DNA SEQUENCING, ANATOMY, AND CALCIFICATION PATTERNS SUPPORT AMONOPHYLETIC, SUBARCTIC, CARBONATE REEF-FORMING CLATHROMORPHUM
(HAPALIDIACEAE, CORALLINALES, RHODOPHYTA)
Walter H. Adey,2 Jazmin J. Hernandez-Kantun
Botany Department, National Museum of Natural History, Smithsonian Institution, Washington, D.C., USA
Gabriel Johnson
Laboratory of Analytical Biology, National Museum of Natural History, Smithsonian Institution, Washington, D.C., USA
and Paul W. Gabrielson
Department of Biology and Herbarium, University of North Carolina, Chapel Hill, North Carolina, USA
For the first time, morpho-anatomical charactersthat were congruent with DNA sequence data wereused to characterize several genera in Hapalidiaceae—the major eco-engineers of Subarctic carbonateecosystems. DNA sequencing of three genes (SSU,rbcL, ribulose-1, 5-bisphosphate carboxylase/oxygenase large subunit gene and psbA, photosystemII D1 protein gene), along with patterns of celldivision, cell elongation, and calcification supporteda monophyletic Clathromorphum. Two characterswere diagnostic for this genus: (i) cell division,elongation, and primary calcification occurred onlyin intercalary meristematic cells and in a narrowvertical band (1–2 lm wide) resulting in a“meristem split” and (ii) a secondary calcification ofinterfilament crystals was also produced.Neopolyporolithon was resurrected for N. reclinatum,the generitype, and Clathromorphum loculosum wastransferred to this genus. Like Clathromorphum, celldivision, elongation, and calcification occurred onlyin intercalary meristematic cells, but in a widervertical band (over 10–20 lm), and a “meristemsplit” was absent. Callilithophytum gen. nov. wasproposed to accommodate Clathromorphum parcum,the obligate epiphyte of the northeast Pacificendemic geniculate coralline, Calliarthron.Diagnostic for this genus were epithallial cellsterminating all cell filaments (no dorsi-ventrality waspresent), and a distinct “foot” was embedded in thehost. Leptophytum, based on its generitype, L. laeve,was shown to be a distinct genus more closelyrelated to Clathromorphum than to Phymatolithon. Allnames of treated species were applied unequivocallyby linking partial rbcL sequences from holotype,isotype, or epitype specimens with field-collectedmaterial. Variation in rbcL and psbA sequencessuggested that multiple species may be passing
under each currently recognized species ofClathromorphum and Neopolyporolithon.
Abbreviations: BI, Bayesian inference; BP, bootstrapvalue; GTR, general time reversible; MCMC, Mar-kov Chain Monte Carlo; ML, maximum likelihood;psbA, Photosystem II D1 protein gene; rbcL, ribu-lose-15-bisphosphate carboxylase/oxygenase largesubunit gene
For the past 50 years, Adey and collaborators haveintensively researched the Subarctic shallow subtid-al, carbonate, reef-forming coralline algae domi-nated by species of Clathromorphum Foslie, but alsoincluding species in Lithothamnion Heydrich, Lepto-phytum W.H. Adey, and Phymatolithon Foslie (Subarc-tic as used herein, includes the Arctic; see Adey andSteneck 2001). As a result, this is one of the beststudied shallow subtidal ecosystems globally withnumerous papers on the ecology (Adey 1964, 1965,1966a,b, 1970a,b, 1971, Adey and McKibbin 1970,Adey and Adey 1973, Adey et al. 2005), physiology(Adey 1970b, Adey and McKibbin 1970, Adey 1973,Adey et al. 2013), and biogeography (Adey 1966b,Adey et al. 1976, 2008, Adey and Steneck 2001, Adeyand Hayek 2011) of these reef-forming carbonatespecies.Concomitantly, studies on the growth and anat-
omy of these species (Adey 1964, 1965, 1966a), andmore recently, high magnification SEM studies(Adey et al. 2005, 2013) have revealed patterns ofcell division, elongation, and calcification that havenot been incorporated into our knowledge of thephylogenetic relationships among these Subarcticand Boreal taxa. For example, all growth (cell divi-sion and cell elongation) and calcification in Sub-arctic Clathromorphum species and in Neopolyporolithon
1Received 20 February 2014. Accepted 6 November 2014.2Author for correspondence: e-mail [email protected] Responsibility: M. Vis (Associate Editor)
W.H. Adey & H.W. Johansen occurs in the interca-lary meristem (Adey 1965, Adey and Johansen 1972,Lebednik 1977, Adey et al. 2005, Fig. 1). Cells arecut-off from the meristem distally to form a photo-synthetic epithallium and proximally to form anextensive perithallium. Moreover, in these SubarcticClathromorphum species, Adey et al. (2013), usinghigh magnification SEM, showed that primary calci-fication occurred in a narrow, horizontal plane(meristem split), a few lm thick, within the meri-stem (Figs. 2 and 3). In Lithothamnion (Figs. 1 and4; Adey et al. 2005) and Leptophytum (Fig. 1), celldivision also occurs in the single layer of intercalarymeristematic cells, but full cell elongation occursover a depth of 15–40 lm into the perithallium.
The Subarctic species of Clathromorphum (C. com-pactum (Kjellman) Foslie C. circumscriptum(Str€omfelt) Foslie, and C. nereostratum Lebednik),unlike all other known nongeniculate corallines,have a unique double mode of calcification (Nashet al. 2012, Adey et al. 2013). The primary calcifica-tion, characteristic of all Corallinales and Sporolit-hales studied to date, is of metabolically emplaced,short, very fine, radially oriented and prismaticmicro-calcite crystals, embedded in organic cell
walls. However, in Subarctic Clathromorphum species,secondary vertically or diagonally oriented, large,angular (deltoid in shape) calcite crystals are em-placed between filaments (interfilament crystals ofAdey et al. 2013; Figs. 2 and 3). These secondary in-terfilament crystals appear to have no organicframework, and they dissolve out more readily thanthe primary wall crystals when older tissue isexposed by invertebrate borers; the calcite dissolu-tion accompanying such boring can allow cells tofall out of the broader carbonate matrix as hollow“grains” of carbonate, the primary wall crystals
FIG. 1. Comparative meristem and upper perithallial mean celldimensions of Lithothamnion lemoineae, Clathromorphum circumscrip-tum, and Leptophytum laeve (See Adey et al. 2005 for details). Sets ofmeristem and perithallial size curves demonstrate three primarycell elongation (growth) types (Leptophytum/Phymatolithon—pro-gressive, Clathromorphum—only meristem, and Lithothamnion—mixed) currently known for Subarctic Hapalidiaceae.
FIG. 2. Clathromorphum nereostratum SEM image at 92,000showing meristem, with its break in calcification, and overlyingepithallium and underlying perithallium. Thin, inner cell layer ofradial calcite crystals (black arrow); mass of larger and more verti-cally oriented interfilament calcite crystals (gray arrow). FromAdey et al. (2013).
FIG. 3. Unfractured meristem cells of Clathromorphum nereostra-tum showing: IM – inner wall, inner membrane, and OM, outermembrane; CZ – fractured calcification zone; and PC – precipita-tion cavity. Note the great difference in size and orientation ofthe inner wall crystals as compared to the interfilament crystals.From Adey et al. (2013).
190 WALTER H. ADEY ET AL.
embedded in organic remains providing the struc-ture of the grains (Adey et al. 2013).
Most coralline genera have a single layer of super-ficial nonphotosynthetic epithallial cells, and in theclassical literature these were called cover cells (Frit-sch 1952) or deckzellen (Suneson 1937). Althoughthey are usually thought of as being very thin-walledwith minimal (if any) calcification, there is a widevariety of structure that is generally uniform at thegeneric level. Subarctic Clathromorphum species, forexample, develop a multilayered, calcified, photo-synthetic epithallium. In contrast, Lithothamnion spe-cies have a single-layered, calcified and thick-walled,“armored” epithallium (flared upper walls in someliterature, e.g., Irvine and Chamberlain 1994) thatare highly distinctive both in surface view and insection, in SEM (Fig. 4) and in decalcified, paraffin-embedded microtome sections (Adey 1966a, Adeyand McKibbin 1970). Epithallial cells of Sporolit-hales (Sporolithon and Heydrichia) are similar
(Fig. 5), and in all cases they are characteristic ofthese three genera (Adey 1966a, Adey et al. 1982,2005, Bahia et al. 2013).Herein, we focus on the genus Clathromorphum
(Foslie 1898) restricting ourselves to the well-studiedand currently recognized northern hemisphere spe-cies. This includes the dominant Subarctic, carbo-nate, reef-forming species: C. compactum (Foslie)Foslie (the generitype), C. circumscriptum (Str€omfelt)Foslie and C. nereostratum Lebednik. Also included inClathromorphum in earlier publications have been thin-ner epilithic species, C. loculosum (Kjellman) Foslieand the Boreal (as defined by Adey and Steneck 2001,including British Columbian) epiphytic species, C.parcum (Setchell & Foslie) W. H. Adey and C. reclina-tum (Foslie) W. H. Adey. We also demonstrate thatLeptophytum and Phymatolithon are distinct genera,resolving a long-standing dispute over the recogni-tion of Leptophytum (Adey et al. 2001, Woelkerlinget al. 2002, Athanasiadis and Adey 2003, 2006).
