+ All Categories
Home > Documents > Any site / any species. 100.000 edits of your choice · 2016-09-04 · Custom Custom Paired...

Any site / any species. 100.000 edits of your choice · 2016-09-04 · Custom Custom Paired...

Date post: 12-Aug-2020
Category:
Upload: others
View: 0 times
Download: 0 times
Share this document with a friend
15
Any site / any species. 100.000 edits of your choice SureGuide
Transcript
Page 1: Any site / any species. 100.000 edits of your choice · 2016-09-04 · Custom Custom Paired sub-libraries non -cloned sub libraries) Custom Probe sets – Ready to clone (Human/Mouse)

Any site / any species. 100.000 edits of your choice

SureGuide

Page 2: Any site / any species. 100.000 edits of your choice · 2016-09-04 · Custom Custom Paired sub-libraries non -cloned sub libraries) Custom Probe sets – Ready to clone (Human/Mouse)

June 12, 2015

2

Fully Customizable Nuclease Specificity • Harness the power of the next-generation of genome editing tools

• Target any region of interest, including long, complex stretches of DNA

Synthesize gRNA on demand • High quality, high yield IVT kit assures reliable results

• Fast, simple, and easy to obtain new guides for different applications

Simple, validated reagents you can be Sure of • Faster start-up times with validated and purified reagents

• Optimized systems allows you to focus on the science, not the tools

Fast, Flexible, and Easy:

Purified Cas9 + gRNA synthesis system

All-in-One

Page 3: Any site / any species. 100.000 edits of your choice · 2016-09-04 · Custom Custom Paired sub-libraries non -cloned sub libraries) Custom Probe sets – Ready to clone (Human/Mouse)

crRNA

Spacer

(guide sequence)

crRNA processing

CAS9 CAS2 CAS1 csn1 CRISPR

dispensable

tracrRNA

The CAS9/CRISPR system targets double stranded DNA for cleavage

tracrRNA

..NNNNNNNNAGTAATATCAAAAAAGCCCCCTTGATTATCNGGNGNNN……

Repeat sequence Repeat sequence spacer

Genomic DNA

Cleavage site

TACGAGGTTTTAGAGCTGTGTTGTTTCGAATGGTTCCAAAACAGTAATATCAAAAAAGCCCCCTTGATTATCGTTTTAGAGCTGTGTTGTTTCGAATGGTTCCAAAAC

PAM site

tracrRNA and crRNA can

be linked to mimic

processed form

For a 50% GC genome PAM

sites are expected to occur

1/32 base pairs

RNAse III

Page 4: Any site / any species. 100.000 edits of your choice · 2016-09-04 · Custom Custom Paired sub-libraries non -cloned sub libraries) Custom Probe sets – Ready to clone (Human/Mouse)

in vitro DNA cleavage by CAS9

stem (30 nt) spacer (20 nt)

tracr tail (13 nt)

CAS9

Needed for in-vitro cleavage

guide RNA (sgRNA)

CAS9

5’

5’ 3’

3’

OH

OH

?

?

5’

5’ 3’

3’ OH

OH

?

?

PAM

Page 5: Any site / any species. 100.000 edits of your choice · 2016-09-04 · Custom Custom Paired sub-libraries non -cloned sub libraries) Custom Probe sets – Ready to clone (Human/Mouse)

Mechanism of action

Agilent confidential

CAS9 binding of guide RNA

evaluation of PAM sites

Guide fitting

conversion to cleavage competent form

• spCAS9 does not turn over!

• It is not an enzyme in the

conventional sense but acts

as a site-specific cleavage

reagent

Page 6: Any site / any species. 100.000 edits of your choice · 2016-09-04 · Custom Custom Paired sub-libraries non -cloned sub libraries) Custom Probe sets – Ready to clone (Human/Mouse)

What are the current primary uses of CAS9?

CAS9

CAS9

Homologous recombination

targeted, concise insertion or replacement

CAS9 expression vector

Guide RNA

expression vector

CAS9

Purified CAS9 protein

purified guide RNA

Better with NLS on CAS9

NHEJ

• Leads to scar at cleavage site (indels)

• mutates target site

DNA oligo libraries

Libraries of guides

Libraries of inserts

Page 7: Any site / any species. 100.000 edits of your choice · 2016-09-04 · Custom Custom Paired sub-libraries non -cloned sub libraries) Custom Probe sets – Ready to clone (Human/Mouse)

Recommended reaction conditions

Reaction volume 20 µl

Target DNA 100 ng

Guide RNA 1 pmole

CAS9 enzyme 125 ng (798 fmoles)

Incubate for 1h at 30 °C,

heat inactivate for 15 minutes at 65 °C

Unit definition:

The amount of CAS9 required to cleave

50% of 100 ng linearized pKS-kanC1 using

the kanC1 guide under the above conditions

1U of CAS9 25 ng

Concentrations in unit definition assay:

guide RNA 50 nM

CAS9 protein 39.9 nM

Target DNA

• Target sites 2.6 nM • PAM sites 1.05 µM

CAS9 titration

guide titration

time course

Agilent confidential

Page 8: Any site / any species. 100.000 edits of your choice · 2016-09-04 · Custom Custom Paired sub-libraries non -cloned sub libraries) Custom Probe sets – Ready to clone (Human/Mouse)

Does spCAS9 display the expected PAM requirements?

