Application of PCR Technologies for - Water Research · PDF file ·...

American Water Works Association

RESEARCH FOUNDATION

Application ofPCR Technologies forVirus Detection inGroundwater

Subject Area: Monitoring and Analysis

Application ofPCR Technologies for Virus Detection in Groundwater

The mission oftheAWWA Research Foundation is to advance the science of water to improve the quality of life. Funded primarily through annual subscription payments from over 900 utilities, consulting firms, and manufacturers in North America and abroad, AWWARF sponsors research on all aspects of drinking water, including supply and resources, treatment, monitoring and analysis, distribution, management, and health effects.

From its headquarters in Denver, Colorado, the AWWARF staff directs and supports the efforts of over 500 volunteers, who are the heart of the research program. These volunteers, serving on various boards and committees, use their expertise to select and monitor research studies to benefit the entire drinking water community.

Research findings are disseminated through a number of technology transfer activi ties, including research reports, conferences, videotape summaries, and periodicals.

Application ofPCR Technologies for Virus Detection in GroundwaterPrepared by:Morteza Abbaszadegan,Peter W. StewartAmerican Water Works Service Company, Inc., Belleville, IL 62220

Mark W. LeChevaliierAmerican Water Works Service Company, Inc., Voorhees, NJ 08043

Charles P. GerbaDepartment of Soil and Water Science,The University of Arizona, Tucson, AZ 85720

Sponsored by:AWWA Research Foundation6666 West Quincy Avenue Denver, CO 80235-3098

Published by theAWWA Research Foundation andAmerican Water Works Association

Disclaimer

This study was funded by the AWWA Research Foundation (AWWARF).AWWARF assumes no responsibility for the content of the research study

reported in this publication or for the opinions or statements of fact expressed in thereport. The mention of trade names for commercial products does not represent or imply

the approval or endorsement of AWWARF. This report is presented solely for informational purposes.

Library of Congress Cataloging-in-Publication Data Application of PCR technologies for virus detection in groundwater /

prepared by Morteza Abbaszadegan ... [et al.].xxii, 60 p. 21.5x28 cm.Includes bibliographical references (p.).ISBN 0-89867-934-61. Viral pollution of water. 2. Enteroviruses Analysis.

3. Polymerase chain reaction. 4. Groundwater Analysis. I. Abbaszadegan, Morteza. II. AWWA Research Foundation. TD427. V55A66 1998628. I'61-dc21 97-34412

CIP

Copyright 1998by

AWWA Research Foundationand

American Water Works Association Printed in the U.S.A.

ISBN 0-89867-934-6 Printed on recycled paper.

Contents

List of Tables ................................................ ix

List of Figures ................................................. xi

Foreword .................................................... xiii

Acknowledgments ............................................ xv

Executive Summary ............................................ xvii

Chapter 1 Introduction ...................................... 1

Enteric Viruses in Water, 1The Polymerase Chain Reaction, 2Cell Culture Methods, 4The Groundwater Disinfection Rule, 6Objectives, 6

General Objectives, 6Specific Objectives, 6

Approach and Experimental Design, 7

Chapter 2 Water-Sampling Program ............................ 9

Site Selection, 9 Sampling Kit, 9Water-Sampling Training Video, 11 Sampling Program, 11 Physicochemical Analysis, 11

Chapter 3 Methods Development................................ 13

Optimization of RT-PCR, 13Reducing Sample Concentrate Volume, 14Pre-PCR Concentrate Treatment, 14Optimization of Reaction Enzymes, 15Reaction Conditions and Other Reagents, 17Short, Sequence-Specific Primers, 18Confirmation and Control, 18Treatment of Samples Highly Resistant to Amplification, 19

vi PCR Technologies for Virus Detection in Groundwater

Chapter 4 Materials and Methods .............................. 21

Sample Collection, 21Filter Elution, 21Virus Flocculation and Reconcentration, 21Cell Culture Assay, 22Bacteriophage Assay, 22Total Coliform Test, 25Total Organic Carbon Assay, 25UV-254 Analysis, 25Chemical Analysis, 25Primers and Probes Used for Virus Detection, 25Large-Volume Polymerase Chain Reaction, 26Pre-PCR Sample Treatment, 26Reverse Transcription Reaction, 27cDNA Amplification by PCR, 28Hybridization Using Radiolabeled DNA Probes, 28Radiolabeling of DNA Probes, 30RT-PCR Confirmation of Cell Culture Results, 32

Chapter 5 Results ............................................ 33

RT-PCR Analysis of Environmental Concentrates, 33 Cell Culture Analysis of Environmental Concentrates, 33 Equivalent Volumes Assayed by PCR and Cell Culture

Assay, 34Bacteriophage Assays, 34 Recovery of Poliovirus by RT-PCR, 36 RT-PCR Analysis of Cell Harvests, 38 Chemical Analyses, 38 Summary of Physicochemical Characteristics of

Groundwater Sites, 41 Statistical Analyses, 41

Chapter 6 Discussion ......................................... 43

A Strategy for the Detection of Viruses by PCR, 43 Positive and Negative Controls for PCR Assays, 44 Confirmation, 44

Statistical Analyses, 45Sample Inhibition of RT-PCR, 45Differential Recovery of Infectious Virus,

Heat-Inactivated Virus, and RNA, 45PCR Assays Compared With Cell Culture Assays, 46

Contents vii

Appendix A: Bacterial Media Used in Bacteriophage Assays ........ 49

Appendix B: Suva Values, Samples 1-150 . ....................... 51

Glossary ..................................................... 53

References. .................................................. 55

List of Abbreviations and Acronyms ............................. 59

Tables

5.1 Summary of viral analyses 355.2 Comparative analysis of enterovirus assays 355.3 Summary of bacteriophage analyses 365.4 Summary of seeded recovery tests 375.5 Cell harvest RT-PCR results 395.6 Summary of chemical analyses 395.7 Summary of physicochemical characteristics 415.8 Summary of geological characteristics of groundwater sites 42

IX

Figures

1.1 Detection of enteroviruses by PCR 5

2.1 Sampling kit 10

3.1 Ethidium-stained gel from poliovirus-seeded waterexperiment 16

3.2 Sample illustration of target DNA, primers 1 and 2, andnested primer-probe for semi-nested PCR assay 19

4.1 Cell culture assay 234.2 Example gel photograph: Enterovirus-seeded reactions 294.3 Example gel photograph: Rotavirus-seeded and nonseeded

reactions 294.4 Gel photograph and autoradiograph of the same samples 31

5.1 Agarose gel of recovery of poliovirus by RT-PCR experiments 37

XI

Foreword

The AWWA Research Foundation is a nonprofit corporation that is dedicated to the implementation of a research effort to help utilities respond to regulatory requirements and traditional high-priority concerns of the industry. The research agenda is developed through aprocess of consultation with subscribers and drinking water professionals. Under the umbrella of a Strategic Research Plan, the Research Advisory Council prioritizes the suggested projects based upon current and future needs, applicability, and past work; the recommendations are forwarded to the Board of Trustees for final selection. The foundation also sponsors research projects through the unsolicited proposal process; the Collaborative Research, Research Applications, and Tailored Collaboration programs; and various joint research efforts with organizations such as the U.S. Environmental Protection Agency, the U.S. Bureau of Reclamation, and the Association of California Water Agencies.

This publication is a result of one of these sponsored studies, and it is hoped that its findings will be applied in communities throughout the world. The following report serves not only as a means of communicating the results of the water industry' s centralized research program but also as a tool to enlist the further support of the nonmember utilities and individuals.

Projects are managed closely from their inception to the final report by the foundation's staff and large cadre of volunteers who willingly contribute their time and expertise. The foundation serves a planning and management function and awards contracts to other institutions such as water utilities, universities, and engineering firms. The funding for this research effort comes primarily from the Subscription Program, through which water utilities subscribe to the research program and make an annual payment proportionate to the volume of water they deliver and consultants and manufacturers subscribe based on their annual billings. The program offers a cost-effective and fair method for funding research in the public interest.

A broad spectrum of water supply issues is addressed by the foundation's research agenda: resources, treatment and operations, distribution and storage, water quality and analysis, toxicology, economics, and management. The ultimate purpose of the coordinated effort is to assist water suppliers to provide the highest possible quality of water economically and reliably. The true benefits are realized when the results are implemented at the utility level. The foundation's trustees are pleased to offer this publication as a contribution toward that end.

A renewed regulatory focus on microbes in groundwater has inspired the drinking water community to develop better techniques for detecting viruses in the subsurface. Conventional virus detection methods (e.g., cell culture) are typically costly and time-consuming. Equipment requirements alone for con ventional methods are often cost and space prohibitive. This project takes advantage

Xlll

xiv PCR Technologies for Virus Detection in Ground-water

of recent advances in molecular techniques (e.g., polymerase chain reaction, or PCR) in an effort to develop more efficient virus detection methods. Depending on the objectives of a groundwater virus monitoring program, PCR may provide utilities with a simpler effective method for virus detection. This report provides a detailed description of a PCR-based virus detection method focused on groundwater applications.

George W. Johnstone James F. Manwaring, P.E.Chair, Board of Trustees Executive DirectorAWWA Research Foundation AWWA Research Foundation

Acknowledgments

The present study has been funded by the American Water Works Associa tion Research Foundation and the United States Environmental Protection Agency with support from the American Water Works Service Company Inc. and the University of Arizona.

The help and guidance of the Project Advisory Committee (PAC) and Project Officer Robert Alien, as well as the early assistance of Shelly Cline, were highly appreciated. The PAC members were

G. Shay Fout, US Environmental Protection Agency,Cincinnati, Ohio

Colin Fricker, Thames Water Utilities, Reading Berkshire,United Kingdom

Mic Stewart, Metropolitan Water District of Southern California,La Verne, Calif.

Marylynn Yates, University of California, Riverside, Calif.

In addition, the help of staff at the American Water Works Service Company Inc., Belleville, 111. especially Raquel Manteiga and Katrina Schneider on sample processing, Robert Kozik on shipping and receiving of sample kits, and John Ban for his supervision of the chemical analysis of water samples and the staff at Charles Gerba's laboratory, University of Arizona, Tucson, Ariz. espe cially Pamela Watt and Carlos Enriquez for cell culture assays was greatly appreciated.

The authors wish to acknowledge the generous assistance of the personnel of the water companies that participated in this study.

xv

Executive Summary

Human enteric viruses may directly or indirectly contaminate water in tended for drinking. Surface water and groundwater of the United States may be subjected to fecal contamination from a variety of sources, including sewage treatment plant effluent, on-site septic waste treatment discharges, land runoff from urban, agricultural, and natural areas, and leachates from sanitary landfills. Evi dence for fecal contamination of surface water and groundwater is provided by the detection of enteric viruses in both types of water and by the occurrence of outbreaks of virus-caused waterborne disease. Conventional methodology for the detection of enteric viruses in environmental samples involves cell culture, which is expensive and time-consuming. The length of time needed to detect viruses in a cell culture assay ranges from a few days to several weeks. An alternative method for the detection of enteric viruses in water samples involves the use of advanced molecular biotechnology.

For this report, the application of the polymerase chain reaction (PCR) for the detection of enteric viruses in groundwater was evaluated. Additionally, the occurrence of enteric viruses in 150 groundwater samples was determined, as was the possible association of virus presence with several potential biological and physical indicators.

