1/31
Analysis of lncRNA, miRNA and mRNA-associated ceRNA networks 1
and identification of potential drug targets for drug-resistant 2
non-small cell lung cancer 3
Shousen Hu1,Yongliang Yuan2,3,Yue Du2,3,Zijia Zhu2,3,Zhizhen Song2,3, Shanshan 4
Lu2,3, Chang Zhao1, Dan Yan2,3,Xiangzhen Kong2,3* 5
6
1 Department of Otolaryngology Head and Neck Surgery, the First Affiliated Hospital 7
of Zhengzhou University, Zhengzhou, China 8
2 Department of Pharmacy, the First Affiliated Hospital of Zhengzhou University, 9
Zhengzhou, China 10
3 Henan Key Laboratory of Precision Clinical Pharmacy, Zhengzhou University, 11
Zhengzhou, China 12
13
Corresponding authors: Xiangzhen Kong, Department of Pharmacy, the First 14
Affiliated Hospital of Zhengzhou University, Henan Key Laboratory of Precision 15
Clinical Pharmacy, No.1 Jianshe road, Zhengzhou, Henan, China 450052. Tel. 16
+86-371-6629-5652, Email: [email protected]. 17
18
Abstract 19
Background: Drug resistance to chemotherapeutic drugs or targeted medicines is an 20
obstacle encountered in the treatment of non-small-cell lung cancer (NSCLC). 21
2/31
However, the mechanisms of competing endogenous RNA (ceRNA) on the drug 22
resistance in NSCLC are rarely reported. In this paper, the comprehensive expression 23
profiles of lncRNAs and mRNAs in drug-resistant NSCLC cells were obtained by 24
RNA sequencing. 25
Methods: The dysregulated lncRNAs, miRNAs and mRNAs in drug-resistant 26
NSCLC cell lines were identified by RNA-sequencing and bioinformatics methods. 27
Results: A total of 39 dysregulated lncRNAs and 650 dysregulated mRNAs were 28
identified between drug-resistant NSCLC cell lines and their parental cell lines. 29
Additionally, 33 lncRNA-miRNA-mRNA pathways in the ceRNA network in 30
drug-resistant NSCLC were constructed through bioinformatics methods and ceRNA 31
regulatory rules. These comprised 12 dysregulated lncRNAs, five dysregulated 32
miRNAs, and eight dysregulated mRNAs. In addition, lncRNA 33
ATP2B1/miR-222-5p/TAB2 and lncRNA HUWE1/miR-222-5p/TAB2 were 34
identified as potential ceRNA networks involved in drug resistance to NSCLC. 35
Conclusions: The current study provides a promising therapeutic strategy against the 36
lncRNA-miRNA-mRNA ceRNA regulatory network for NSCLC treatment and 37
deepens our comprehension of the ceRNA regulatory mechanisms related to drug 38
resistance to NSCLC. 39
40
Key words:non-small cell lung cancer, competing endogenous RNA network, drug 41
resistance, RNA sequencing 42
43
http://dict.cnki.net/dict_result.aspx?searchword=%e6%b2%bb%e7%96%97%e7%ad%96%e7%95%a5&tjType=sentence&style=&t=therapeutic+strategy
3/31
Introduction 44
Non-small-cell lung cancer (NSCLC) accounts for approximately 85% of lung 45
cancer, which is one of the most common malignant cancers in the world, and is 46
characterized by high morbidity and mortality [1]. Current effective therapies for 47
NSCLC patients include surgical resection, chemotherapy, targeted therapy and 48
immunotherapies [2, 3]. However, despite improvements in NSCLC therapy over the 49
last few decades, the long-term survival rate of patients with NSCLC is still 20%35% 50
[4]. To a certain extent, the treatment of NSCLC may fail due to resistance to 51
chemotherapeutic drugs or targeted medicines. 52
Various studies have proposed that somatic activating mutations, dysregulation 53
of drug transport, and disorders of cell apoptosis pathways or cell cycle regulation are 54
common mechanisms of drug resistance[5, 6]. However, there are almost no available 55
methods for effectively overcoming drug resistance at present. Thus, there is an 56
imperative need to clarify novel mechanisms of drug resistance in NSCLC. Therefore, 57
it is necessary to explore the molecular differences between drug-resistant NSCLC 58
cell lines and their parental cell lines to identify new potential targets for the treatment 59
of drug resistance in NSCLC, as well as to improve the effectiveness of treatments for 60
this disease. 61
The competing endogenous RNA (ceRNA) mechanism stated that the transcripts 62
of non-coding RNAs like long non-coding RNAs (lncRNAs), can act as natural 63
microRNAs (miRNAs) sponges through competitively binding to miRNA response 64
elements (MREs) on target mRNAs to inhibit their functions [7]. In recent years, this 65
javascript:showjdsw('showjd_0','j_0')https://fanyi.so.com/?src=onebox#%20clarify
4/31
ceRNA regulatory network has received considerable attentions, and many have 66
studied the molecular mechanisms related to the occurrence and progression of 67
tumors [8, 9]. However, there are limited researches focused on the mechanisms of 68
ceRNAs in NSCLC drug resistance. 69
To explore the potential mechanisms of ceRNAs in NSCLC drug resistance, we 70
detected the expression levels of lncRNAs, miRNAs and mRNAs in the drug-resistant 71
NSCLC cell lines (A549/DDP and HCC827/GR) and their parent cell lines (A549 and 72
