EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006
An Introduction to Knowledge DiscoveryApplications and Challenges
in Life Sciences
Limsoon Wong
2
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Plan
• Quick introduction to knowledge discovery (13 slides, 20 min)
• Apps and challenges of knowledge discovery– Protein function inference (20 slides, 40 min)
– Gene feature recognition (25 slides, 60 min)
– Protein subcellular localization prediction (20 slides, 40 min)
– Disease diagnosis, treatment, and understanding (40 slides, 80 min)
– Biomedical text mining (35 slides, 50 min)
– Discovery of protein binding motifs (40 slides, 60 min)
• Advancing knowledge discovery (3 slides, 10 min)
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006
Quick Intro to Knowledge Discovery
20 min
4
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Jonathan’s rules : Blue or CircleJessica’s rules : All the rest
What is Knowledge Discovery?
Whose block is this?
Jonathan’s blocks
Jessica’s blocks
5
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
What is Knowledge Discovery?
Question: Can you explain how?
6
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Main Steps of Knowledge Discovery
• Training data gathering• Feature generation
– k-grams, colour, texture, domain know-how, ...• Feature selection
– Entropy, χ2, CFS, t-test, domain know-how...• Feature integration
– SVM, ANN, PCL, CART, C4.5, kNN, ...
Someclassifier/methods
7
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
An Abstract Model of a Classifier
• Given a test sample S• Compute scores p(S), n(S)• Predict S as negative if p(S) < t * n(s)• Predict S as positive if p(S) ≥ t * n(s)
t is the decision threshold of the classifier
8
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Neighborhood
5 of class3 of class
=
kNN (k=8)
Image credit: Zaki
9
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
kNN
• Given a sample S, find the k observations Si in the known data that are “closest” to it, and average their responses
• Assume S is well approximated by its neighbours
p(S) = Σ 1Si ∈Nk(S) ∩ DP
n(S) = Σ 1Si ∈Nk(S) ∩ DN
where Nk(S) is the neighbourhood of Sdefined by the k nearest samples to it.
Assume distance between samples is Euclidean distance for now
10
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Curse of Dimensionality
• How much of each dimension is needed to cover a proportion r of total sample space?
• Calculate by ep(r) = r1/p
• So, to cover 1% of a 15-D space, need 85% of each dimension!
00.10.20.30.40.50.60.70.80.9
1
p=3 p=6 p=9 p=12 p=15
r=0.01r=0.1
Exercise: Why ep(r) = r1/p?
11
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Consequence of the Curse
• Suppose the number of samples given to us in the total sample space is fixed
• Let the dimension increase
• Then the distance of the k nearest neighbours of any point increases
• Then the k nearest neighbours are less and less useful for prediction, and can confuse the k-NN classifier
12
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Tackling the Curse
• Given a sample space of p dimensions
• It is possible that some dimensions are irrelevant
• Need to find ways to separate those dimensions (aka features) that are relevant (aka signals) from those that are irrelevant (aka noise)
13
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Signal Selection (Basic Idea)
• Choose a feature w/ low intra-class distance• Choose a feature w/ high inter-class distance
14
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Signal Selection (e.g., t-statistics)
15
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Self-fulfilling Oracle
• Construct artificial dataset with 100 samples, each with 100,000 randomly generated features and randomly assigned class labels
• select 20 features with the best t-statistics (or other methods)
• Evaluate accuracy by cross validation using only the 20 selected features
• The resultant estimated accuracy can be ~90%
• But the true accuracy should be 50%, as the data were derived randomly
16
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
What Went Wrong?
• The 20 features were selected from the whole dataset
• Information in the held-out testing samples has thus been “leaked” to the training process
• The correct way is to re-select the 20 features at each fold; better still, use a totally new set of samples for testing
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006
Protein Function Inference
40 min
18
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Sequence Alignment
• Key aspect of seqcomparison is seqalignment
• A seq alignment maximizes the number of positions that are in agreement in two sequences
Sequence U
Sequence V
mismatch
match
indel
19
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Sequence Alignment: Poor Example
• Poor seq alignment shows few matched positions⇒ The two proteins are not likely to be homologous
No obvious match between Amicyanin and Ascorbate Oxidase
20
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Sequence Alignment: Good Example
• Good alignment usually has clusters of extensive matched positions
⇒ The two proteins are likely to be homologous
good match between Amicyanin and unknown M. loti protein
21
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Multiple Alignment: An Example
• Multiple seq alignment maximizes number of positions in agreement across several seqs
• seqs belonging to same “family” usually have more conserved positions in a multiple seqalignment
Conserved sites
22
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Function Assignment to Protein Seq
• How do we attempt to assign a function to a new protein sequence?
SPSTNRKYPPLPVDKLEEEINRRMADDNKLFREEFNALPACPIQATCEAASKEENKEKNRYVNILPYDHSRVHLTPVEGVPDSDYINASFINGYQEKNKFIAAQGPKEETVNDFWRMIWEQNTATIVMVTNLKERKECKCAQYWPDQGCWTYGNVRVSVEDVTVLVDYTVRKFCIQQVGDVTNRKPQRLITQFHFTSWPDFGVPFTPIGMLKFLKKVKACNPQYAGAIVVHCSAGVGRTGTFVVIDAMLDMMHSERKVDVYGFVSRIRAQRCQMVQTDMQYVFIYQALLEHYLYGDTELEVT
23
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Guilt-by-AssociationCompare T with seqs of known function in a db
Assign to T same function as homologs
Confirm with suitable wet experiments
Discard this functionas a candidate
24
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
BLAST: How It WorksAltschul et al., JMB, 215:403--410, 1990
• BLAST is one of the most popular tool for doing “guilt-by-association” sequence homology search
find from db seqswith short perfectmatches to queryseq
find seqs withgood flanking alignment
25
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
26
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
27
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
28
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Homologs obtained by BLAST
• Thus our example sequence could be a protein tyrosine phosphatase α (PTPα)
29
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Example Alignment with PTPα
30
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Guilt-by-Association: Caveats
• Ensure that the effects of database size and composition have been accounted for
• Ensure that the function of the homology is not derived via invalid “transitive assignment’’
• Ensure that the target sequence has all the key features associated with the function, e.g., active site and/or domain
31
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Law of Large Numbers
• Suppose you are in a room with 365 other people
• Q: What is the prob that a specific person in the room has the same birthday as you?
• A: 1/365 = 0.3%
• Q: What is the prob that there is a person in the room having the same birthday as you?
• A: 1 – (364/365)365 = 63%
• Q: What is the prob that there are two persons in the room having the same birthday?
• A: 100%
32
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Interpretation of P-value
• Seq. comparison progs, e.g. BLAST, often associate a P-value to each hit
• P-value is interpreted as prob that a random seqhas an equally good alignment
• Suppose the P-value of an alignment is 10-6
• If database has 107 seqs, then you expect 107 * 10-6 = 10 seqs in it that give an equally good alignment
⇒ Need to correct for database size if your seqcomparison prog does not do that!
33
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Lightning Does Strike Twice!
• Roy Sullivan, a former park ranger from Virgina, was struck by lightning 7 times– 1942 (lost big-toe nail)– 1969 (lost eyebrows)– 1970 (left shoulder seared)– 1972 (hair set on fire)– 1973 (hair set on fire & legs seared)– 1976 (ankle injured)– 1977 (chest & stomach burned)
• September 1983, he committed suicideCartoon: Ron Hipschman
Data: David Hand
34
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Effect of Seq Compositional Bias
• One fourth of all residues in protein seqs occur in regions with biased amino acid composition
• Alignments of two such regions achieves high score purely due to segment composition
• While it is worth noting that two proteins contain similar low complexity regions, they are best excluded when constructing alignments
• BLAST employs the SEG algorithm to filter low complexity regions from proteins before executing a search
Source: NCBI
35
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Effect of Sequence Length
Source: Abagyan & Batalov
Distribution of seq identity vs length of unrelated proteins
36
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Important Unsolved Challenges
• What if there is no useful sequence homolog?• Guilt by other types of association!