Research Objectives___________________

The primary objective of this research project was to apply advanced molecular techniques for the development of a rapid, simple, and inexpensive assay to allow the water industry to detect viral contamination in water. Molecular techniques are now widely used in environmental research and monitoring, with the necessary tools and techniques available from a variety of sources. A comprehen sive research plan was developed to evaluate the application of PCR technology for virus detection in groundwater and to investigate the applicability of the method for the detection of enteroviruses, hepatitis A virus, and rotavirus in groundwater sources. The approach included laboratory studies for the development and optimi zation of the PCR technology and the determination of the specificity of the PCR primers for the detection of viruses, followed by a field evaluation of the method using groundwater sources from different geographical locations and with a variety of physical, chemical, and geological settings. The specific objectives were as follows:

1. Develop and evaluate a simple, rapid, and inexpensive method of detecting human enteric viruses in groundwater samples using the reverse transcription-polymerase chain reaction (RT-PCR)

XVll

xviii PCR Technologies for Virus Detection in Groundwater

Optimize PCR methodology for the detection of low concentrationsof viruses in groundwater as an alternative to cell culture assaysDevelop a sample treatment protocol for removing enzymeinhibitors from groundwater concentratesDevelop a PCR method to assay a larger equivalent sample volumeof each water concentrateConduct a field evaluation of the optimized method for the detectionof enteroviruses, hepatitis A virus, and rotavirus, using 150groundwater samples

Approach

During the methods development phase of the project and before the actual testing of water samples, numerous experiments were conducted to learn the optimum sample pretreatment procedures and the optimum RT-PCR conditions. For the optimization of RT-PCR, a systematic protocol was followed to evaluate the reaction components and conditions, such as the concentrations of enzymes, reaction temperatures, number of reaction cycles, and reaction volume.

A complete field evaluation was performed to examine the applicability of the method for the detection of viruses in water samples. To ensure a variety of samples and to best evaluate the method, sites were selected based on different chemical, physical, and geological criteria.

After the laboratory studies and field evaluation were completed, a strategy for the detection of viruses in groundwater was developed. The strategy is based on" the collection of a large sample volume, the removal of inhibitory substances from the water concentrate, a large-volume RT-PCR that allows for the testing of a larger equivalent volume of a water sample, testing of the possible inhibitory nature of each sample by seeding some of each with known quantities of viruses, the inclusion of reagent positive and negative controls to exclude false positive and false negative results, and confirmation assays of the PCR product. The strategy outlined here fulfills the water industry's need for a rapid, reliable, inexpensive, and easily performed analysis of groundwater for virus contamination.

One hundred fifty groundwater sample concentrates were analyzed for enterovirus presence by both RT-PCR and cell culture assay. Virus assays were conducted after concentration of a minimum of 400 gal (1,512 L) of groundwater by a filter adsorption and elution method. Besides cell culture and PCR assays, bacteriophage and total coliform analyses were performed on the water samples collected during this study to investigate the occurrence of bacterio-phages in groundwater and the possible correlation with human viruses.

The samples were analyzed by RT-PCR for enteroviruses, hepatitis A virus, and rotavirus. Each sample was assayed twice for each virus once using only the concentrate as a template for RT-PCR, and once (positive control) using the concentrate seeded with a low number of either poliovirus, hepatitis A virus, or rotavirus.

Using primers specific for enteroviruses in the reactions, 17 samples (11.3 percent) failed to exhibit amplification when seeded. Of the samples that could be

Executive Summary xix

assayed, 40 of 133 (30.1 percent) were deemed positive for the presence of enterovirus ribonucleic acid (RNA).

When primers specific for hepatitis A virus were used in the RT-PCR assay, 11 samples (7.3 percent) failed to exhibit amplification when seeded. Of the samples that could be assayed, 12 of 139 (8.6 percent) were deemed positive for the presence of hepatitis A viral RNA.

RT-PCR analysis using rotavirus specific primers resulted in 20 samples (13.3 percent) unable to be assayed. Of the remaining 130 samples, 18(13.8 percent) were positive for rotavirus RNA.

For all samples, only five could not be assayed by either the enterovirus, hepatitis A virus, or rotavirus primers.

The samples were also analyzed for enteroviruses by cell culture techniques using Buffalo Green monkey (BGM) kidney cells. Thirteen of the 150 samples (8.7 percent) showed cellular cytopathic effects in both the initial and confirmation phases of the analysis. The most probable number (MPN) of virus per 100 L of original sample ranged from 0.15 to 1.86 for the samples that were positive. Thirty- one of the samples (20.7 percent) exhibited cellular toxicity, and three samples (2 percent) were contaminated with bacteria; however, all of these samples were able to be assayed after toxicity or bacterial contamination was eliminated. Additionally, all of the samples tested positive when seeded with poliovirus type 1 (LSc strain) as a positive control.

PCR analysis of water samples for the detection of viruses is feasible if the samples are first treated to remove inhibitory substances from the water concentrate. The protocols for inhibitor removal provided in this report will reduce interfering materials, enabling a successful PCR amplification. The large-volume RT-PCR protocol allows for sufficient removal or dilution of inhibitors so that more than 95 percent of the samples may be expected to be assayed for at least one virus by PCR. The specificity and sensitivity of the reactions using the listed primers (for enteroviruses, hepatitis A virus, and rotavirus) are sufficient for the testing of water samples for the detection of viruses. Techniques such as Southern hybridization allow evaluation of samples with even greater sensitivity and allow for confirmation of initial results.

Conclusions________________________

Given PCR's increased sensitivity over cell culture techniques and its ability to detect either infectious or noninfectious viruses, PCR analysis would be expected to reveal more positive results than cell culture analysis. Since both cell culture analysis and PCR analysis can reveal only a "snapshot" of the quality of the groundwater being sampled, PCR seems to be a desirable and rapid initial screening tool.

Although the detection of viral RNA does not necessarily indicate an infectious level of contamination, the presence of viral RNA does suggest a source of viral contamination and thus the potential for health risk. The most sensitive method of detection would be the most desirable, even in the absence of an ability to confirm the infectivity of the sample contamination. Thus, the following conclusions are stated:

xx PCR Technologies for Virus Detection in Groundwater

1. Viruses were detected in groundwater sources by both cell culture assay and the PCR method.

2. The developed PCR-based detection methodology can be used by water utilities for monitoring purposes. The technique can be utilized for a rapid screening of samples for identifying viral contamination of source water.

3. The treatment protocol outlined in this report organic extraction and size exclusion chromatography enabled more than 95 percent of the samples to be successfully assayed by PCR for at least one virus of interest and more than 90 percent of the samples to be successfully assayed for two of the three viruses. Eighty-four percent of the samples could be assayed for all three viruses, whereas only five samples (3.3 percent) could not be assayed for any virus.

4. Based on the statistical analyses for the 150 samples, the authors did not see a significant correlation between any of the measured water quality parameters and enterovirus occurrence when using either RT-PCR or cell culture assays. The results of this project did not support reports showing a high correlation between the presence of F-specific RNA bacteriophages and enteric viruses in fresh water.

5. As results were generated from this study, the authors informed the participating utilities when a water sample was positive for enterovirus contamination by cell culture analyses. The authors advised the utilities that maintaining a disinfection residual is crucial for the source. However, since the samples were taken before any disinfection, the positive results do not necessarily indicate a health risk for the communities served by the water provider.

Recommendations____________________

The authors make the following recommendations:

1. Molecular techniques, such as PCR, are a fast-growing area inmicrobiology, and recent advances should be considered to simplify the procedure further. Close collaborations among laboratories or companies performing biotechnology research should be established to further simplify the method presented here and to design a simple kit for the field detection of viruses.

2. The identification of viable pathogens in water samples is critical to characterize fully the health risk associated with contaminated water. Knowing the limitations of the PCR technique is very important. The standard PCR assay does not determine the viability of detected microorganisms, and in light of this fact, extreme caution should be exercised in the interpretation of PCR results.

3. The United States Environmental Protection Agency (USEPA) has proposed source water monitoring for total culturable viruses as part of the Information Collection Rule (ICR). It is proposed in the ICR protocol that a small portion of each sample be archived for future

Executive Summary xxi

analysis. The sample collection procedure and the elution procedure followed for this research project (using 1MDS filters [CUNO, Inc., Meriden, Conn.] and beef extract, respectively) are similar to the proposed ICR virus protocol. Therefore, for a better identification of viruses, it is recommended that the protocol for sample pretreatment for removing inhibitors, as well as the RT-PCR assay developed for this project, be directly used for the sample concentrates that will be archived during the ICR study. Based on the results of the field evaluation of this report's method, it is anticipated that most of the ICR samples could be analyzed by RT-PCR for some viruses based on the strategy outlined in this report.

Future Research

Genomic sequence databases are rapidly expanding for all classes of microorganisms. Based on computer assisted nucleic acid analyses, unique genetic fragments of microbial pathogens can be identified. A specific fragment can then be used as a diagnostic tool for the detection of pathogens in water samples. The use of molecular techniques could lead to vastly improved methods for the rapid identification of microorganisms in water. In addition to occurrence information, molecular methods can determine species diversity and help in the identification of emerging pathogens in the environment. The disadvantages of culture methods for monitoring purposes are many and have been listed in this report. However, a few issues remain to be addressed for the application of PCR technology for the detection of pathogens in water samples. Additional related research is suggested by this study and briefly stated here:

1. Research related to the identification of other groups of viruses in groundwater concentrates and cell culture harvests (cell culture flask contents)

2. Research involving the identification of specific enterovirus strains, such as distinguishing Coxsackie virus from vaccine-strain poliovirus

3. Research involving a low-volume sample collection (a grab sample) for the detection of viruses by RT-PCR

4. Multiplex PCR (use of multiple primer sets in the same reaction) to detect multiple strains of viruses simultaneously

5. In situ PCR (amplification of viral nucleic acid that is still within a cell) to identify and determine infectivity of viruses

6. Research in improving virus or viral nucleic acid isolation and concentration to remove potential inhibitors to a greater degree and to facilitate the assay of a greater amount of the original sample

7. Research in the applicability of integrated cell culture andRT-PCR methodology for a rapid detection of infectious enteric viruses from water samples

Chapter 1 _________

IntroductionEnteric Viruses in Water

Human enteric viruses are excreted in the feces of infected individuals and may directly or indirectly contaminate water intended for drinking. These viruses are excreted in high numbers: 106 to 109 per gram of feces of infected individuals. The enteric viruses include the enteroviruses, rotaviruses, Norwalk and Norwalk- like viruses, adenoviruses, reoviruses, and others. Surface water and groundwater of the United States may be subjected to fecal contamination from a variety of sources, including sewage treatment plant effluent, on-site septic waste treatment discharges, land runoff from urban, agricultural, and natural areas, and leachates from sanitary landfills. Evidence for fecal contamination of surface water and groundwater is provided by the detection of enteric viruses in both types of water and by the continued occurrence of outbreaks of virus-caused waterborne disease. For example, between 1971 and 1985, 502 drinking-water-borne outbreaks of disease involving 111,228 cases of illness were reported in the United States, of which 49 percent were associated with groundwater sources and 51 percent with surface water sources (Craun 1988, 1992). Nine percent of the reported outbreaks (USEPA 1990) were due to enteric viruses (hepatitis A virus, Norwalk virus, and rotaviruses). It is possible that many waterborne disease outbreaks for which no etiological agent was identified (half of all reported outbreaks) were caused by viruses as a result of (1) the failure to look for viruses and (2) the limitations of current detection methodology.