HCC827) by RNA sequencing. We then carried out a comprehensive analysis of the 73
dysregulated lncRNAs, miRNAs, and mRNAs using bioinformatics methods. Finally, 74
based on the bioinformatics results and the ceRNA regulatory rules, a 75
lncRNA-miRNA-mRNA network was constructed among the dysregulated lncRNAs, 76
miRNAs, and mRNAs. This paper might provide new insights into the mechanisms of 77
drug resistance and might have certain clinical significance for further research in this 78
area. 79
80
Materials and Methods 81
Cell lines and culture conditions 82
A549 cells were obtained from Shanghai Meixuan Biological science and 83
technology LTD, and HCC827 cells were kindly provided by Stem Cell Bank, 84
Chinese Academy of Sciences. A549 and HCC827 cells were grown in RPMI-1640 85
(Hyclone, MA, USA) supplemented with 10% fetal bovine serum (Gibco, NY, USA) 86
and penicillin/streptomycin. The cisplatin-resistant A549/DDP cells and the 87
5/31
gefitinib-resistant HCC827/GR cells were generated by gradient dose treatment for 88
almost six months. Drugs were added to maintain resistance and were withdrawn one 89
week before the experiment. 90
91
RNA isolation and purification 92
Total RNA from the cell lines was extracted by Trizol reagent (Invitrogen, CA, 93
USA) according to the instruction. The quantity and purity of total RNA were 94
measured by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit (Agilent, CA, USA) 95
with a RIN number ≥ 8. 96
97
LncRNA and mRNA sequencing 98
First, ribosomal RNA was depleted from approximately 10 μg of total RNA by 99
the Epicentre Ribo-Zero Gold Kit (Illumina, CA, USA). And then, the rRNA-depleted 100
RNA was broken into small pieces using divalent cations under an elevated 101
temperature and then reverse-transcribed to create the final cDNA library by the 102
mRNA-Seq sample preparation kit (Illumina, CA, USA). Then, paired-end 103
sequencing (300 ± 50 bp) was performed on Illumina X10 (LC Sciences, USA) 104
according to the vendor’s recommended protocol. 105
106
Transcript assembly 107
Adaptor contamination, low-quality bases, and undetermined bases were 108
removed using Cutadapt, and the quality of sequencing was verified by FastQC 109
6/31
(http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). The reads of each 110
sample were mapped to the human genome by Bowtie 2 [10] and topaht2 [11] and 111
were constituted by StringTie [12]. All transcriptomes of samples were combined to 112
regenerate an integrated transcriptome using Perl scripts. After the ultimate 113
transcriptome was generated, the expression level of all transcripts was estimated by 114
StringTie [12] and Ballgown [13]. 115
116
LncRNA identification 117
The transcripts overlapping with known mRNAs and transcripts < 200 bp and 118
the transcripts with a Coding Potential Calculator (CPC) score [14] < -1 and a 119
Coding-Non-Coding Index (CNCI) score [15] < 0 were removed. And the remaining 120
were taken as lncRNAs. The raw and processed data were transmitted to GEO with 121
the GEO accession number GSE132418. 122
123
Differential expression analysis of lncRNAs and mRNAs 124
The expression values of lncRNAs and mRNAs were calculated as FPKM 125
(fragments per kilobase per million) by StringTie [12]. The differentially expressed 126
lncRNAs and mRNAs were selected with fold change ≥ 2 or ≤ 0.5 and P ≤ 127
0.05 using R package-Ballgown [13]. 128
129
Quantitative real-time PCR 130
Quantitative real-time PCR (qRT-PCR) was performed on Applied Biosystems 131
QuantStudio 5 (Thermo Fisher Scientific, USA). Total RNA was extracted from A549, 132
https://fanyi.so.com/?src=onebox#%20constitute
7/31
A549/DDP by Trizol (Roche, CA, USA) and reversely transcribed into cDNA by First 133
Strand cDNA Synthesis Kit (Roche, CA, USA). The 2-ΔΔCT methods were employed 134
to analysis the relative expression levels of lncRNAs. The primer sequences were 135
listed in Table 1. 136
Table 1. The primers for qRT-PCR. 137
Name Sequence (5'-3')
lncRNA RALGAPB (F) TGAAGCCATTGTTGGTTGGC
lncRNA RALGAPB (R) AGGGTCTTAAGGGTCTTTACCA
lncRNA HCG25 (F) CAGGAAAGGAGGGTGACAGAC
lncRNA HCG25 (R) GCTTTGGTAGTTCCTGCCTTCA
PXN-AS1 (F) TGGCGAGCTCAGCAAACTAA
PXN-AS1 (R) TTTGCGTGCTTCCTCTTTGC
lncRNA NT5C3A (F) AAGGAGGCTTCACTGGGACT
lncRNA NT5C3A (R) GGTCAACGTAGGCACCTCTAA
TAB2 (F) CTCCTGGTGGTACAACTCGAC
TAB2 (R) TGATTTGGCTGTTGAGATGAGG
18S (F) GTAACCCGTTGAACCCCATT
18S (R) CCATCCAATCGGTAGTAGCG
GAPDH (F) TGTTGCCATCAATGACCCCTT
GAPDH (R) CTCCACGACGTACTCAGCG
138
Functional enrichment analysis of differentially expressed lncRNAs 139
To clarify the potential functional roles of the dysregulated lncRNAs, the 140
cis-target genes of the dysregulated lncRNAs 100 kbp upstream and downstream of 141
the chromosome were picked using a Python script. The neighboring genes were then 142
performed for gene ontology (GO) analysis and Kyoto encyclopedia of genes and 143
genomes (KEGG) enrichment analysis. Significance is expressed as a P-value < 0.05. 144