– Domain modeling (e.g., HMMPFAM)– Similarity of dissimilarities (e.g., SVM-PAIRWISE)– Similarity of phylogenetic profiles– Similarity of subcellular co-localization & other
physico-chemico properties(e.g., PROTFUN)– Similarity of gene expression profiles– Similarity of protein-protein interaction partners– …– Fusion of multiple types of info
37
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Fusion of Multiple Types of Info
Model each data source into a graph
Combine graphs from diff sources to form larger graph
38
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Recommended Readings
• Wong, The Practical Bioinformatician, 2004, ICP. Chapters 10 & 19
• Chua et al., Exploiting indirect neighbours and topological weight to predict protein function from protein-protein interactions. Bioinformatics, 2006. (To appear)
• Bateman et al., The Pfam protein families database. NAR, 32:D138-D141, 2004
• Jaakkola et al., A discriminative framework for detecting remote protein homologies. JCB, 7:95-114, 2000
• Jensen et al., Prediction of human protein function from post-translational modifications and localization features. JMB, 319:1257-1265, 2002
• Pellegrini et al., Assigning protein functions by comparative genome analysis: Protein phylogenetic profiles. PNAS, 96:4285-4288, 1999
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006
Gene Feature Recognition
60 min
40
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
...AATGGTACCGATGACCTG... ...TRLRPLLALLALWP......AAUGGUACCGAUGACCUGGAGC...
Central Dogma
41
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Translation Initiation Site
42
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
A Sample cDNA
• What makes the second ATG the TIS?
299 HSU27655.1 CAT U27655 Homo sapiensCGTGTGTGCAGCAGCCTGCAGCTGCCCCAAGCCATGGCTGAACACTGACTCCCAGCTGTG 80CCCAGGGCTTCAAAGACTTCTCAGCTTCGAGCATGGCTTTTGGCTGTCAGGGCAGCTGTA 160GGAGGCAGATGAGAAGAGGGAGATGGCCTTGGAGGAAGGGAAGGGGCCTGGTGCCGAGGA 240CCTCTCCTGGCCAGGAGCTTCCTCCAGGACAAGACCTTCCACCCAACAAGGACTCCCCT............................................................ 80................................iEEEEEEEEEEEEEEEEEEEEEEEEEEE 160EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE 240EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
43
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Approach
• Training data gathering• Signal generation
– k-grams, distance, domain know-how, ...• Signal selection
– Entropy, χ2, CFS, t-test, domain know-how...• Signal integration
– SVM, ANN, PCL, CART, C4.5, kNN, ...
44
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Training & Testing Data
• Vertebrate dataset of Pedersen & Nielsen [ISMB’97]
• 3312 sequences• 13503 ATG sites• 3312 (24.5%) are TIS• 10191 (75.5%) are non-TIS• Use for 3-fold x-validation expts
45
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Signal Generation
• K-grams (ie., k consecutive letters)– K = 1, 2, 3, 4, 5, …– Window size vs. fixed position– Up-stream, downstream vs. any where in window– In-frame vs. any frame
0
0.5
1
1.5
2
2.5
3
A C G T
seq1seq2seq3
46
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Signal Generation: An Example
• Window = ±100 bases• In-frame, downstream
– GCT = 1, TTT = 1, ATG = 1…• Any-frame, downstream
– GCT = 3, TTT = 2, ATG = 2…• In-frame, upstream
– GCT = 2, TTT = 0, ATG = 0, ...
299 HSU27655.1 CAT U27655 Homo sapiensCGTGTGTGCAGCAGCCTGCAGCTGCCCCAAGCCATGGCTGAACACTGACTCCCAGCTGTG 80CCCAGGGCTTCAAAGACTTCTCAGCTTCGAGCATGGCTTTTGGCTGTCAGGGCAGCTGTA 160GGAGGCAGATGAGAAGAGGGAGATGGCCTTGGAGGAAGGGAAGGGGCCTGGTGCCGAGGA 240CCTCTCCTGGCCAGGAGCTTCCTCCAGGACAAGACCTTCCACCCAACAAGGACTCCCCT
47
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Too Many Signals
• For each value of k, there are 4k * 3 * 2 k-grams
• If we use k = 1, 2, 3, 4, 5, we have 24 + 96 + 384 + 1536 + 6144 = 8184 features!
• This is too many for most machine learning algorithms
48
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Signal Selection (Basic Idea)
• Choose a signal w/ low intra-class distance• Choose a signal w/ high inter-class distance
49
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Signal Selection (e.g., CFS)
• Instead of scoring individual signals, how about scoring a group of signals as a whole?
• CFS– Correlation-based Feature Selection– A good group contains signals that are highly
correlated with the class, and yet uncorrelated with each other
50
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Sample K-grams Selected by CFS
• Position –3• in-frame upstream ATG• in-frame downstream
– TAA, TAG, TGA, – CTG, GAC, GAG, and GCC
Kozak consensus Leaky scanning
Stop codon
Codon bias?
51
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Signal Integration
• kNN– Given a test sample, find the k training samples
that are most similar to it. Let the majority class win
• SVM– Given a group of training samples from two
classes, determine a separating plane that maximises the margin of error
• Naïve Bayes, ANN, C4.5, ...
52
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Results (3-fold x-validation)
TP/(TP + FN) TN/(TN + FP) TP/(TP + FP) Accuracy
Naïve Bayes 84.3% 86.1% 66.3% 85.7%
SVM 73.9% 93.2% 77.9% 88.5%
Neural Network 77.6% 93.2% 78.8% 89.4%
Decision Tree 74.0% 94.4% 81.1% 89.4%
53
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Improvement by Scanning
• Apply Naïve Bayes or SVM left-to-right until first ATG predicted as positive. That’s the TIS
• Naïve Bayes & SVM models were trained using TIS vs. Up-stream ATG
TP/(TP + FN) TN/(TN + FP) TP/(TP + FP) Accuracy
NB 84.3% 86.1% 66.3% 85.7%
SVM 73.9% 93.2% 77.9% 88.5%
NB+Scanning 87.3% 96.1% 87.9% 93.9%
SVM+Scanning 88.5% 96.3% 88.6% 94.4%
54
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
mRNA→Protein
F
L
I
MV
S
P
T
A
Y
H
Q
N
K
D
E
C
WR
G
AT
E
LR
S
stop
How about using k-grams from the translation?
55
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Amino-Acid Features
56
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Amino-Acid Features
57
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Amino Acid K-grams Discovered (by Entropy)
58
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Independent Validation Sets
• A. Hatzigeorgiou:– 480 fully sequenced human cDNAs– 188 left after eliminating sequences similar to
training set (Pedersen & Nielsen’s)– 3.42% of ATGs are TIS
• Our own:– well characterized human gene sequences from
chromosome X (565 TIS) and chromosome 21 (180 TIS)
59
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Validation Results (on Hatzigeorgiou’s)
– Using top 100 features selected by entropy and trained on Pedersen & Nielsen’s dataset
60
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
ATGpr
Ourmethod
Validation Results (on Chr X and Chr 21)
• Using top 100 features selected by entropy and trained on Pedersen & Nielsen’s
61
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Important Unsolved Challenges
• Other gene features: TSS, PolyA, Splicing, …
• Gene regulation: TFBS, EREs, miRNA targets, …
• “Dark matters”: miRNA & non-coding genes
62
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
TSS: Is State of the Art Good Enough?
63
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
TFs and TFBSs
• Recognize TFBS– Short & degenerate– Incomplete erroneous data
• Characterize type of regulation, e.g., suppressor vs enhancer
• Identify synergistic TF pairs– Genes that are coordinately
bound are coordinately expressed
– Requires data over many time points
– TFs may interact only under certain conditions
• A method to identify synergistic TF pairs in cell cycle– Study if a pair of TFs are
assoc with the same genes more often than random
– For each significant pair, test whether there is a phase in cell cycle where the common associated genes are significantly diff in other cell cycle phases
⇒ Quite primitive. Lots more work needed!
