“Proteomics & Bioinformatics”

A Practical Approach to Proteomics and the associated Technologies and the Data Mining Tools.

Sean Taylor, Ph.D.

DNA Genome “Genomics”

Proteins

Cell functions

Proteome “Proteomics”

DNA sequencing

cDNA arrays

2D PAGE, HPLC

CGTCCAACTGACGTCTACAAGTTCCTAAGCT

RNA Transcriptome

“-ome”

Reactome, the chemical reactions involving a nucleotide

• Proteins are the mediators of functions in the cell

• Deviations from normal status denotes disease

• Proteins are drug/therapeutic targets

• Protein expression levels do not correlate strongly with mRNA

Why are we studying proteins?

The Proteome

The proteome in any cell represents a subset of all possible gene products

Not all the genes are expressed in all the cells.

It will vary in different cells and tissue types in the same organism and between different growth and developmental stages

The proteome is dependent on environmental factors, disease, drugs, stress, growth conditions.

1485 protein spots detected

2D Gel of Mouse Brain

Proteome complexity

•More than 100 modification forms known•A single protein may carry several modifications•Modified proteins show different properties compared to unmodified counterparts•In most cases, we do not know the origin or the biological significance of the observed heterogeneities

Much larger number of spots compared to protein species they represent

H.influenza : 1500 spots 500 different proteins

Protein Heterogeneity

Complexity

Tools of ProteomicsProtein extraction

Solubilize proteins from cells or tissue

Protein separation technologySimplify complex protein mixturesTarget specific proteins for analysis

Mass spectrometry (MS)Provide accurate molecular mass measurements of intact proteins and peptides

DatabaseProtein, EST, and complete genome sequence databases

Software collectionMatch the MS data with specific protein sequences in databases

Detergents: solubilize membrane proteins-separation from lipids

Reductants: Reduce S-S bonds

Denaturing agents: Disrupt protein-protein interactions-unfold proteins

Enzymes: Digest contaminating molecules (nucleic acids etc)

Protease inhibitors

Aim: High recovery-low contamination-compatibility with separation method

Protein extraction

ESI-MS

Electrospray Ionization tandem MS

MALDI-TOF

Matrix Assisted Laser Desorption Ionization –Time of Flight

Workflow of proteomics analysisproteins digestionseparation

MALDI, MS/MS

digestion

peptides

(LC)-MS/MSIdentification

The less complex a mixture of proteins is, the better chance we have to identify more proteins.

Detergents

Reductants

Denaturing agents

Enzymes

digestion

Separation of Protein Mixtures

Separation techniques

1D- and 2D-SDS PAGE

Preparative IEF isoelectricfocusing

HPLC

Separating intact proteins to take advantage of their diversity in physical properties

Separation techniques for peptides

MS-MS

HPLC (MudPIT)

SELDI

Separation techniques used with intact proteins

Differential display proteomicsDifference gel electrophoresis (DIGE)

Isotope-coded affinity tagging (ICAT)

H.J. Issaq, 2003M.F. Lopez, 2000

Apolipo-A1

1%

Apolipo-B

AGP

Ceruloplasmin

Factor H

Lipoprotein A

C4-Comp factor

Comp factor B

Pre-albumin

C9-Comp factorC1q-Comp

factorC8-Comp factor

Deep Proteome™

Large number of Low abundance

proteins

Albumin

IgG

Transferrin

FibrinogenIgA

α2 macroglobulinIgM

α1-ATC3 Comp factor

10%Haptoglobulin

Dynamic Range of the Plasma Proteome

Limitations of Immunodepletion

To alleviate the dynamic range problem in serum & plasma, immunodepletion products have been developed

Immunodepletion suffers from many limitationsReliant upon predefined set of antibodiesDilutes the sampleInadvertently lose associated proteins when high abundant proteins are removedExpensive, due to the use of antibodies

94 Yellow5 Blue3 Green1 Red1 Pink

BindWash away Excess

Elute

4 Yellow4 Blue3 Green1 Red1 Pink

ProteoMiner Technology

Each bead may bind an unique protein, or protein complex

With sufficient diversity, there will be a ligand to most, if not all, proteins in the mixture

Diverse Ligand Library

Benefits of ProteoMiner Technology

Decreases the amount of high-abundance proteins without losing associated proteins

Enriches and concentrates low-abundance proteins that cannot be detected through traditional methods

Not dependent on a predefined set of antibodies

Can be used to decrease the dynamic range of the protein concentration in a variety of biological fluids

Serum: Treated vs. Untreated

Molecular Mass (M/Z)