The enteroviruses (poliovirus, Coxsackie A and B viruses, echovirus) can cause a variety of illnesses ranging from gastroenteritis to myocarditis and aseptic meningitis (Melnick 1990). Many studies have documented the presence of en teroviruses in both raw and (occasionally) treated drinking water (Keswick et al. 1984; Keswick etal. 1982), wastewater (Payment 1981), and sludge (Craun 1984). Enteroviruses in the environment pose a public health risk because these viruses can be transmitted via the fecal-oral route through contaminated water (Craun 1984) and low numbers can initiate an infection in humans.

Rotaviruses are the leading cause of acute infantile gastroenteritis and diarrhea-related infantile death (Gouvea et al. 1990). The virus has also been associated with diarrhea outbreaks among the elderly and among immuno-compro- mised patients (Ball et al. 1996). Rotavirus group A has been documented as a cause of waterborne outbreaks in humans (Gerba and Rose 1990). The virus has been isolated from humans, monkeys, cattle, sheep, mice, cats, dogs, and other mammals,

2 PCR Technologies for Virus Detection in Groundwater

as well as from chickens and turkeys; it has been detected in fresh water and sewage (Estes, Palmer, and Obijeski 1983). Although the various strains of rotavirus are usually associated with a specific species, reports have been published documenting infection by interspecies transmission of the virus, such as human infection by a bovine strain of rotavirus (Nakagomi et al. 1994). Additionally, recent work has shown that an isolated rotavirus surface protein alone can produce diarrhea in mice (Ball et al. 1996).

Hepatitis A virus (HAV) is an important waterborne virus because of the severity of the disease it may cause in susceptible individuals. HAV is the cause of acute infectious hepatitis and was the first enteric virus identified as being associ ated with a waterborne disease outbreak in the United States (Sobsey et al. 1988). The virus was shown to survive more than 4 months at both 5 C (41 F) and at 25 C (77 F) in water, wastewater, and sediments (Sobsey et al. 1988). Hepatitis A is a major cause of acute gastroenteritis, and its symptoms may be the most serious of those caused by the enteric viruses. In one survey, hepatitis A virus was identified as the causative agent in more than 20 percent (68 of 322 outbreaks) of the waterborne disease outbreaks in the United States from 1946 through 1980 for which a causative agent was identified (Lippy and Waltrip 1984).

The calicivirus and the small round structured virus (SRSV) groups have been implicated or suspected in several outbreaks of acute diarrheal illness. These groups are composed of members such as Norwalk virus, Snow Mountain agent, Hawaii virus, Taunton virus, Parramatta virus, and other viruses that are as yet unnamed (Kapikian and Chanock 1990). Shared morphological and genomic characteristics of several of these viruses such as having a single-stranded ribonucleic acid (RNA) as a genome, having a single protein capsid, and sharing genome organization similarities have led to calling these viruses the Norwalk group of viruses, with the Norwalk virus as its most typical member.

The Polymerase Chain Reaction____________

All organisms use either deoxyribonucleic acid (DNA) or RNA as the "blueprint" during the synthesis of the structural proteins, enzymatic proteins, and hormonal proteins needed to sustain life. DNA and RNA consist of only four different subunits,* arranged in linear structure. The sequence of the subunits is unique for each species or strain of single-cell organisms. Knowing the sequence of the DNA subunits allows a researcher to identify the source of the DNA as a member of a particular species or even as a particular individual.

The way in which DNA is duplicated within a cell has been known for some time. DNA, which consists of a double strand, is partially separated into single strands. An enzyme called DNA polymerase then duplicates each strand. The strands then reassociate into double strands, and where there was one molecule, there are now two identical molecules.

* dNTPs refer to an equimolar mixture of deoxyadenosine triphosphate (dATP), deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), and deoxythymidine triphosphate (dTTP) the four components of DNA. The "N" is a common shorthand for either A, G, T, or C.

Introduction 3

In 1985, Kary Mullis was researching the DNA mutations responsible for sickle-cell anemia. He envisioned a process in which DNA, DNA polymerase, and the DNA subunits could be combined in a test tube and subjected to the temperature changes needed for the DNA duplication process to occur. By repeating this process many times, he was able to generate the large amount of DNA necessary for his research. This reaction, termed the polymerase chain reaction (PCR) (Mullis and Faloona 1987; Saiki et al. 1988), can, under ideal conditions, generate millions of copies of a single DNA molecule in just 20 to 30 repetitions of the temperature cycle each cycle requiring only a few minutes. One component of the reaction is a short stretch of DNA called a primer. The primers bind to the separated strands of DNA at a specific site and enable the polymerase enzyme to function. By being able to dictate where the enzyme will begin duplication, the researcher can selectively amplify only a portion of the DNA perhaps a few hundred subunits (or base pairs) rather than the entire sequence.

Since its invention, PCR has become one of the most widely used biochemi cal assays. The speed, specificity, and low cost of the procedure have led to its use in such fields as criminal and pathological forensics, genetic mapping, disease diagnosis, systematics and evolutionary studies, and environmental science.

PCR can also be used to amplify, to detectable levels, nucleic acids associated with pathogens that may be present in low numbers in water samples. PCR assays are intended to detect viruses that have been concentrated from large volumes (100 to 1,500 L [25 to 400 gal]) of water (APH A, AWWA, and WEF1995). This concentration is usually accomplished by a filter adsorption and elution method, resulting in a concentrate containing viruses as well as and organic and dissolved solids. These other compounds, such as humic substances, once concen trated, can interfere with the activity of the enzymes used in PCR.

Many of the viruses associated with waterborne disease are termed "RNA viruses," meaning that their genetic material consists of RNA rather than DNA. Because the PCR reaction amplifies DNA, this RNA must first be converted to DNA through an initial step called reverse transcription. This conversion is accomplished through the use of an enzyme called reverse transcriptase. The enzyme can read the RNA sequence and synthesize a complementary strand of DNA (cDNA). Once this reaction is complete, the sample can be subjected to PCR. This two-step process is referred to as reverse transcription-polymerase chain reaction (RT-PCR).

The RT-PCR procedure can be summarized as follows: First, the water concentrate is treated to remove substances that may inhibit PCR. The sample is then heated to denature the virus's protein coat and liberate the genomic material of the target virus. Viral RNA is than transcribed to a cDNA template, which is utilized in the PCR amplification. The cDNA of the targeted virus is amplified through cycles of denaturation, annealing of primers, and extension. After the PCR cycles are complete, the amplified reaction products are separated by size using gel electrophoresis. The PCR products (amplified regions) are then stained using ethidium bromide (causing the DNA to fluoresce when exposed to ultraviolet [UV] light) and detected using an ultraviolet transilluminator.

The first part of the process, DNA denaturation, is accomplished by heating the double-stranded DNA, resulting in two single strands of DNA. Single-stranded DNA is then available for primer annealing. Primers, or oligonucleotides, are


specific short sequences of DNA used to amplify the desired region of genomic material. Primer annealing is done at a lower temperature than the denaturation step, usually between 55 C and 65 C. The annealing temperature can control the stringency, and subsequently the specificity, of the reaction. During the annealing process, a set of primers will attach (hybridize) to the complementary DNA sequences at the boundary of the desired DNA region. Primers are designed to complement a known sequence within the nucleic acid of a targeted microorganism and can thus detect a specific organism or group of related organisms. After the primers are hybridized to the desired sequences of a DNA strand, DNA polymerase will extend the primer and synthesize a DNA strand complementary to the original sequence using the deoxynucleotide triphosphates (dNTPs) present in the reaction buffer. At this point, one PCR cycle is completed. Repeating the cycle 30 times using an automated thermal cycler (a PCR machine) is common. After 30 cycles, the targeted region can be amplified to millions of copies. The summary of the procedure is illustrated in the Figure 1.1.

The advantages of PCR are numerous. When compared with techniques such as cell culture for the detection of viruses, the time required for the assay can be reduced from days or weeks to hours. Both the initial and recurring costs for PCR are much less than for cell culture techniques, and the PCR technique is easily performed. Additionally, PCR can be used to identify a specific pathogen found in water. It cannot, however, be used to detect the infectious state of an organism only the presence or absence of pathogen-specific DNA or RNA. PCR assays have been applied to the detection of enteroviruses and other pathogens in clinical samples (Hyypia, Auvinen, and Maaronen 1989; Rotbart 1990) and environmental samples (Abbaszadegan et al. 1997a; Abbaszadegan et al. 1993; Pillai et al. 1991; DeLeon et al. 1990).

Cell Culture Methods__________________

Conventional methodology for the detection of enteric viruses from the environment relies on a few established cell lines. The Buffalo Green monkey (BGM) kidney cell line is the most commonly used for the detection of enteroviruses in the environment (Dahling and Wright 1986). This cell is preferred to others, including primary cells, because it provides high sensitivity to natural isolates of enteroviruses (Dahling, Safferman, and Wright 1984). Its sensitivity can be further enhanced by pretreatment of the cells with enzymes or other substances (Benton and Ward 1982). Unfortunately, the use of other cell lines is required to detect other groups of enteric viruses (Smith and Gerba 1982). This can greatly increase the cost and time of assay. Although the cell culture assay can detect infectious viruses in environmental samples, without additional tests no determination can be made as to the particular strain of virus present in a sample. Additionally, the length of time needed to detect infection in the cell culture can vary greatly, from a few days to several weeks, depending on the number of viruses present.

Introduction 5

Detection of Entero viruses by the Polymerase Chain Reaction (PCR)

1 Sample Preparation and LysisPCR-inhibiling substances are removed from the sample through size exclusion

Sample *

Sephadex G-200 '

Chclex-100 . Glass Wool .

The following reaction mixture is prepared:I Ou,L of sample MgCI, dNTPs Buffer

II*. Mineral oil

The sample is heated for 3 minutes to denature the viral protein coat

Viral RNA (+) sense

PI P2 P3

;•/ ^~RNA"——-——-3

•AAAAn

3' 5'

Primer 1: S TCCGGCCCCTGASATGCGGCT 3'445-465Primer 2: 5' TGTCACCATAAGCAGCC 3'577-S94

2 RNA Transcription

The Following is added to the reaction mixure:Reverse transcriptasc RNAasc inhibitor Random primer

Temperature Profile 24 C 10 min 44 C 50 min <)» C 5 min

5 C soak

Viral RNA is transcribed locDNA template for PCR assay

DMA

3 DNA Amplification (PCR)

Tile following .substances areadded to the reaction mixturefor the PCR assay:PCR bufferMgCU.Primers specific for enlerovirusesTat/ polymerascDistilled H20 ________Total reaction volume = 100 (iL

Temperature Profile94 C I min 55 C 45 s 72 C 45s

cDNA is amplified through clenaluraiion, annealing of the primers, and extension

Cycle IPrimer 1

cONA

Cycle 2

4 Detection

Amplified product is separated by size using gel electrophorcsis

The PCR products arc stained with cthidium bromide and examined on a UV-lransilluminaior

Prepared by: Jeffrey Brendecke

Figure 1.1 Detection of enteroviruses by PCR


The Groundwater Disinfection Rule

On June 21, 1992, the United States Environmental Protection Agency (USEPA) proposed a "draft strawman" version of the Groundwater Disinfection Rule (GWDR). The GWDR is a response to the 1986 amendments to the Safe Drinking Water Act, which requires disinfection of all public water supplies. The rule could require an unspecified level of disinfection (expressed as CxT, or disinfectant concentration multiplied by the contact time) for groundwater supplies. The rule would be formulated in a manner so as to protect groundwater supplies from contamination by human enteric viruses.