64
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
miRNA: New Frontier in Molecular Biology
• Impt functions of miRNA: – Control of cell fate and fat
metabolism in flies– Neuronal patterning in
nematodes– Modulation of
hematopoietic lineage differentiation in mammals
– control of leaf and flower development in plants
• By regulating gene expr in binding targets:– Repression/inhibition of
translation– Degradation of mRNA
• miRNA identification thru direct cloning has limitations:– miRNAs may be expressed
only in certain tissues or at certain times
– Expr levels vary greatly – Degradation products from
mRNAs and other endogenous non-coding RNAs coexist w/ miRNAsand are sometimes dominant in small RNA molecule samples extracted from cells
65
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Recommended Readings
• Wong, The practical Bioinformatician, 2004, ICP. Chapters 4, 5, 6, & 7
• Liu & Wong, Data mining tools for biological sequences. JBCB, 1:139-168, 2003
• Tsai et al., Statistical methods for identifying yeast cell cycle transcription factors. PNAS, 102:13532-13537, 2005
• Yang et al., Identification of microRNA precursors via SVM. APBC 2006, pages 267-276
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006
Protein SubcellularLocalization Prediction
40 min
67
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Compartments and Sorting
• Eukaryotic cells requires proteins be targeted to their subcellulardestinations
• Protein sorting is determined by specific amino acid sequences, or “signals”, within the protein
• Secretory pathway targets proteins to plasma membrane, some membrane-bound organelles such as lysosomes, or to export proteins from the cell
68
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Datasets
• Reinhartdt & Hubbard, NAR, 26:2230--2236, 1998– 2427 eukaryotic proteins for 4 locations (cytoplasmic, extracellular,
nuclear,& mitochondrial)– 997 prokaryotic proteins for 3 locations (cytoplasmic, extracellular, &
periplasmic)
• Park & Kanehisa, Bioinformatics, 19:1656--1663, 2003
– 7589 eukaryotic proteins from 709 organisms for 12 locations (chloroplast, cytoplasmic, cytoskeleton, ER, extracellular, golgi, lysosomal, mitochondrial, nuclear, peroxisomal, plasma membrane, vacuolar)
• Chou & Cai, JBC, 277:45765--45769, 2002– 2191 proteins for 12 locations
• Emanuelsson et al., JMB, 300:1005--1016, 2000• Gardy et al., NAR, 31:3613--3617, 2003
69
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Common Eukaryotic Protein Sorting Signals
For a comprehensive list of cellular localization sites, seehttp://mendel.imp.univie.ac.at/CELL_LOC/index.html
70
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Schematic View of SortingSignals
cleavage site
~25aa
71
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Sequence Logos ofSP, mTP, & cTP
SPsignal peptide
mTPmitochondrial
transfer peptide
cTPchloroplast
transit peptide
72
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Expert System Approach: PSORT Horton & Nakai, ISMB, 1997
A simplified version of the decision tree thatPSORT uses tocheck and reasonover various sorting signals
73
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Amino acid composition of
proteins residing in
different sites are different
74
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Amino Acid Composition Differences
• each cellular location has own characteristic physio-chemical environment
• proteins in each location have adapted thru evolution to that environment
• thus reflected in the protein structure and amino acid composition
• If the above is true, the amino acid composition differences wrt cellular location sites should be more pronounced on protein surfaces than protein interior
• Exercise: Why?
75
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Adaptation of Protein SurfacesAndrade et al., JMB, 1998
• To test the theory of adaptation of protein surfaces to subcellularlocalization, we do a plot of 3 types of composition vectors along their first two principal components
Proportion ofjth amino acid type in ith protein
76
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Adaptation of Protein Surfaces Andrade et al., JMB, 1998
• Clearly total & surface composition vectors show better separation than interior composition vectors
Total amino acidcomposition vector
Interior amino acidcomposition vector
Surface amino acidcomposition vector
nuclearcytoextracell
77
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Amino Acid Composition
• This means can use amino acid composition vectors, especially those from protein surfaces, to predict subcellular localization!
• Let’s see how this turn out….
78
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Neural Networks: NNPSLReinhardt & Hubbard, NAR, 26:2230--2236, 1998
Input1
Input20
cytoplasmic
extracellular
mitochodrial
nuclear
fraction of each aminoacid in the input protein
79
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
NNPSL:Performance
• Outputs of NNPSL have values 0 to 1. The difference (Δ) between the highest and the next highest nodes can be used as a reliability index
0 < Δ < 0.2
0.2 < Δ < 0.4
0.4 < Δ < 0.6
0.6 < Δ < 0.8
0.8 < Δ < 1
Dataset: Reinhardt & Hubbard,NAR, 1998
80
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Support Vector Machines: SubLocHua & Sun, Bioinformatics, 17:721--728, 2001
extracellularvs rest
nuclearvs rest
cytoplasmicvs rest
mitochondrialvs rest
ArgmaxX X-vs-rest
SVM
SVM
SVM
SVMThe SVMs use • polynomial kernel with d = 9 (prokaryotic),
K(Xi,Xj) = (Xi ·Xj + 1)d
• RBF kernel with γ=16 (eukaryotic),K(Xi, Xj) = exp(- γ |Xi - Xj|2)
20-dimensional vector giving amino
acid composition of the input protein
81
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
SubLoc:
PerformanceNNPSL SubLoc
(Eukaryotic)
Dataset: Reinhardt & Hubbard, NAR, 1998
82
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
SubLoc: Robustness of Amino Acid Composition Approach
• Amazingly, accuracy of SubLoc is virtually unaffected when the first 10, 20, 30, & 40 amino acids in a protein are deleted
• Amino acid composition is a robust indicator of subcellularlocalization, and is insensitive to errors in N-terminal sequences
83
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Amino Acid Composition:Taking it Further
• How about pairs of consecutive amino acids? (a.k.a 2-grams) How about 3-grams, …, k-grams?
• How about pseudo amino acid composition?• How about presence of entire functional
domains? (I.e. think of the presence/absence of a functional domain as a summary of amino acid sequence info...)
84
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Functional Domain CompositionCai & Chou, BBRC, 305:407--411, 2003
Training seqs of various localizationsites
BLAST againstdb of known functional domains(Interpro)
NN-5875D:Train k-NN (k=1) using these vectors
or, if nohit found
Pseudo aminoacid composition
Aminoacidcomposition
NN-40D:Train k-NN (k=1) using these vectors
If a protein got a hit in Interpro,use NN-5875D; else use NN-40D
85
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Functional Domain Composition:
Performance
Dataset: Reinhardt & Hubbard, NAR, 1998
86
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Recommended Readings• Horton & Nakai, “Better prediction of protein cellular localization sites
with the k-nearest neighbours classifier”, ISMB, 5:147--152, 1997
• Gardy et al., “PSORT-B: Improving protein subcellular localization for Gram-negative bacteria”, NAR, 31:3613--3617, 2003
• Emanuelsson, “Predicting protein subcellular localization from amino acid sequence information”, BIB, 3:361--376, 2002
• Andrade et al., “Adaptation of protein surfaces to subcellular location”, JMB, 276:517--525, 1998
• Yuan, “Prediction of protein subcellular locations using Markov chain models”, FEBS Letters, 451:23--26, 1999
• Hua & Sun, “Support vector machine approach for protein subcellularlocalization prediction”, Bioinformatics, 17:721--728, 2001
• Park & Kanehisa, “Prediction of protein subcellular locations by support vector machines using compositions of amino acids and amino acid pairs”, Bioinformatics, 19:1656--1663, 2003
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006
Disease Diagnosis, Treatment, & Understanding
80 min
88
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
• The subtypes look similar
• Conventional diagnosis– Immunophenotyping– Cytogenetics– Molecular diagnostics
Childhood Acute Lymphoblastic Leukemia
• Major subtypes: T-ALL, E2A-PBX, TEL-AML, BCR-ABL, MLL genome rearrangements, Hyperdiploid>50
• Diff subtypes respond differently to same Tx
• Over-intensive Tx– Development of
secondary cancers– Reduction of IQ
• Under-intensiveTx– Relapse
89
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Childhood ALL Cure Rates
• Conventional risk assignment procedure requires difficult expensive tests and collective judgement of multiple specialists
⇒ Not available in less advanced ASEAN countries
⇒ Can we have a single-test easy-to-use platform instead?0% 20% 40% 60% 80%
singapore
malaysia
indonesia
philippines
thailand
vietnam
cambodia cure rate
90
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Single-Test Easy-to-Use Platform
91
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
A Sample Affymetrix GeneChipData File (U95A)
92
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Overall Strategy
• For each subtype, select genes to develop classification model for diagnosing that subtype
• For each subtype, select genes to develop prediction model for prognosis of that subtype
Diagnosis of subtype
Subtype-dependentprognosis
Risk-stratifiedtreatmentintensity
93
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Subtype Diagnosis by PCL
• Gene expression data collection
• Gene selection by χ2
• Classifier training by emerging pattern
• Classifier tuning (optional for some machine learning methods)
• Apply classifier for diagnosis of future cases by PCL
94
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Childhood ALL Subtype Diagnosis Workflow
A tree-structureddiagnostic workflow was recommended byour doctor collaborator
95
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Training and Testing Sets
96
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Signal Selection Basic Idea
• Choose a signal w/ low intra-class distance• Choose a signal w/ high inter-class distance
97
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Signal Selection by χ2
98
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Emerging Patterns
• An emerging pattern is a set of conditions– usually involving several features– that most members of a class satisfy – but none or few of the other class satisfy
• A jumping emerging pattern is an emerging pattern that – some members of a class satisfy– but no members of the other class satisfy
• We use only jumping emerging patterns
99
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Examples
Reference number 9: the expression of gene 37720_at > 215Reference number 36: the expression of gene 38028_at <= 12
Patterns Frequency (P) Frequency(N){9, 36} 38 instances 0{9, 23} 38 0{4, 9} 38 0{9, 14} 38 0{6, 9} 38 0{7, 21} 0 36{7, 11} 0 35{7, 43} 0 35{7, 39} 0 34{24, 29} 0 34
Easy interpretation
100
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
PCL: Prediction by Collective Likelihood
101
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
PCL Learning
Top-Ranked EPs inPositive class
Top-Ranked EPs inNegative class
EP1P (90%)
EP2P (86%)
.