145
Construction of a lncRNA-miRNA-mRNA-related ceRNA regulatory network 146
First, starBase v3.0 [16] and miRcode [17] were employed to analyze the 147
https://fanyi.so.com/?src=onebox#%20clarify
8/31
relationships between the dysregulated lncRNAs and miRNAs. starBase v3.0 is a 148
database for studying miRNA-ncRNA, miRNA-mRNA and RNA-RNAinteractions 149
from CLIP-seq data [16]. miRcode provides miRNA target predictions including 150
lncRNAs, based on the comprehensive GENCODE gene annotation [17]. Therefore, 151
we employed miRcode to decipher the interactions between lncRNAs and miRNAs 152
and between miRNAs and mRNAs. Second, miRanda [18], miRcode [17], and 153
TargetScan [19] were employed to decode the relationships between the dysregulated 154
miRNAs and mRNAs. miRanda is a database that can predict miRNA targets and 155
miRNA expression [18]. TargetScan is a database that can predict miRNA targets in 156
mammals by matching the conserved 8mer, 7mer, and 6mer sites with the seed region 157
of miRNA [19]. Finally, the ceRNA regulatory network was constructed according to 158
the ceRNA regulatory mechanism and the changing trends of lncRNAs, miRNAs and 159
mRNAs, and the network was visualized by Cytoscape 3.6.1. 160
161
TCGA data analysis 162
The data from the lung adenocarcinoma patients were downloaded from the 163
database of The Cancer Genome Atlas (TCGA, https://cancergenome.nih.gov/). The 164
optimal cut-off point for the expression of all RNAs in the ceRNA regulatory network 165
was divided into high-risk and low-risk groups using the “cutp” function from R 166
package-survMisc. Survival analysis of all RNAs in the ceRNA network was 167
calculated by Kaplan-Meier analysis, which was performed using R package-survival. 168
P < 0.05 was considered statistically significant. 169
http://www.mircode.org/info.phphttps://cancergenome.nih.gov/
9/31
170
RNA interference experiments 171
A549/DDP cells were seeded in plates, and transfected with 40 nM siRNAs 172
using jetPRIME® (Polyplus-transfection SA, France). SiRNAs were purchased from 173
Shanghai GenePharma Co., Ltd (Shanghai, China). The sense sequence of siTAB2 is 174
5’-GCUGGGUAUCUCAGUUUAATT-3’ and the antisense sequence of siTAB2 is 175
5’-UUAAACUGAGAUACCCAGCTT-3’. The sense sequence of negative control 176
(siNC) is 5’-UUCUCCGAACGUGUCACGUTT-3’and the antisense sequence of 177
siNC is 5’-ACGUGACACGUUCGGAGAATT-3’. Cells were transfected for at least 178
24 h before the subsequent experiments. 179
180
Western blot analysis 181
A549/DDP cells were seeded in 6-well plates at a density of 300,000 cells/well 182
and then transfected with 40 nM siNC or siTAB2 after 24h of cultivation. After 48h 183
of transfection, the cells were lysed using RIPA lysis buffer with protease inhibitor. 184
Total protein (20 μg) was separated on 10% SDS-PAGE, transferred to PVDF 185
membranes (Millipore) and immunoblotted with a rabbit polyclonal antibody against 186
TAB2 (catalog number: 14410-1-AP, Proteintech, USA) or GAPDH (catalog number: 187
10494-1-AP, Proteintech, USA). Bands were detected by ChemiDocTM Imaging 188
System (Bio-Rad, USA). 189
190
Growth inhibition assay 191
10/31
Growth inhibition assay was assessed by measuring thiazolyl blue (MTT). 192
A549/DDP cells were seeded in 96-well plates at a density of 4,000 cells/well and 193
then transfected with 40 nM siNC or siTAB2 after 24h of cultivation. Different 194
concentrations of DDP were added to the cells after 24h of transfection, and each 195
group was set in triplicate. After 48h of treatment with DDP, 15μL 5mg/ mL MTT 196
(sigma, USA) was added into the wells and cultured at 37 ℃ for 4 h. The medium 197
was removed and 100μL DMSO was added into the wells. The plate was shocked and 198
the absorbance was measured at 570 nm using PerkinElmer Multimode Plate Reader 199
EnVision® (PerkinElmer, USA). 200
201
Results 202
Differentially expressed lncRNAs in drug-resistant NSCLC cell lines 203
RNA sequencing was carried out in the drug-resistant NSCLC cell lines 204
(A549/DDP and HCC827/GR) and their parent cell lines (A549 and HCC827) on an 205
Illumina X10. The global lncRNA abundances on different chromosomes were 206
visualized based on sample expression and class code expression by mapping all 207
lncRNA transcripts to a human reference genome (Fig. 1A and 1B). To identify the 208
dysregulated lncRNAs in those cells, the up- or down-regulated lncRNAs between 209
A549 and A549/DDP cells were taken as one group ,while the up- or down-regulated 210
lncRNAs between HCC827 and HCC827/GR cells were taken as the other group. 211
Then, the same change trends of lncRNAs between these two groups with a fold 212
change ≥ 2.0 or ≤ 0.5 and P ≤0.05 were chosen as lncRNAs candidates. Venn 213
javascript:showjdsw('showjd_2','j_2')
11/31
analysis displayed that there were 39 dysregulated lncRNAs, including 19 214
