. BBSRC and the MRC provided ®nancialsupport.

References

Bochkareva, E. S. & Girschovich, A. S. (1992). ATPinduces non-identity of two rings in chaperoninGroEL. J. Biol. Chem. 267, 6796±6800.

Braig, K., Otowinski, Z., Hegde, R., Boisvert, D. C.,Joachimiak, A., Horwich, A. L. & Sigler, P. B.(1994). The crystal structure of the bacterial chaper-onin GroEL at 2.8 A. Nature, 371, 578±586.

Chen, S., Roseman, A. M., Hunter, A. S., Wood, S. P.,Burston, S. G., Ranson, R. A., Clarke, A. R. & Saibil,H. R. (1994). Location of a folding protein and

shape changes in GroEL-GroES complexes imagedby cryo-electron microscopy. Nature, 371, 261±264.

Ellis, R. J. & Hartl, F.-U. (1996). Protein folding in thecell: competing models of chaperonin function.FASEB J. 10, 20±26.

Fayet, O., Louarn, J.-M. & Georgopoulosm, C. (1986).Suppression of the Escherichia coli dnaA46 mutationby ampli®cation of the groES and groEL genes. Mol.Gen. Genet. 202, 435±445.

Fenton, W. A. & Horwich, A. L. (1997). GroEL-mediatedprotein folding. Protein Sci. 6, 743±760.

Gray, T. E. & Fersht, A. R. (1991). Co-operativity in ATPhydrolysis by GroEL is increased by GroES. FEBSLetters, 292, 254±258.

Guzman, L.-M., Belin, D., Carson, M. J. & Beckwith, J.(1995). Tight regulation, modulation, and high levelexpression by vectors containing the pBAD promo-ter. J. Bacteriol. 177, 4121±4130.

Hartl, F.-U. (1994). Protein folding: secrets of a double-doughnut. Nature, 371, 557±559.

Hartl, F.-U. (1996). Molecular chaperones in cellular pro-tein folding. Nature, 381, 571±580.

Hayer-Hartl, M. K., Weber, F. & Hartl, F.-U. (1996).Mechanism of chaperonin action ± GroES bindingand release can drive GroEL-mediated protein fold-ing in the absence of ATP hydrolysis. EMBO J. 15,6111±6121.

Hendrick, J. P. & Hartl, F-U. (1993). Molecular chaper-one functions of heat shock proteins. Annu. Rev.Biochem. 62, 349±384.

Horovitz, A., Bochkareva, E. S., Yifrach, O. &Girshovich, A. S. (1994). Prediction of an inter-ringinteraction in the chaperonin GroEL from multiplesequence alignments is con®rmed by double-mutantcycle analysis. J. Mol. Biol. 238, 133±138.

Ivic, A., Olden, D., Wallington, E. J. & Lund, P. A.(1996). Deletion of Escherichia coli groEL is comple-mented by a Rhizobium leguminosarum groEL homol-ogue at 37�C but not at 43�C. Gene, 194, 1±8.

Kunkel, T. A., Roberts, J. D. & Zakour, R. A. (1987). Pro-duction of single stranded plasmid DNA. MethodsEnzymol. 154, 367±370.

Lorimer, G. H. & Todd, M. J. (1996). GroE structuresgalore. Nature Struct. Biol. 3, 116±121.

Mayhew, M., Dasilva, A. C. R., Martin, J.,Erdjumentbromage, H., Tempst, P. & Hartl, F.-U.(1996). Protein folding in the central cavity of theGroEL-GroES chaperonin complex. Nature, 379,420±426.

Monod, J., Wyman, J. & Changeux, J.-P. (1965). On thenature of allosteric transitions: A plausible model.J. Mol. Biol. 12, 88±118.

Roseman, A. M., Chen, S., White, H., Braig, K. & Saibil,H. R. (1996). The chaperonin ATPase cycle: mechan-ism of allosteric switching and movements of sub-strate-binding domains in GroEL. Cell, 87, 241±251.

Rusanganwa, E. & Gupta, R. S. (1993). Cloning andcharacterisation of multiple chaperonin-encodinggenes in Rhizobium meliloti. Gene, 126, 67±75.

Rye, H. S., Burston, S. G., Fenton, W. A., Beechem, J. M.,Xu, Z., Sigler, P. B. & Horwich, A. L. (1997). Dis-tinct actions of cis and trans ATP within the doublering of the chaperonin GroEL. Nature, 388, 792±798.

Staniforth, R. A., Burston, S. G., Atkinson, T. & Clarke,A. R. (1994). Af®nity of chaperonin-60 for a proteinsubstrate and its modulation by nucleotides andchaperonin-10. Biochem. J. 300, 651±658.

Stanssens, P., Opsomer, C., McKeown, Y. M., Kramer,W., Zabeau, M. & Fritz, H.-J. (1989). Ef®cient oligo-

800 Ring-ring Interactions in GroEL Homologues

nucleotide-directed construction of mutations inexpression vectors by the gapped duplex DNAmethod using alternating selectable markers. Nucl.Acids Res. 17, 4441±4454.

Todd, M. J., Viitanen, P. V. & Lorimer, G. H. (1993).Hydrolysis of adenosine 50triphosphate by Escheri-chia coli GroEL: Effects of GroES and potassium ion.Biochemistry, 32, 8560±8567.

Todd, M. J., Viitanen, P. V. & Lorimer, G. H. (1994).Dynamics of the chaperonin ATPase cycle: impli-cations for facilitated protein folding. Science, 265,659±666.

Todd, M. J., Lorimer, G. H. & Thirumalai, D. (1996).Chaperonin-facilitated protein folding; optimizationof rate and yield by an iterative annealing mechan-ism. Proc. Natl Acad. Sci. USA, 93, 4030±4035.

Wallington, E. J. & Lund, P. A. (1994). Rhizobium legumi-nosarum contains multiple chaperonin (cpn60)genes. Microbiology, 140, 113±122.

Weissman, J. S., Hohl, C. M., Kovalenko, O., Kashi, Y.,Chen, S., Braig, K., Saibil, H. R., Fenton, W. A. &Horwich, A. L. (1995). Mechanism of GroEL action:

productive release of polypeptide from a seques-tered position under GroES. Cell, 83, 577±587.

White, H. E., Chen, S. X., Roseman, A. M., Yifrach, O.,Horovitz, A. & Saibil, H. R. (1997). Structural basisof allosteric changes in the GroEL mutantArg197Ala. Nature Struct. Biol. 4, 690±694.

Xu, Z., Horwich, A. L. & Sigler, P. B. (1997). The crystalstructure of the asymmetric GroEL-GroES-(ADP)7chaperonin complex. Nature, 388, 741±750.

Yifrach, O. & Horovitz, A. (1994). Two lines of allostericcommunication in the oligomeric chaperonin GroELare revealed by the single mutation Arg19Ala.J. Mol. Biol. 243, 397±401.

Yifrach, O. & Horovitz, A. (1996). Allosteric control byATP of non-folded protein binding to GroEL. J. Mol.Biol. 255, 356±361.

Zahn, R., Buckle, A. M., Perrett, S., Johnson, C. M.,Corrales, F. J., Golbik, R. & Fersht, A. R. (1996).Chaperone activity and structure of monomericpolypeptide binding domains of GroEL. Proc. NatlAcad. Sci. USA, 93, 15024±15029.

Edited by A. R. Fersht

(Received 13 January 1998; received in revised form 19 June 1998; accepted 30 June 1998)