FIG. 4. SEM at 93,000 of Lithothamnion tophiforme showingcharacteristic armored epithallium. (a) Surface view showing twolayers of epithallial cells, upper layer breaking off in patches. (b)View in fractured section showing thick-walled epithallial cells ontop of meristem cells of varying length depending upon divisionstate.
FIG. 5. SEM of Sporolithon dimotum (Caribbean) showing char-acteristic armored epithallium. (a) Surface at 95,000 showingarmored cells similar to Lithothamnion (Fig. 4), with slightlythicker side walls. (b) Fractured section at 92,000 showingarmored epithallium.
CLATHROMORPHUM PHYLOGENETIC ANALYSES 191
MATERIALS AND METHODS
Specimen collection, preparation, and preservation. Most of thesubtidal collections utilized in this study were taken bySCUBA; extractions from rocky bottoms being made manu-ally by hammer and chisel as were intertidal collections. Themethodology for the Adey and Halfar collections wasdescribed in detail in Adey et al. (2013); for the Lebednikcollections in Lebednik (1977). Sequenced specimens arecited by herbarium acronym and accession number, exceptfor the University of British Columbia Herbarium (UBC) Le-bednik material cited by his collection number and Adey’smaterial at the National Museum of Natural History (NMNH)(US, the United States National Herbarium at NMNH) citedby his collection numbers (Table S1 in the Supporting Infor-mation). Type material was kindly loaned from TrondheimHerbarium (TRH), University of California, Berkeley, Herbar-ium (UC), and UBC; herbarium acronyms from Thiers(2014).
Morphological features, ecological, and distributionalinformation analyzed against the phylogeny were derived pri-marily by the information provided in Adey (1964, 1965,1966a), Adey and Johansen (1972), Lebednik (1977) and Adeyet al. (2005, 2013). To compare features against the phylogeny,many of the coralline specimens collected from 1960s to 1970swere diamond-sawed into smaller blocks, some were fixed,decalcified, microtome-sectioned in paraffin, and studied withcompound light microscopes. Larger portions have been main-tained in the dry state as part of the Coralline Collection ofUnited States. A large microscope slide collection remains partof this material. Some specimens from the older collectionsand most from those taken recently have been examined with aLeica Stereoscan 440 SEM at the Smithsonian’s NMNHImaging Laboratory. Specimens were carbon-coated for SEMimaging. While thallus surfaces were examined with SEMdirectly after mounting and coating, the majority of imageswere acquired from vertical surfaces fractured with wire cutters.Large specimens were usually first cut with a diamond sawbefore being appropriately fractured with wire cutters prior tomounting and coating. Most specimens were preserved bydrying in shipboard ovens; some were further preserved forDNA extraction by storing in silica gel.
DNA extractions, PCR amplification, and sequencing. Cleansmall fragments to a total volume of ~3 mm3 were removedfrom air or silica gel dried field samples or from type mate-rial while viewed under a dissecting microscope to be certainthat they were clean of algal epiphytes. Field-collected sam-ples were crushed to powder in clean paper or foil. Extrac-tion of total genomic DNA followed either the protocol ofSaunders (1993) using a pretreatment before the QiagenDNeasy Plant mini-kit instructions or the protocol of Hugheyet al. (2001). Extractions of herbarium specimens followedthe protocol of Hughey et al. (2001), following the recom-mendations of Saunders and McDevit (2012) and Hugheyand Gabrielson (2012).
Markers amplified were ribulose-1, 5-bisphosphate carbox-ylase/oxygenase large subunit gene (rbcL), photosystem IID1 protein gene (psbA), and SSU rDNA. Primer pairs usedfor rbcL were F57 (forward)—R1150 (reverse) and F753(forward)—RrbcS start (reverse; Freshwater and Rueness1994). For nongeniculate type material, a new forward primerwas designed (F1150Cor—GGTATACATTGTGGACAAATGC)that was used in combination with R1308 (Gabrielson et al.2011) to yield a 135 base pair (bp) sequence, hereafter calledrbcL 135 or with RrbcS to yield a 296 bp sequence, hereaftercalled rbcL 296. The psbA gene was amplified in one reactionusing the primers psbA-F and psbA-R2 (Yoon et al. 2002). SSUrDNA was amplified in two reactions using the primer pairsG01 (forward)—G14 (reverse) for the 50 end and G04
(forward)—G07 (reverse) for the 30 end (Saunders and Kraft1994).
All PCR runs included negative controls. Two PCR reac-tion mixes and thermocycler protocols were used, one follow-ing Hughey et al. (2001) and the other: 1 lL (1/10 dilution)sample, 2 lL 109 deoxynucleotide triphosphates (10 mM),2.5 lL 109 buffer, 1.25 lL MgCl2 (25 mM), 15.5 lL nucle-ase free water, 1 lL (10 lM) primer Forward, 1 lL (10 lM)primer Reverse, 0.2 lL Taq Enzyme Biolase! Bioline (5 lg !lL"1) and 0.5 lL BSA (10 mg ! mL"1)/reaction tube with 35cycles of 30 s at 94°C, 45 s at 52°C and 1 min at 72°C and afinal cycle of 5 min at 72°C.
Either Exosap-IT (USB, Cleveland, OH, USA) was usedfor the purification of PCR products using 2 lL of 1:3dilution of the enzyme for each tube and incubating for30 min at 37°C followed by 15 min at 80°C or QiaQuickPCR purification kit following the manufacturer’s protocol.Sequencing reactions were performed using 5 lL of thepurified PCR with the addition of 3.7 lL nuclease freewater, 1 lL primer (1 lM), 2 lL BigDye buffer and 0.8 lLBigDye (ABI, Foster City, CA, USA) and run in the thermalcycler for 1 cycle of 5 s at 95°C, 30 cycles of 30 s at 95°C,30 s at 50°C and 4 min at 60°C; and a final cycle of 5 s at60°C. The samples were then purified using Millipore Sepha-dex plates (MAHVN-4550; Millipore, Billerica, MA, USA)under manufacturer’s guidelines. Sequences were obtainedusing an ABI 3730XL automated DNA sequencer at theNMNH Laboratories of Analytical Biology or using an ABI3100 Genetic Analyzer (DNA Analysis Core Facility, Centerfor Marine Sciences, University of North Carolina, Wilmington,NC, USA).
Generitype species and type material. All of the treated Hapa-lidiaceae genera included their generitype species, exceptLithothamnion (we did not know if the included NorthernHemisphere Lithothamnion species belonged in a clade withthe southern hemisphere generitype, L. muelleri Lenormandex Rosanoff). For each species of Clathromorphum, Mesophyl-lum, and Phymatolithon, and for Leptophytum foecundum,the holotype, an isotype or an epitype was sequenced,unequivocally linking the name to field-collected material.The generitype of Leptophytum, L. laeve was based on materialfield-collected and identified by W.H. Adey, the author of thegenus.
Phylogenetic analyses. Sporolithon Heydrich and HeydrichiaR.A. Townsend, Y.M. Chamberlain & Keats from the orderSporolithales were used as outgroups for the phylogeneticreconstruction. This selection was based on the phyloge-netic relationship of those two genera with Hapalidiaceaein previous reconstructions (Broom et al. 2008, Bittneret al. 2011). Other combinations of outgroups (includingLithophyllum incrustans Philippi, Pseudolithophyllum neofarlowii(Setchell & L.R. Mason) W.H. Adey, Palmaria palmata(Linnaeus) Weber & Mohr and Centroceras clavulatum (C.Agardh) Montagne) and within groups for the North Paci-fic (Mesophyllum Me. Lemoine and Lithothamnion species)were also analyzed to test the stability of our primary Sub-arctic and Boreal generic groupings. Sequence lengths weretrimmed to 850 bp for psbA, 1,384 bp for rbcL, and1,701 bp for SSU. Individual data sets, as well as the con-catenated data set (3,935 bp in length) were aligned usingClustalW in Mega version 5 (Tamura et al. 2011) withdefault settings. Phylogenetic reconstruction for each dataset was performed using maximum likelihood (ML) in RAx-ML 1.3 (Mac version: Silvestro and Michalak 2011) usingGTR (General Time Reversible) model with gamma distri-bution and invariant sites; statistical support was obtainedperforming Bootstrap (BP) analyses with 1,000 resampling.The individual rbcL and psbA data sets were partitioned by
192 WALTER H. ADEY ET AL.
codon (first, second, and third codon position). For theML analysis of the concatenated data set in RaxML, thedata were partitioned following the recommendation inVerbruggen et al. (2010). Partition strategy included marker+ codon position, so in total seven partitions: rbcL first,rbcL second, rbcL third, psbA first, psbA second, psbA thirdcodon position, and SSU rDNA. ML was run using GTRmodel with gamma distribution and invariant sites; statisti-cal support was obtained performing BP analyses with 1,000resampling.
The concatenated data set was also analyzed using Bayesianinference (BI). BI was performed with Mr Bayes v. 3.2.2(Huelsenbeck and Ronquist 2001) running four MarkovChain Monte Carlo (MCMC) for 5,000,000 generations andtree sampling was carried out every thousand generations.The stationary distribution of the runs was verified with Tra-cer v.1.5 (Rambaut and Drummond 2007) before stoppingthe program; 1,250 trees were discarded as burn-in, using theremaining trees to build the 50% majority-rule consensustrees.