up-regulated lncRNAs and 20 down-regulated lncRNAs (Fig. 2A and 2B). The heat 215
map analysis shows the expression of the dysregulated lncRNAs visually (Fig. 2C and 216
2D). 217
218
Validation of lncRNA expression by qRT-PCR 219
Four lncRNAs were randomly selected to verify the data of high-throughput 220
RNA sequencing by qRT-PCR. The results showed that the change trends of three of 221
those four lncRNAs were in accordance with the sequence data, suggesting that the 222
sequence data were highly reliable (Fig. 3). 223
224
Functional enrichment analysis of cis-target genes of differentially expressed 225
lncRNAs 226
GO and KEGG pathway analysis were conducted to understand the biological 227
significance and mechanisms of the dysregulated lncRNAs. The cis-target genes of 228
the dysregulated lncRNAs upstream and downstream of the chromosome in the range 229
of 100 kbp were selected for GO and KEGG pathway analyses. The main associated 230
GO items of both the up- and down-regulated lncRNAs indicated translational 231
termination, translational elongation, ribosome, and cytosol (Fig. 4A and 4B), 232
suggesting that the dysregulated lncRNAs may be related to the transcriptional 233
regulation of gene expression. All three KEGG pathway analyses of both the up- and 234
down-regulated lncRNAs were ribosome, proteasome, and ECM-receptor interaction 235
12/31
(Fig. 4C and 4D). 236
237
Differentially expressed mRNAs in drug-resistant NSCLC cell lines 238
To investigate the expression levels of mRNAs in drug-resistant NSCLC cell 239
lines, the mRNA expression levels in the drug-resistant NSCLC cell lines (A549/DDP 240
and HCC827/GR) and their parent cell lines (A549 and HCC827) with a fold change 241
≥ 2.0 or ≤ 0.5 and P ≤0.05 were analyzed. Venn analysis displayed that there 242
were 195 up-regulated mRNAs and 455 down-regulated mRNAs (Fig. 5A and 5B). 243
The heat map analysis shows the expression of the first 20 up-regulated mRNAs and 244
the first 20 down-regulated mRNAs visually (Fig. 5C and 5D). 245
246
Construction of a ceRNA network in drug-resistant NSCLC cell lines based on 247
bioinformatics prediction 248
To further understand the roles of the dysregulated lncRNAs, miRNAs, and 249
mRNAs in drug-resistant NSCLC cell lines and to clarify the relationships among 250
them, a lncRNA-miRNA-mRNA-related ceRNA regulatory network was done in 251
drug-resistant NSCLC cell lines. The dysregulated miRNA expression levels in the 252
drug-resistant NSCLC cell lines (A549/DDP and HCC827/GR) and their parent cell 253
lines (A549 and HCC827) are described in our previous study [20]. 254
First, starBase v3.0 and miRcode were employed to analyze the relationships 255
between the dysregulated lncRNAs and miRNAs. Second, miRanda, miRcode, and 256
TargetScan were employed to decode the relationships between the dysregulated 257
13/31
miRNAs and mRNAs. And the ceRNA network was constructed in drug-resistant 258
NSCLC cell lines by incorporating 12 lncRNAs (10 up-regulated and two 259
down-regulated), five miRNAs (two up-regulated and three down-regulated), and 260
eight mRNAs (five up-regulated and three down-regulated), according to the ceRNA 261
regulatory mechanism and the change trend of lncRNAs, miRNAs and mRNAs. This 262
was visualized using Cytoscape 3.6.1 (Fig. 6). In the ceRNA network, there were 33 263
lncRNA-miRNA-mRNA pathways; the result is shown in Table S1. 264
265
Survival analysis of the potential lncRNAs, miRNAs and mRNAs in the ceRNA 266
regulatory network based on TCGA data 267
TCGA data for lung adenocarcinoma were employed to identify the prognostic 268
characteristics of the promising lncRNAs, miRNAs, and mRNAs in the ceRNA 269
regulatory network. As a result, four lncRNAs and one mRNA were found to be 270
significantly related to overall survival (P < 0.05; Fig. 7). Two lncRNAs, lncRNA 271
ATP2B1 and lncRNA HIST1H4H, were negatively correlated with overall survival. 272
Additionally, two lncRNAs, lncRNA RALGAPB and lncRNA SNHG3, and one 273
mRNA, PNRC1, were positively related to overall survival. 274
275
Correlation analysis of the potential lncRNAs, miRNAs, and mRNAs in the 276
ceRNA regulatory network 277
To further confirm the possible interaction of lncRNAs, miRNAs, and mRNAs 278
in the constructed ceRNA network, correlation analysis based on TCGA data was 279
14/31
conducted between the expression levels of 12 lncRNAs and their paired mRNAs in 280
lung cancer. It was shown that lncRNA ATP2B1 and TAB2, and lncRNA HUWE1 281
and TAB2 had a direct linear correlation with the correlation coefficient ≥ 0.3 and 282
P-value < 0.05 (Fig. 8). Combined with the results in Fig. 5, we propose that lncRNA 283
ATP2B1/miR-222-5p/TAB2 and lncRNA HUWE1/miR-222-5p/TAB2 may be 284
potential ceRNA regulatory networks. 285
286
Knocking down TAB2 enhances the sensitivity of drug-resistant NSCLC cell 287
lines 288
To further investigate the roles of TAB2 in the sensitivity of drug-resistant 289
