An Introduction to DNA microarrays

Rebecca Fry, Ph.D.(and Leona Samson)

http://www.buffalo.edu/UBT/UBT

What is a DNA Microarray?genes or gene fragments attached to a substrate (glass)Hybridized slideTwo dyesImage analyzed Tens of thousands of spots/genes=entire genome in 1 experimentA Revolution in Biology

mRNA Analysis MethodsNorthern Blot (Single Gene analysis)

Microarray Technology (Genome Wide Experiment)

mRNAs separated on gel according to sizemRNAs transferred to a membrane and hybridized with small number (1-5) of radioactively labeled DNA probes. Probe corresponds to gene of interestTarget RNA is spatially fixed and the labeled probe is in solution Low throughputNORTHERN BLOTS

i.e., your cloned gene(s)

Number of Genes in Different Organisms

i.e., your cloned gene(s)We could just 35,000 Northern to monitor expression of all genes!!!

Northern BlotsImmobilized mRNA population hybridized with labeled probe representing one gene

DNA MicroarraysImmobilized probes hybridized with labeled mRNA population representing all expressed genes

Need to achieve two things:Immobilize thousands of probes specific for individual genes Label mRNA populations

EGFP ORF1846ATTCTGCAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGAAGCTTAGCCATGGCTTCCCGCCGGCGGTGGCGGCGCAGGATGATGGCACGCTGCCCATGTCTTGTGCCCAGGAGAGCGGGATGGACCGTCACCCTGCAGCCTGTGCTTCTGCTAGGATCAATGTGTAGGCGGCCGCGACTCTAGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGADesigning Oligo Probes70 mer oligo

specific to gene of interest

Number of Genes in Different Organisms

Spotted microarraysLiquid HandlingResuspension of oligoswww.qiageninstruments.com Overview of fabrication of spotted microarraysIntroduction

Need to achieve two things:Immobilize thousands of probes specific for individual genes Label mRNA populations

562 nmcy3cy5www.amersham.comcy3cy5

Differential dye incorporationcy5 less well than cy3Light sensitivity: cy5 more easily degradedProtect your reactions from light!!

664 nm510 nmIntroductioncy3 and cy5: Commonly used dyes

www.genetics.ucla.eduLabeled cDNA preparationRNASample 2Spotted MicroarrayTarget preparationReverse transcriptionFlourescent dyes

IntroductionEGFP KDCombined in equal amounts

Spotted microarray target preparationDirect labelingcy5cy3cDNAcDNAEGFPCo-hybridized to array

www.genetics.ucla.eduLabeled cDNA preparationRNASample 2Spotted MicroarrayTarget preparationReverse transcriptionFlourescent dyes

IntroductionCombined in equal amounts

Spotted microarray target preparationDirect labelingcy5cy3cDNAcDNACo-hybridized to array

yellow cy3=cy5red cy5>cy3green cy3>cy5EGFP KDEGFP

cDNA Two Color ChipsTarget preparation Array preparation

summary

This is the kind of thing you will see in YOUR microarray experiments

Whats happening at each spot?

cDNA Chip vs. Northern Blot

Two Popular Microarraying Platformswww.molgen.mpg.deSpotted microarrayscDNA: PCR products (500-1,000bp)synthesized oligos (70 mer)

>10,000 probesAffymetrixGene Chip500,000 probes25 mer (represents a fragment of a gene)IntroductionCommercially available Oligo microarraywww.the-scientist.com

So..what gene probes are represented on the array you will use??EGFP, p53, EXO1, AAG, ATM, and ATR.But we added in a bunch more!!

POLQPRKDCPRSS25RAD1RAD17RAD18RAD23ARAD23BRAD50RAD51RAD51CRAD51L1RAD51L3RAD52RAD54BRAD54LRAD9RECQL4REV1LalkB homologBreast cancer 1Excision repairGrowth arrest and DNA-damage-inducibleNo homology toHuman sequences

Alien DNA

ABHABH2ABH3ADPRTADPRTL2ADPRTL3APEXAPEXL2ATMATRBIDBLMBRCA1BRCA2

BTG1CASP2CASP3CASP8CASP9CCNHCDK2CDK4CDK6CDK7CDK8CETN2DCLRE1ADDB1DDB2

DMC1DUTEGFPENDOGERCC1ERCC2ERCC3ERCC4ERCC5EXO1FANCAFANCCFANCEFANCFFEN1FOSERCC6

G22P1GADD45AGADD45BGADD45GGTF2H4HAP1HCNPHSU24186HUS1JUNLIG1LIG3LIG4MAD2L2

28SLiver 18S28S6 kb4 kb2 kb1 kb0.5 kb0.2 kbElectropherogram (28S/18S Ratio~2)RNA quality controlLad, 1,2Gel Image (in silico) Sharp, Clear Bands

Pre-labeling quality control:

Determine RNA Quality Agilent Bioanalyzer: 50-500 ngNo more formaldehyde gels!!

Microarray MeasurementsScannerImage Analysis.txt or .xls fileImage Analysis: Spotted arrays

The title of this talk is the design and implementation fo t DNA microarray experiments

Always difference between cy3 and cy5, there is obvious structural difference with an additional double bond