Finally, SSU, psbA, and rbcL alignments in the concate-nated data set were also used to analyze pair-wise distance.The distance matrix for each marker was built using the dis-tance analysis in Mega version 5 (Tamura et al. 2011).
RESULTS
For the concatenated data set, ML showed thesame topology as BI; BI posterior probabilities weremapped on the ML phylogram (Fig. 7). All nodeswere supported from moderate (55/0.82) to full(100/1). All markers, SSU, rbcL, and psbA, individu-ally and concatenated for both analyses (ML andBI) supported Northern Hemisphere Clathromorp-hum and Leptophytum belonging in a clade (Figs. 6and 7) with support ranging from weak (SSU—BS57%) to moderate (rbcL–BS 89%) to very strong(psbA—BS 97%, combined data set–BS 100%, pp1.0). No analysis supported Leptophytum as a speciesof Phymatolithon; these genera occurred in differentclades (Figs. 6 and 7). Phylograms based on theindividual markers (Fig. 6) were congruent exceptfor the lack of resolution with SSU (BS 50%–61%;Fig. 6) for the clade containing Clathromorphum par-cum (G1, G5, G18, G12), Neopolyporolithon reclinatum(G17, G7, G6), and N. loculosum (PL4, PL3C, PL2B)compared to rbcL (BS 66%–99%) and psbA (BS76%–99%). In all analyses, both Clathromorphum andLeptophytum were polyphyletic (Figs. 6 and 7). Totest the effect of Leptophytum laeve on the polyphylyof Clathromorphum, sequences of L. laeve wereremoved from the analyses (Figs. S1 and S2 in theSupporting Information). No topological changesresulted, only increases or decreases of not largerthan 5 points in BS support in the single marker(Fig. S1) or concatenated (Fig. S2) phylograms, andClathromorphum, Neopolyporolithon I and II, and Calli-lithophytum were maintained as distinct and well sup-ported genera.
At the species rank, SSU did not segregate someclosely related species, for example Lithothamniontophiforme (Esper) Unger and L. lemoinieae W.H. Adeyand Clathromorphum circumscriptum and C. nereostratum
(Fig. 6, SSU), species that were clearly distin-guished by psbA and rbcL (Fig. 6) as well as by mor-pho-anatomy.A monophyletic Clathromorphum was comprised of
the Subarctic, carbonate reef-forming species C. com-pactum, C. circumscriptum, and C. nereostratum. Anavailable name for some species previously includedin Clathromorphum was Neopolyporolithon, herein resur-rected for N. reclinatum, the generitype, and towhich we referred C. loculosum. For C. parcum, weproposed the new genus Callilithophytum. Part of thecollection of Clathromorphum loculosum comprised anundescribed genus. Based on variation in psbA andrbcL sequences, all currently recognized species inthe revised Clathromorphum and Neopolyporolithonlikely contain additional cryptic species.Clathromorphum Foslie 1898: 4 emend. W.H. AdeyPlants encrusting; multifilament hypothallium
sub-parallel to substrate, mostly arching up to formperithallium, some filaments arching downward,dead-ending on substrate; epithallium with abundantplastids and thick, of 3–14 cell layers (largely depen-dent on level of invertebrate grazing); meristemintercalary below epithallium, growth (cell divisionand elongation), and cell wall calcification occur-ring only in meristematic cells in a narrow, often inan un- or weakly calcified horizontal plane (meri-stem split) before formation of transverse cell walls;double mode of calcification, with primary smallprismatic, radial calcite crystals within cell walls plussecondary, large, diagonal, deltoid interfilamentcrystals between filaments in perithallium; in epi-thallium wall interfilament crystals minimum, verti-cal and plate-like; all conceptacle fertile disksdeveloped directly from meristem, sunken at matu-rity; intersporangial filaments initially calcified, dis-solved when sporangia mature; sporangia bearingcolumnar cap walls (i.e., conceptacles multiporate),roof exposed by sloughing-off overlying epithallium;conceptacle cavity calcite, including surroundingand underlying perithallium dissolved by maturingsporangia; roof of spermatangial conceptacles notreformed by lateral growing in of tissue, spermatan-gia produced from columnar cells clothing entireinner wall of conceptacles.Clathromorphum compactum (Kjellman) Foslie
(Novaya Zemlya), 26.vi.1875, leg. F. J. R. Kjellman(Woelkerling 1988: 161).Isolectotypus: The Museum of Evolution Herbarium
Uppsala University (UPS) unnumbered, Mare Glaci-ale: Kostni Shar, Novaja Semlja (Novaya Zemlya),vii.1875, leg. F. J. R. Kjellman.DNA sequences. rbcL 296 was obtained from the lec-
totype specimen and an isolectotype specimen of L.
CLATHROMORPHUM PHYLOGENETIC ANALYSES 193
compactum both of which were an exact match overtheir lengths with a 1,384 bp rbcL sequence of aspecimen from Labrador, Canada (GenBank num-ber KP142774, Specimen US 170929). With thatinformation, we unambiguously identified the Lab-rador specimen as C. compactum and from which weobtained also SSU and psbA sequences. rbcL 1384was obtained from two other specimens identifiedas C. compactum from Newfoundland, Canada andMaine, USA (Table S1: GenBank KP142796, speci-men The University of North Carolina Herbarium(NCU) 601308; GenBank KP142773, specimen US170930) and differed by a minimum of 9 bp (3%)over the same rbcL 296 of the lectotype and isolecto-type, comparable to the divergence observed forlonger length rbcL 1384 and psbA sequences(Table 1). SSU very weakly discriminated these taxa(0.8%, Table 1).
Anatomy. As for genus, except as noted below.Morphology, Reproduction, and Habitat. Crusts thick
to 20 cm, tightly attached and producing a hemi-spherical shape with age. Perithallial filament
branching necessary to gradually expand thallusupwards, thereby producing hemispherical shape,tending to occur together on vertical planes; thesebranching planes appear as shallow grooved ridgeson surface; these surface facets very species distinc-tive when grazing minimal. Asexual conceptacledevelopment beginning in early autumn, maturingin early winter in south of range (at high growthrates) and in late spring to summer at northern endof range, with weak tendency to occur in patchesand rarely close to crust margins. Conceptacles bur-ied after maturity, and commonly, when not exten-sively grazed by sea urchins, producing distinctyearly bands; currently samples known up to1200 years of age. Gametangial conceptacles notfound. Subtidal on bedrock, boulders, or cobble,and less commonly on pebbles and shell, withstrong tendency to midphotic depths (typically 5–20 m, depending upon turbidity); less abundant atlocalities with lower salinities (≤25 ppt) and/or withmore silt. Reaching peak abundance at summerwater temperatures ≤6–8°C; and requiring winter
FIG. 6. ML phylogenetic reconstructions from SSU, psbA, and rbcL, individually, showing evolutionary relationships of Clathromorphumspecies with northern species of Hapalidiaceae. Bootstrap values shown on branches; *full support (100%). Species names with ID codeand data included in Table S1. Sequences with label EXX (e.g., E43) are published in Hernandez-Kantun et al. (2014).
194 WALTER H. ADEY ET AL.
temperatures ≤ ~1°C, achieving maximum abun-dance, where winter sea ice present.
Distribution. Based on its distinctive morphology,C. compactum is reported to occur subtidally fromnortheastern Hokkaido, Japan through the Arctic tothe central Gulf of Maine in the western Atlantic(Adey et al. 2008); not reliably known from Icelandor Norway. Based on limited sequencing, known atNovaya Zemlya, Russia (lectotype and isolectotypespecimens) and in Labrador, Canada.
Comments. rbcL 296 from the lectotype of L. com-pactum was generated in a separate lab from the onefield-collected sequence that it matched, so thissequence could not have resulted from contamina-
tion from more recently collected material. Basedon the rbcL and psbA sequence divergences, two spe-cies likely are passing under the name C. compactum,but we now know which specimens match the lecto-type. In the future, many of the Subarctic field-col-lected specimens at United States (US) and otherherbaria need to be sequenced to determine whichspecimens are C. compactum and which may repre-sent a cryptic species and the extent of populationvariation. These sequenced specimens can then beexamined for morpho-anatomical characters thatmay distinguish the species. All of the heterotypicsynonyms of C. compactum cited in AlgaeBase (Guiryand Guiry 2014) also need to be sequenced todetermine which entity they match and to possiblyprovide names for the potential cryptic species.Clathromorphum circumscriptum (Str€omfelt) Foslie
1886: 20, pl. 1, figs. 4–8. Seven microscope slidesfrom the original specimen in S.Epitypus: US 170939 (66-24-1A W.H. Adey collec-
tion no.), Holmonas, Reydharfjord, Iceland,29.vii.1966, leg. W.H. Adey.DNA sequences. rbcL 296 was generated for the
herein designated epitype specimen from near oneof the syntype localities. This sequence was identicalover its length to sequences from three other speci-mens, two from Maine, USA (GenBank KP142795,specimen NCU 601330; GenBank KP142776, speci-men US 170928) and one from Labrador, Canada(GenBank KP142775, specimen US 169083), anddiffered by 7 bp (0.6% sequence divergence) froma sequence from a Newfoundland, Canada specimen(GenBank KP142778, specimen US 169302) identi-fied as C. circumscriptum (Table S1 and Table 1).psbA sequences from the Maine and Labrador speci-mens were identical to each other.Anatomy. As for genus.Morphology, Reproduction and Habitat. Crusts moder-
ately thick, 0.5–1 cm, exceptionally to 8 cm; smoothwhen young, but becoming highly irregular at themm scale. Asexual conceptacles occurring in large,central patches, formed in early autumn, reachingmaturity in winter and spring and almost alwaysbreaking out as extended “sori” following sporerelease. Conceptacle break-out initially produces
FIG. 7. ML phylogenetic reconstruction from three-gene analy-sis (SSU, psbA, and rbcL) showing evolutionary relationships ofClathromorphum species with northern species of Hapalidiaceae.Bootstrap values shown on branches with ML values followed byposterior probabilities from Bayesian analysis (e.g., 100/0.98);*full support for both analyses (100/1). Numbers after names arespecimen codes in Table S1. Sequences with label EXX (e.g.,E43) are published in Hernandez-Kantun et al. (2014). Out-groups are taxa of Sporolithales (Sporolithon and Heydrichia).