NSCLC cell lines, A549/DDP cells were then transfected with siNC or siTAB2. After 290
48h, the mRNA and protein levels of TAB2 were reduced as shown in Fig. 9A and 9B. 291
Growth inhibition assay indicated that down-regulation of TAB2 significantly 292
reduced the sensitivity of A549/DDP cells (Fig. 9C). 293
294
Discussion 295
Drug resistance to chemotherapeutic drugs or targeted medicines is an obstacle 296
encountered in NSCLC treatment [21, 22]. Besides mRNAs, lncRNAs and miRNAs 297
have been reported to play an important part in the drug resistance of cancers [23, 24, 298
25]. In fact, some lncRNAs and miRNAs have been demonstrated to take part in drug 299
resistance to chemotherapeutic drugs or targeted medicines of NSCLC, including 300
lncRNA TUG1 related to 5-fluorouracil resistance [26], miR-15b related to sunitinib 301
https://www.ncbi.nlm.nih.gov/pubmed/30601026
15/31
resistance[27]. 302
Most lncRNAs and miRNAs may function as one member of the ceRNA 303
regulatory networks. In fact, several reports have suggested that the ceRNA networks 304
are related to the occurrence and progression of tumors, such as hepatocellular 305
carcinoma[28], prostate cancer [29] and glioblastoma [30]. However, there have been 306
few reports regarding the ceRNA regulatory networks and their involvement in drug 307
resistance except for chemo-resistance to osteosarcoma [23] and cisplatin-resistance 308
to epithelial ovarian cancer [31]. In our study, we present a comprehensive 309
perspective on the potential function of lncRNAs and mRNAs. Based on 310
RNA-sequencing and bioinformatics analysis, we constructed a ceRNA network that 311
may be related to drug resistance to chemotherapeutic drugs and targeted medicines in 312
NSCLC. The selected lncRNAs, miRNAs, and mRNAs in the networks corresponded 313
with the ceRNA rule. There were 33 lncRNA-miRNA-mRNA pathways in the 314
ceRNA regulatory network, includng 12 lncRNAs, five miRNAs and eight mRNAs. 315
In addition, we conducted survival analysis and correlation analysis of the potential 316
lncRNAs, miRNAs and mRNAs in the ceRNA regulatory network using TCGA data 317
and found that four lncRNAs (lncRNA ATP2B1, lncRNA HIST1H4H, lncRNA 318
RALGAPB, and lncRNA SNHG3) and one mRNA (PNRC1) were significantly 319
related with overall survival. In addition, lncRNA ATP2B1/miR-222-5p/TAB2 and 320
lncRNA HUWE1/miR-222-5p/TAB2 were revealed as potential ceRNA regulatory 321
networks. 322
There have been a few reports suggesting that miR-222-5p and TAB2 are related 323
16/31
to the occurrence and progression of tumors or drug resistance. MiR-222-5p has been 324
reported to be involved in triple-negative breast cancer [32], central lymph node 325
metastases of papillary thyroid cancer [33], ovarian cancer [34], and resistance 326
tamoxifen treatment in breast cancer [35]. TAB2 is an activator of MAP3K7/TAK1 327
and is required for TLR-mediated or IL-1-induced NF-kB activation [36, 37]. The 328
NF-kB signaling pathway is a key regulator of tumor occurrence and development 329
and can also take part in drug resistance to chemotherapy and targeted therapy [38, 330
39]. Additionally, TAB2 has been reported to serve as a new target for tamoxifen 331
resistance in breast cancer [40], and down-regulation of TAB2 may sensitize NSCLC 332
cells to BMS-690514, a new pan-HER/VEGFR inhibitor [41]. In our study, we found 333
that down-regulation of TAB2 enhanced the sensitivity of A549/DDP cells and we 334
proposed that TAB2 might play a vital role in drug resistance to chemotherapy and 335
targeted therapy in NSCLC. Until now, there have been no reports regarding TAB2 in 336
NSCLC drug resistance, and further experiments are necessary to evaluate the role 337
and mechanism of TAB2 in NSCLC drug resistance. 338
The mechanisms behind resistance to chemotherapeutic drugs or targeted 339
medicines may differ greatly, but it is anticipated that some overlapping mechanisms 340
between these two distinct types of drug resistance may exist. For example, ECM, 341
which plays a vital role in biological processes such as cell proliferation, 342
differentiation, and adhesion [42], can also be associated with chemotherapy 343
resistance [43, 44] and may be related to gefitinib resistance via the ECM receptor 344
[45]. Interestingly, we found that ECM-receptor interaction was one KEGG pathway 345
17/31
in both the up- and down-regulated lncRNAs. This discovery further confirmed our 346
speculation and may deepen our understanding of drug resistance. 347
To our knowledge, this is the first report to construct and analyse the ceRNA 348
network of lncRNAs, miRNAs and mRNAs in NSCLC drug resistance to 349
chemotherapeutic drugs or targeted medicines. However, there are some limitations to 350
our study. For example, the validation of potential lncRNAs, miRNAs, and mRNAs in 351
drug resistance of NSCLC were not performed, and the mechanism of the ceRNA 352