.EPn
P (68%)
EP1N (100%)
EP2N (95%)
.
.EPn
N (80%)
The idea of summarizing multiple top-ranked EPs is intendedto avoid some rare tie cases
102
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
PCL Testing
ScoreP = EP1P’ / EP1
P + … + EPkP’ / EPk
P
Most freq EP of pos classin the test sample
Most freq EP of pos class
Similarly, ScoreN = EP1
N’ / EP1N + … + EPk
N’ / EPkN
If ScoreP > ScoreN, then positive class, Otherwise negative class
103
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Accuracy of PCL (vs. other classifiers)
The classifiers are all applied to the 20 genes selected by χ2 at each level of the tree
104
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Understandability of PCL
• E.g., for T-ALL vs. OTHERS, one ideally discriminatory gene 38319_at was found, inducing these 2 EPs
• These give us the diagnostic rule
105
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Multidimensional Scaling Plot for Subtype Diagnosis
Obtained by performing PCA on the 20 genes chosen for each level
106
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
ImpactConventional Tx:• intermediate intensity to everyone⇒ 10% suffers relapse⇒ 50% suffers side effects⇒ costs US$150m/yr
Our optimized Tx:• high intensity to 10%• intermediate intensity to 40%• low intensity to 50%• costs US$100m/yr
•High cure rate of 80%• Less relapse
• Less side effects• Save US$51.6m/yr
107
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Asian Innovation Gold Award, Far Eastern Economic Review, November 2003
108
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Is there a new subtype?
• Hierarchical clustering of gene expression profiles reveals a novel subtype of childhood ALL
109
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Hierarchical Clustering
• Assign each item to its own cluster– If there are N items initially, we get N clusters,
each containing just one item• Find the “most similar” pair of clusters, merge
them into a single cluster, so we now have one less cluster – “Similarity” is often defined using
• Single linkage• Complete linkage• Average linkage
• Repeat previous step until all items are clustered into a single cluster of size N
110
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Single, Complete, & Average Linkage
Single linkage defines distancebetw two clusters as min distancebetw them
Complete linkage defines distancebetw two clusters as max distance betwthem
Exercise: Give definition of “average linkage”
Image source: UCL Microcore Website
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006
Selection of Patient Samples and Genes for
Disease Prognosis
112
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Gene Expression Profile + Clinical Data
⇒ Outcome Prediction
• Univariate & multivariate Cox survival analysis (Beer et al 2002, Rosenwald et al 2002)
• Fuzzy neural network (Ando et al 2002)
• Partial least squares regression (Park et al 2002)
• Weighted voting algorithm (Shipp et al 2002)
• Gene index and “reference gene” (LeBlanc et al 2003)
• ……
113
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Another Approach …
“extreme”sampleselection
ERCOF
114
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Short-term Survivors v.s. Long-term Survivors
T: sampleF(T): follow-up time
E(T): status (1:unfavorable; 0: favorable)c1 and c2: thresholds of survival time
Short-term survivorswho died within a short
period
F(T) < c1 and E(T) = 1
⇓
Long-term survivorswho were alive after a
long follow-up time
F(T) > c2
⇓
Extreme Sample Selection
115
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
ERCOFEntropy-
Based Rank Sum Test & Correlation
Filtering
Remove genes with expression values w/o cut point found (can’t be discretized)
Calculate Wilcoxonrank sum w(x) for gene x. Remove gene x if w(x)∈ [clower, cupper]
Group features by Pearson Correlation For each group, retain the top 50% wrt class entropy
116
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Linear Kernel SVM regression functionbixTKyaTG i
ii +=∑ ))(,()(
T: test sample, x(i): support vector,yi: class label (1: short-term survivors; -1: long-term survivors)
Transformation function (posterior probability)
)(11)( TGe
TS −+= ))1,0()(( ∈TS
S(T): risk score of sample T
Risk Score Construction
117
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Diffuse Large B-Cell Lymphoma
• DLBC lymphoma is the most common type of lymphoma in adults
• Can be cured by anthracycline-based chemotherapy in 35 to 40 percent of patients
⇒ DLBC lymphoma comprises several diseases that differ in responsiveness to chemotherapy
• Intl Prognostic Index (IPI) – age, “Eastern Cooperative
Oncology Group” Performance status, tumor stage, lactate dehydrogenase level, sites of extranodal disease, ...
• Not very good for stratifying DLBC lymphoma patients for therapeutic trials
⇒ Use gene-expression profiles to predict outcome of chemotherapy?
118
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Rosenwald et al., NEJM 2002
• 240 data samples– 160 in preliminary group– 80 in validation group– each sample described by 7399 microarray
features• Rosenwald et al.’s approach
– identify gene: Cox proportional-hazards model– cluster identified genes into four gene signatures– calculate for each sample an outcome-predictor
score– divide patients into quartiles according to score
119
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Knowledge Discovery from Gene Expression of “Extreme” Samples
“extreme”sampleselection:< 1 yr vs > 8 yrs
knowledgediscovery from gene expression
240 samples
80 samples26 long-
term survivors
47 short-term survivors
7399genes
84genes
T is long-term if S(T) < 0.3T is short-term if S(T) > 0.7
120
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
732547+1(*)Informative
1607288OriginalDLBCL
AliveDead
TotalStatusData setApplication
Number of samples in original data and selected informative training set.(*): Number of samples whose corresponding patient was dead at the end of follow-up time, but selected as a long-term survivor.
Discussions: Sample Selection
121
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
84(1.7%)Phase II
132(2.7%)Phase I
4937(*)Original
DLBCLGene selection
Number of genes left after feature filtering for each phase.(*): number of genes after removing those genes who were absent in more than 10% of the experiments.
Discussions: Gene Identification
122
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
p-value of log-rank test: < 0.0001Risk score thresholds: 0.7, 0.3
Kaplan-Meier Plot for 80 Test Cases
123
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
(A) IPI low, p-value = 0.0063
(B) IPI intermediate,p-value = 0.0003
Improvement Over IPI
124
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
(A) W/o sample selection (p =0.38) (B) With sample selection (p=0.009)
No clear difference on the overall survival of the 80 samples in the validation group of DLBCL study, if no training sample selection conducted
Merit of “Extreme” Samples
125
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Is ERCOF Useful? Observations from 1000+ Expts
• Feature selection methods considered– All use all features
– All-entropy select features whose value range can be partitioned by Fayyad & Irani’sentropy method
– Mean-entropy select features whose entropy is better than the mean entropy
– Top-number-entropy select the top 20, 50, 100, 200 genes by their entropy
– ERCOF at 5% significant level for Wilcoxon rank sum test and 0.99 Pearson correlation coeff threshold
• Data sets considered– Colon tumor– Prostate cancer– Lung cancer– Ovarian cancer– DLBC lymphoma– ALL-AML– Childhood ALL
• Learning methods considered– C4.5– Bagging, Boosting, CS4– SVM, 3-NN
126
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
ERCOF vs All-Entropy
All-entropywins 4 times
ERCOF wins 60 times
127
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
ERCOF vs Mean-Entropy
Mean-entropywins 18 times
ERCOF wins 42 times
128
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Effectiveness of ERCOF
22Total wins 38 46 47 48 51 47 67
129
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Conclusions
• Selecting extreme cases as training samples is an effective way to improve patient outcome prediction based on gene expression profiles and clinical information
• ERCOF is very suitable for SVM, 3-NN, CS4, Random Forest, as it gives these learning algoshighest no. of wins
• ERCOF is suitable for Bagging also, as it gives this classifier the lowest no. of errors
⇒ ERCOF is a systematic feature selection method that is very useful
130
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Beyond Classification of Gene Expression Profiles
• After identifying the candidate genes by feature selection, do we know which ones are causal genes and which ones are surrogates?