TABLE 1. Pair-wise distance of partial SSU, psbA, and rbcLsequences comparing each of the species studied in thegenus Chlathromorphum (Figs. 6 and 7).
SSU psbA rbcL
C. compactum 5 vs. 10 0.8 3.4 3.6C. compactum 5 vs. C. circumscriptum 3 0.8 2.4 3.9C. compactum 5 vs. C. nereostratum 43 0.8 2.7 4.5C. compactum 5 vs. C. circumscriptum 4 0.8 3.1 3.7C. circumscriptum 3 vs. C. nereostratum 43 0 1 1.8C. nereostratum 43 vs. C. circumscriptum 4 0 0.7 1.6C. circumscriptum 3 vs. C. circumscriptum 4 0 1.5 0.6C. circumscriptum 4 vs. C. circumscriptum 7 0 0 0
CLATHROMORPHUM PHYLOGENETIC ANALYSES 195
clathrate surface, and although usually growing induring the following summer, yearly repetition,especially with grazing by invertebrates, producesvery irregular crusts. Gametangial conceptaclesknown, and described, but rare. Growing on rock,pebbles and shell in mid-to-low intertidal pools andin shallow subtidal, typically ≤10 m depth. Requireswinter temperatures ≤2°C; limited by summer tem-peratures of ~16°C.
Distribution. Based on its highly distinctive mor-phology and ecology, C. circumscriptum is the mostwidely distributed species of the genus, rangingfrom Hokkaido, Japan and British Columbia, Can-ada (Adey et al. 1976, Lebednik, 1977) in the NorthPacific through the Arctic to the southern Gulf ofMaine in the western Atlantic; in Iceland and in theNorwegian fjords south to Trondheimsfjord (Adey1965, 1971) in the eastern Atlantic. Based on mate-rial that we have sequenced, this species is con-firmed from Iceland and in the northwest Atlanticfrom Labrador to the Gulf of Maine.
Comments. According to the curator at S (SwedishMuseum of Natural History, M. Hamnede), the onlytype material of L. circumscriptum comprises sevenmicroscope slides. In accordance with Article 9.8(McNeill et al. 2012), we herein designate US170939 (66-24-1A W.H. Adey collection no.) fromone of the syntype localities of L. circumscriptum toserve as the epitype for the seven microscope slidesthat is the type material of L. circumscriptum. Epitypeis a thin, mostly smooth crust from a rock ledge inshallow water with scattered evidence of clathrate,conceptacle break-out from the previous winter. Par-tial rbcL sequences from the Aleutian Islands speci-mens identified as C. circumscriptum are more similarto the Newfoundland specimen (US 169302) thanto the Labrador and Maine specimens, but manymore specimens need to be sequenced to know thepopulation variation and if cryptic species or popu-lations need to be recognized.
Holtypus: WTU 258721 (AM-C-60, 12-70-12, 17C),Constantine Harbor, Amchitka I., Alaska, USA,12.xii.1970, 20 m depth on ledge, leg. P. A. Lebed-nik.
Isotypus: UBC A54073 (AM-C-60, 12-70-12, 16B),Constantine Harbor, Amchitka I., Alaska, USA,12.xii.1970, 20 m depth on ledge, leg. P. A. Lebed-nik.
DNA sequences. rbcL 135 was generated for an iso-type specimen (UBC A54073), and this sequencewas identical over its length to one other specimen(GenBank KP142777, specimen US 170931),differed from an additional three specimens by1 bp (GenBank number KP142801, specimen NCU627110; GenBank KP142797, specimen NCU627718; GenBank number KP142800, specimenNCU 627106) and from two others by 2 bp (Gen-Bank KP142798, specimen NCU 597128; GenBank
KP142799, specimen NCU 627108) all from theAleutian Islands, Alaska, USA (Table S1). Theseseven specimens for which we have rbcL 1384showed an 8–11 bp variation (0.6%–0.8%); psbAsequences from these same seven specimens dif-fered from each other by 2–4 bp.Anatomy. As for genus.Morphology, Reproduction, and Habitat. Our observa-
tions agree with those of Lebednik (1977). Crustsnow known to 30 cm thick, with measured yearlyvertical growth averaging ~360 lm. Samples cur-rently known up to ~850 years of age. Abundantasexual conceptacles produced in fall and winter;rarely gametangial conceptacles produced insummer.Distribution. Central and western Aleutian Islands
(Lebednik 1977), Commander Islands (Selivanovaand Zhigadlova 1997) and also reported from theRussian coast, from the Okhotsk Sea northwards(Klochkova et al. 2009). Confirmed by DNAsequencing from Bering Island (CommanderIslands) and from the central and western AleutianIslands (Table S1).Comments. Additional sequencing of specimens
from throughout the North Pacific is needed todetermine if the variation we have observed is indic-ative of population or species level differences.Leptophytum W. H. Adey 1966a: 323Nongeniculate, thin, crust strongly adhering to
pebbles and shells, growing with entire thallusattached; thallus surface initially smooth, except forraised conceptacles; multifilament hypothallium sub-parallel to substrate, mostly arching up to form peri-thallium, some filaments arching downward, dead-ending on substrate; epithallium absent or of veryfew (1–3), thin-walled, nonphotosynthetic layers;meristem small-celled, intercalary below epithallium;elongation of perithallial cells gradual during burial;double mode of calcification absent; asexual con-ceptacles multiporate; mature spermatangial systemssimple, composed of lunate spermatangial mothercells on the floor; spermatangial mother cells cut-ting off up to 5 spermatangia; dendroid spermatan-gial mother cells rare; cystocarpic (uniporate)conceptacles conical; carposporangia producedperipherally around central fertile zone thatremains more or less flat; older conceptacles notbecoming buried in thallus, but thalli may overgrowone another resulting in conceptacles appearing tobe buried.There has been some dispute over the nomencla-
tural validity of this genus. The matter has beenpresented in detail by Adey et al (2001) and Athanasi-adis and Adey (2003).Leptophytum laeve W. H. Adey 1966a: 324.Holotypus: In S (unnumbered); a single slide
annotated ‘Lithophyl. laeve n. sp. Sporangia Eyrp"asten I fjare 4/9 83 G. Str€omfelt.DNA sequences. The holotype is a slide from which
DNA cannot be obtained. All three markers are
196 WALTER H. ADEY ET AL.
congruent in recognizing Leptophytum, based on L.laeve as a distinct genus (see below under Comments).
Anatomy. As for genus.Morphology and Habitat. Leptophytum leave is a deep
water (typically ≥15 m) Subarctic species thatextends to Boreal waters. Most typically it occurs onpebbles and shells, especially in areas of strong cur-rents or waves where the substrate is coarse andkept in motion (Adey 1970b). It is restricted to sum-mer temperatures ≤14°C and winter temperatures≤6°C (Adey and Sperapani 1971).
Distribution. Leptophytum laeve occurs throughoutthe Arctic and Subarctic reaching into the NorthAtlantic and North Pacific. It occurs south to CapeCod in the western Atlantic and south to the north-ern British Isles in the eastern Atlantic; it extendssouth to northern Hokkaido in the western PacificAdey et al. 1976), but its southerly extent in theeastern Pacific needs to be corroborated (Athanasia-dis and Adey 2006).