network was not confirmed by luciferase reporter assay or RNA immunoprecipitation 353
assays. 354
355
Conclusion 356
In conclusion, we provide here a comprehensive expression profile of lncRNAs, 357
miRNAs, and mRNAs. We also constructed a lncRNA-miRNA-mRNA ceRNA 358
regulatory network for drug resistance to chemotherapeutic drugs or targeted 359
medicines in NSCLC. In addition, we found that lncRNA 360
ATP2B1/miR-222-5p/TAB2 and lncRNA HUWE1/miR-222-5p/TAB2 are potential 361
ceRNA regulatory networks in NSCLC drug resistance according to TCGA data and 362
bioinformatics analysis. These results revealed that the lncRNA-miRNA-mRNA 363
ceRNA regulatory network might play a vital role in drug resistance to NSCLC and 364
might be a promising therapeutic strategy for further study. These results will deepen 365
our comprehension of the ceRNA mechanisms involved in drug resistance to NSCLC. 366
367
https://fanyi.so.com/?src=onebox#analysehttp://dict.cnki.net/dict_result.aspx?searchword=%e6%b2%bb%e7%96%97%e7%ad%96%e7%95%a5&tjType=sentence&style=&t=therapeutic+strategy
18/31
Abbreviations 368
ceRNA: competing endogenous RNA; GEO: gene expression omnibus; GO: 369
gene ontology; KEGG: kyoto encyclopedia of genes and genomics; lncRNA: long 370
non-coding RNAs; miRNA: microRNA; MRE: miRNA-response element; NCBI: 371
national center for biotechnology information; NSCLC: non-small cell lung cancer; 372
qRT-PCR: quantitative real-time PCR; TCGA: the cancer genome atlas. 373
374
Authors’ contributions 375
HSS and KXZ designed the research, and wrote the paper; YYL and ZZJ 376
analyzed data; DY, SZZ , LSS, ZC and YD performed the experiments. All authors 377
read and approved the final manuscript. 378
379
Funding 380
The present study was financially supported by the National Natural Science 381
Foundation of China (Grant No. 81600812 and 81903094), Program of Science & 382
Technology of Henan Province (Grant No. 182102310554 and 172102310381). The 383
funders had no role in study design, data collection, analysis, interpretation of data, or 384
manuscript preparation. 385
386
Availability of data and materials 387
The raw and processed RNA-sequencing data were transmitted to the GEO 388
database with the GEO accession number GSE132418 389
19/31
(https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE132418). 390
391
Ethics approval and consent to participate 392
Not applicable. 393
394
Competing interests 395
The authors declare that they have no competing interests. 396
397
References 398
1. Chen W, Zheng R, Baade PD, et al. Cancer statistics in China, 2015. CA: a cancer journal for 399
clinicians. 2016; 66:115-32. 400
2. Yang Y, Li H, Hou S, et al. The noncoding RNA expression profile and the effect of lncRNA 401
AK126698 on cisplatin resistance in non-small-cell lung cancer cell. PloS one. 2013; 402
8:e65309. 403
3. Brahmer J, Reckamp KL, Baas P, et al. Nivolumab versus Docetaxel in Advanced 404
Squamous-Cell Non-Small-Cell Lung Cancer. The New England journal of medicine. 2015; 405
373:123-35. 406
4. Ramalingam SS, Owonikoko TK, Khuri FR. Lung cancer: New biological insights and recent 407
therapeutic advances. CA: a cancer journal for clinicians. 2011; 61:91-112. 408
5. Rotow J, Bivona TG. Understanding and targeting resistance mechanisms in NSCLC. Nature 409
reviews. Cancer. 2017; 17:637-58. 410
6. Cree IA, Charlton P. Molecular chess? Hallmarks of anti-cancer drug resistance. BMC cancer. 411
2017; 17:10. 412
7. Salmena L, Poliseno L, Tay Y, et al. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA 413
language? Cell. 2011; 146:353-8. 414
8. Sanchez-Mejias A, Tay Y. Competing endogenous RNA networks: tying the essential knots for 415
cancer biology and therapeutics. Journal of hematology & oncology. 2015; 8:30. 416
9. Qi X, Zhang DH, Wu N, et al. ceRNA in cancer: possible functions and clinical implications. 417
Journal of medical genetics. 2015; 52:710-8. 418
10. Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nature methods. 2012; 419
9:357-9. 420
11. Kim D, Pertea G, Trapnell C, et al. TopHat2: accurate alignment of transcriptomes in the 421
presence of insertions, deletions and gene fusions. Genome biology. 2013; 14:R36. 422
12. Pertea M, Pertea GM, Antonescu CM, et al. StringTie enables improved reconstruction of a 423
transcriptome from RNA-seq reads. Nature biotechnology. 2015; 33:290-5. 424
13. Frazee AC, Pertea G, Jaffe AE, et al. Ballgown bridges the gap between transcriptome 425
20/31
assembly and expression analysis. Nature biotechnology. 2015; 33:243-6. 426
14. Kong L, Zhang Y, Ye ZQ, et al. CPC: assess the protein-coding potential of transcripts using 427
sequence features and support vector machine. Nucleic acids research. 2007; 35:W345-9. 428
15. Sun L, Luo H, Bu D, et al. Utilizing sequence intrinsic composition to classify protein-coding 429
and long non-coding transcripts. Nucleic acids research. 2013; 41:e166. 430