Diagnostic ALL BM samples (n=327)
3σ-3σ -2σ -1σ 0 1σ 2σσ = std deviation from mean
Gen
es fo
r cla
ss
dist
inct
ion
(n=2
71)
TEL-AML1BCR-ABL
Hyperdiploid >50E2A-PBX1
MLL T-ALL Novel
131
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Gene Regulatory Circuits
• Genes are “connected”in “circuit” or network
• Expr of a gene in a network depends on expr of some other genes in the network
• Can we “reconstruct”the gene network from gene expression and other data? Source: Miltenyi Biotec
132
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Recommended Readings
• Wong, The Practical Bioinformatician, 2004, ICP. Chapter 14• Li & Wong, Identifying good diagnostic genes or gene groups
from gene expression data by using the concept of emerging patterns. Bioinformatics, 18:725-734, 2002
• Miller et al., Optimal gene expression analysis by microarrays. Cancer Cell, 2:353-361, 2002
• Liu et al,. Use of Extreme Patient Samples for Outcome Prediction from Gene Expression Data. Bioinformatics, 21:3377-3384, 2005
• Eisen et al., Cluster analysis and display of genome-wide expression patterns. PNAS, 8:14863-14868, 1998
• Tibshirani et al., Diagnosis of multiple cancer types by shrunken centroids of gene expression. PNAS, 99:6567-6572, 2002
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006
Biomedical Text Mining
50 min
134
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Text Mining of Biomedical Literature
• Knowledge discovery system for processing free texts in scientific abstracts
• Specialized in– Extracting
protein names– Extracting
protein-protein interactions
– Etc …
135
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Main Steps of Text Mining
136
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Bio Entity Name Recognition, Zhou et al., BioCreAtIvE, 2004
Adapted w/ permission from Jian Su
137
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Bio Entity Name Recognition:
Ensemble Classification Approach• Features considered
– orthographic, POS, morphologic, surface word, trigger words (TW1: receptor, enhancer, etc. TW2: activation, stimulation, etc.)
• SVM– Context of 7 words– Each word gives 5 features,
plus its position• HMMs
– 3 features used (orthographic, POS, surface word)
– HMM1 & HMM2 use POS taggers trained on diff corpora
HMM1balanced precision
& recall
HMM2low precision& high recall
SVMhigh precision& low recall
MajorityVoting
138
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
• h1, h2, h3 are indep classifiers w/ accuracy = 60%• C1, C2 are the only classes• t is a test instance in C1
• h(t) = argmaxC∈{C1,C2} |{hj ∈{h1, h2, h3} | hj(t) = C}|• Then prob(h(t) = C1)
= prob(h1(t)=C1 & h2(t)=C1 & h3(t)=C1) +prob(h1(t)=C1 & h2(t)=C1 & h3(t)=C2) +prob(h1(t)=C1 & h2(t)=C2 & h3(t)=C1) +prob(h1(t)=C2 & h2(t)=C1 & h3(t)=C1)
= 60% * 60% * 60% + 60% * 60% * 40% +60% * 40% * 60% + 40% * 60% * 60% = 64.8%
Why Ensemble?
139
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Bio Entity Name Recognition:
Performance at BioCreAtIvE 2004
Adapted w/ permission from Zhou et al., BioCreAtIve 2004
140
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Co-Reference Resolution, Yang et al., IJCNLP, 2004
Adapted w/ permission from Yang et al., IJCNLP 2004
141
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Co-Reference Resolution:
Baseline Features Used
Adapted w/ permission from Yang et al., IJCNLP 2004
142
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Co-Reference Resolution:
New Features Used & Performance
Adapted w/ permission from Yang et al., IJCNLP 2004
Base Classifier:
C5.0
143
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
• The max entropy model:
• where– o is the outcome– h is the feature vector– Z(h) is normalization
function– fj are feature functions– αj are feature weights
Protein Interaction Extraction, Xiao et al, IJCNLP 2004
Adapted w/ permission from Xiao et al., IJCNLP 2004
144
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Protein Interaction Extraction:
Features Used
Adapted w/ permission from Xiao et al.
145
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Protein Interaction Extraction:
Performance on IEPA Corpus
Adapted w/ permission from Xiao et al.
IEPA = Interaction Extraction Performance Assessment
146
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Issues in Constructing Gene/Protein Networks
• Sound:– Is the contents of our databases correct?
• Complete:– Is the structure of our databases expressive
enough to capture critical information explicitly? • Understandable:
– Is our databases or search results understandable?
147
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon WongAdapted w/ permission from Judice Koh, Mong Li Lee, & Vladimir Brusic
Soundness:Is the content of our databases correct?
• 11 types & 28 subtypes of data artifacts– Critical artifacts (vector
contaminated sequences, duplicates, sequence structure violations)
– Non-critical artifacts (misspellings, synonyms)
• > 20,000 seq records in public contain artifacts
• Identification of these artifacts are impt for accurate knowledge discovery
• Sources of artifacts– Diverse sources of data
• Repeated submissions of seqs to db’s• Cross-updating of db’s
– Data Annotation• Db’s have diff ways for data
annotation• Data entry errors can be introduced• Different interpretations
– Lack of standardized nomenclature
• Variations in naming• Synonyms, homonyms, & abbrevn
– Inadequacy of data quality control mechanisms
• Systematic approaches to data cleaning are lacking
148
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Classification of Errors,
Koh et al, DBiDB, 2005
Adapted w/permision from Judice Koh, Mong Li Lee, & Vladimir Brusic
149
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Context of the misspellingsCorrectionsMisspellings
EMBL:Y18050 E.faecium pbp5 geneTITLE Modification of penicillin-binding protein 5 asociated with highlevel ampicillin resistance in Enterococcus faeciumgi|1143442|emb|X92687.1|EFPBP5G
associatedasociated
Swiss-Prot:P03385Env polyprotein precursor DEFINITION Env polyprotein precursor [Contains: Surface protein (SU) (GP70);Tranmembrane protein (TM) (p15E); R protein].gi|119478|sp|P03385|ENV_MLVMO
transmembranetranmembrane
Patent Database:A76783 Sequence 11 from Patent WO9315210CDS <1..150/note="gene cassete encoding intercalating jun-zipper andlinker"gi|6088638|emb|A76783.1||pat|WO|9315210|11[6088638]
CassetteCassete
GenBank:AAD26534 nectin-1 [Rattus norvegicus]TITLE Nectin/PRR: An Immunogloblin-like Cell Adhesion Molecule Recruitedto Cadherin-based Adherens Junctions through Interaction withAfadin, a PDZ Domain-containing Proteingi|4590334|gb|AAD26534.1
ImmunoglobulinImmunoglobinRECORD
SINGLE SOURCE DATABASE
Invalid values
Ambiguity
Incompatible schema
ATTRIBUTE
Spelling errorsFormat violation
Annotation error
Dubious sequences
Sequence redundancy
Data Provenanceflaws
Cross-annotation error
Sequence structure violation
• Usually typo errors
• Occurs in different fields of the record
• We identified 569 possible misspelled words affecting up to 20,505 nucleotide records in Entrez.
Vector contaminated sequence
Erroneous data transformation
MULTIPLESOURCE DATABASE
Spelling Errors
Copyright © 2006 by Limsoon Wong. Adapted w/permision from Judice Koh, Mong Li Lee, & Vladimir Brusic
150
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
RECORD
SINGLE SOURCE DATABASE
Invalid values
Ambiguity
Incompatible schema
ATTRIBUTE
Uninformative sequences
Undersized sequences
Annotation error
Dubious sequences
Sequence redundancy
Data provenance flaws
Cross-annotation error
Sequence structure violation
Vector contaminated sequence
Erroneous data transformation
MULTIPLESOURCE DATABASE
Among the 5,146,255 protein records queried using Entrez to the major protein or translated nucleotide databases , 3,327 protein sequences are shorter than four residues (as of Sep, 2004).
• In Nov 2004, the total number of undersized protein sequences increases to 3,350.
• Among 43,026,887 nucleotide records queried using Entrez to major nucleotide databases, 1,448 records contain sequences shorter than six bases (as of Sep, 2004).
• In Nov 2004, the total number of undersized nucleotide sequences increases to 1,711.