Comments. There are two problems with Leptophy-tum, the genus created by Adey (1966a). The first isthat the basionym of the generitype species, L. laeve,is Lithophyllum laeve Str€omfelt 1886, a later hom-onym of L. laeve K€utzing 1847, and therefore anillegitimate name. A solution to this problem wasrecommended by the late, eminent, nomenclatural-ist, Dr. Paul C. Silva, who proposed that L. laeve betreated as a new name (D€uwel and Wegeberg 1996:473, cited as P. C. Silva personal communication), asolution that Guiry and Guiry (2014) and we haveadopted. The type of the species and genus remainsStr€omfelt’s type material of L. laeve, which brings usto the second problem. The holotype is representedby only a single microscope slide that some considerunambiguously to be L. laeve (Adey et al. 2001),whereas others (D€uwel and Wegeberg 1996,Woelkerling et al. 2002) believe that it is “. . .demon-strably ambiguous and cannot be critically identifiedfor purposes of the precise application of the nameto a taxon” (McNeill et al. 2012, Article 9.8). Thus,D€uwel and Wegeberg (1996) proposed an epitypebased on material collected from the type locality(topotype material) that upon examination theybelieved to represent Phymatolithon lenormandii(Areschoug) W.H. Adey, making Leptophytum a syno-nym of Phymatolithon. We are convinced thatStr€omfelt’s holotype microscope slide is L. laevebased on the nonoverlapping pore plate diametersof asexual conceptacles and on the nonoverlappingsporangial lengths, both 1.5–2 times larger in L. la-eve compared to P. lenormandii, and distinct from allother Subarctic nongeniculate corallines. That bothAdey (1968) and D€uwel and Wegeberg (1996) wereunable to find material at the type locality and thatL. laeve does not occur intertidally, whereStr€omfelt’s material was said to have been collected,indicates that perhaps the locality of the collectionmay be incorrect. It also is possible that the typematerial was cast ashore and into a tide pool during
the heavy storms that frequent the south coast ofIceland. Finally, DNA sequences, using three mark-ers from three specimens that were identified byAdey as L. laeve belong to a genus distinct fromboth Phymatolithon and Clathromorphum (Fig. 7). Weconsider the rbcL and psbA sequences from thesethree specimens (US 169242, US 170538 and US170934; Table S1) identified by Adey, the author ofthe genus, to be diagnostic for L. laeve, analogous toa “Representative DNA Barcode” (Clarkston andSaunders 2013).Anatomically, Leptophytum is anomalous with
respect all other genera in this clade, lacking the well-developed photosynthetic epithallium of the epilithicspecies of Clathromorphum and some Neopolyporolithonand the large-celled meristem characteristic of theaforementioned genera plus Callilithophytum. It alsoshows strong progressive cell elongation in the upperperithallium unlike any of the other related generain this study examined to date. Reproductively, themale spermatangia of L. laeve are simple, releasing afew lunate spermatia, and are unlike the highly den-dritic spermatangial branches of Phymatolithon. How-ever, L. laeve lacks the palisade spermatangia presentin the other related genera. L. laeve forms thin crusts,is abundant only in deeper water (Adey 1966a,b), andtends to develop primarily on mobile shell fragmentsand pebbles (Adey 1970b). This habitat is in strongcontrast to the Clathromorphum species that grow pri-marily on bedrock and large boulders (Adey 1965,1966a,b, 1970b) at middepths. The competitive strat-egy for success on this abundant mobile and unstablebottom type, with few active grazers, would appear tobe rapid lateral growth and reproduction.All other species assigned to Leptophytum need to
be sequenced to determine that they indeed arecorrectly classified. Already, we have shown that theSubarctic and Boreal species L. foecundum (Kjell-man) W.H. Adey does not belong in Leptophytum(Figs. 6 and 7).Neopolyporolithon W.H. Adey & W.H. Johansen
1972: 160.Thalli encrusting or epiphytic; multifilament
hypothallium of ascending and descending filaments,parallel to substrate; strong tendency to be “leafy” inhabit; epithallium 1–7 cells, minimally photosyn-thetic; meristem photosynthetic; meristem intercalarybelow epithallium; growth (cell division and elonga-tion) and calcification occurring only in meriste-matic cells before formation of transverse cell walls,but not in a strongly defined band (no meristemsplit); double mode of calcification absent; allconceptacle primordia developed directly fromintercalary meristem, sunken at maturity; sporangiabearing columnar cap walls (i.e., conceptacles multi-porate, roof exposed by sloughing-off overlyingepithallium; conceptacle cavity calcite, includingsurrounding and underlying perithallium dissolvedby maturing sporangia; roof of spermatangialconceptacles not reformed by lateral growing in of
CLATHROMORPHUM PHYLOGENETIC ANALYSES 197
tissue, spermatangia produced from columnar cellsclothing entire inner wall of conceptacles.
Comments. Neopolyporolithon was erected by Adeyand Johansen (1972) for the single species, N. reclin-atum that they removed from Polyporolithon L.R.Mason (1953), a genus Mason had erected for whatshe called “hemiparasites”, noting the presence of afoot that penetrates host tissue. The diagnostic fea-tures of Neopolyporolithon were the location of plast-ids primarily in meristem cells and an epithalliumof generally two or three cell layers. Lebednik(1977) concluded that the characters used by Adeyand Johansen (1972) were not sufficiently importantto recognize a genus, and he transferred N. reclina-tum to Clathromorphum. The DNA sequence data,however, supports recognition of Neopolyporolithon,but with an emended suite of diagnostic features.
1970: 28.Holotypus: TRH B17-2590, “Botany Beach”, Port
Renfrew, Vancouver Island, British Columbia, Can-ada, vii.1901, leg. K. Yendo.
DNA sequences. rbcL 296 (GenBank KP142803) wasobtained from the holotype specimen (TRH B17-2590) of L. reclinatum, and it was identical over itslength to sequences from seven other epiphytes onNE Pacific geniculate corallines (Table S1). Fromfour of these same specimens, psbA sequences alsowere identical to each other and from three of thesefour specimens their SSU sequences also were iden-tical to each other (Table S1).
Anatomy. Epithallium consists of only 1–3 cells,only the lowermost cell and meristem is photosyn-thetic; also meristem cells are larger (longer andwider) than in related N. loculosum. N. reclinatum isclearly reduced in its epiphytic habit.
Morphology and Habitat. As described by Adey andJohansen (1972) and by Lebednik (1977), but seeComments below.
Distribution: Reported from the North PacificOcean (Japan and California, USA north to south-ern British Columbia, Canada), but DNA sequencedata only confirms this species from northern Wash-ington, USA and from throughout British Colum-bia, Canada.
Comments. All of our confirmed specimens of N.reclinatum are epiphytic on Bossiella or Corallina spe-cies in the NE Pacific, and it is possible that thisspecies occurs only on geniculate coralline algae.On the basis of DNA sequence data, we are awareof at least two other species passing under thisname in the NE Pacific, also epiphytic on geniculate
corallines or on fleshy red algae, but we need addi-tional data to be able to characterize these species.Voucher specimens for all other records of N. reclin-atum need to be sequenced to determine their iden-tity and to establish the distribution of this andother Neopolyporolithon epiphytic species. GenBanksequences under the collection number GWS008332(as Clathromorphum reclinatum) all are N. reclinatum.Neopolyporolithon loculosum (Kjellman) W.H. Adey,
Kongl. Svenska Vetenskaps-Akademiens Handlingar 23:21-22, pl. I, figs. 1 and 2.Homotypic Synonym:Clathromorphum loculosum (Kjellman) Foslie 1898:
8.Lectotypus: TRH C21-3520, Bering Island, 15-19.
viii.1879, leg. F. R. Kjellman, designated by Lebed-nik (1977).Isolectotypus: UPS, Bering Island, 15-19.viii.1879,
leg. F. R. Kjellman.DNA sequences. rbcL 296 from an isolectotype speci-
men of Lithothamnion loculosum from Bering Island(UPS) was an exact match over its sequence length(except for 10 bp ambiguities) with four specimensin UBC collected from Amchitka Island by Lebednikthat also were identical to each other over compara-ble sequence lengths. psbA sequences were gener-ated for these four and one additional specimen,and all of these sequences were identical to eachother. From one of these specimens, an SSUsequence also was obtained. No marker supportedC. loculosum as a species of Clathromorphum (Fig. 6).Both rbcL and psbA strongly support C. loculosum asa species of Neopolyporolithon and sister to the genusCallilithophytum (Fig. 6) as does the concatenateddata set (Fig. 7). Two other specimens (GenBankKP142737 psbA, specimen AM-C-20; GenBankKP142780 rbcL/KP142738 psbA, specimen AM-IP-I;Table S1) morphologically similar to N. loculosumare treated below under Neopolyporolithon II and werestrongly supported in psbA and rbcL as sister to theCallilithophytum/Neopolyporolithon clade (Fig. 6). SSUsequences, in contrast, placed these two specimensand real C. loculosum as sister to Neopolyporolithonwith strong support, with Callilithophytum sister tothis clade (Fig. 6). SSU only provides moderate sup-port that real C. loculosum is sister to these otherspecimens.Anatomy. Epithallium well-developed; otherwise as
for genus (see Lebednik 1977).Morphology and Habitat. Expansive, free-living
“leafy” crusts to 2 cm thick.Distribution. Lebednik (1977) reports this species
from southern SE Alaska (Baranof Island), Cold Bayon the Alaska Peninsula, St. Lawrence I., the wes-tern Aleutian Islands, the Commander Islands, Kuri-le Islands and north to Konyam Bay, southwest ofthe Bering Strait. We have confirmed the distribu-
198 WALTER H. ADEY ET AL.
tion by DNA sequencing only from Bering Island(Commander Islands) and Amchitka Island (westernAleutians).