Unknown in the development of this rule is the percentage of water supplies at risk from viruses, the levels of viruses in these contaminated groundwater supplies, the criteria necessary to identify contaminated wells, or the levels of treatment necessary to ensure safe drinking water. It is expected that the USEPA will issue the proposed version of the GWDR in mid-1998 and the final version in 2000.

There remains an important need to develop a database of virus occurrence and virus concentrations in public groundwater systems. Advanced molecular techniques such as PCR allow routine monitoring of source or finished water samples for the presence or absence of viruses. It was an objective of this project to develop a detection technique for use by water utilities to permit an assessment of the applicability of the GWDR.

Objectives________________________

General ObjectivesThe overall aim of this research project was to apply advanced molecular

biotechnology for the detection of viruses in groundwater sources used for drinking water.

Specific ObjectivesThe specific objectives were as follows:

1. Develop and evaluate a simple, rapid, and inexpensive method of detecting human enteric viruses in groundwater samples using RT-PCR

2. Optimize PCR methodology for the detection of low concentrations of viruses in groundwater as an alternative to cell culture assays

3. Develop a sample treatment protocol for removing enzyme inhibitors from groundwater concentrates

4. Develop a PCR method to assay a larger equivalent sample volume of each water concentrate

5. Conduct a field evaluation of the optimized method for the detection of enteroviruses, hepatitis A virus, and rotavirus, using 150 groundwater samples

Introduction 7

Approach and Experimental Design__________

A comprehensive research plan was developed to evaluate the application of PCR technology for virus detection in groundwater and to investigate the occurrence of enteroviruses, hepatitis A virus, and rotavirus in 150 groundwater sources. The approach included laboratory studies for the development and optimi zation of the PCR technology and determination of the specificity of the PCR primers for the detection of viruses, followed by a field evaluation of the method using groundwater sources in different geographical locations and with a variety of physical, chemical, and geological settings.

During the methods development stage and before the actual testing of water samples, numerous experiments were conducted to learn the optimum sample pretreatment procedures and the optimum RT-PCR reaction conditions. For the optimization of RT-PCR, a systematic protocol was followed to evaluate the reaction components and conditions, such as the amounts of all enzymes, reaction temperatures, number of cycles, and reaction volume.

A complete field evaluation was performed to examine the applicability of the method for the detection of viruses in water samples. To ensure a variety of samples and to best evaluate the method, sites were selected based on different chemical, physical, and geological criteria.

After the laboratory studies and field evaluation were completed, a strategy for the detection of viruses in groundwater was developed. The strategy is based on

1. Large-volume sample collection2. Removal of inhibitory substances from water concentrate3. A large-volume RT-PCR that allows for the testing of a larger

equivalent volume of a water sample4. Testing of the possible inhibitory nature of each sample by seeding

some of each with known quantities of viruses5. Use of assay controls reagent positive and reagent negative

controls to exclude false positive and false negative results6. Confirmation assays of the PCR product

The strategy outlined here fulfills the water industry's need for a rapid, reliable, inexpensive, and easily performed analysis of groundwater for virus contamination.

Chapter 2___________

Water-Sampling ProgramSite Selection

For this study, 150 water samples were collected. To analyze the PCR technique on as wide a variety of water quality parameters as possible, sites that were under the influence of surface water, sites that had previously exhibited high levels of certain inorganic substances, and sites with extremes of pH and tempera ture were initially selected. Physical characteristics included well depth; proximity to surface water, sewer lines, or septic tanks; and the type of geologic setting. All of the wells were actual drinking water production wells, not monitoring wells.

The site selection criteria can be summarized as follows:

1. Groundwater sites with high concentration of minerals, metals, or total organic carbon (TOC)

2. Sites with a previous detection of any virus or bacteria in the groundwater source

3. Potential exposure of groundwater to contaminations: Agricultural activities near the well Industrial activities near the well Septic tanks near the well

4. Sites with different pH values, temperatures, depths, production capacities, and aquifer types

5. Active pumping wells, not monitoring wells

Sampling Kit_______________________

To provide consistent sampling procedures, 30 identical sample kits were assembled. Each kit contained all equipment needed to collect a sample, including all hoses and connectors, a filter and a filter housing, protective gloves, reusable ice packs, sample bottles, a sample data sheet, and a detailed written protocol. The kits also included a water meter to enable the sampler to record how much water was sampled, as well as an in-line flow-restricting device to limit the filtration rate to


Figure 2.1 Sampling kit

4 gpm (15 L/min). The sample kit is illustrated in Figure 2.1. The full list of contents was as follows:

Filter housing containing a 1MDS filterA hose with a brass quick-connect, a backflow prevention valve, anda flow restrictorTwo additional hoses with a quick-connect tap connectionA brass quick-connect tap connectionpH meterThermometerWater meterThree ice packsTwo 1-L presterilized bottlesSurgical glovesSample data sheetSample collection protocolAluminum foil sheetsReturn address label with shipping instructionsTraining video

Water-Sampling Program II

Water-Sampling Training Video_____________

Additionally, to help ensure a consistent water-sampling procedure, a 10-minute VHS video was professionally produced detailing and illustrating all of the procedures. It shows all steps of the sampling protocol from the time the sampler received the sampling kit until the sample was returned. The training video was provided to samplers before their first sample collection.

Sampling Program____________________

The sampling kit was provided to the samplers a week before the sample collection. The minimum sample volume collected was 1,500 L (400 gal) at a maximum flow rate of 15 L/min (4 gpm). The sampler measured water temperature and pH at the time of sample collection, then returned the 1MDS filter along with two 1-L (3.78 gal) samples of the raw water by overnight courier. The efficiency of the adsorption of viruses to 1MDS filters is greatly reduced when groundwater with pH values greater than 8.0 are sampled; however, no adjustments were made on the one sample that had a pH value greater than 8.0. Microbial, general chemistry, turbidity, and conductivity analyses were conducted at the Quality Control and Research Laboratory of the American Waterworks Service Company Inc. (Belleville, 111.).

The sampling program can be summarized as follows:

1. Water sampling started in March 1994 and ended in November 1995.

2. One hundred fifty samples were collected.3. Sampling kits were shipped out to the sites and were returned to the

laboratory via an overnight courier immediately after sampling.4. Sampling kits were disinfected before being shipped to new sites.

Physicochemical Analysis_______________

Samplers measured water temperature and pH at the time of sampling at the collection site. Turbidity and UV absorbance at 254 nm were measured upon receipt of the samples. One liter of water sample was used for the general chemistry (USEPA method 300.0 for minerals [USEPA 1993] and USEPA methods 200.7 and 200.8 for metals [USEPA 1994]) and the TOC analysis.

To determine whether a water sample had high or low aquatic humic materials, the specific UV absorbance (SUVA) was measured. The SUVA is defined as the UV absorbance at 254 nm (expressed as per meter of absorbance) divided by the dissolved organic carbon (DOC) concentration in mg/L. A SUVA value above 4 shows that the DOC of a water sample is composed largely of aquatic humic material. A SUVA value of less than 3 indicates that the DOC is composed largely of nonhumic material (Edzwald and Van Bens£hoten 1990).

Chapter 3

Methods DevelopmentThe PCR technique is a sensitive reaction, but when it is not optimized it can

result in a nonspecific amplification, lower sensitivity, or inhibition of the reaction. (Nonspecific amplification refers to the amplification of DNA other than the DNA of interest.) Before the actual testing of environmental samples, numerous experi ments were performed to determine the optimum sample pretreatment procedures and the optimum RT-PCR reaction conditions. This chapter details those experi ments, and Chapter 4 details the protocols and procedures used for the testing of groundwater samples.

Optimization of RT-PCR_________________

Optimization of RT-PCR involved the following steps:

1. Optimization of the reaction components: The amounts of all enzymes used reverse transcriptase, RNase inhibitor, and DNA polymerase were altered to find the most effective enzyme combination. Additionally, the concentrations and pHs of necessary reagents were altered to maximize the enzymatic reaction.

2. Optimization of the reaction conditions: The reaction temperatures, cycle time, number of cycles, and reaction volume were varied to maximize the reaction effectiveness, as measured by the sensitivity of virus-seeded samples.

3. Implementation of confirmation and control steps: With each set of reactions, both positive (virus-seeded water) and negative reagent controls (water only as the sample) were also performed. Southern transfer of all gels was performed, and the resulting membranes were probed with radiolabeled internal probes to confirm or reveal positive or negative samples.

The following paragraphs summarize the experiments conducted to arrive at the present sample pretreatment and RT-PCR. The complete protocol including inhibitor removal and RT-PCR is listed in Chapter 4.

Initially, the reaction volumes used were 30 uL for the reverse transcription reaction and 100 uL for PCR (including the 30-uL RT reaction). Experiments designed to optimize the sample treatment and reaction conditions are detailed in this chapter.

13


Reducing Sample Concentrate Volume

Concentration to 30 mL is common for a sample volume of 1,000-1,500 L (265^00 gal). Briefly, samples are concentrated by first using a solution of beef extract for elution. Then, lowering the pH of the beef extract solution allows proteins and viruses to be precipitated out of the solution. The mixture is then centrifuged, the supernatant is removed, and the resulting pellet of proteins and viruses is resuspended in a buffer solution. Since viruses may be present in very low concentrations in water samples, efforts were made to reduce the buffer volume to increase the amount of the total equivalent volume assayed by RT-PCR.

An attempt to resuspend the pellet in 10 mL of a buffer, rather than the usual 30 mL, presented some problems. Because the pellets vary in size and viscosity, 10 mL was either an insufficient volume to fully resuspend the pellet or, with larger pellets, resulted in a resuspension that was greater than 10 mL. Both problems were overcome when the buffer volume was increased to 15 mL, and this volume was used for the remainder of the project, resulting in a twofold increase in the amount of sample assayed by RT-PCR. However, there was no attempt to determine the effect of reducing the volume from a standard amount of 30 mL to 15 mL on recovery efficiency. When this volume reduction is combined with the large-volume PCR reaction (described in Chapter 4), a tenfold increase in the total equivalent volume assayed by RT-PCR can be accomplished.

Pre-PCR Concentrate Treatment___________

One problematic aspect of applying RT-PCR to environmental water samples is the removal or neutralization of naturally occurring substances that inhibit the RT reaction and/or PCR amplification. A goal of this project was to arrive at a procedure that would render nearly all samples capable of being assayed by PCR. The approach focused first on isolating potential viruses, either through chromatographic separation or through filtration based on molecular size, then on releasing RNA from any viruses present in the sample and isolating the RNA from other sample components. Included in both approaches was the use of a chelating resin (Chelex 100, Bio-Rad, Hercules, Calif.) to bind metal ions.

Experiments were performed in which sample concentrates were placed atop a column of Sephadex G-100 (Pharmacia, Piscataway, N.J.) overlaid with Chelex 100. The column was then centrifuged, and the portion of the sample not retained in the column was subjected to RT-PCR. Although this approach was useful with relatively "clean" samples, several samples continued to resist ampli fication in PCR.

Experiments were also conducted in which samples were filtered through membranes designed to allow only molecules larger than 100,000 D to pass (Microcon 100, Amicon Inc., Beverly, Mass.). This approach was also less than optimal, as several samples still could not be amplified with RT-PCR.

One possible explanation for the lack of success of both approaches is that whatever substances that were present to inhibit the reaction were similar in size to or larger than the virus particles. In the first experiments, based on size separation,

Methods Development 15

any molecules approximately the same size as viruses would co-migrate through the column with the viruses. In the second approach, inhibitory molecules of the same size or larger would be trapped on the filter along with the viruses. One suspected class of inhibitory molecules is the humic acids organic molecules associated with decaying organic matter spanning a large molecular size range shown to inhibit PCR (Tsai and Olson 1992).