Undersized protein sequences in major databases
218 17142
528
116 151
1015
364 383
12351
1253 2 120 0 23
0
200
400
600
800
1000
1200
1 2 3
Sequence Length
Num
ber o
f rec
ords DDBJ
EMBL
GenBank
PDB
SwissProt
PIR
Undersized nucleotide sequences in major databases
2 3 924
5573 69
11581
233228
108 108
5167
640 45
77104
0
50
100
150
200
250
1 2 3 4 5
Sequence LengthNu
mbe
r of r
ecor
ds
DDBJEMBLGenBankPDB
Copyright © 2006 by Limsoon Wong. Adapted w/permision from Judice Koh, Mong Li Lee, & Vladimir Brusic
Meaningless Seqs
151
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
RECORD
SINGLE SOURCE DATABASE
Invalid values
Ambiguity
Incompatible schema
ATTRIBUTE
Overlapping intron/exon
Annotation error
Dubious sequences
Sequence redundancy
Data Provenanceflaws
Cross-annotation error
Sequence structure violation
Vector contaminated sequence
Erroneous data transformation
MULTIPLESOURCE DATABASE
Syn7 gene of putative polyketide synthase in NCBI TPA record BN000507 has overlapping intron 5 and exon 6.
rpb7+ RNA polymerase II subunit in GENBANK record AF055916 has overlapping exon 1 and exon 2.
Overlapping Intron/Exons
Copyright © 2006 by Limsoon Wong. Adapted w/permision from Judice Koh, Mong Li Lee, & Vladimir Brusic
152
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
RECORD
SINGLE SOURCE DATABASE
Invalid values
Ambiguity
Incompatible schema
ATTRIBUTE
Annotation error
Dubious sequences
Sequence redundancy
Data provenance flaws
Cross-annotation error
Sequence structure violation
Vector contaminated sequence
Erroneous data transformation
MULTIPLESOURCE DATABASE
Replication of sequence informationDifferent views
Overlapping annotations of the same sequence
• Submission of the same sequence to different databases
• Repeated submission of the same sequence to the same database
• Initially submitted by different groups
• Protein sequences may be translated from duplicate nucleotide sequences
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=protein&list_uids=11692005&dopt=GenPept
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=protein&list_uids=11692005&dopt=GenPept
Seqs w/ Identical Info
Copyright © 2006 by Limsoon Wong. Adapted w/permision from Judice Koh, Mong Li Lee, & Vladimir Brusic
153
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
SINGLE-SOURCE DATABASE
ATTRIBUTE
Schema remapping
Sequence Structure Parser
RECORD
Concatenated values
Spelling errors
Format violation
Synonyms
Homonyms/Abbreviations
Misuse of fields
Features do not correspond with sequence
Dictionary lookup
Integrity constraints
Undersized sequences
Uninformative sequences
Replication of sequence information
Different views
Overlapping annotations of the same sequence
Fragments
Duplicate detection
Mis-fielded values
Comparative analysis
Sequence structure violation
MULTI-SOURCEDATABASE
Vector contaminated sequencesVector screening
Putative features
Cross-annotation error
Trying our hands on
data cleansing problems
154
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Association Rule Mining for De-
duplication
Compute similarity scores from known duplicate pairs
Select matching criteria
Generate association rules
Detect duplicates using the rules
155
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Scorpion venom datasetcontaining 520 records
695 duplicate pairs are collectively identified.
Snake PLA2 venom dataset containing 780 records
Entrez (GenBank, GenPept, SwissProt, DDBJ, PIR, PDB)
251 duplicate pairs 444 duplicate pairs
scorpion AND (venom OR toxin) serpentes AND venom AND PLA2
Expert annotation
Dataset
156
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Features to Match
Adapted w/permision from Judice Koh, Mong Li Lee, & Vladimir Brusic
157
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
AAG39642 AAG39643 AC0.9 LE1.0 DE1.0 DB1 SP1 RF1.0 PD0 FT1.0 SQ1.0
AAG39642 Q9GNG8 AC0.1 LE1.0 DE0.4 DB0 SP1 RF1.0 PD0 FT0.1 SQ1.0
P00599 PSNJ1W AC0.2 LE1.0 DE0.4 DB0 SP1 RF1.0 PD0 FT1.0 SQ1.0
P01486 NTSREB AC0.0 LE1.0 DE0.3 DB0 SP1 RF1.0 PD0 FT1.0 SQ1.0
O57385 CAA11159 AC0.1 LE1.0 DE0.5 DB0 SP1 RF0.0 PD0 FT0.1 SQ1.0
S32792 P24663 AC0.0 LE1.0 DE0.4 DB0 SP1 RF0.5 PD0 FT1.0 SQ1.0
P45629 S53330 AC0.0 LE1.0 DE0.2 DB0 SP1 RF1.0 PD0 FT1.0 SQ1.0
LE1.0 PD0 SQ1.0 (99.7%)SP1 PD0 SQ1.0 (97.1%)SP1 LE1.0 PD0 SQ1.0 (96.8%)DB0 PD0 SQ1.0 (93.1%)DB0 LE1.0 PD0 SQ1.0 (92.8%)DB0 SP1 PD0 SQ1.0 (90.4%)DB0 SP1 LE1.0 PD0 SQ1.0 (90.1%)RF1.0 SP1 LE1.0 PD0 SQ1.0 (47.6%)RF1.0 DB0 LE1.0 PD0 SQ1.0 (44.0%)
Similarity scores of known
duplicate pairs
Association rule mining
Frequent item-set with support
Association Rule Mining
158
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Duplicates detected by association rules
6
36.3
0.3
49.4
5.2
32.7
0.11.8 2.4 3.8 5.7 7.5 7.9 9.4
0
10
20
30
40
50
60
Rule 1Rule 2
Rule 3Rule 4
Rule 5Rule 6
Rule 7
Association rulesFP
% a
nd F
N%
FP% FN% x 1000
S(Seq)=1 ^ N(Seq Length)=1 ^ M(Species)=1 ^ M(PDB)=0 ^ M(DB)=0 (90.1%)Rule 7
S(Seq)=1 ^ M(Species)=1 ^ M(PDB)=0 ^ M(DB)=0 (90.4%)Rule 6
S(Seq)=1 ^ M(Seq Length)=1 ^ M(PDB)=0 ^ M(DB)=0 (92.8%)Rule 5
S(Seq)=1^ M(PDB)=0 ^ M(DB)=0 (93.1%)Rule 4
S(Seq)=1 ^ N(Seq Length)=1 ^ M(Species)=1 ^ M(PDB)=0 (96.8%)Rule 3
S(Seq)=1 ^ M(PDB)=0 ^ M(Species)=1 (97.1%)Rule 2
S(Seq)=1 ^ N(Seq Length)=1 ^ M(PDB)=0 (99.7%)Rule 1
Results
Adapted w/permision from Judice Koh, Mong Li Lee, & Vladimir Brusic
Rule 1. Identical sequences with the same sequence length and not originated from PDB are 99.7% likely to be duplicates.
Rule 2. Identical sequences with the same sequence length and of the same species are 97.1% likely to be duplicates.
Rule 3. Identical sequences with the same sequence length, of the same species and not originated from PDB are 96.8% likely to be duplicates.
159
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Completeness:Is the structure of our db expressive
enough to capture critical info explicitly?
• Take a key paper such as the Kohn paper that summarises current knowledge on p53 regulation
• Is there a structured database that is able to capture all info in that paper explicitly?
• Is there a semi-structured database that is able to capture all info in that paper explicitly?
• How well does this (semi-) structured database generalize to other similar type of papers?
160
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Understandability:Is our db or search results understandable?• Take a search on p53. You will get >300k hits or
some number like that on MEDLINE• It is not feasible for anyone to go thru all of that
to find what he wants! And this problem is growing bigger as MEDLINE doubles every 1-2 year.
• Need to organize the database and/or the search results into hierarchy or “semantic” net to make it easier for users to understand or to browse the results
• How do we define this hierarchy/net? • Can this hierarchy/net be self-organized?
161
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Important Unsolved Challenges
• Bio entity name recognition• Bio interaction extraction• Extraction of other relevant info• Information integration• And so on …
162
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Bio Name Recognition
• Nomenclature loosely followed• Frequent use of conjunction and disjunction in
bio names with multiple bio-entity names sharing one head noun
• Long descriptive names• Names of genes and proteins used
interchangeably
163
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
• Inherent complexity of biological interactions
⇒ Sentences describing them also tend to be complicated
Bio-Interaction Extraction
164
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Bio-Interaction Extraction
• Domain knowledge is often needed for interaction template filling
165
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Extraction of Other Relevant Info
• Contextual information– Species, cell type, cellular localisation, etc
• Negative information
• Speculative & incomplete facts
166
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Information Integration
• Bio-name mapping
• Bio-interaction mapping– how do you know two complex sentences are
talking about the same interaction?