Comments. Even with the ambiguities in the iso-lectotype sequence of L. loculosum, it is clearwhich specimens belong to this species and whichdo not. On the basis of the strong support fromboth rbcL and psbA, we transfer C. loculosum toNeopolyporolithon. This placement also is supportedby the sequence divergence values (Table 2),which for N. loculosum and N. reclinatum are com-parable to sequence divergence values amongClathromorphum species (Table 1). Lebednik (1976)demonstrated that the perithallial growth wasentirely located in the meristem, but we couldfind no evidence of either a meristem split or ofsecondary interfilament crystals in this species,both characters that define Clathromrophum. Neo-polyporolithon loculosum typically has a “leafy” habit,allowing crusts the ability to bridge gaps or unfa-vorable portions of substrate. Extra calcification,coupled with a higher density, as provided by thesecondary interfilament crystals of Clathromorphumspecies would likely be disadvantageous to this habit.N. reclinatum is clearly reduced and specialized for itsepiphytic habit, as we described above. As we havesequenced only two specimens (AM-C-20 and AM-IP-I, Table S1) that clearly are not C. loculosum, we awaitadditional material before making any further taxo-nomic proposals (see Neopolyporolithon II below).
Etymology: Calli = beautiful also refers to thegeniculate coralline host genus, Calliarthron; litho =rock and phytum = plant.
Diagnosis: Plants nongeniculate, encrusting, obli-gate epiphytes on Calliarthron; epithallial cells termi-nate all filaments, dorsal, ventral, and lateral exceptthose contacting host which are adapted to form a“foot”; primary hypothallium weakly developed orlacking; secondary hypothallium gradually becomingstrongly developed with up- and down-turning peri-thallium; perithallium extensive; asexual concepta-cles multiporate; gametangial conceptaclesuniporate.
Type species: Callilithophytum parcum (Setchell &Foslie) P.W. Gabrielson, W.H. Adey, G.P. Johnson &J.J. Hern#andez-Kantun gen. et comb. nov.
Basionym: Lithothamnion parcum Setchell & Fosliein Foslie 1907, Det Kong. Norske Vidensk. Selsk. Skr.1907: 14–15.
Adey 1970c: 27.Holotypus: TRH B17-2582, Monterey, California,
USA, 10.i.1899, leg. Setchell & Gibbs. [Note: Lebed-nik (1977) cited UC 745690 as an isotype, but it wasnot collected on the same date as the holotype,
rather 2 d earlier, and was not cited in the proto-logue. See also Woelkerling et al. (2005: 346).]DNA sequences. rbcL 296 from the holotype
(GenBank KP142793, specimen TRH B17-2582) ofL. parcum was identical to rbcL sequences from fivefield-collected specimens, all epiphytes on Calliar-thron tuberculosum (Postels & Ruprecht) E.Y. Dawson(Table S1). The host specimen of the holotype alsowas sequenced and was C. tuberculosum (Table S1).Anatomy, Morphology, and Habitat. As described by
Adey and Johansen (1972) and by Lebednik (1977),both as C. parcum.Distribution. Haida Gwaii, British Columbia Can-
ada south to San Luis Obispo Co., CA, USA, northof Point Conception.Comments. This is one of the most distinctive and
easily identified nongeniculate corallines in the NEPacific, due to its being an obligate epiphyte on C.tuberculosum and its thick, flat-topped and frequentlysomewhat concave thallus. It can only be confusedwith the thin, convex Mesophyllum conchatum (Setc-hell & Foslie) W.H. Adey, also epiphytic on C. tuber-culosum and said to occur on other geniculatecorallines, although this needs to be confirmed byDNA sequencing. Unfortunately in Abbott and Holl-enburg (1976), the habit illustrations of these twotaxa were switched; fig. 333 is C. parcum and fig. 335is M. conchatum.Neopolyporolithon II. While sequencing specimens
thought to belong in C. loculosum, we found twospecimens (GenBank KP142737 psbA, specimen AM-C-20; GenBank KP142780 rbcL/KP142738 psbA, spec-imen AM-IP-I; Table S1) from Amchitka Island,Alaska, USA whose DNA sequences from all threemarkers clearly were not C. loculosum, but that didfall within the Clathromorphum complex of genera(Figs. 6 and 7). These taxa were strongly supportedin psbA and rbcL (Fig. 6), and in the concatenated
TABLE 2. Pair-wise distance of partial SSU, psbA, and rbcLsequences comparing each of the groups observed in theChlathromorphum complex (Figs. 6 and 7).
SSU psbA rbcL
Clathromorphum spp.vs. Leptophytum laeve
1.6–2.3 6.8–8 12.4–13
Clathromorphum spp.vs. Neopolyporolithon II
2.0–2.9 8.2–8.8 10.7–11.3
Clathromorphum spp.vs. Callilithophytum parcum
2.3–3.1 7.7–7.9 12.1–12.8
Clathromorphum spp.vs. N. loculosum
1.9–2.5 7.3–8.1 11.9–12.7
Clathromorphum spp.vs. N. reclinatum
2.4–2.9 7.8–8.6 12.7–13
Leptophytum leavevs. Neopolyporolithon II
1.8–2.1 6.9–7.3 14.5
Neopolyporolithon IIvs. N. reclinatum
2.0–2.2 5.6–5.7 8.4
Callilithophytum parcumvs. N. reclinatum
2.6 4.8 8.4
Neopolyporolithon loculosumvs. N. reclinatum
1.7 1.3 3–3.4
CLATHROMORPHUM PHYLOGENETIC ANALYSES 199
data set (Fig. 7) as sister to the Callilithophytum/Neo-polyporolithon clade. SSU, in contrast, placed thesetwo specimens as sister to Neopolyporolithon and withCallilithophytum sister to this clade (Fig. 6), but withno real support (Fig. 6). Sequence divergence val-ues between these specimens and other genera inthis complex indicate that they should be recog-nized at the generic rank (Table 2). Both of thesespecimens have a strongly layered perithallus, incontrast to all N. loculosum specimens examined. Weare awaiting additional material to be able to fullycharacterize this undescribed genus.
DISCUSSION
In all analyses and for all markers, individuallyand concatenated, Clathromorphum, as currently con-stituted, was clearly polyphyletic as was Leptophytum(Figs. 6 and 7). Intergeneric sequence divergencevalues (Table 2) that have been used by numerousworkers to assess phylogenetic relationships amongSporolithales and/or Corallinales (e.g., Bailey andChapman 1998, Bittner et al. 2011, Gabrielson et al.2011, Kato et al. 2011, Hind and Saunders 2013)also indicate that several distinct genera are passingunder Clathromorphum.
Each of these genera that we propose to recog-nize, Clathromorphum, Neopolyporolithon, Leptophytum,and Callilithophytum, is segregated not only by
DNA sequence data but also by a suite of vegeta-tive developmental features, including patterns ofcell wall calcification (Fig. 8), as well as by ecolog-ical and distribution data (Adey et al. 2013).Unique to Clathromorphum, and evolutionarilyadapted to its slow growing, grazer rich, Subarctic,carbonate reef-forming ecology, are its multilay-ered, photosynthetic epithallium and its doublemode of calcification enabling the formation ofmassive carbonate structures with multiyear longev-ity. Nowhere else in Corallinales do we see thiscombination of characters, although a comparisonwith Subantarctic taxa that occupy similar habitatsis needed. The Subarctic species, C. compactum, C.circumscriptum, and C. nereostatum, range only mar-ginally southwards into Boreal waters (Adey et al.2013).Neopolyporolithon, like Clathromorphum, has a large-
celled intercalary meristem, and all cell division andelongation is restricted to that cell layer. Unlike inClathromorphum, the extent of the growth and calcifi-cation band appears to include much of the lengthof meristem lateral cell wall; no meristem split ispresent. While Neopolyporolithon has a multilayeredepithallium, it contains many fewer plastids, thelarge-celled, intercalary, meristem layer being theprimary photosynthetic tissue. Neopolyporolithon spe-cies are epiphytic or epilithic, but when epilithic,they are thin and do not form massive carbonate
FIG. 8. Anatomical and reproductive character graphic based on three-gene tree of Figure 7. See text for discussion. degrade. epith.,degraded epithallium; ar. epith., armored epithallium; prog. growth, progressive growth; inter. calc., interfilament calcification; synch.peri., synchronized (layered) perithallium.
200 WALTER H. ADEY ET AL.
structures; most are Boreal taxa. Sequencing ofmany more specimens assigned to both species inthis genus is needed, as significant DNA sequencevariation has been observed indicating that nearlyall of these species may contain additional crypticspecies.
The monotypic Callilithophytum shares with Clathro-morphum and Neopolyporolithon, a large-celled interca-lary meristem; like Clathromorphum, the epithalliumis the primary photosynthetic tissue. Unique to thisgenus among all Corallinales and Sporolithales isthat epithallial cells terminate all filaments, dorsal,ventral, and lateral except those contacting host,which are adapted to form a “foot”. Callilithophytumparcum is an obligate epiphyte, that based on oursequencing observations is restricted to the genicu-late coralline, Calliarthron tuberculosum, even thoughits sister species Calliarthron cheilosporiodes Manzashares some of the same distribution range and hab-itats (Gabrielson et al. 2011). This is a Boreal genusthat like its host is endemic to the NE Pacific.