Another approach used and ultimately incorporated in the authors' pro tocol relied on the use of an organic solvent to dissolve and separate organic matter in the sample concentrates. The use of a phenol:chloroform mixture is widely used to separate nucleic acids from bacterial and other cells by denaturing and precipitating proteins and lipids (Sambrook, Fritsch, and Maniatis 1989). When the pH of the phenol solution is less then 7.0, DNA will also be denatured and precipitated, leaving RNA in the aqueous phase. Since the viruses the authors were attempting to detect are all RNA viruses, an acidic phenol:chloroform mixture (5:1 ratio) was used for RNA isolation. The sample was mixed volume for volume (500 uL of each) with the acidic phenol:chloroform mixture, and the resulting RNA was isolated using columns of Sephadex G-100 (Pharmacia, Piscataway, N.J.) (see Chapter 4). Rather than using centrifugation through Sephadex to isolate the extracted RNA from extraneous material, it was found that a drip column fractionization resulted in greater sensitivity in seeded reactions. To determine the fraction containing the maximum amount of extracted RNA, a virus-seeded sample of water was extracted with phenol:chloroform and the resulting aqueous portion applied to the Sephadex column. Nine 500-uL portions of water were then applied in succession, with each column elution collected in separate tubes. RT-PCR was then performed on all 10 fractions (fraction 1 represented the elution collected immediately following application of the sample). Fractions 3, 4, and 5 were the only fractions that exhibited amplification, with fraction 4 showing the most intense band on an ethidium stained gel (Figure 3.1). The collection of fraction 4 was shown to work consistently and was incorporated into the protocol used for the remainder of the study.

Optimization of Reaction Enzymes__________

Several reactions in which the amount of reverse transcriptase was altered allowed the determination of the minimum amount of enzymes required to obtain maximum amplification. It was determined that 9.5 units of reverse transcriptase were the optimum amounts. This was determined by seeding environmental samples with a known amount of virus and then subjecting the sample to RT-PCR using decreasing amounts of the enzyme. The reaction that matched the sensitivity of a positive control reaction (sterile, nuclease-free water seeded with poliovirus) was determined to be the reaction containing the optimum amount of the enzyme. The optimum amount of an RNasin ribonuclease inhibitor (Promega, Madison, Wis.) was also determined in the same manner. Fifty units of reverse transcriptase enzyme were optimal for maximum cDNA production. Three different reverse transcriptase enzymes AMV and M-MLV (Promega) and Superscript II (BRL Life Technologies) were evaluated. The third was clearly superior and was used exclusively. Unlike the other reverse transcriptases, Superscript II does not have


12345

388 IP __ 288 fcp , 188 fcp

Key: Lane M 100-base-pair DMA markerLane 1 Sephadex G-100 fraction 1Lane 2 Sephadex G-100 fraction 2Lane 3 Sephadex G-100 fraction 3Lane 4 Sephadex G-100 fraction 4Lane 5 Sephadex G-100 fraction 5Lane 6 Sephadex G-100 fraction 6Lane 7 Sephadex G-100 fraction 7Lane 8 Negative controlLane 9 Positive controlLane M 100-base-pair DMA marker

Figure 3.1 Ethidium-stained gel from poliovirus-seeded water experiment (103 pfu/mL; phenohchloroform extracted; fractionated through Sephadex G-100; 500-uL fractions)

any RNase H activity and therefore does not degrade the RNA template during cDNA synthesis.

Experiments were performed in which the product of the reverse transcrip tion was treated with RNase H, intending to degrade the RNA portion of the reaction, leaving only the cDNA for PCR. Some success was noted (i.e., higher intensity of PCR products visualized in agarose gels) with this procedure in virus- seeded water-based reactions. However, similar results were not seen when envi ronmental concentrates were used, and this additional reaction step was not used in the final protocol.


Reaction Conditions and Other Reagents_______

The PCR temperature and time parameters were altered to give maximum amplification with minimum nonspecific products. Annealing temperatures below 55 C resulted in excessive nonspecific products, as did more than 35 reaction cycles. The concentration of dNTPs in the reaction was optimized, and experiments using different sources of water autoclaved Milli-Q water (Millipore Corp., Bedford, Mass.), HPLC-grade water (Fisher Scientific, Pittsburgh, Pa.), and sterile, nuclease-free water (Amresco, Solon, Ohio) in the reaction were performed. The sterile, nuclease-free water gave the most consistent results.

Several different primer pairs were evaluated before the current pair was selected. The concentration of the primers was also varied in several experiments to arrive at the optimum level.

The Optiprime PCR Optimization Kit (Stratagene, La Jolla, Calif.) was used to vary several reaction conditions and component concentrations simulta neously, such as pH, Mg++ concentration, and KC1 concentration. The kit also includes for evaluation several commonly used reaction additives, such as dithiotreitol (DTT), dimethyl sulfoxide (DMSO), and bovine serum albumin (BSA). Provided with the kit are 12 different buffers that cover pHs of 8.3, 8.8, and 9.2; Mg++ at 1.5mM and 3.5mM; and KC1 at 25mM and 75mM. Twelve different control reactions were performed using a different buffer in each reaction. Buffer 12, supplied with the kit and containing 3.5mM Mg++ and 75mM KC1 at pH 9.2, provided superior amplification in the large-volume reaction based on visual analysis of an ethidium bromide stained agarose gel; it was used for the remainder of the study. Once the optimal buffer was determined, the adjunct substances provided with the kit were tested in buffer 12. These adjuncts included formamide, DMSO, glycerol, BSA, 750mM ammonium sulfate, and Perfect Match DNA Polymerase Enhancer (Stratagene, La Jolla, Calif.). None of the reaction additives demonstrated an increased sensitivity over the use of the buffer alone.

Experiments were conducted to increase the reaction size by performing a 300-uL reverse transcription reaction and using increasing amounts from this reaction (10, 20, and 50 uL) in a 100-uL PCR reaction. Each increase in the RT reaction amount caused a greater PCR amplification. Eventually the authors decided to use the entire RT reaction in the PCR, setting up a 290-uL RT reaction and adding 10 uL of PCR cocktail consisting of primers and AmpliTaq (Perkin Elmer, Foster City, Calif.) to the entire reaction. This proved successful and is the method currently used.

The optimal amount of sample concentrate added to the RT reaction was also investigated. Reactions were performed using 200, 150, 100, and 50 uL of the treated sample. It was determined that 50 uL of the concentrate resulted in the maximum amplification, presumably because of sufficient dilution of inhibitors without significant loss of detectable viruses.


Short, Sequence-Specific Primers

A number of experiments were conducted to evaluate the usefulness of short, sequence-specific (SSS) primers in the reverse transcription phase of virus detection. These primers, used instead of random hexamers, are short (10 to 1.4 base pairs in length) and are specific to the area near the 5-prime end of the amplicon. The use of the short, sequence-specific primers, as opposed to random primers, has been shown to increase the detection of low-copy-number cDNA by RT-PCR (Pfeffer, Fecarotta, and Vidali 1995) to generate more cDNA containing the desired amplicon. The short primers have a melting temperature lower than temperatures used in the PCR reaction; thus, they fail to anneal to the template during the amplification reaction.

Two SSS primers were selected for evaluation using the Gene Runner computer software program (Hastings Software Inc., Hastings, N. Y.). Both primers corresponded to an area very close to the 5-prime end of the amplicon. One primer was 14 base pairs long, and the other was 12 base pairs in length. The selection was based on their proximity to the beginning of the amplicon and on the computer analysis prediction of a lack of secondary structure and melting temperatures in the proper range (less than 40 C).

In controlled, seeded experiments (high-performance liquid chromatography [HPLC] grade water and seeded poliovirus), these primers showed improved sensitivity. However, when the primers were used with environmental samples, this improvement was not seen. One sample showed a positive result when SSS primers were used in place of random primers, but several showed the opposite result. The reason for this is not known but may suggest that any inhibitors present in the sample act on the ability of primer to anneal to the template. Overall, upon comparing those samples assayed using both random hexamers and SSS primers, the authors decided to continue the use of random hexamers.

Confirmation and Control________________

Under suboptimal conditions, DNA sequences different from the desired sequence may be amplified in a PCR reaction and may be approximately the same size as the desired PCR product. It is therefore important to confirm that the PCR product observed on a gel is the actual desired product. The confirmation of PCR amplification was evaluated by two different techniques: Southern hybridization and semi-nested PCR assays.

Southern hybridization is a technique in which the PCR product (or any DNA in a gel) is transferred to a membrane, usually made of nitrocellulose or nylon. The DNA is then fixed to the membrane, either by baking or by exposure to ultraviolet light, resulting in cross-linking of the DNA to the membrane material. The membrane is then soaked in a solution containing a 32P-labeled DNA probe having a sequence that matches some of the sequence expected in the PCR product. Following this hybridization step, the membrane is allowed to expose a sheet of X-ray film. If the desired PCR product was on the membrane, a dark band of the appropriate size (as compared to a positive control) will appear on the film. A


AGCATCGATC (primer !)->

TCGTAGCTAGCTAGCTATATCGCGGCTATCGCGATCGCGATATCGCGATCGCAGCTAGCGA(torge^A^)

<--CGCTAGCGCTA <- CGTCGATCGCT (primer 2)

(nestedprimer /probe)

Figure 3.2 Sample illustration of target DMA, primers 1 and 2, and nested primer-probe for semi-nested PCR assay

complete description of this procedure and an illustration of the results are included in Chapter 4.

The same DNA probe as used in Southern hybridization was also employed as a primer in a semi-nested PCR reaction. This technique employs a second PCR amplification, into which a small portion of the first PCR product has been added. In the second reaction, one of the original primers is reutilized, whereas the second primer is replaced with a primer having a sequence that matches a portion of the target DNA between the first two primers, as illustrated in Figure 3.2.

In the first PCR reaction, the entire target DNA should be amplified, whereas in the second reaction, if the target DNA is actually present, only the portion in bold type would be amplified. If the target DNA is not present, the nested primer should fail to anneal to the targeted region, and the reaction will fail. Because of its speed and sensitivity, the semi-nested reaction can be incorporated into a basic assay strategy.

Treatment of Samples Highly Resistant to Amplification_______________________

Five samples were shown to be highly inhibitory to RT-PCR. The samples had very dark coloration in common. Inhibition was shown by an inability for poliovirus to be detected when it was seeded into these samples and by the absence of "primer-dimers" in unseeded reactions. Primer-dimers are PCR artifacts result ing from the amplification of the primers themselves during PCR. They usually approximate the combined size of both primers and are common in certain reactions, i.e., for certain primer pairs.

Several tactics were tested to overcome this inhibition. First, semi-nested PCR was performed on the samples that failed to show amplification when seeded. One sample exhibited amplification in the second reaction when the sample was initially seeded with 10 pfu. One other sample showed primer-dimer product but no PCR product.

Next, the amount of the sample used in the reaction was reduced from 50 uL to either 10 fiL or 25 uL. The rationale was that further dilution of the inhibitors would facilitate the reaction. No improvement was seen with this

20 PCR Technologies for Virus Detection in Ground-water

approach. A reduction in the PCR annealing temperature was also examined. This too did not affect the resistant samples, although the positive controls showed the expected decrease in specificity.

