Proc. Nadl. Acad. Sci. USAVol. 91, pp. 8925-8929, September 1994Plant Biology

An ethylene-responsive enhancer element is involved in thesenescence-related expression of the carnation glutathione-S-transferase (GSTI) gene

(Dianhus caryophyllusplant hormone/flower senescence/transcription)

HANAN ITZHAKI*, JULIE M. MAXSON, AND WILLIAM R. WOODSONtDepartment of Horticulture, Purdue University, West Lafayette, IN 47907-1165

Communicated by Shang Fa Yang, May 16, 1994

ABSTRACT The increased production of ethylene duringcarnation petal senescence regulates the transcription of theGSTI gene encoding a subunit ofglutathione-S-transferase. Wehave investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements andtrans-acting factors involved in the expression of the GSTIgene. Transient expression assays following delivery ofGSTI 5'flanking DNA fused to a P-glucuronidase reporter gene wereused to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' fanking se-quences ofGST1 identifted a single positive regulatory elementof 197 bp between -667 and -470 necesary for ethylene-re-sponsive expression. The sequences within this ethylene-re-sponsive region were further localized to 126 bp between -596and -470. The ethylene-responsive element (ERE) within thisregion conferred ethylene-regulated expression upon ami lcauliflower mosaic virus-35S TATA-box promoter in an ori-entation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identifyproteins that bind to sequences within the ERE. Nuclearproteins from carnation petals were shown to specificallyinteract with the 126-bp ERE and the presence and binding ofthese proteins were independent of ethylene or petal senes-cence. DNase I footprinting defined DNA sequences between-510 and -488 within the ERE specifically protected by boundprotein. An 8-bp sequence (ATTTCAAA) within the protectedregion shares si ant homology with promoter sequencesrequired for ethylene responsiveness from the tomato fruit-ripening E4 gene.

The gaseous plant hormone ethylene is involved in theregulation of plant growth and development and the responseof plants to biotic and abiotic stresses (1). In carnations, thedevelopmentally programed senescence of flower petals isregulated by the increased production of ethylene (2). Thesenescence of carnation flower petals is an active processinvolving programed cell death as evidenced by the necessityfor gene transcription and protein synthesis (2). This has ledus to clone several senescence-related genes in an attempt tounderstand their functional significance to the processes ofsenescence and the role ethylene plays in their transcriptionalregulation (3, 4). One such gene from carnation was recentlyfound to encode a glutathione-S-transferase (GST; ref. 5).The GSTs are a superfamily of enzymes and catalyze theconjugation of the thiol group of glutathione (GSH) to avariety of electrophilic substrates (6). Plant GSTs have beenshown to conjugate GSH to a number of herbicides leading totheir detoxification (7, 8). In addition, a GST was recentlyshown to bind auxin with high affinity and may be involvedin intercellular transport or conjugation of this important

plant hormone (9). The function of the carnation senescence-related GST is unknown. The cDNA representing this gene,pSR8, detects a transcript that increases in abundance duringpetal senescence (3). The increase in ethylene that accom-panies petal senescence is essential for the transcriptionalactivation of the SR8 gene (4). Other plant GSTs have beenshown to respond to a number ofinducers, including ethylene(10), herbicide safeners (11), auxin (12), and pathogens (13).Given the variety ofinducers it will be ofinterest to determineif common cis elements are involved in the transcriptionalregulation of these genes. The transcriptional regulation ofGSTs in mammalian cells in response to xenobiotics andantioxidants has been studied in detail (14). Cis elementshave been identified in the promoters of the GST Ya subunitgenes from mouse and rat that are responsible for inducibleexpression of these genes (15-17). To date, no detailedfunctional analysis ofthe 5' flanking region ofa plantGST hasbeen reported. We recently described the carnation senes-cence-related GSTJ gene (18) and reported that -1457 bp ofthe 5' flanking DNA of this gene was sufficient to conferethylene responsiveness to a chimeric reporter gene. In thispaper we report the identification of a region of the carnationGSTI promoter that is both necessary and sufficient forethylene-responsive transcription of this gene during petalsenescence. We also define sequence-specific protein bind-ing sites within this region using gel mobility-shift and DNaseI footprinting analyses.