Leptophytum, based on the generitype, L. laeve, isdistinct from all the above genera in having a small-celled, nonphotosynthetic meristem and cell elonga-tion that continues deeply into the perithallium. Itshabitat is also very different from all the above taxaoccurring primarily on small, mobile, substratum,pebbles, and shell fragments in the deeper subtidal.The genus also is polyphyletic with L. foecundum(Kjellman) W. H. Adey, being more closely relatedto Mesophyllum than to Leptophytum in all of ouranalyses. Numerous species in the Boreal NE Pacificare assigned to Leptophytum based on morpho-anat-omy (Athanasiadis and Adey 2006, Athanasiadis2007. Whether these and other Subarctic speciescurrently assigned to Leptophytum based on morpho-anatomy belong to the genus needs to be reassessedwith DNA sequence data.
Comparing the three markers used in our analy-ses, SSU did not segregate some closely related spe-cies, for example Clathromorphum circumscriptumfrom C. nereostratum and Lithothamnion tophiformefrom L. lemoinieae, species that were clearly distin-guished by psbA and rbcL as well as by morpho-anat-omy (Figs. 6 and 8; Table 1). Gabrielson et al.(2011) previously noted that SSU was a poor dis-criminator of the related geniculate genera BossiellaP.C. Silva, Calliarthron Manza, and Johansenia K.R.Hind & G.W. Saunders, genera clearly segregated byrbcL, psbA, and morpho-anatomical characters (Hindand Saunders 2013). Thus, SSU may not be a goodmarker to use when assessing species relationshipsfor both geniculate and nongeniculate corallines.
We are very grateful to the curators at S (Ms. MarianneHamnede), TRH (Dr. Kristian Hassel), UBC (Dr. SandraLindstrom), UC (the late Dr. Paul C. Silva), and UPS (Dr.Stefan Ekman) for the loan of type material critical to thisstudy; equally grateful to the following for collecting speci-mens: J. Estes, S. M. E. Gabrielson, A. Galloway, J. Halfar, S.
C. Lindstrom, K. A. Miller, K. M. Miklasz, P. T. Martone, R. S.Steneck, and T. Suskiewicz. A portion of this study was donewhile PWG was a visiting professor at the Friday Harbor Labo-ratories, University of Washington. PWG also thanks Dr. ToddVision (University of North Carolina, Chapel Hill) for the useof lab space and equipment. This research was funded in partby a family trust to P. W. G. and by Ecological Systems Tech-nology, The Natural Science and Engineering ResearchCouncil of Canada, and the Botany Department of the Smith-sonian’s National Museum of Natural History to W. H. A. J.H.-K. is grateful to the Smithsonian Institution for a postdoc-toral fellowship.
Abbott, I. A. & Hollenburg, G. J. 1976. Seaweeds of California. Stan-ford University Press, Stanford, California, 827 pp.
Adey, W. 1964. The genus Phymatolithon in the Gulf of Maine.Hydrobiologia 24:377–420.
Adey, W. 1965. The genus Clathromorphum in the Gulf of Maine.Hydrobiologia 26:539–73.
Adey, W. 1966a. The genera Lithothmanion, Leptophytum (nov.gen.) and Phymatolithon in the Gulf of Maine. Hydrobiologia28:321–70.
Adey, W. 1966b. Distribution of saxicolous crustose corallines inthe northwestern North Atlantic. J. Phycol. 2:49–54.
Adey, W. 1968. The distribution of crustose corallines on the Ice-landic Coast. Scientia Islandica 1:16–25.
Adey, W. 1970a. The crustose corallines of the northwesternNorth Atlantic, including Lithothamnium lemoinii nov. sp. J.Phycol. 6:225–9.
Adey, W. 1970b. Some relationships between crustose corallinesand their substrate. Soc. Sciencia Islandica 2:21–5.
Adey, W. H. 1970c. A revision of the Foslie crustose coralline her-barium. Det Kong. Norske Vidensk. Selsk. Skr. 1:1–46.
Adey, W. 1971. The sublittoral distribution of crustose corallineson the Norwegian coast. Sarsia 46:41–58.
Adey, W. 1973. Temperature control of reproduction and produc-tivity in a subarctic coralline alga. Phycologia 12:111–118.
Adey, W. & Adey, P. 1973. Studies on the biosystematics and ecol-ogy of the epilithic crustose Corallinacea of the British Isles.Br. Phycol. J. 8:343–407.
Adey, W., Athanasiadis, A. & Lebednik, P. 2001. Re-instatement ofLeptophytum and its type Leptophytum leave: taxonomy and bio-geography of the genera Leptophytum and Phymatolithon (Co-rallinales, Rhodophyta). Eur. J. Phycol. 36:191–203.
Adey, W., Chamberlain, Y. & Irvine, L. 2005. Morphology, repro-duction and ecology of Lithothamnion tophiforme Unger (Co-rallinales, Rhodophyta), an Arctic coralline. J. Phycol.41:1010–24.
Adey, W., Halfar, J. & Williams, B. 2013. Biological, physiologicaland ecological factors controlling high magnesium carbonateformation and a precision Arctic/Subarctic marine climatearchive: the coralline genus Clathromorphum Foslie emendAdey. Smithsonian Contr. Mar. Sci. 40:1–41.
Adey, W. & Hayek, L. A. 2011. Elucidating marine biogeographywith macrophytes: quantitative analysis of the North Atlanticsupports the thermogeographic model and demonstrates adistinct Subarctic region in the northwestern Atlantic. North-eastern Nat. 18:1–125.
Adey, W. & Johansen, H. W. 1972. Morphology and taxonomyof Corallinaceae with special reference to Clathromorphum,Mesophyllum and Neopolyporolithon gen. nov. Phycologia11:159–80.
Adey, W., Lindstrom, S., Hommersand, M. & Muller, K. 2008.The biogeographic origin of Arctic endemic seaweeds: athermogeographic view. J. Phycol. 44:1384–94.
Adey, W., Masaki, T. & Akioka, H. 1976. The distribution of crus-tose corallines in eastern Hokkaido and the biogeographicrelationships of the flora. Bull. Fac. Fisheries Hokkaido Univ.4:303–13.
Adey, W. & McKibbin, D. 1970. Studies of the maerl species ofthe Ria de Vigo. Bot. Mar. 8:100–6.
CLATHROMORPHUM PHYLOGENETIC ANALYSES 201
Adey, W. & Sperapani, C. 1971. The biology of Kvaleya epilaeve, anew parasitic genus and species of Corallinaceae. Phycologia10:29–42.
Adey, W. & Steneck, R. 2001. Thermogeography over time createsbiogeographic regions: a temperature/space/time–integratedmodel and an abundance-weighted test for benthic marinealgae. J. Phycol. 37:677–98.
Adey, W., Townsend, R. & Boykins, W. 1982. The crustose coral-line algae (Rhodophyta: Corallinaceae) of the HawaiianIslands. Smithsonian Contr. Mar. Sci. 15:1–74.
Athanasiadis, A. & Adey, W. 2003. Proposal to conserve the nameLithophyllum leave Str€omfelt against L. leave K€utzing (Coralli-nales, Rhodophyta) with a conserved type. Taxon 52:342–50.
Athanasiadis, A. & Adey, W. 2006. The genus Leptophytum Adey(Melobesioideae, Corallinales) on the northern Pacific coastof North America. Phycologia 45:71–115.
Bahia, R., Amado-Filho, G., Maneveldt, G., Adey, W., Johnson, G.,Marins, B. & Longo, L. 2013. Sporolithon tenue sp. nov.(Sporolithales, Corallinophycidae, Rhodophyta): a new rho-dolith-forming species from the tropical southwestern Atlan-tic. Phycological Res. 62:44–54.
Bailey, J. C. & Chapman, R. L. 1998. A phylogenetic study of theCorallinales (Rhodophyta) based on nuclear small-subunitrRNA gene sequences. J. Phycol. 34:692–705.
Bittner, L., Payri, C., Mandeveldt, G., Couloux, A., Cruaud, C.,Reviers, B. & Le Gall, L. 2011. Evolutionary history of theCorallinales (Corallinophycidae, Rhodophyta) inferred fromnuclear, plastidial and mitochondrial genomes. Mol. Phyloge-net. Evol. 61:697–713.
Broom, J., Hart, D., Farr, T., Nelson, W., Neill, K., Harvey, A. &Woelkerling, W. 2008. Utility of psbA and nSSU for phyloge-netic reconstruction in the Corallinales based on New Zea-land taxa. Mol. Phylogenet. Evol. 46:958–73.
Clarkston, B. E. & Saunders, G. W. 2013. Resolving species diver-sity in the red algal genus Callophyllis (Kallymeniaceae, Gig-artinales) in Canada using molecular assisted alphataxonomy. Eur. J. Phycol. 48:27–46.
D€uwel, L. & Wegeberg, S. 1996. The typification and status ofLeptophytum (Corallinaceae, Rhodophyta). Phycologia 35:470–83.
Foslie, M. 1898. Systematical survey of the lithothamnia. Det Kong.Norske Vidensk. Selsk. Skr. 1898:1–7.
Foslie, M. 1905. Remarks on northern lithothamnia. Det Kong.Norske Vidensk. Selsk. Skr. 1905:1–138.