Expected PAM site: …nnnnNGGNN…

Heat map of cleavage efficiencies: only

mutations of positions 2 and 3 affect cleavage

efficiency

Agilent confidential

Page 9: Any site / any species. 100.000 edits of your choice · 2016-09-04 · Custom Custom Paired sub-libraries non -cloned sub libraries) Custom Probe sets – Ready to clone (Human/Mouse)

Are cleavage products compatible with down stream molecular biology applications?

Expected product sizes:

3.9 kB, 180 bps

Cloning of 156 bps fragment

10 randomly picked clones analyzed by

restriction analysis

All clones were the expected product

Page 10: Any site / any species. 100.000 edits of your choice · 2016-09-04 · Custom Custom Paired sub-libraries non -cloned sub libraries) Custom Probe sets – Ready to clone (Human/Mouse)

Cloning of CAS9-digested DNA fragments

Cloned CAS9-excised 5.4 kb fragment

into Strataclone blunt vector

Selected for marker (gentamycin

resistance) encoded by cloned fragment

Picked 10 colonies for restriction

analysis

Analyzed cloning junctions of 5 isolates

Additional nucleotide at junction is

due to cleavage at the -4 position

instead of the -3 position relative to

the PAM site

Wobble cleavage occurs at a

frequency of 1/20

Page 11: Any site / any species. 100.000 edits of your choice · 2016-09-04 · Custom Custom Paired sub-libraries non -cloned sub libraries) Custom Probe sets – Ready to clone (Human/Mouse)

adaptors can be ligated to CAS9 digested sites

CAS9

P P

cleave target with CAS9

ligate adaptors with T4 DNA ligase

purify ligation product

PCR amplify ligation product

no

CA

S9

CA

S9

dig

este

d

Page 12: Any site / any species. 100.000 edits of your choice · 2016-09-04 · Custom Custom Paired sub-libraries non -cloned sub libraries) Custom Probe sets – Ready to clone (Human/Mouse)

SureGuide Ordering

Page 13: Any site / any species. 100.000 edits of your choice · 2016-09-04 · Custom Custom Paired sub-libraries non -cloned sub libraries) Custom Probe sets – Ready to clone (Human/Mouse)

Genome Editing for Functional Genomics

Studies the relationship between the genome

and its regulatory elements and the phenotype

(function & interaction)

Functional Genomics

CRISPR enables the easy and flexible implementation of

targeted functional assays for the entire Genome:

• KnockOut Exome

• KnockOut Inter-genes (Regulation)

• GE Activation (Regulation)

• GE Inhibition (Tunable RNA KnockDown, Regulation)

• KnockIns & Genome Tagging

CRISPR & Functional Genomics

Page 14: Any site / any species. 100.000 edits of your choice · 2016-09-04 · Custom Custom Paired sub-libraries non -cloned sub libraries) Custom Probe sets – Ready to clone (Human/Mouse)

gRNA libraries: Functional Genomics

gRNA Oligo Array Synthesis gRNAs cleaved &

PCR amplified

Cloning & Purification

Viral

packaging

Transduction

and selection of

Target Cells

Treatment

vs. Control

Screening and

Hit sequencing

Pathway analysis

(e.g. drug resistance

KO assay)

Page 15: Any site / any species. 100.000 edits of your choice · 2016-09-04 · Custom Custom Paired sub-libraries non -cloned sub libraries) Custom Probe sets – Ready to clone (Human/Mouse)

Early access to Agilent gRNA libraries

Catalog Libraries Format: Cloned in a lentiviral vector

• Exome Human

• Exome Mouse

Cloned Catalog Exome Libraries Paired Gene Libraries

Custom Custom Paired sub-libraries

(non-cloned sub-libraries)

Custom Probe sets –

Ready to clone (Human/Mouse)

• Custom Exome Pools

• Custom Mouse and Human

Genome Target sets

• Cloning kit

Custom gRNA sequences (Any Species)

Custom

(non-cloned)

Targeted Gene Editing

TC-RNA: Synthetic Guides in

single well, with modified

nucleotides

Cas9 and Guides in vivo

delivery methods

Agilent Confidential

-In development

-Early access coming soon


Recommended