MATERIALS AND METHODSPlant Material. Carnation (Dianthus caryophyllus L. cv.

White Sim) flowers were harvested from greenhouse-grownplants at anthesis. Flower petals were removed for all ex-periments and placed on moist filter paper in Petri dishes. Forethylene treatment, flower petals were placed in 24-literPlexiglas chambers through which humidified ethylene in airwas passed. The concentration of ethylene (10 A/liter) wasverified by analyzing the effluent air for ethylene by gaschromatography.

Construction of Chimeric Genes. The construction of aGSTI-f3-glucuronidase (GSTI-GUS) chimeric gene was pre-viously described (18). This chimeric gene consists of the 5'flanking region of GSTI (-1457 to +15) ligated to the GUScoding sequences and nopaline synthase (NOS) 3' poly(A)addition sequences ofpBI201.2 (Clontech). This plasmid wasused as a template to generate a series of 5' deletions usingexonuclease III. Internal deletions from the GSTJ 5' flanking

Abbreviations: CaMV, cauliflower mosaic virus; GUS, frglucuroni-dase; GST, glutathione-S-transferase; LUC, luciferase; NOS, no-paline synthase; ERE, ethylene-responsive element; MU, 4-meth-ylumbelliferone.*Present address: Institute of Field and Garden Crops, AgriculturalResearch Organization, The Volcani Center, Bet Dagan 50250,Israel.to whom reprint requests should be addressed.

8925

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

June

20,

202

0

Proc. Natl. Acad. Sci. USA 91 (1994)

DNA of the chimeric genes were made by digestion withrestriction endonucleases and religation. The structure of theresulting plasmids and the deletion endpoints were confirmedby DNA sequence analysis.

Particle Bombardment. The transient expression of chi-meric GSTI-GUS genes was determined following delivery ofDNA into cells by particle bombardment (19) using a BiolisticPDS-1000/He particle delivery system (Bio-Rad). Approxi-mately 10 ,ug of supercoiled CsCl-purified plasmid DNA wasprecipitated onto 3 mg of 1.6-pm gold particles in 50%oethanol/50% glycerol according to the manufacturer's in-structions. The amount of DNA was adjusted for deletedplasmids to ensure equal molar amounts of DNA. TheDNA-coated gold particles were resuspended in 100o etha-nol and 10 gl pipetted onto macrocarrier disk for eachbombardment. Intact flower petals, placed on moist filterpaper in a Petri dish, were bombarded at a distance of 2 cmfrom the stopping plate using 1300-psi (1 psi = 6.89 kPa)rupture disks. Following bombardment, tissue samples wereincubated for 16 hr in 24-liter chambers through whichhumidified ethylene-free air or ethylene in air (10 ul/liter)was passed.GUS Assays. Following incubation, petal tissue was ex-

tracted and extracts were analyzed for GUS activity byfluorometric quantification of 4-methylumbelliferone (MU)produced from 4-methylumbelliferyl f3D-glucuronide (Sig-ma) as described (20, 21). GUS activity was expressed inpmol of product generated per min per petal. The conditionsof bombardment were such that the entire petal was apotential target for particles and therefore relating GUSactivity back to the petal ensured all cells expressing GUSwere included in the calculation.

Preparation of Nuclear Proteins. Crude nuclei were pre-pared from carnation flower petals as described (22). Nuclearprotein extracts were prepared according to Miskimins et al.(23). Following protein determination (Bio-Rad protein as-say), aliquots were frozen in liquid N2 and stored at -800C forup to 1 month.