Foslie, M. 1906. Algologiske notiser II. Det Kong. Norske Vidensk.Selsk. Skr. 1906:1–28.
Foslie, M. 1907. Algologiske notiser IV. Det Kong. Norske Vidensk.Selsk. Skr. 1907:1–30.
Freshwater, D. W. & Rueness, J. 1994. Phylogenetic relationshipsof some European Gelidium (Gelidiales, Rhodophyta) spe-cies based upon rbcL sequence analysis. Phycologia 33:187–94.
Fritsch, F. 1952. The Structure and Reproduction of the Algae, vol 2.Cambridge University Press, Cambridge, 939 pp.
Gabrielson, P. W., Miller, K. A. & Martone, P. 2011. Morphomet-ric and molecular analyses confirm two distinct species ofCalliarthron (Corallinales, Rhodophyta), a genus endemic tothe northeast Pacific. Phycologia 50:298–316.
Guiry, M. D. & Guiry, G. M. 2014. AlgaeBase. World-wide elec-tronic publication, National University of Ireland, Galway.Available at: http://www.algaebase.org; accessed 1.x.2014.
Hernandez-Kantun, J. J, Riosmena-Rodriguez, R., Hall-Spencer, J.,Pe~na, V., Maggs, C. & Rindi, F. 2014. Phylogenetic analysis ofrhodolith formation in the Corallinales (Rhodophyta). Eur.J. Phycol. in press. doi.org/10.1080/09670262.2014.984347
Hind, K. R. & Saunders, G. W. 2013. A molecular phylogeneticstudy of the tribe Corallineae (Corallinales, Rhodophyta)with an assessment of genus-level taxonomic features anddescriptions of novel genera. J. Phycol. 49:103–14.
Huelsenbeck, J. P. & Ronquist, F. 2001. MRBAYES: Bayesian infer-ence of phylogeny. Bioinformatics 17:754–5.
Hughey, J. R. & Gabrielson, P. W. 2012. Comment on “AcquiringDNA from dried archival red algae (Florideophyceae) for
the purpose of applying available names to contemporarygenetic species: a critical assessment”. Botany 90:1191–4.
Hughey, J. R., Silva, P. C. & Hommersand, M. H. 2001. Solvingtaxonomic and nomenclatural problems in Pacific Gigartina-ceae (Rhodophyta) using DNA from type material. J. Phycol.37:1091–109.
Irvine, L. & Chamberlain, Y. 1994. Seaweeds of the British Isles: Vol1, Rhodophyta, Part 2B Corallinales, Hildenbrandiales. The Natu-ral History Museum, London, 276 pp.
Kato, A., Baba, M. & Suda, S. 2011. Revision of the Mastophoroi-deae (Corallinales, Rhodophyta) and polyphyly in nongeni-culate species widely distributed on Pacific coral reefs. J.Phycol. 47:662–72.
Kjellman, F. R. 1883. Norra Ishafvets algflora. Vega-expeditionensVetenskapliga Iakttagelser, Vol. 3, pp. 1–431.
Kjellman, F. R. 1889.Om Beringhafvets algflora. Kongl. Svenska Ve-tenskaps-Akademiens Handlingar 23: 1–58, pls I-VII.
Klochkova, N. G., Korolyova, T. N. & Kusidi, A. E. 2009. Atlas ofMarine Algae of Kamchatka and Surrounding Areas. Vol. 2. RedSeaweeds. KamchatNIRO Press, Petropavlovsk-Kamchatsky,301 pp.
Lebednik, P. 1977. The Corallinaceae of northwestern NorthAmerica. I Clathromorphum Foslie emend. Adey. Syesis 9:59–112.
Mason, L. R. 1953. The crustaceous coralline algae of the Pacificcoast of the United States, Canada and Alaska. Univ. Cal.Publ. Bot., 26: 313–89, Pl. 27–46.
McNeill, J., Barrie, F. R., Buck, W. R., Demoulin, V., Greuter, W.,Hawksworth, D. L., Herendeen, P. S. et al. 2012. Interna-tional Code of Nomenclature for algae, fungi and plants(Melbourne Code) adopted by the Eighteenth InternationalBotanical Congress Melbourne, Australia, July 2011. Reg. Veg.154: 1–208.
Nash, M., Opdyke, B., Troitzsch, U., Russell, B., Adey, W., Kato,A., Diaz-Pulido, G., Brent, C., Gardner, M., Prichard, J. &Kline, D. 2012. Dolomite rich coral reef coralline algae resistdissolution in acidified conditions. Nature Clim. Change.3,263–272.
Rambaut, A. & Drummond, A. J. 2007. Tracer v1.4. Available at:http://beast.bio.ed.ac.uk/Tracer (accessed 1.x.2014.).
Saunders, G. W. 1993. Gel purification of red algal genomicDNA: an inexpensive and rapid method for the isolation ofpolymerase chain reaction-friendly DNA. J. Phycol. 29:251–4.
Saunders, G. W. & Kraft, G. T. 1994. Small-subunit rRNA genesequences from representatives of selected families of theGigartinales and Rhodymeniales (Rhodophyta). I. Evidencefor the Plocamiales ord. nov. Can. J. Bot. 72:1250–63.
Saunders, G. W. & McDevit, D. C. 2012. Acquiring DNA fromdried archival red algae (Floridophyceae) for the purpose ofapplying available names to contemporary genetic species: acritical appraisal. Botany 90:191–203.
Selivanova, O. N. & Zhigadlova, G. G. 1997. Marine algae of theCommander Islands. Preliminary remarks on the revision ofthe flora. III. Rhodophyta.. Bot. Mar. 40:15–24.
Silvestro, D. & Michalak, I. 2011. RAxMLGUI: a graphical front-end for RAxML. Available at: https://sites.google.com/site/raxmlgui/accessed 1.x.2014.
Str€omfelt, H. F. G. 1886. Om algvegetationen vid Islands Kuster. Aka-demisk Afhandling, G€oteborg, 89 pp.
Suneson, S. 1937. Studien €uber die entwicklungeschicte der Cor-allinaceen. Lunds Univer. Arsskr. N. F. Avd. 2:1–102.
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. & Ku-mar, S. 2011. MEGA5: molecular evolutionary genetics analy-sis using maximum likelihood, evolutionary distance, andmaximum parsimony methods. Mol. Biol. Evol. 28:2731–9.
Thiers, B. 2014. Index herbariorum: a global directory of publicherbaria and associated staff. New York Botanical Garden’sVirtual Herbarium. Available at: http://sweetgum.nybg.org/ih/ accessed 19 Jan 2014.
Verbruggen, H., Maggs, C., Saunders, G., Le Gall, L., Yoon, H. &De Clerck, O. 2010. Data mining approach identifiesresearch priorities and data requirements for resolving thered algal tree of life. BMC Evol. Biol. 10:16.
202 WALTER H. ADEY ET AL.
Woelkerling, W. J. 1988. The Coralline Red Algae: An Analysis of theGenera and Subfamilies of Nongeniculate Corallinaceae. BritishMuseum (Natural History) & Oxford University Press, Lon-don & Oxford, 268 pp.
Woelkerling, W. J., Furnari, G. & Cormaci, M. 2002. Leptophytum(Corallinaceae, Rhodophyta): to be or not to be? – that is thequestion, but what is the answer? Austral. Syst. Bot. 15:597–618.
Woelkerling, W. J., Gustavsen, G., Myklebost, H. E., Prestø, T. &S"astad, S. M. 2005. The coralline red algal herbarium of Mik-ael Foslie: revised catalogue with analyses. Gunneria 77:1–625.
Yoon, H. S., Hackett, J. D. & Bhattacharya, D. 2002. A single ori-gin of the peridinin and fucoxanthin containing plastids indinoflagellates through tertiary endosymbiosis. Proc. Natl.Acad. Sci. USA 99:11724–9.
Supporting Information
Additional Supporting Information may befound in the online version of this article at thepublisher’s web site:
Figure S1. Three ML phylogenetic reconstruc-tions from SSU, psbA, and rbcL, showing evolu-tionary relationships of Clathromorphum specieswith northern species of Hapalidiaceae withoutLeptophytum laeve sequences. Bootstrap valuesshown on branches; *full support (100%). Speciesnames with ID code and data included in TableS1.
Figure S2. ML phylogenetic reconstructionfrom three-gene analysis (SSU, psbA, rbcL) show-ing evolutionary relationships of Clathromorphumspecies with northern species of Hapalidiaceaewithout Leptophytum laeve sequences. Bootstrap val-ues shown on branches with ML values followedby posterior probabilities from Bayesian analysis(e.g., 100/0.98); *full support for both analyses(100/1). Numbers after names are specimencodes in Table S1. Outgroups are species ofSporolithales (Sporolithon and Heydrichia).
Table S1. List of specimens sequenced, treecode, herbarium number and reason for theirinclusion, collection data and GenBank Accessionnumbers for each of three markers, rbcL, psbA,and SSU. Taxa are listed in alphabetical order;original name of specimen, if different from cur-rent name, is listed under reason for inclusion;specimens are listed north to south; west to eastfor Clathromorphum nereostratum. Sequences withlabel EXX (e.g., E43) are published in Hernan-dez-Kantun et al. (2014).