16. Li JH, Liu S, Zhou H, et al. starBase v2.0: decoding miRNA-ceRNA, miRNA-ncRNA and 431
protein-RNA interaction networks from large-scale CLIP-Seq data. Nucleic acids research. 432
2014; 42:D92-7. 433
17. Jeggari A, Marks DS, Larsson E. miRcode: a map of putative microRNA target sites in the 434
long non-coding transcriptome. Bioinformatics. 2012; 28:2062-3. 435
18. Betel D, Wilson M, Gabow A, et al. The microRNA.org resource: targets and expression. 436
Nucleic acids research. 2008; 36:D149-53. 437
19. Agarwal V, Bell GW, Nam JW, et al. Predicting effective microRNA target sites in mammalian 438
mRNAs. eLife. 2015; 4. 439
20. Hu S, Yuan Y, Song Z, et al. Expression Profiles of microRNAs in Drug-Resistant Non-Small 440
Cell Lung Cancer Cell Lines Using microRNA Sequencing. Cellular physiology and 441
biochemistry : international journal of experimental cellular physiology, biochemistry, and 442
pharmacology. 2018; 51:2509-22. 443
21. Maione P, Sacco PC, Sgambato A, et al. Overcoming resistance to targeted therapies in 444
NSCLC: current approaches and clinical application. Therapeutic advances in medical 445
oncology. 2015; 7:263-73. 446
22. Fennell DA, Summers Y, Cadranel J, et al. Cisplatin in the modern era: The backbone of 447
first-line chemotherapy for non-small cell lung cancer. Cancer treatment reviews. 2016; 448
44:42-50. 449
23. Zhu KP, Zhang CL, Ma XL, et al. Analyzing the Interactions of mRNAs and ncRNAs to 450
Predict Competing Endogenous RNA Networks in Osteosarcoma Chemo-Resistance. 451
Molecular therapy : the journal of the American Society of Gene Therapy. 2019; 27:518-30. 452
24. Si W, Shen J, Zheng H, et al. The role and mechanisms of action of microRNAs in cancer drug 453
resistance. Clinical epigenetics. 2019; 11:25. 454
25. Zang H, Peng J, Wang W, et al. Roles of microRNAs in the resistance to platinum based 455
chemotherapy in the non-small cell lung cancer. Journal of Cancer. 2017; 8:3856-61. 456
26. Wang M, Hu H, Wang Y, et al. Long non-coding RNA TUG1 mediates 5-fluorouracil 457
resistance by acting as a ceRNA of miR-197-3p in colorectal cancer. Journal of Cancer. 2019; 458
10:4603-13. 459
27. Lu L, Li Y, Wen H, et al. Overexpression of miR-15b Promotes Resistance to Sunitinib in 460
Renal Cell Carcinoma. Journal of Cancer. 2019; 10:3389-96. 461
28. Liao X, Wang X, Huang K, et al. Integrated analysis of competing endogenous RNA network 462
revealing potential prognostic biomarkers of hepatocellular carcinoma. Journal of Cancer. 463
2019; 10:3267-83. 464
29. Xu N, Wu YP, Yin HB, et al. Molecular network-based identification of competing 465
endogenous RNAs and mRNA signatures that predict survival in prostate cancer. Journal of 466
translational medicine. 2018; 16:274. 467
30. Yuan Y, Jiaoming L, Xiang W, et al. Analyzing the interactions of mRNAs, miRNAs, 468
lncRNAs and circRNAs to predict competing endogenous RNA networks in glioblastoma. 469
21/31
Journal of neuro-oncology. 2018; 137:493-502. 470
31. Zhao X, Tang DY, Zuo X, et al. Identification of lncRNA-miRNA-mRNA regulatory network 471
associated with epithelial ovarian cancer cisplatin-resistant. Journal of cellular physiology. 472
2019. 473
32. Piasecka D, Braun M, Kordek R, et al. MicroRNAs in regulation of triple-negative breast 474
cancer progression. Journal of cancer research and clinical oncology. 2018; 144:1401-11. 475
33. Han PA, Kim HS, Cho S, et al. Association of BRAF V600E Mutation and MicroRNA 476
Expression with Central Lymph Node Metastases in Papillary Thyroid Cancer: A Prospective 477
Study from Four Endocrine Surgery Centers. Thyroid : official journal of the American 478
Thyroid Association. 2016; 26:532-42. 479
34. Li Y, Liu C, Liao Y, et al. Characterizing the landscape of peritoneal exosomal microRNAs in 480
patients with ovarian cancer by high-throughput sequencing. Oncology letters. 2019; 481
17:539-47. 482
35. Kim C, Go EJ, Kim A. Recurrence prediction using microRNA expression in hormone 483
receptor positive breast cancer during tamoxifen treatment. Biomarkers : biochemical 484
indicators of exposure, response, and susceptibility to chemicals. 2018; 23:804-11. 485
36. Shi M, Deng W, Bi E, et al. TRIM30 alpha negatively regulates TLR-mediated NF-kappa B 486
activation by targeting TAB2 and TAB3 for degradation. Nature immunology. 2008; 9:369-77. 487
37. Zhang L, Ding X, Cui J, et al. Cysteine methylation disrupts ubiquitin-chain sensing in 488
NF-kappaB activation. Nature. 2011; 481:204-8. 489
38. Li Q, Yang G, Feng M, et al. NF-kappaB in pancreatic cancer: Its key role in chemoresistance. 490
Cancer letters. 2018; 421:127-34. 491
39. Darvishi B, Farahmand L, Eslami SZ, et al. NF-kappaB as the main node of resistance to 492
receptor tyrosine kinase inhibitors in triple-negative breast cancer. Tumour biology : the 493
journal of the International Society for Oncodevelopmental Biology and Medicine. 2017; 494
39:1010428317706919. 495
40. Cutrupi S, Reineri S, Panetto A, et al. Targeting of the adaptor protein Tab2 as a novel 496