Gel Mobility-Shift Assay. Fragments of the GSTI promoterwere amplified by PCR using the following oligonucleotidepairs with the 5' deletion constructs in pBI201.2 as templates.Fragment A: sense, Sp6 primer; antisense, 5'-GAGATGC-TACATGCTAGGC-3'. Fragment B: sense, 5'-GAATTGAA-TGGAGGGAGGA-3'; antisense, 5'-GAGATGCTACATGC-TTAGGC-3'. Fragment C: sense, Sp6 primer; antisense, 5'-CTCCTCCCTCCATTCAATT-3'. Promoter fragments wereend-labeled with [32P]dATPby filling-in 3' recessed ends withKlenow fragment (Promega). Binding reactions were carriedout in 20 /4 of solution containing 0.1-0.2 ng oflabeled DNA,1 pg ofpoly(dI-dC), 1 pug ofnuclear proteins, 10mM Tris*HCI(pH 7.9), 50 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol,and 5% glycerol at 25°C for 15 min. In competition experi-ments, 20x molar excess ofunlabeled DNA was added to thereaction for 15 min prior to the addition of labeled DNA.Reaction products were separated on nondenaturing 4%polyacrylamide gels as described (22). The dried gels wereexposed to x-ray film at -70°C with intensifying screensovernight.DNase I Footprinting. Approximately 0.5 ng of 32P-labeled

DNA was incubated with nuclear proteins as described aboveexcept that reactions were scaled up to 80-pl volumes toaccommodate increasing protein concentrations. After incu-bation at 25°C for 15 min, CaCl2 was added to 1 mM andMgCl2 to 5 mM followed by DNase I addition (1 pg) for 5 min.Reactions were terminated by adding 80 ,u of stop solution(30 mM EDTA/1% SDS/300 mM NaCl/250 mg oftRNA perml) followed by phenol extraction and ethanol precipitation.Maxam-Gilbert sequencing ofthe labeledDNA fragment wasperformed according to Maniatis et al. (24). Samples weredissolved in 5 Al of sequencing load mix (United States

Biochemical), boiled for 3 min, placed on ice, and loaded ontoan 8% polyacrylamide sequencing gel.

RESULTSAnalysis of 5' Deletions of the GSTI Promoter. To investi-

gate the sequences responsible for ethylene-responsive ex-pression of the carnation GSTI gene we employed micropro-jectiles to deliver DNA constructs into petal tissue. Theanalysis oftransient gene expression in situ by this method ofDNA delivery has been found to reliably duplicate tissue-specific (25, 26), environmental (25), and hormonal cues (27)responsible for regulated transcription of stably integratedDNA. Previously we reported that a chimeric GSTI-GUSgene was responsive to ethylene in transient assays followingdelivery into petal tissue by particle bombardment (18). Toidentify regions that are required for this ethylene-regulatedexpression, a series of5' deletions ofthe GSTI-GUS chimericgene was generated. Using particle bombardment, theseconstructs were delivered into petals isolated from carnationflowers at anthesis (Od) or from flowers entering into theethylene climacteric 5-6 days after harvest (senescing).Senescing petals were allowed to continue into the laterstages of senescence overnight in air, while presenescentpetals were incubated in air or ethylene (10 //liter) for 16 hrfollowing bombardment. In preliminary experiments we at-tempted to employ an internal standard by bombarding withtwo constructs simultaneously. In this case the control plas-mid was a 1.6-kbp cauliflower mosaic virus (CaMV)-35Spromoter fused to luciferase (LUC) (27). However, back-ground luminescence, which increased in senescing flowerpetals, severely limited the usefulness of this control. There-fore, experiments were conducted using only the chimericgene of interest and generally involved between 8 and 12replicate bombardments. Treatment of petals with ethylenefollowing delivery of the -1457-bp GSTJ-GUS constructresulted in a 10-fold increase in GUS activity (Fig. 1). A lesspronounced induction was observed with naturally senescingpetals. This is likely due to the decrease in cell viability

300

250

C 200

2 150

ECL 100

50

00-

CM M "i tm mCO CD

co r-- 0 101) c .:> 0)q' I? I

FIG. 1. Deletion analysis of the GSTI 5' flanking DNA. GSTJpromoter deletion endpoints relative to the start of transcription areindicated in bp shown on the abscissa. Chimeric genes were deliv-ered into carnation petals by particle bombardment. Petals wereincubated in ethylene-free air or ethylene (10 /4/liter) for 16 hrfollowing bombardment and then assayed for GUS activity. Errorbars represent the standard deviation of the mean and each pointrepresents an average of at least eight bombardments. Air, petalsfrom flowers at anthesis incubated in ethylene-free air; Ethylene,petals from flowers at anthesis incubated in ethylene (10 4/liter);Senescing, petals from flowers 6 days after harvest and producingclimacteric ethylene.