DNA polymerase requires magnesium to function and is always present in a PCR reaction'. If a sample contained material that would somehow remove the magnesium added to the reaction, inhibition could occur. To test whether additional magnesium in the PCR reaction was beneficial, reactions were run using a twofold increase in the concentration of Mg++ . This also did not affect the seeded samples (i.e., there was still no amplification), but it greatly reduced the reaction product in the positive control tube.

The five samples were finally reverse transcribed using SSS primers, as discussed earlier. One sample showed amplification when seeded with these primers as opposed to the random hexamer primers.

Finally, the two remaining resistant samples were used as substrate in reactions in which cDNA generated in a positive control was seeded into the samples and subjected to PCR. No reaction products, either amplicons or primer-dimers, were shown, suggesting that the inhibition may occur in either the RT reaction, the PCR reaction, or both.

The following conclusions may be drawn from these experiments:

1. The authors' basic protocol phenol xhloroform extraction followed by Sephadex G-100 (Pharmacia, Piscataway, N.J.) fractionization and large-volume RT-PCR allows for sufficient removal or dilution of inhibitors so that more than 95 percent of the samples can be assayed by RT-PCR using the three sets of primers designed to detect enterpviruses, hepatitis A virus, and rotavirus.

2. Inhibiting substances vary by sample and seem to inhibit either the reverse transcription or the PCR amplification.

3. Reassaying samples resistant to amplification by performing a second reaction using a different volume of concentrate or semi- nested primer pairs (or a different set of primers) may allow the samples to be assayed by RT-PCR.

4. Certain groundwater samples, when eluted, reconcentrated, and pretreated, may still contain too many inhibitors to be removed, neutralized, or diluted. RT-PCR may not be possible with these samples.

Chapter 4

Materials and MethodsChapter 3 detailed experiments designed to optimize the sample pretreat-

ment and RT-PCR reaction conditions. The present chapter provides the complete details of the finalized procedures used in testing environmental samples.

Sample Collection____________________

Groundwater samples were obtained by passing a minimum of 400 gal (1,500 L) of raw groundwater (before any treatment) through a 1MDS filter (CUNO, Inc., Meriden, Conn.) at a flow rate of no more than 4 gpm (15 L/min). The filters remained in the filter housing and were shipped by overnight courier at 4 C (39 F) and processed within 48 hours of the completion of sample collection.

Filter Elution________________________

The filters were eluted using an autoclaved solution of 1.5 percent beef extract (Becton Dickinson, Cockeysville, Md.), 0.05M glycine (U.S. Biochemical, Cleveland, Ohio), pH 9.4. One liter of the beef extract solution was poured into the filter housing containing the 1MDS filter and left for 15 minutes. The solution was then forced from the filter housing into a sterile 2-L beaker using nitrogen gas (N2 ). The eluan was then poured back into the filter housing and again forced out using N2 into the same beaker. The pH of the solution was then lowered to 7.1-7.3 using IM HCI and stirred for 15 minutes. Then 40 mL of the eluant was mixed with 4 mL glycerol (10 percent) and stored at -80 C until the bacteriophage assay was performed. Another 100 mL was stored at -80 C for archival purposes.

Virus Flocculation and Reconcentration________

The elution solution was either stored at -20 C or immediately adjusted to pH 3.5 and stirred for 15 minutes. The solution was then centrifuged for 30 minutes at 4,000xg at 4 C. The resulting pellet was resuspended in 0.15MNa2HPO4 (pH 9.4) and transferred to a 50-mL centrifuge tube. The pH was adjusted to 7.2 and the volume brought to 15 mL with 0.15M Na2HPO4 (pH 7.2). The solution was then

27


mixed with an equal volume of FREON (Fisher Scientific, Pittsburgh, Pa., and Aldrich Chemical, Milwaukee, Wis.), vortexed for 2 minutes, and centrifuged at 2,700xg for 10 minutes. The upper, aqueous portion was removed and transferred to a fresh 15-mL tube, and the volume was brought to 15 mL using 0.15M Na2HPO4 (pH 7.2). One-half of this 15-mL volume (7.5 mL) was stored at -80 C for use in PCR analysis. The other half (50 percent of the original pellet) was brought to 15 mL with 0.1 5M Na2HPO4 , pH 7.2, and was stored at -80 C until used in the cell culture analysis.

Cell Culture Assay____________________

Buffalo Green monkey kidney cells were grown to confluent monolayers in 25-cm2 and 75-cm2 plastic flasks using Eagle's minimum essential medium with Earle's salts (Irvine Scientific, Irvine, Calif.) containing 10 percent fetal bovine serum (Sigma Chemical, St. Louis, Mo.). Included in the maintenance media were antibiotics and antimycotic solutions (BRL Life Technologies, Gaithersburg, Md.) containing 100 units/mL penicillin, 100 ug/mL streptomycin, and 0.25 ug/mL amphotericin B. Before the actual assay, 1 mL of the concentrate was placed on BGM cells in a 25-cm2 flask, and the monolayer was observed for up to 1 week for toxicity or bacterial contamination. If toxicity was observed, the sample was diluted 1:3 in 0.1 5M sodium phosphate (pH 7.0-7.5) for the actual assay. If bacterial contamination was observed, concentrate was filtered through a 0.2-uM filter (Millipore, Bedford, Mass.) through which 10 mL of 1.5 percent beef extract had been passed. Before exposure to the sample, the growth medium was poured off and the cell monolayer was washed twice with Tris (Sigma Chemical) buffered saline solution. For each sample, a 3-mL volume of the final concentrate was inoculated into each of four 75-cm2 flasks. A total of 12 mL volume of the final concentrate was assayed for each sample. The flasks were incubated at 37 C for 60 minutes and rocked every 15 minutes to facilitate virus adsorption to the cells. Twenty milliliters of maintenance medium consisting of Eagle's minimum essential medium supple mented with 2 percent fetal bovine serum and 1 mL of gentamicin (BRL Life Technologies) (50 ug/mL) was added to each flask. The flasks were incubated at 37 C and examined daily for 14 days for viral cytopathic effect (CPE). Any flask with suspected viral CPE was confirmed by inoculation of the medium onto a fresh monolayer of BGM and the cells observed for CPE. The analysis is summarized in Figure 4.1.

All samples that were negative for CPE on the first passage were passed a second time on BGM cells. All samples that exhibited CPE were confirmed by two additional passages on BGM cells.

Bacteriophage Assay__________________

Bacteriophages are viruses that infect bacteria and use bacterial cells as their replicative hosts. Coliphages are bacteriophages associated with the E. coli family of bacteria. Bacteriophages are also classified according to their mode of infection. Male-specific (also called F-specific) bacteriophages attach to the cells'

Materials and Methods 23

BGM CELLS (15 mL of Sample Concentrate)

I3.3 mL

I3mL

13mL

I3mL

I3mL

1Save 2.7 mL

Positive control with5-lOPFUof

poliovirus

75cm2

flask

75cm2

flask

75cm2

flask

75cm2

flask

Observed for CPE for 14 days

V

If Positive, cell harvest was filtered and passed onto a fresh monolayer for confirmation.

APassed on from each flask onto fresh monolayers of BGM cells in 25cm2 flasks. Observed for CPE for 14 days. If positive, after the second 14 days

PCR for viruses An Aliquot of sample concentrate and cell harvest were used for the PCR assay.

Figure 4.1 Cell culture assay


short, hairlike projections called pili whereas somatic bacteriophages attach directly to the bacterial cell wall. Bacteria without the hairlike projections cannot be infected by male-specific bacteriophages.

Recent research (Sobsey 1990) suggests that male-specific bacterio-phages are similar to enteric viruses in terms of size, shape, survival, and transport behavior in the environment. In addition, their removal during coagulation practices is similar to that for enteroviruses (Abbaszadegan et al. 1997b). A good correlation between the presence of F-specific RNA bacteriophages and enteric viruses in fresh water has also been reported (Havelaar, Van Olphen, and Drost 1993).

Besides cell culture and PCR assays, bacteriophage analyses were per formed on the water samples collected during this study to investigate the occur rence of bacteriophages in groundwater samples and possible correlations with both RT-PCR and cell culture results.

The following phage hosts were used for the coliphage assays:

1. E. coli C (American Type Culture Collection [ATCC] 13706): This host was proposed for the Information Collection Rule (ICR) protocol. It is also listed in Standard Methods for the Examination of Water and Wastewater- as the proposed host for coliphage detection.

2. E. coli C-3000 (ATCC 15597): This organism is the host used to detect F-specific coliphage MS-2 (MS-2 phage). This host has been widely used in groundwater sampling.

3. Salmonella typhimurium WG-49: This strain, constructed by Havelaar's group (Havelaar, Van Olphen, and Drost 1993), is specific for male-specific (FRNA) bacteriophage. This host can be infected by somatic Salmonella phages and by male-specific RNA and DNA bacteriophages. Havelaar's group found a good correlation between the presence of enteric viruses and F-specific RNA bacteriophages in fresh surface water.

The following bacteriophages were used as positive controls:

1. MS-2 (ATCC 15597-B1) was used with the hosts E. coli C-3000 and Salmonella typhimurium WG-49.

2. O XI74 (ATCC 13706-B1) was used with the host£. coli C.

The day prior to the phage assay, liquid bacterial cultures were started from glycerol frozen stocks by adding one loopful of bacterial stock to 30 mL of liquid media (see Appendix A for media used in bacteriophage assays). The cultures were grown overnight, with vigorous shaking, at 37 C. On the day of the assay, 1 mL of the overnight culture was transferred to 25 mL of fresh liquid media, and the culture was grown, with shaking, for 4 hours at 37 C.

A total of 10 mL of the pH 7.2 filter eluant was assayed for bacterio-phage. For each assay, 5 mL of the eluant was added to 0.1 mL of the appropriate 4-hour bacterial culture and 4 mL of warmed agar (48 C). The mixture was vortexed briefly and immediately poured onto a room-temperature bottom agar plate. The plates were inverted and incubated overnight at 37 C and examined for plaques the following day. The equivalent volume assayed for each host was approximately 15 L.


Total Coliform Test____________________

At the time of the sample collection, a 1-L sample of raw water was collected into a sterile polypropylene container and returned, on ice, in the sampling kit. Within 24 hours of receipt, three 100-mL portions of this sample were assayed for total coliforms by membrane filtration through a 0.45-um filter, which was then incubated on m Endo Agar LES (Difco Laboratories, Detroit, Mich.) for 24 hours at 35 C. Results were reported as either positive or negative for total coliform colonies. Negative controls, consisting of 100 mL of autoclaved Milli-Q water (Millipore Inc., Bedford, Mass.), were run along with each set of raw water samples.

Total Organic Carbon Assay______________

TOC analyses were done in triplicate in the Belleville, 111., laboratory of the American Water Works Service Company Inc. Three 5-mL portions of each raw water sample were analyzed with a TOC-5000 total organic carbon analyzer (Shimadzu Inc., Columbia, Md.).

UV-254 Analysis______________________

Two 2-mL portions of each raw water sample were analyzed for spectral absorbance at 254 nm (i.e., a UV-254 analysis was conducted) using a Milton Roy Spectronic 21-D spectrophotometer (Milton Roy, Rochester, N.Y.). The water sample was placed in a quartz cuvette (Spectrocell Corp., Oreland, Pa.), and duplicate readings were taken. The instrument was zeroed using Milli-Q water (Millipore Inc., Bedford, Mass.).

Chemical Analysis____________________

At the time of the sample collection, a 1,000-mL sample of raw water was collected in a sterile polypropylene container and was used for chemical analysis performed in the Belleville, 111., laboratory of the American Water Works Service Company Inc. Tests were performed according to current USEPA accepted proto cols. A summary of the chemical assays and methods used is detailed in Table 5.6 (p.39).