Surface enhanced laser desorption/ ionization (SELDI) MS

µA

untreated

flowthrough

eluate

1-D gel

Sample Treated with ProteoMiner

Gel electrophoresisClassical processHigh resolving power: visualization of thousands of protein forms

QuantitativeIdentifying proteins within proteomeUp/ down regulation of proteinsDetection of post-translational modifications

Protein fixing and staining or blotting

General detection methods (staining)Organic dye – and silver based methods Coomassie blue, SilverRadioactive labeling methodsReverse stain methodsFluorescence methods (Supro Ruby)

Gel scanning(storage of image in a database)

Coomassie blue stained gels

Silver stained

Ruby red

2D Gel Electrophoresis

pH 3 pH 10

The strip is loaded onto a SDS gel Mw

pI

Staining !

Proteins that wereseparated on IEF gelare next separated inthe second dimensionbased on theirmolecular weights.

Limitations/difficulties - 2D gels

ReproducibilitySamples must be run at least in triplicate to rule out effects from gel-to-gel variation (statistics)

Incompatibility of some proteins with the first dimension IEF step (hydrophobic proteins)

Marginal solubility leads to protein precipitation and degradation- smearing

(Glycolysation, oxidation)

Small dynamic range of protein staining as a detection technique- visualization of abundant proteins while less abundant might be missed.

Posttranscriptional control mechanismsCo-migrating spots forming

a complex region

Streaking and smearing

Weak spots and background

Vacuum assisted aspiration into sample tubes

Large amount of proteins (up to 3g protein)

Preparative IEF

The protein mixture is injected into the focusing chamber

Proteins are focused as in standard IEF

The pH gradient is achieved with soluble ampholytes

Gel Image Analysis

Image analysis is extracting perceptible data out of the 2DE image, and storing it in a database.

It involves detecting spots and warping separate images to align like-spots of the same proteins.

Spot data comes from the levels of spot darkness which is proportional to the level of proteins staining or dye labeling of particular amino acids.

staining Image acquisition Image analysis /quantification

Film or Imager?

DensitometerDensitometerDensitometerDensitometer

VersaDoc VersaDoc FamilyFamily

VersaDoc VersaDoc FamilyFamily GelDoc GelDoc

FamilyFamily

Film

ChemiDoc XRS

Time (seconds)15

Molecular ImagerSystem

Dynamic Range ChemiDoc XRS System vs. Film

Harta LED test targets imaged with Bio-Rad's Molecular Imaging ChemiDoc XRS Systems, as well as exposed to film, for 15 seconds. The Harta target produces illumination that range from bright to very faint. It is controlled tool for testing the dynamic range of any luminescence detection system, without the variables usally introduced during sample prep, electrophoresis, and blotting.

The ChemiDoc XRS System displays a high linear dynamic range, enabling it to see all 7out of 9 spots in 15 seconds, without saturating the brightest signal. This quantitative data is due to the 16,000 electron well capacity of the CCD and low 4.5 electron noise. The high quantum efficiency of the CCD also enables the system to detect signal fast, avoiding building up of background noise. In 15 seconds, film also detected 7 out of 9 spots, and the 4 brightest spots are saturated. This illustrates the limited dynamic range of film. While film is a good tool to see the absence or presence of a sample, it is not quantitative.

PDQuest 2-D Analysis Software

http://www.bio-rad.com/

PDQuest Features

http://www.bio-rad.com/

•Quick guides to lead a beginner through the major applications of the software

•Onscreen context-sensitive help

•Context-sensitive, right-mouse-click menus that offer ready access to common commands

•Experiment setup wizard

Identification

Quantification

General workflow of proteomics analysis

MALDI, MS/MS Store peak lists and all meta data

PMF

MS/MS

DIGE

LC-MS & Tags

Proteins/peptides2D gel image aquisition andstorage

Digestion and/or separation

KEGG PDB DIPOMIMReactomePROSITPfamSPINBONDSTRINGAmiGODavidPubMedMEDLINE

Strategy for Biomarker Discovery

Large # samplesSmall # candidates

DiscoveryCandidate gene

Validationin situ hybridization Immunohistochemistry

Application

Disease vs. Normal Proteomic analysis(2D gels / MS)

Genomic analysismRNA level

Diagnostic Therapeutic

Clinical Application

Prognostic

Conclusions

The success of proteomics (structural, functional, expressional) hinges almost entirely on successful sample preparation and separation. Time taken to design proteomics experiments will save in downstream analysis and productivity. Bioinformatics (web databases, servers, data mining tools, NN’s, HMM’s) can and does play an increasingly important role in optimizing or improving experimental design and data interpretation.