8926 Plant Biology: Itzhaki et al.

Dow

nloa

ded

by g

uest

on

June

20,

202

0

Proc. Natl. Acad. Sci. USA 91 (1994) 8927

associated with tissues that have passed through the ethyleneclimacteric into advanced stages of senescence. In contrast,a chimeric CaMV-35S-GUS gene (pBI221) did not exhibitincreased expression in response to exogenous ethylenetreatment. A promoterless GUS construct (pBI201) wasdelivered into petal tissue to assess background levels ofGUS activity. In this case GUS activity was typically <5pmol ofMU per min per petal and was unaffected by ethyleneor petal senescence. In the absence of ethylene, the -1457construct exhibited GUS activity =2-fold above the promot-erless pBI2O1 construct. Treatment of petals with the ethyl-ene action inhibitor 2,5-norbornadiene did not reduce thisGUS activity (data not shown), suggesting wounding by theparticles did not lead to sufficient ethylene to induce theGST1 promoter. Deletion of the GSTI promoter to -956 bpdid not influence the GUS activity in response to ethylene;however, further deletion to -667 bp resulted in a 25-foldinduction of GUS activity following ethylene treatment anda 20-fold induction in senescing petals. This result suggeststhat a silencing element is present between -956 and -667of the GSTI gene. Further deletion of the GSTI 5' flankingsequences to -470 completely eliminated the ethylene-

A

I I GUS-NOB -956

-956 4 -231I 1 GUS -956 A-364/-231

-956 -875Li

-231G S-NOB -956 A-875/-231

-667I IT -GUS-NOBS - 6 6 7

-667 -364 -2311 1 a8GUS--667 A-864/-231

responsive expression of the chimeric GSTI-GUS gene.These results indicate that 197 bp are necessary for ethylene-responsive expression of the carnation senescence-relatedGSTJ gene.To determine if sequences downstream of the ethylene-

responsive region of GSTI participate in ethylene-regulatedgene expression a series of chimeric constructs was gener-ated in which internal sequences were deleted (Fig. 2A).These internal deletions took advantage of several Acc I siteswithin the GSTI promoter. Deletion of 133 bp between -364and -231 did not affect the ethylene responsiveness ofeitherthe -956 or the -667 GSTI-GUS chimeric gene (Fig. 2B). Incontrast, an internal deletion between -875 and -231 bpremoved the ethylene-responsive region and resulted in com-plete loss of ethylene-regulated expression of the chimeric

A

-667

-461 +8

1 -1CaMV GUS-rbcS 3

-470 -4W- +8\/I- I

GST1 TCaM GUS-rbcS 3'

-667 -580-46 +8I I

GSTI M GUS~c3

-596 -470546- +81 1

GSTI CaM| GUS-rbcS 3'

-470 -596 46- +81-1

GST1 CaMV GUS-rbcS 1

-596 -470 -596 -470 -596 -470-46- +8

GST1 GST1 I GST1 I Camvl GUS-rbcS3|

A

B

C

D

E

F

B

IE

B

35

30 1

0)

0.fC

E0.V-

r- qp-~~~~~C'

C#) cr) ~~~~~~~Cf'

I c cm

25 F

20 V

15 -

10 F

5

0

FIG. 2. Effects of internal deletions on the ethylene-responsiveexpression of the GSTI promoter. (A) Schematic representations ofvarious constructs in which portions of the 5' flanking DNA weredeleted. The thin lines represent the 5' flanking DNA of GSTJ. Thesolid box represents the relative position of the ethylene-responsiveregion between -667 and -470. Deletion endpoints are in bp andwere generated by digestion with Acc I followed by religation. (B)Chimeric genes were delivered into carnation petals by particlebombardment and incubated in air or ethylene (10 pl/liter) for 16 hrand then assayed forGUS activity. Error bars represent the standarddeviation of the mean and each point is the average of at least eightbombardments.