167
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Recommended Readings
• Hirschman et al., Accomplishments and challenges in literature data mining for biology. Bioinformatics, 18:1553-1561, 2002
• Ng & Tan, Challenges in biological literature mining for online discovery of molecular interaction pathways, IJCAT, 2006. (To appear)
• Zhou et al., Recognizing names in biomedical texts: a machine learning approach, Bioinformatics, 20:1178-1190, 2004
• Blaschke et al., Do you text? Bioinformatics, 21:4199-4200, 2005
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006
Discovering Motif Pairs at Interaction Sites
from Protein Sequences on a
Proteome-Wide Scale
60 min
169
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Proteins & Their Interactions
• 4 types of reps for proteins: primary, secondary, tertiary, & quaternay
• Protein interactions play impt role in inter cellular communication, in signal transduction, & in the regulation of gene expression
Courtesy of JE Wampler
170
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Binding Sites
• Discovery of binding sites is a key part of understanding mechanisms of protein interactions
• Structure-based approaches– E.g., docking– Relatively accurate– Struct must be known
⇒ Sequence-based approaches
171
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Typical Sequence-Based Approach
• Typical seq-based approaches have two steps:– Use pattern discovery algorithms to discover
domains and/or motifs of a group of proteins– Use domain-domain interaction discovery
methods (e.g., domain fusion) to discovery interacting domains
• Shortcomings:– Protein interaction information is not used by motif
discovery algorithms– Exact positions of binding sites often not
recognized
172
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
How about ...
• How about making use of known protein-protein bindings to guide the discovery of binding motifs?
173
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Yeast SH3 domain-domainInteraction network: 394 edges, 206 nodes
Tong et al. Science, v295. 2002
8 proteins containing SH35 binding at least 6 of them
Protein Interaction Graphs
174
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Bipartite Subgraphs
SH3 Proteins SH3-BindingProteins
The larger this group,the more likely theiractive sites will showup clearly in a multiplealignment?
175
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Problem StatementGiven a PPI expt E, the problem is
(1) To find all pairs X, Y of interacting protein groups, so that
(1.1) X and have full mutual interactions(1.2) X and Y are as large as possible
&
(2) To identify “good” binding motif pairs from these pairs of interacting protein groups
176
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
PPI Expt As a Graph
• PPI expt E as undirected graph GE = ⟨VE, DE⟩, – where VE are the proteins and DE the
edges,– so that two proteins are connected in GE iff
there is a binding betw them in PPI expt E
• Let LE(p) denote neighborhood of protein p in GE
• Let LE(P) = ⎧⎫p∈P LE(p) denote the common neighborhood of all proteins in P in GE
177
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Maximality
• Proposition 2.1Let E be a PPI expt. Let X,Y be a pair of protein groups so that X =
LE(Y) and Y = LE(X). Let X’,Y’ be another pair of protein groups so that
X’ = LE(Y’), Y’ = LE(X’), X’⊆ X, & Y’ ⊆ Y. Then X = X’ and Y = Y’.
⇒ In other words, if X = LE(Y) and Y = LE(X), then X,Y is a maximal pair of protein groups that have full interactions
178
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Recasting to Graph Theory
• X, Y is a pair of interacting protein groups in PPI exptE iff X = LE(Y) and Y = LE(X) 1.1
1.2
179
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Max Complete Bipartite Subgraph
• A graph H = ⟨V1∪V2, DH⟩ is a maximal complete bipartite subgraph of G iff– H is a subgraph of G, – V1 × V2 = DH, – V1 ∩ V2 = {}, &– There is no H’ = ⟨V’1∪V’2, DH’⟩ with V1 ⊂ V’1
& V2 ⊂ V’2 that has the same properties above
180
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
The Connection to Graph Theory
• X, Y is a pair of interacting protein groups in PPI exptE iff H = ⟨X ∪Y, X ×Y ⟩ is max complete bipartite subgraphof GE
• Let H = ⟨X ∪Y, DE| X ∪Y⟩ be subgraph of GE with X,Y a pair of interacting protein groups
⇒ X = LE(Y) and Y = LE(X) ⇒ Full interactions betw X & Y⇒ X × Y = DE| X ∪Y
• By excluding self-binding, we have X ∩ Y = {}
• By Prop 2.1, we have H is max
181
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Therefore … But ...
• Therefore, to find pairs of interacting protein groups, we can use algorithms from graph theory for enumerating maximal complete bipartite subgraphs
• According to Eppstein 1994, this has complexity O(a322an), where a is the aboricity of the graph and n the number of vertices
• This is inefficient because a is often around 10-20 in practice
182
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
From PPI Expts To Transactions
• In PPI expt E, we obtain for each protein p, a list LE(p) of proteins that bind p– assume p∉LE(p), as such expts are not intended to detect self-binding
– assume q∈LE(p) implies p∈ LE(q), as binding is symmetric
• LE(p) can be thought of as a transaction & tE(p) as the “id” of this transaction
⇒ E can be thought of as generating a db of transactions DE = {tE(p1), …, tE(pk)}, where p1, …, pkare all the proteins involved in E
⇒ a set of proteins X can be thought of as a patternin DE if there is tE(p)∈ DE st X ⊆ LE(p)
183
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Example
• Consider expt E with 5 proteins p1, …, p5, st p2and p3 bind every protein except themselves
• Then DE looks like this (as a matrix):
p1
p2
p3
p4
p5
184
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Notations
• Let sE(d) denote the protein p st tE(p) = d⇒ sE(tE(p)) = p• Let [|p|]E denote the set {tE(q) | p∈LE(q)} of
transactions in DE in which p occurs⇒ tE(p)∈ [|q|]E implies tE(q)∈[|p|]E
• Let [|X|]E denote the set ⎧⎫p∈X [|p|]E of transactions in which the pattern X occurs
⇒ tE(Y)⊆[|X|]E implies tE(X)⊆[|Y|]E
• Let tE(X) denote the set {tE(p) | p∈ X} of transaction id’s, where X is a pattern in DE
• Let sE(T) denote the pattern {sE(d) | d∈T}⇒sE[|X|]E = ⎧⎫p∈X LE(p) = LE(X)
185
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Closed Patterns
• Let [X]E = {Y | [|Y|]E = [|X|]E} denote the equivalence class of the pattern X in DE
• A pattern X is said to be a closed pattern of DE iff X = closedE(X), where {closedE(X)} = max [X]E
186
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Key Proposition
• Proposition 3.2Let X be a closed pattern in DE.Then X = sE [|sE [|X|]E |]E
X
[|X|]
sE[|X|]E
[|sE[|X|]E|]E
187
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Proof
188
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Consequently...
• Corollary 3.4Let X and Y be closed pattern in DE.Then X = Y iff sE [|X|]E = sE [|Y|]E
• Proposition 3.5For any pattern X, we have X ∩ sE [|X|]E = {}
189
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Implication
• Corollary 3.6Let E be a PPI expt.Let C be the set of closed patterns of DE.Then |C| is even
190
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
More Important Implication
• Theorem 3.7The bijective function sEo[|·|]E partitions the set of closed patterns of DE into bipartite graphs
p1
p2
p3
p4
p5
191
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Even More Interesting...
• For each pair X and Y, – X is the largest group of
proteins that bind all the proteins in Y; and
– Y is the largest group of proteins that bind all the proteins in X
⇒ X,Y is a pair of interacting protein groups
192
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
A Couple More Propositions
• Proposition 3.3For any pattern X, sE[|X|]E is closed pattern in DE
• Corollary 3.7X is a closed pattern in DE iff X = sE[|sE[|X|]E|]E
“the common neighbours of the common neighbours of X
are X themselves.”
“each side of a protein interaction group is a
closed pattern”
“X is one side of a protein interaction
group”
Recall that sE[|X|]E = LE(X)
193
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
At Last!