approach to revert tamoxifen resistance in breast cancer cells. Oncogene. 2012; 31:4353-61. 497
41. de La Motte Rouge T, Galluzzi L, Olaussen KA, et al. A novel epidermal growth factor 498
receptor inhibitor promotes apoptosis in non-small cell lung cancer cells resistant to erlotinib. 499
Cancer research. 2007; 67:6253-62. 500
42. Liu T, Zhou L, Li D, et al. Cancer-Associated Fibroblasts Build and Secure the Tumor 501
Microenvironment. Frontiers in cell and developmental biology. 2019; 7:60. 502
43. Rintoul RC, Sethi T. Extracellular matrix regulation of drug resistance in small-cell lung 503
cancer. Clinical science. 2002; 102:417-24. 504
44. Helleman J, Jansen MP, Burger C, et al. Integrated genomics of chemotherapy resistant 505
ovarian cancer: a role for extracellular matrix, TGFbeta and regulating microRNAs. The 506
international journal of biochemistry & cell biology. 2010; 42:25-30. 507
45. Ju L, Zhou C, Li W, et al. Integrin beta1 over-expression associates with resistance to tyrosine 508
kinase inhibitor gefitinib in non-small cell lung cancer. Journal of cellular biochemistry. 2010; 509
111:1565-74. 510
511
512
22/31
513
514
Figure. 1 The density distribution of all the lncRNA transcripts on different 515
chromosomes. The global lncRNA abundances on different chromosomes were 516
visualized based on sample expression (A) and class code expression (B) by mapping 517
all lncRNA transcripts to reference genome. 518
519
javascript:showjdsw('showjd_2','j_2')
23/31
520
Figure. 2 The expression profiles of the same change trends of lncRNAs in 521
drug-resistant NSCLC cell lines. Venn analysis displayed the numbers of the 522
up-regulated lncRNAs (A) and the down-regulated lncRNAs (B) between group 523
1(A549/DDP vs A549) and group 2 (HCC827/GR vs HCC827) with the criteria of 524
fold change ≥ 2 or ≤ 0.5 and P < 0.05. Heat map showed the expression and 525
hierarchical clustering of the up-regulated lncRNAs (C) and the down-regulated 526
lncRNAs (D). 527
528
529
24/31
530
Figure. 3 Validation of lncRNA expression in drug-resistant NSCLC cell lines by 531
qRT-PCR. 532
533
25/31
534
Figure. 4 GO enrichment and KEGG pathway analysis of the dysregulated lncRNAs 535
in drug-resistant NSCLC cell lines. GO enrichment analysis of the target genes 536
corresponding to the up-regulated lncRNAs (A) and the down-regulated lncRNAs 537
(B).KEGG pathway analysis of the target genes corresponding to the up-regulated 538
lncRNAs (C) and the down-regulated lncRNAs (D). 539
540
26/31
541
Figure. 5 The expression profiles of the same change trends of mRNAs in 542
drug-resistant NSCLC cell lines. Venn analysis displayed the numbers of the 543
up-regulated mRNAs (A) and the down-regulated mRNAs (B) between group 544
1(A549/DDP vs A549) and group 2 (HCC827/GR vs HCC827) with the criteria of 545
fold change ≥ 2 or ≤ 0.5 and P < 0.05. Heat map showed the expression and 546
hierarchical clustering of the first 20 up-regulated mRNAs (C) and the first 20 547
down-regulated mRNAs (D). 548
549
27/31
550
Figure. 6 The lncRNA-miRNA‑mRNA ceRNA network analysis in drug-resistant 551
NSCLC cell lines. The lncRNA-miRNA‑mRNA ceRNA network analysis was 552
constructed by Cytoscape. Green and watermelon red represented up-regulated and 553
down-regulated lncRNAs, miRNAs or mRNAs, respectively. Diamond, square and 554
oval represented lncRNAs, miRNAs and mRNAs, respectively. 555
556
https://fanyi.so.com/?src=onebox#diamondhttps://fanyi.so.com/?src=onebox#square
28/31
557
Figure. 7 Survival analysis of lncRNAs, miRNAs and mRNAs in the ceRNA network 558
based on TCGA database. Data from TCGA database for lung adenocarcinoma was 559
employed to identify the prognostic characteristics of the promising lncRNAs, 560
miRNAs and mRNAs in the ceRNA network. The results showed the survival 561
analysis of the potential lncRNAs, miRNAs and mRNAs with P < 0.05. 562
563
29/31
564
Figure. 8 Correlation analysis of the potential lncRNAs and mRNAs in the ceRNA 565
network. Correlation analysis between the expression levels of lncRNAs and their 566
paired mRNAs in lung cancer based on TCGA database was employed. The results 567
showed the correlation analysis of the potential lncRNAs and mRNAs with the 568
correlation coefficient ≥0.3 and P-value <0.05. 569
570
30/31
571
Figure. 9 Knocking down TAB2 reduces the sensitivity of drug-resistant NSCLC cell 572
lines. The mRNA and protein levels of TAB2 were detected by qRT-PCR (A) and 573
western blot (B) after 48h of transfection with siNC or siTAB2 in A549/DDP cells. 574
A549 / DDP cells transfected with siNC or siTAB2 were treated with DDP at 575
different concentrations. The cell growth rate was assessed by MTT, and the OD570nm 576
of A549/DDP cells transfected with siNC but not treated by DDP was taken as 1 (C). 577
*P
31/31
Supplementary materials 584
Table S1. The lncRNA-miRNA- mRNA pathways in the ceRNA network. 585