A B C D E F

Construct

FIG. 3. Effects of 5' flanking sequences ofGSTI on the ethylene-responsive expression of a minimal CaMV-35S promoter fused toGUS. (A) Schematic representation of chimeric genes constructedbetween a minimal CaMV-35S TATA-box promoter fused to GUSand 5' flanking sequences of GSTL. (B) Chimeric genes were deliv-ered into carnation petals by particle bombardment. Petals wereincubated in air (open boxes) or 10 4 of ethylene per liter (closedboxes) for 16 hr following bombardment and then assayed for GUSactivity. Error bars represent the standard deviation ofthe mean andeach point represents an average of at least eight bombardments.

Plant Biology: Itzhaki et al.

Dow

nloa

ded

by g

uest

on

June

20,

202

0

Proc. Natl. Acad. Sci. USA 91 (1994)

gene. Interestingly, the -364 to -231 internal deletion froma -956 GSTI-GUS chimeric gene increased ethylene-responsive expression significantly over the complete -956construct. This result indicates that sequences downstreamof the ethylene-responsive element (ERE) act in a combina-torial fashion with silencing sequences between -956 and-667.The Ethylene-Responsive Region of GSTI Is Sufficient for

Ethylene-Regulated Expression. To determine whether se-quences present between -667 and -470 of the GST1 pro-moter are sufficient to confer ethylene responsiveness, thisregion was fused to a minimal CaMV-35S promoter (28)containing a TATA box and driving the transcription of theGUS coding region (Fig. 3A). Bombardment of carnationpetals with this construct resulted in a 6-fold induction ofGUS activity in response to ethylene exposure (Fig. 3B). Tolocalize more precisely the regulatory sequences within the197-bp GSTI promoter, these sequences were further dividedinto two regions (-667 to -580 and -55% and -470; Fig. 3A).Sequences present between -5% and -470 (Fig. 3B, con-struct D) conferred ethylene responsiveness to the minimalCaMV-35S promoter. The ERE between -596 and -470functioned in an orientation-independent manner (Fig. 3B,construct E) and exhibited additive responsiveness whentandemly arranged (Fig. 3B, construct F). Taken together,these data suggest that the regulatory sequences between-5% and -470 function as an ethylene-responsive enhancerelement.A Carnation Flower Petal Nuclear Protein Interacts with the

Ethylene-Responsive Region of GSTL. To identify nuclearproteins from carnation petals that interact specifically withsequences in the ethylene regulatory region ofGST1, nuclearextracts were prepared from petals at anthesis, petals treatedwith ethylene, and petals producing the climacteric ethyleneassociated with senescence. These proteins were incubatedwith a 32P-end-labeled promoter fragment from -667 to-470. DNA binding activity was present in both presenes-cent and ethylene-producing petals (Fig. 4). Similar DNAbinding patterns were observed with nuclear proteins isolatedfrom ethylene-treated petals (data not shown). Addition of a20-fold molar excess of unlabeled fragments from -667 to-470 (fragment A) and -5% to -470 (fragment B) effectivelycompeted for protein binding to the labeled GSTI fragment.

A-667

C

Comp. (20x)

Protein

o day

A B C

+ + +$ +

-470

B

6 day

A B C;

d * Bound on

Free aFIG. 4. Gel mobility-shift analysis of the ERE-containing GSTI

promoter region using crude nuclear extracts from carnation petalsat anthesis (0 day) or entering the ethylene climacteric (6 day).Binding of the end-labeled GSTI promoter fragment from -667 to-470 with petal nuclear protein competed with a 20x molar excessof unlabeled DNA fragments: A, -667 to -470; B, -596 to -470; C,-667 to -580. Products were analyzed on a 4% nondenaturingpolyacrylamide gel.