Primers and Probes Used for Virus Detection_____

The primers used for the detection of enteroviruses in the sample concen trates (5' - CCT CCG GCC CCT GAA TG - 3') and (5' - ACC GGA TGG CCA ATC CAA - 3') produce a 196-base-pair product (DeLeon et al. 1990). The


internal probe used for hybridization consisted of (5' CCC AAA GTA GTC GOT TCC CGC 3') (Abbaszadegan et al. 1993).

The hepatitis A virus primers (5' - CAG CAC ATC AGA AAG GTG AG 3') and (5' CTC CAG AAT CAT CTC CAA C - 3') produce a 192-base-pair product (DeLeon et al. 1990). The hybridization probe consisted of the sequence (5' AAT GTT TAT CTT TCA GCA A 3').

The upstream primer for rotavirus (CON 1,5'- TTG CCA CCA ATT CAG AAT AC - 3') and downstream primer (CON 2,5' - ATT TCG GAC CAT TTA TAA CC - 3') produce a 211-base-pair product. The rotavirus primer sequences were kindly provided by Jon Gentsch at the Centers for Disease Control, Viral Gastroenteritis Unit, Atlanta, Ga., as was the sequence for the hybridization probe, AVP4-C: (5' AGA GAG CAC AAG TTA ATG AAG 3').

Large-Volume Polymerase Chain Reaction_______

Most manufacturers of the enzymes needed for PCR describe reaction protocols in which the total reaction volume ranges between 30 and 100 uL. These are also the most commonly described reaction volumes in the scientific literature, although reactions of 10 uL or less are common. A trend has been observed in which the reaction volume is reduced to conserve reagents and to facilitate many reactions being run simultaneously. The drawback to this approach, with respect to analyzing environmental samples, is the examination of smaller portions of a potentially dilute source.

The authors initially followed their own previous protocol (Abbaszadegan et al. 1993) using 10 uL of a sample in 30 uL of reverse transcription reaction. This 10 uL represented 0.5 L of the original sample. Because viral contamination may be at very low concentrations and still present health problems, the authors wished to maximize the sample size. The authors have accomplished this by increasing the sample to 50 uL, representative of 5 L of original sample (1,500 L is concentrated to 15 mL) without a five-fold increase in the reaction size or reagents. The amount of RNase inhibitor is 3.3 times the amount used in the smaller reaction, and the amount of reverse transcriptase is only twice the amount used in the smaller reaction, so a tenfold increase in reaction volume is accomplished with about a 2.5-fold increase in cost. Additionally, the sensitivity of the reaction is greater and the results more consistent.

Pre-PCR Sample Treatment_______________

Before PCR analysis, each sample concentrate was extracted once with phenol:chloroform (5:1, pH 4.7) (Amresco Inc., Solon, Ohio) and once with chloroform (Amresco). The concentrate was combined 1:1 with the phenol:chloroform mixture and vortexed for 3 minutes. The sample was then centrifuged for 15 minutes at 14,000xg. The aqueous portion was removed and combined with an equal volume of chloroform, vortexed for 1 minute, and centrifuged for 5 minutes at 14,000xg. The resulting aqueous portion (500 to 750 uL) was applied to the top of a column consisting of 5 mL of autoclaved DNA


Grade Sephadex G-100 (Pharmacia Biotech, Piscataway, N.J.), equilibrated in HPLC grade water, in a 5-mL syringe plugged at the bottom with a 1-in. (25-cm) square piece of sterile Kirn-Wipe tissue (Kimberly-Clark Corp., Roswell, Ga.). The initial column eluant was discarded. Three successive 750-uL aliquots of HPLC grade H2O were applied, the column being allowed to drain between each application. The first two column eluants were discarded. The final 750-uL eluant fraction was collected in a 1.5-mL microcentrifuge tube containing approximately a 50-uL volume of autoclaved Chelex 100 resin (Bio-Rad Laboratories, Hercules, Calif.) and was stored at -20 C until RT-PCR analysis.

Reverse Transcription Reaction_____________

Two RT-PCR reactions were performed on each sample concentrate. One 50-uL reaction (total reaction volume) was seeded with 10 pfu of poliovirus or hepatitis A virus or 10 TCID50 (tissue culture infective dose 50) of rotavirus, whereas the other reaction consisted only of the sample and was performed in a final volume of 300 uL. (The amount of virus used in the seeded samples is more than might be expected in an environmental sample; however, the purpose of seeding the concentrates was to provide a rapid and definitive indication of whether or not the sample would permit amplification of virus. A sample seeded with less virus may undergo amplification, but the amount of reaction product may be difficult or impossible to detect without additional, time-consuming confirmation steps such as Southern hybridization.)

The smaller-volume, seeded reverse transcription reactions were per formed as follows: 10 uL of the sample was combined with 5 uL of sterile, nuclease- free water containing either 10 pfu or 10 TCID50 of the virus along with 0.7 uL random hexamers (250uM stock) in a 500-uL microcentrifuge tube. The mixture was heated at 99 C for 4 minutes and then placed on ice. A reaction cocktail of 33 uL was then added, consisting of 18.3 uL of sterile, nuclease-free water, 6 uL lOx buffer (35mM MgCl2 , 750mM KC1, lOOmM Tris, pH 9.5), 6 uL dithiothreitol (0.1 M), 1.3 uL dNTP mix (lOmMeach dNTP), 0.8 uL of RNasin RNase inhibitor (40 units/uL) (Promega, Madison, Wis.), and 0.4 uL Superscript II Reverse Transcriptase (200 units/uL) (BRL Life Technologies, Gaithersburg, Md.). The reverse transcription reaction, 48.5 uL total volume, was then incubated at 25 C for 15 minutes and 42 C for 45 minutes and then heated to 99 C for 5 minutes. The reaction product was then stored at 4 C until the amplification reaction was performed.

For the large-volume, unseeded reaction, 50 uL of sample and 50 uL of sterile, nuclease-free water were combined with 4 uL of random hexamers (250uA/ stock) (Pharmacia Biotech, Piscataway, N.J.) in a 500-uL microcentrifuge tube. The mixture was heated at 99 C for 4 minutes and then placed on ice. A reaction cocktail of 186 uL was prepared by combining 110.5 uL sterile, nuclease- free water, 30 uL lOx buffer (35mM MgCl2 , 750mM KC1, lOOmM Tris, pH 9.5), 30 uL DTT (0.1M), 8 uL dNTP mix (1 OmM each dNTP) (Pharmacia Biotech), 5 uL of RNasin (40 units/uL) (Promega) and 2.5 uL Superscript II Reverse Transcriptase


(200 units/uL) (BRL Life Technologies) and added to the tube containing the sample. The reverse transcription reaction, 290 \\L total volume, was then incubated at 25 C for 15 minutes and 42 C for 45 minutes and then heated to 99 C for 5 minutes. The reaction product was then stored at 4 C until the amplification reaction was performed.

cDNA Amplification by PCR_______________

PCR, using the entire reverse transcription reaction, was performed by the addition of a reaction cocktail consisting of primers and AmpHTaq DNA polymerase (Perkin Elmer, Foster City, Calif.).

For the small-volume, virus-seeded reaction, a 1.5-uL cocktail consisting of 0.3 uL of each primer (75uM), 0.3 uL of AmpliTaq DNA polymerase (1.5 units), and 0.6 uL of water was added to the reverse transcription reaction. The reaction volume was then incubated for 3 minutes at 96 C and subjected to 35 temperature cycles of 45 seconds at 94 C, 30 seconds at 55 C, and 45 seconds at 72 C. A final annealing phase was performed for 7 minutes at 72 C. The reaction products were stored at 4 C until analyzed by agarose gel electrophoresis.

For each large-volume (300-uL) reaction, a 10-uL cocktail consisting of 2 uL of each primer (75uM), 2 uL of AmpliTaq DNA polymerase, and 4 uL of water was prepared and added to the reverse transcription reaction. The reaction volume was then incubated for 4 minutes at 96 C and then subjected to 35 cycles, each consisting of 75 seconds at 94 C, 60 seconds at 55 C, and 75 seconds at 72 C. A final extension phase was performed at 72 C for 7 minutes. The reaction products were stored at 4 C until analyzed by agarose gel electrophoresis.

Agarose gel electrophoresis was performed in 1.6 percent agarose I gel (Amresco Inc., Solon, Ohio) containing 1.5 ug/mL of ethidium bromide. The gels were run for 2 hours at 100 constant volts and analyzed by photographing the gels as they were exposed to ultraviolet light using a UV transilluminator (UVP Inc., Upland, Calif.). Example illustrations of gel photographs are shown in Figures 4.2 and 4.3.

Hybridization Using Radiolabeied DNA Probes____

Following electrophoresis, agarose gels were soaked in 0.4A/ HC1 for 15 minutes, rinsed in Milli-Q water (Millipore, Bedford, Mass.), then soaked in 0.4M NaOH for 15 minutes to denature the double-stranded PCR product. The DNA was then Southern transferred (Southern 1975) to a charged nylon membrane (GeneScreen Plus, DuPont NEN Research, Boston, Mass.) using a vacuum blotter (Model 785, Bio-Rad, Hercules, Calif.). The membrane was soaked for 30 minutes in lOx SSC (1.5M sodium chloride, 0.15A/ sodium citrate, pH 7.0) and then placed atop a piece of blotting paper on the vacuum blotter surface. The blotter's surface was then overlaid with a plastic sheet in which a window smaller than the membrane was cut. The gel was placed over the membrane, 1 L of lOx SSC was added to the blotter chamber, and vacuum (5 in. [25.4 torr] Hg) was applied for 90 minutes. Following


1357 11 13 ' 15 17 19 P

E133-158 SEEPED 1/10/96

Key: Lane 1 123-base-pair markerLanes 2-19 Samples 133-150Lane P Positive control 10 pfu poliovirusLane N Negative controlLane 22 123-base-pair marker

Figure 4.2 Example gel photograph: Enterovirus-seeded reactions

1 2 3 4 5 6 7 8 9 10 11 1213

Key: Lane 1 Lanes 2-6 Lane 7-11 Lane 12 Lane 13

123-base-pair marker Seeded reactions, samples 80-84 Nonseeded reactions, samples 80-84 Positive control 10 TCID50 rotavirusNegative control

Figure 4.3 Example gel photograph: Rotavirus-seeded and nonseeded reactions


transfer, the membrane was soaked for 1 minute in 0.4MNaOH to denature the DNA on the membrane completely and then soaked in 1 .OM Tris-HCl (pH 7.5) (Sigma, St. Louis, Mo.) and 5x SSC for 1 minute to neutralize the NaOH. The membrane was placed between two pieces of blotting paper to remove excess moisture and then placed in an ultraviolet light chamber (UVC 500 UV Crosslinker, Pharmacia, Piscataway, N.J.) and exposed to 120,000 uJ/cm2 of UV-254 light. UV exposure resulted in the permanent fixation of transferred DNA to the nylon membrane, as recommended by the membrane manufacturer.