• These are ALL the interacting protein groups
⇒ To mine these protein groups, it suffices to mine closed patterns in DE
194
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
An Extension
• Not all interacting protein groups X, Y are equally interesting– X and Y are both singleton, vs– X is a large group, Y is small group, vs– X is a large group, Y is a large group
⇒ Set “interestingness” threshold on X, Y st a pair of interacting protein groups X, Y is interesting only if |X| ≥ m and |Y| ≥ n
195
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
An Optimization
• Let X, Y be a pair of interacting protein groups– By Theorem 3.7, X = sE [|Y|]E and Y = sE [|X|]E
– By Definition of [|•|]E, |X| = times Y occurs in DE
– By Definition of [|•|]E, |Y| = times X occurs in DE
⇒ To mine interesting pairs X, Y of interacting protein groups in an expt E such that |X| ≥ m and |Y| ≥ n, it suffices to mine closed patterns X that appears ≥ n times in DE and |X| ≥ m
196
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Closed Pattern Mining Algorithms
• CLOSET, Pei et al. 2000• CARPENTER, Pan et al. 2003• FPclose*, Grahne & Zhu 2003• GC-growth, Li et al. 2005• ...
⇒We have efficient algorithms for mining interesting interacting protein groups
197
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Example Breitkreutz et al, Genome Biology, 4, R23, 2003X and sE[|X|]E both occur with freqat least that of support threshold
198
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
It now remains to generate the motif pairs …
199
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Many Motif Discovery Methods
• MEME, Bailey & Elkan 1995
• CONSENSUS, Hertz & Stormo 1995
• PROTOMAT, Henikoff & Henikoff 1991
• CLUSTAL, Higgins & Sharp 1988
• …
• For illustration, we use PROTOMAT here
200
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
PROTOMAT• Core of Block Maker, a WWW server that return
blocks (ungapped multiple alignments) for any submitted set of protein sequences
• Comprises 2 steps:– MOTIF, Smith et al. 1990
• Look for spaced triplets in given set of proteins– MOTOMAT, Henikoff & Henikoff 1991
• Merge overlapping blocks produced by MOTIF• Extend blocks in both directions until similarity falls• Determine best set of blocks that are in the same order
and do not overlap
we treat every block, instead of whole set of blocks generated by PROTOMAT, as a binding motif
201
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Example, Breitkreutz et al, Genome Biology, 4, R23, 2003
• Comprises 19038 genetic and physical interactions in yeast among 4907 proteins
• Look for interesting pairs with m = n = 5• About 1s to generate 60k closed patterns⇒ Too many for PROTOMAT. So consider only
maximal closed patterns, giving 7847 pairs• PROTOMAT produces 17256 left blocks and
19350 right blocks after 6 hours • Most groups yield 1 to 3 blocks• Ave length of blocks = 11.696, std dev = 5.45
202
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Databases Used for Validation
• BLOCKS, Pietrokovski et al. 1996
• PRINTS, Attwood & Beck 1994
• Pfam, Sonnhammer et al. 1997
• InterDom, Ng et al. 2003
203
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Validation for Single Motifs
• Compare all single motifs in our discovered motif pairs with all domains of specific domain databases – LAMA, Pietrokovski 1996– transform blocks into position-specific scoring matrices (PSSM)– run Smith-Waterman to align pairs of PSSM using Pearson
correlation coefficient to measure similarity betw 2 columns– a block is mapped to another block if 95% of positions in a block
occuring in the optimal alignment is common to another block and Z-score is > 5.6, where Z-score is the number std dev away from the mean generated by millions of shuffles of the BLOCKS database
• Determine number of motifs that can be mapped to these domains and the overall correlation in the portions that are mapped
204
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Results for Single Motifs
• Our blocks map to 32% of blocks in BLOCKS and PRINTS, yet motifs from our blocks cover 72% of domains in BLOCKS and PRINTS
⇒ Maybe most domains in BLOCKS and PRINTS have less than half a block as binding motifs, or may not be related to binding behaviour
205
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Validation for Motif Pairs
• Map our motif pairs into domain-domain interacting pairs
• Determine the number of overlaps between our motif pairs and those in the domain-domain interaction database
• Use InterDom as the domain-domain interaction database 30037
interactionsamong3535 domains
206
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Linking Our Motif Pairs to InterDom
• InterDom represents domains by Pfam entries
⇒ To x-link, we have to– Map our motifs to blocks in BLOCKS and PRINTS– Link from BLOCKS and PRINTS to InterPro– Link from InterPro to Pfam– Match Pfam to InterDom
207
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Results for Motif Pairs
Domain-domain interactionsinferred from protein complexesor from interactions betweensingle domain proteins
Both sidesmapped to BLOCKS
Both sidesmapped to PRINTS
One side mapped to PRINTS,one side mapped to BLOCKS
208
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Example Confirmed Binding Motif
• 1 of the 241 binding motifs we found that can be confirmed using protein complexes is #1781...
As shown in the next slide, this pair corresponds to interactionsites between LSM domains. E.g., all 7 pairs of adjacent
LSM domains of pdb1mgq exhibits it.
209
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Example: LSM Domainsof pdb1mgq
210
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Sequence Identity Within a Group
• Ave seq identity within a group is 7.5%
⇒Group is unlikely to be detected by standard methods based on seqhomology
211
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Conclusions
• Connection between maximal complete bipartite subgraphs and closed patterns
⇒ Closed pattern mining algorithms can be used to enumerate maximal complete bipartite subgraphsefficiently
• Connection between pairs of interacting protein groups and closed patterns
⇒ Discovery of binding motifs is accelerated because we need not execute expensive motif discovery algorithms on insignificant groups
212
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
References
• Haiquan Li, Jinyan Li, Limsoon Wong. Discovering Motif Pairs at Interaction Sites from Protein Sequences on a Proteom-Wide Scale. Bioinformatics, 22(8):989--996, 2006
• Jinyan Li, Haiquan Li, Donny Soh, Limsoon Wong. A Correspondence Between Maximal Complete Bipartite Subgraphs and Closed Patterns. Proceedings of 9th European Conference on Principles and Practice of Knowledge Discovery in Databases, pages 146--156, Porto, Portugal, October 2005
• Smith et al., Finding Sequence Motifs in Groups of Functionally Related Proteins. PNAS, 87:826-830, 1990
• Henikoff & Henikoff. Automated assembly of protein blocks for database searching. NAR, 19:6565-6572, 1991
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006
Advancing Knowledge Discovery
10 min
214
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Some of those “techniques”
frequently needed in analysis of
biomedical data are insufficiently
studied by current data mining researchers
• Recognizing what samples are relevant and what are not
• Recognizing what features are relevant and what are not & handling missing or incorrect values
• Recognizing trends, changes, and their causes
215
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Going Beyond Frequent Patterns:Marrying Statisticians and Data Miners
• Statisticians use a battery of “interestingness”measures to decide if a feature/factor is relevant
• Examples:– Odds ratio– Relative risk– Gini index– Yule’s Q & Y– etc
• Odds ratio
−−
−
−=
,
,
,
,
),(
D
eD
dD
edD
PPPP
DPOR
216
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Going Beyond Frequent Patterns:Experimenting With Tipping Events
• Given a data set, such as those related to human health, it is interesting to determine impt cohorts and impt factors causing transition betw cohorts
⇒ Tipping events⇒ Tipping factors are “action
items” for causing transitions
• “Tipping event” is two or more population cohorts that are significantly different from each other
• “Tipping factors” (TF) are small patterns whose presence or absence causes significant difference in population cohorts
• “Tipping base” (TB) is the pattern shared by the cohorts in a tipping event
• “Tipping point” (TP) is the combination of TB and a TF
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006
Any Question?
218
EII PhD Winter School in Data Mining & Bioinformatics, Lorne, 13-17 August 2006 Copyright 2006 © Limsoon Wong
Acknowledgements• Disease Treatment Planning & Understanding
– Jinyan Li, Huiqing Liu– Allen Yeoh, Richie Soong, Benjamin Mou, Anthony Tung
• Gene Feature Recognition– Huiqing Liu, Rajesh Chowdhary, Vladimir Bajic– Fanfan Zeng, Roland Yap, Liang Huai Yang, Yun Zheng,
Mong Li Lee, Wynne Hsu• Protein Function Inference & Binding Motifs
– Jinyan Li, Haiquan Li, See-Kiong Ng, Chris Tan, Donny Soh– Hon Nian Chua, Wing-Kin Sung, Jing Chen
• Text Mining from Biomedical Literature– See-Kiong Ng, Jian Su, Guodong Zhou– Chew Lim Tan
• Data Mining Theory & Technologies– Jinyan Li, Haiquan Li, Guimei Liu – Meng Ling Feng, Guozhu Dong