CODING STRAND NONCODING STRAND

iig protein 0 30 75 0 30 75

I,"

GTGATTTACCACCTATTTCAAAGCACTAAATGGTGGATAAAGTTTC

FIG. 5. DMase I protection analysis of the ethylene-responsiveGSTI promoter region (-667 to -470) defined by interaction ofnuclear factors from carnation petals in the ethylene climacteric. Thepromoter fragment was end-labeled on the coding or noncodingstrand and incubated with the indicated concentration of nuclearprotein prior to DNase I digestion. Products were analyzed on an 8%polyacrylamide denaturing gel. Maxam-Gilbert G and A + G se-quencing reactions were run on the same gel to precisely identifyprotected regions. The GSTI promoter sequence from -510 to -488is shown. Thick lines correspond to regions of protection on eachstrand. Arrows indicate sequences with dyad symmetry.

In contrast, no competition for DNA binding activity wasobserved with the GSTI 5' flanking sequences between -667and -570 (fragment C). To more precisely localize thesequences involved in protein binding, DNase I footprintingwas performed on both strands of the -667 to -470 GSTI 5'flanking sequence. Incubation with nuclear extracts frompetals in the ethylene climacteric revealed regions of protec-tion from -510 to -488 on both strands (Fig. 5). Thissequence exhibits an imperfect dyad symmetry common toDNA-protein binding sites. These data show that a DNAbinding factor(s) is present in nuclear extracts of carnationpetals that interacts specifically with a region of the GSTIpromoter (-5% to -470) containing an ERE. The agreementbetween functional ethylene regulation and in vitro proteinbinding activity suggests that the DNA binding protein(s)may represent trans-acting factor(s) involved in the ethylene-regulated expression of GSTI.

DISCUSSIONIn the flowers of carnation it is well established that theincreased ethylene production associated with petal senes-cence regulates the processes of programed cell death in-cluding the transcriptional activation of senescence-relatedgenes (2, 4). In an attempt to understand how ethyleneregulates-gene expression during petal senescence we haveexamined the cis elements and trans-acting factors involvedin the transcriptional regulation of the carnation senescence-related GSTI gene.Idencation of DNA Sequences Necess and Suit

for Ethylene-Responsive Gene Expression. We employed aparticle bombardment transient gene expression system tofunctionally define the DNA sequences involved in ethylene-inducible expression of the GST1 gene. A single positiveregulatory region of 197 bp between -667 and -470 of theGSTI 5' flanking DNA was necessary for ethylene-respon-sive expression (Fig. 1). The ERE was further localized to a126-bp region between -55% and -470. The sequences withinthis ERE were sufficient to confer ethylene-responsive ex-

8928 Plant Biology: Itzhaki et al.

Dow

nloa

ded

by g

uest

on

June

20,

202

0

Proc. Natl. Acad. Sci. USA 91 (1994) 8929

pression upon a minimal CaMV-35S TATA-box promoter.The ERE functions in an orientation-independent mannerand thus may represent an ethylene-responsive enhancerelement. In addition, removal of sequences downstream ofthe ERE did not alter ethylene responsiveness (Fig. 2)indicating position-independent regulation. We previouslyidentified DNA sequences between -595 and -578 withinthe ERE that shared homology with a region ofthe 5' flankingDNA of a pathogen-induced wheat GST gene (29). In addi-tion, an AP-1-like motif is present within the ERE between-567 and -561. Similar sequences are present within theEpRE ofthe mouse GST Ya gene (15,16) and the antioxidant-responsive element (ARE) of the rat GST Ya gene (17). TheEpRE of the mouse GST Ya subunit promoter contains twoadjacent AP-1-like binding sites and the close proximity ofthese two sites was shown to be essential for inducibleexpression (16). In contrast, the carnation GST1 ERE con-tains only one AP-1-like binding site. The functional signif-icance of this site remains to be determined. In addition toAP-1-like sequences ofthe EpRE, the 5' flanking sequence ofthe rat GST Ya gene was also found to include a xenobiotic-responsive element similar to those found in the planararomatic-responsive cytochrome P1-450 genes (17). This doesnot seem to contribute to the responsiveness of this gene toplanar aromatic inducers since deletion ofthe element did notinhibit basal or inducible expression of the gene (17). Thecarnation GSTI ERE does not contain sequences similar tothis xenobiotic-responsive element. Comparison of the se-quences within the GSTI ERE to other ethylene-responsivepromoters, including the tomato E8 gene (30), the beanchitinase gene (31), the PRB-lb gene (32), an avocado cel-lulase gene (33), or the carnation SR12 gene (22), revealed nosignificant homologies. The consensus sequences recentlyidentified in ethylene-responsive pathogenesis-related pro-moters (32) were likewise not contained within the ERE ofGSTL.Nuclear Proteins from Carnation Petals Interact with the

