+ All Categories
Home > Documents > AP Biology 2006-2007 Quickie Intro to DNA Technologies.

AP Biology 2006-2007 Quickie Intro to DNA Technologies.

Date post: 11-Jan-2016
Category:
Upload: elmer-stewart
View: 214 times
Download: 0 times
Share this document with a friend
14
AP Biology 2006-2007 Quickie Intro to DNA Technologies
Transcript
Page 1: AP Biology 2006-2007 Quickie Intro to DNA Technologies.

AP Biology 2006-2007

Quickie Intro to DNA Technologies

Page 2: AP Biology 2006-2007 Quickie Intro to DNA Technologies.

AP Biology

Watson and Crick1953 article in Nature

Page 3: AP Biology 2006-2007 Quickie Intro to DNA Technologies.

AP Biology

Double helix structure of DNA

Page 4: AP Biology 2006-2007 Quickie Intro to DNA Technologies.

AP Biology

Cut DNA Restriction enzymes

restriction endonucleases discovered in 1960s evolved in bacteria to cut up foreign DNA

“restriction” protection against viruses & other bacteria

bacteria protect their own DNA chemically & by not using the base sequences recognized by the enzymes in their own DNA

Page 5: AP Biology 2006-2007 Quickie Intro to DNA Technologies.

AP Biology

Discovery of restriction enzymes1960s | 1978

Werner Arber Daniel Nathans Hamilton O. Smith

Restriction enzyme movie

Restriction enzymes are named for the organism they come from:EcoR1 = 1st restriction enzyme found in E. coli

Page 6: AP Biology 2006-2007 Quickie Intro to DNA Technologies.

AP Biology

Restriction enzymes Action of enzyme

cut DNA at specific sequences restriction site

symmetrical “palindrome” produces protruding ends

sticky ends

Many different enzymes named after organism they are found in

EcoR1, HindIII, BamH1, Sma1

Madam I’m Adam

CTGAATTCCGGACTTAAGGC

CTG|AATTCCGGACTTAA|GGC

Page 7: AP Biology 2006-2007 Quickie Intro to DNA Technologies.

AP Biology

AATTC

AATTC

AATTC

GAATTC

G

G

GG

G

GAATTC

CTTAAG

GAATTCCTTAAG

CTTAA

CTTAA

CTTAAG

DNA ligasejoins the strands.

DNA

Sticky ends (complementarysingle-stranded DNA tails)

Recombinant DNA molecule

AATTCGG

CTTAA

Biotech use of restriction enzymes

Restriction enzymecuts the DNA

Add DNA from another source cut with same restriction enzyme

Page 8: AP Biology 2006-2007 Quickie Intro to DNA Technologies.

AP Biology

Paste DNA Sticky ends allow:

H bonds between complementary bases to anneal

Ligase enzyme “seals”

strands bonds sugar-

phosphate bonds covalent bond of

DNA backbone

Page 9: AP Biology 2006-2007 Quickie Intro to DNA Technologies.

AP Biology

Gel Electrophoresis Separation of DNA fragments by size

DNA is negatively charged moves toward + charge in electrical field

agarose gel “swimming through Jello” smaller fragments move faster

cut DNA with restriction enzymes

Page 10: AP Biology 2006-2007 Quickie Intro to DNA Technologies.

AP Biology

Gel Electrophoresis

Page 11: AP Biology 2006-2007 Quickie Intro to DNA Technologies.

AP Biology

Gel Electrophoresis

Page 12: AP Biology 2006-2007 Quickie Intro to DNA Technologies.

AP Biology

Page 13: AP Biology 2006-2007 Quickie Intro to DNA Technologies.

AP Biology

Measuring fragment size compare bands to a known “standard”

usually lambda phage virus cut with HindIII nice range of sizes with a distinct pattern

Page 14: AP Biology 2006-2007 Quickie Intro to DNA Technologies.

AP Biology

And from that comes a host of…

Biotech Tools


Recommended