Defined ERE. The DNA sequences between -5% and -470,which make up the functionally defined ERE, specificallyinteract with nuclear proteins from carnation petals as de-termined by gel mobility-shift assays and DNase I footprint-ing. These proteins could represent trans-acting factors in-volved in the formation of an active transcription complex.The protein(s) that specifically bind to the ERE are presentin the nuclei of petals at anthesis, during the ethyleneclimacteric and following treatment with exogenous ethyl-ene. Since GSTI transcription is ethylene-inducible, post-translational modifications or interactions with other proteinsmay be an essential part of ethylene-regulated expression.Interestingly, cis elements of other ethylene-responsivegenes have been shown to interact with nuclear proteins in anethylene-independent manner (22, 27, 32). DNase I footprint-ing was used to more precisely define the DNA sequencesbound by carnation nuclear proteins. Sequences between-510 and -488 were protected from DNase I digestion byinteracting protein(s). The protected sequences do not rep-resent the region of homology with the wheat gstlA gene orthe AP-1-like motif previously identified in the GSTI pro-moter (18). However, within the footprinted region an 8-bpsequence (ATTTCAAA) is very similar to sequences withinthe ethylene-responsive region of the E4 gene from tomato(27). The DNA sequence within the E4 gene (AATTCAAA)was previously shown to be protected from DNase I digestionby proteins from the nuclei of unripe fruit, and to a lesserextent ripe fruit (27). Given the strict regulation of the GSTIand E4 genes by ethylene, it is possible that these sequencesrepresent cis-acting EREs and the proteins that bind to thesesequences are trans-acting factors involved in transcriptionalactivation. The symmetrical sequence motif within the GSTIfootprinted region may serve as contact points for a dimeric

trans-acting factor. The cloning ofcDNAs encoding proteinsthat specifically interact with the GSTI ERE should allow usto begin to address their function in ethylene-responsive geneexpression during carnation petal senescence.

We thank Peter Goldsbrough and Clint Chapple for critical reviewof the manuscript, Ron Somerville for valuable suggestions, andAmanda Brandt for excellent technical assistance. This is publicationno. 14,177 of the Purdue University Office of Agricultural ResearchPrograms. This research was supported by National Science Foun-dation Grants DCB-8911205 and IBN-9206729.

1. Mattoo, A. K. & Suttle, J. C. (1991) The Plant HormoneEthylene (CRC, Boca Raton, FL).

2. Borochov, A. & Woodson, W. R. (1989) Hortic. Rev. 11,15-43.

3. Lawton, K. A., Huang, B., Goldsbrough, P. B. & Woodson,W. R. (1989) Plant Physiol. 90, 690-696.

4. Lawton, K. A., Raghothama, K. G., Goldsbrough, P. B. &Woodson, W. R. (1990) Plant Physiol. 93, 1370-1375.

5. Meyer, R. C., Jr., Goldsbrough, P. B. & Woodson, W. R.(1991) Plant Mol. Biol. 17, 277-281.

6. Pickett, C. B. & Lu, A. Y. H. (1989) Annu. Rev. Biochem. 58,743-764.

7. Mozer, T. J., Tiemeier, D. C. & Jaworski, E. G. (1987) Bio-chemistry 22, 1068-1072.

8. Timmerman, K. P. (1989) Physiol. Plant. 77, 465-471.9. Bilang, J., Macdonald, H., King, P. J. & Sturm, A. (1993) Plant

Physiol. 102, 29-34.10. Zhou, J. & Goldsbrough, P. B. (1993) Plant Mol. Biol. 22,

517-523.11. Wiegand, R. L., Shah, D. M., Mozer, T. J., Harding, E. I.,

Diaz-Collier, J., Sauders, C., Jaworski, E. G. & Tiemeier,D. C. (1986) Plant Mol. Biol. 7, 235-243.

12. Droog, F. N. J., Hooykaas, P. J. J., Libbenga, K. R. & vander Zaal, E. J. (1993) Plant Mol. Biol. 21, 965-972.

13. Dudler, R., Hertig, C., Rebmann, G., Bull, J. & Mauch, F.(1991) Mol. Plant-Microbe Interact. 4, 14-18.

14. Daniel, V. (1993) Crit. Rev. Biochem. Mol. Biol. 28, 173-207.15. Friling, R. S., Bensimon, A., Tichauer, Y. & Daniel, V. (1990)

Proc. Natl. Acad. Sci. USA 87, 6258-6262.16. Friling, R. S., Bergelson, S. & Daniel, V. (1992) Proc. Natl.

Acad. Sci. USA 89, 668-672.17. Rushmore, T. H. & Pickett, C. B. (1990) J. Biol. Chem. 265,

14648-14658.18. Itzhaki, H. & Woodson, W. R. (1993) Plant Mol. Biol. 22,

43-58.19. Klein, T. M., Wolf, E. D., Wu, R. & Sanford, J. L. (1987)

Nature (London) 327, 70-73.20. Jefferson, R. A., Kavanagh, T. A. & Bevan, M. W. (1987)

EMBO J. 6, 3901-3907.21. Jefferson, R. A. (1987) Plant Mol. Biol. Rep. 5, 387-405.22. Raghothama, K. G., Lawton, K. A., Goldsbrough, P. B. &

Woodson, W. R. (1991) Plant Mol. Biol. 17, 61-71.23. Miskimins, K., Roberts, M. P., McClelland, A. & Ruddle,

F. H. (1985) Proc. Natl. Acad. Sci. USA 82, 6741-6744.24. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) Molecular

Cloning: A Laboratory Manual (Cold Spring Harbor Lab.Press, Plainview, NY).

25. Bansal, K. C., Viret, J.-F., Haley, J., Khan, B. M., Schantz,R. & Bogorad, L. (1992) Proc. Natl. Acad. Sci. USA 89,3654-3658.

26. Twell, D., Klein, T. M., Fromm, M. E. & McCormick, S.(1989) Plant Physiol. 91, 1270-1274.

27. Montgomery, J., Goldman, S., Deikman, J., Margossian, L. &Fischer, R. L. (1993) Proc. Natl. Acad. Sci. USA 90, 5939-5943.

28. Benfey, P. N. & Chua, N.-H. (1990) Science 250, 959-966.29. Mauch, F., Hertig, C., Rebmann, G., Bull, J. & Dudler, R.

(1991) Plant Mol. Biol. 16, 1089-1091.30. Deikman, J. & Fischer, R. L. (1988) EMBO J. 7, 3315-3320.31. Broglie, K. E., Biddle, P., Cressman, R. & Broglie, R. (1989)

Plant Cell 1, 599-607.32. Eyal, Y., Meller, Y., Lev-Yadun, S. & Fluhr, R. (1993) Plant

J. 4, 225-234.33. Cass, L. G., Kirven, K. A. & Christoffersen, R. E. (1990) Mol.

Gen. Genet. 223, 76-86.

Plant Biology: Itzhaki et al.

Dow

nloa

ded

by g

uest

on

June

20,

202

0