Following fixation of the DNA to the membrane, the membrane was placed in a glass roller bottle (Robbins Scientific, Sunnyvale, Calif.), and sufficient hybridization buffer (Rapid-Hyb, Amersham Life Sciences, Arlington Heights, 111.), prewarmed to 42 C, was added to the tube to soak the membrane completely. The hybridization buffer both facilitates the binding of the probe to the target DNA fixed to the membrane and prevents nonspecific binding of the probe to the membrane itself. The tube was placed in a hybridization incubator (Model 400, Robbins Scientific) equipped with a rotating tube holder, and the tube was rotated for 30 minutes at 42 C, after which 5 uL of radiolabeled DNA probe was added to the buffer in the tube. The tube was returned to the incubator and rotated for an additional 120 minutes at 42 C.

Following hybridization, the hybridization buffer was poured off and 30 mL of 2x SSC (0.3A/ sodium chloride, 0.03M sodium citrate, pH 7.0) was added to the bottle. The bottle was gently shaken by hand for 10 minutes at room temperature. The wash solution was then poured off and an additional 30 mL of 2x SSC was added to the tube, which was again gently shaken for 10 minutes at room temperature. The wash solution was discarded, and approximately 30 mL of 2x SSC and 1 percent (SDS), prewarmed to 42 C, was added to the bottle, the bottle was rotated in the hybridization incubator for 20 minutes at 42 C. After 20 minutes, the wash solution was poured off, and 30 mL of 0.2x SSC and 1 percent SDS, prewarmed to 42 C, was added to the bottle. The bottle was again rotated in the incubator for 20 minutes at 42 C.

The membrane was blotted to remove excess moisture and placed in a scalable plastic envelope (Kapak Corp., Minneapolis, Minn.). The envelope was placed in a photographic exposure cassette (TMC International, Glenview, 111.) and allowed to expose a sheet of X-ray film (X-OMAT AR, Eastman Kodak Co., Rochester, N.Y.) overnight at -80 C. Depending on the intensity of the signal observed on the film, some exposures were repeated for as little as 2 hours or as long as 48 hours. The film was developed according to the film manufacturer's direc tions. An example of an autoradiograph is illustrated in Figure 4.4.

Radiolabeling of DNA Probes______________

DNA probes were 3-prime end-labeled with 32P dATP (Amersham Life Sciences, Arlington Heights, 111.) using the DNA 3' End Labeling System (Promega, Madison, Wis.). For a 20-uL reaction, 4 uL of 5x Terminal Transferase buffer (supplied with the End Labeling Systems Kit), 1 uL of DNA probe (2 picomoles [pmol]), 1 uL of Terminal Transferase (10-20 units/uL), 1.6 uL of 32P-labeled dATP (800 Ci/mmol), and 12.4 uL of water were added to a 50-uL microcentrifuge


2 3 4 S 6 7 8 9 10 11 12 13 14 15

Key: Lane 1 123-base-pair markerLanes 2-9 Samples 1, 6, 16, 31, 32, 46, 47, 54Lane 10 Negative controlLane 11 Positive control 10 TCID50 rotavirus

Figure 4.4 Gel photograph and autoradiograph of the same samples (assayed for rotavirus positive samples in lanes 6, 7, and 9)


tube. The tube was incubated for 60 minutes at 37 C, and the reaction was stopped by heating for 10 minutes at 70 C. The labeled probe was stored at -20 C for 10 days or less, until used.

RT-PCR Confirmation of Cell Culture Results_____

To confirm the cell culture results, the culture flask contents were subjected to RT-PCR using enterovirus-specific primers. Following the cell culture analysis, the flasks were frozen at-80 C and then thawed. The resulting lysed cells and media were then stored until the RT-PCR assay.

Two hundred microliters of the cell harvest was placed in a 100,000-D molecular weight cutoff filter (Microcon 100, Amicon Inc., Bedford, Mass.), which was then placed in a 1.5-mL centrifuge tube and centrifuged at 500xg for 15 minutes at room temperature, according to the filter manufacturer's protocol. Fifty microliters of water was placed on the filter to resuspend any virus particles and the filter was inverted in a fresh 1.5-mL tube and centrifuged for 1 minute at 14,000xg. The supernatant collected was then subjected to RT-PCR as described previously (50-uL reaction).

Chapter 5

ResultsRT-PCR Analysis of Environmental Concentrates

One hundred fifty samples were analyzed by RT-PCR for enteroviruses, hepatitis A virus, and rotavirus. Each sample was assayed twice for each virus once using only the concentrate as a template for RT-PCR, and once using the concentrate seeded with either 10 pfu of poliovirus, 10 pfu of hepatitis A virus, or 10TCID50 of rotavirus.

When primers specific for enteroviruses in RT-PCR reactions were used, 17 samples (11.3 percent) failed to exhibit amplification when seeded. Of the samples that could be assayed, 40 of 133 (30.1 percent) were deemed positive for the presence of enterovirus RNA.

When primers specific for hepatitis A virus were used in the RT-PCR reactions, 11 samples (7.3 percent) failed to exhibit amplification when seeded. Of the samples that could be assayed, 12 of 139 (8.6 percent) were deemed positive for the presence of hepatitis A viral RNA.

RT-PCR analysis using rotavirus-specific primers resulted in 20 samples (13.3 percent) unable to be assayed. Of the remaining 130 samples, 18 (13.8 percent) were positive for rotavirus RNA.

For all samples, only five could not be assayed with any of the enterovirus, hepatitis A virus, or rotavirus primers.

Cell Culture Analysis of Environmental Concentrates

One hundred fifty samples were analyzed for enteroviruses by cell culture techniques using BGM cells. Thirteen of the 150 samples (8.7 percent) showed cellular cytopathic effects in both the initial and confirmation phases of the analysis. The most probable number (MPN) of virus per 100 L of original sample ranged from 0.15 to 1.86 for the samples that were positive. Thirty-one of the samples (20.7 percent) exhibited cellular toxicity, and three samples (2 percent) were contami nated with bacteria; however, all of these samples were able to be assayed after toxicity or bacterial contamination was eliminated. Additionally, all of the samples tested positive when seeded with poliovirus type 1 (LSc strain) as a positive control.

There seemed to be no relationship between a sample being toxic to BGM cells and being inhibitory to the RT-PCR analysis. The five samples that could not be assayed by RT-PCR for any of the three viruses showed no cytotoxicity when on

33

34 PCR Technologies for Vims Detection in Groundwater

cells. Of the samples that were inhibited for either one or two (but not all three) of the RT-PCR assays, six showed cytotoxicity, whereas six showed no toxic effect when applied to cells.

The cell culture and RT-PCR results are summarized in Table 5.1, and in Table 5.2, cell culture results are compared to RT-PCR and bacteriophage results.

Equivalent Volumes Assayed by PCR andCeil Culture Assay____________________

Although RT-PCR and cell culture methods assay different equivalent volumes of the original sample (5 L versus 600 L, respectively), the difference in the assays' sensitivities needs to be considered when one is comparing the assay results in order to assess the methods' practical applications in water analysis. The minimum detection level of viruses using a cell culture assay is 1 pfu in a given sample volume. Since hundreds of virus particles may be required to produce a single pfu, assay methods such as PCR that detect virus particles directly will result in significantly greater sensitivity. The minimum detection limit of viruses for RT-PCR is one virus particle, and studies have shown that PCR can consistently detect 10"2 pfu of virus (Abbaszadegan et al. 1993). Thus, the RT-PCR assay is approximately 100 times more sensitive, which approximately counters the greater equivalent volume for cell culture methods.

The equivalent assay volumes were calculated based on the total volume of sample concentrates analyzed. For cell culture, a total of 12 mL of a sample concentrate was divided among four 75-cm2 flasks (3 mL per flask, corresponding to 150 L equivalent sample volume). For the 150 concentrates assayed by cell culture, no sample exhibited CPE in all four cell culture flasks. For this study, a single reaction tube of RT-PCR corresponded to an equivalent volume of 5 L. This comparatively small sample volume may be more than offset by the hundredfold increase in sensitivity offered by the method.

Bacteriophage Assays__________________

One hundred forty-four groundwater concentrates were assayed for bacte riophage presence using three different bacterial hosts: Salmonella WG-49, E. coli C-3000, and E. coli C.

Twenty-seven of the samples (18.8 percent) tested positive using host WG-49, 13 samples (9.0 percent) tested positive using host E. coli C-3000, and 11 samples (7.6 percent) tested positive using host E. coli C. Forty-four samples (30.6 percent) tested positive on at least one host, and seven samples (4.9 percent) tested positive on two different hosts. The amount of the sample analyzed repre sented approximately 4.5 L of the original 1,500-L sample (1,500 L eluted in 1 L; 3 mL of eluant sampled for bacteriophage). Of the samples testing positive, the average number of plaques per 100 L was less than 14. The complete results are summarized in Table 5.3.

Results 35

Table 5.1 Summary of viral analysesType of assay Finding

Cell culture assays Enterovirus positive Enterovirus negative Sample did not precipitate

Sample analyses completed

Enterovirus PCR assays Positive Negative Reaction failed


Hepatitis A PCR assays Positive Negative Reaction failed


Rotavirus PCR assays Positive Negative Reaction failed


13136

1Tso

409317

150

12127

11150

1811220

150

(8.7%)(91.3%)(0.01%)

(26.7% of total, 30.1% of assayed) (62.0% of total, 69.9% of assayed) (11.3% of total)



Table 5.2 Comparative analysis of enterovirus assays

Cell culture assay versus RT-PCR enterovirus assay

Cell culture positive Cell culture negative

PCR positive

6 34

PCR negative

6 89

PCR unknown

1 14

Cell culture assay versus bacteriophage assays




Salmonella WG-49 positive

3 24

E. coli C positive

2 9

E. coli C-3000 positive

2 11

Salmonella WG-49 negative

10 107

E. coli C negative

11 122

E. coli C-3000 negative

11 120


Table 5.3 Summary of bacteriophage analysesHost Finding

Salmonella WG-49Positive 27 (18.8%) Negative 117 (81.2%)

Samples analyzed 144 Average pfu value of positive samples 10 pfu/100L

E. coli C-3000Positive 13 (9.0%) Negative 131 (91.0%)

Samples analyzed 144 Average pfu value

of positive samples 12 pfu/100L

E. coli CPositive 11 (7.6%) Negative 133 (92.4%)

Samples analyzed 144 Average pfu value

of positive samples 13.3 pfu/100L

Recovery of Poliovirus by RT-PCR

Three recovery tests were performed in which approximately 30 gal (113 L) of reverse osmosis water was seeded with either infectious poliovirus, heat- inactivated poliovirus, or poliovirus that had been phenol:chloroform extracted to isolate only the viral RNA. The heat-inactivated poliovirus was inactivated by heating for 5 minutes at 56 C. Both the heat-inactivated and infectious virus tests were seeded into the water at a concentration of IxlO6 pfu per 113 L. When the authors used phenol extracted viral RNA, the equivalent of 1 x 107 pfu was seeded into 113 L. (This was to compensate for any potential loss of material during the phenol extraction.) These seeded water samples were filtered through 1MDS filters, eluted, and concentrated as described previously; they were then subjected to RT-PCR. All of the concentrates were then extracted with phenol:chloroform and then with chloroform, followed by Sephadex fractionization, as described previ ously. When used in the RT-PCR assays, the resulting treated concentrates from the infectious and heat-inactivated virus trials were diluted 10, 100, and 1,000 times in sterile, nuclease-free water (Amresco, Solon, Ohio). The RNA-seeded concentrate was used undiluted, tenfold diluted, and hundredfold diluted. Results of gel analysis is shown in Figure 5.1.

The results of these experiments (summarized in Table 5.4) suggest that the recovery and subsequent detection of enteroviruses by PCR are greater for intact virus particles than for free viral RNA. This result is not surprising, given that RNA, unprotected by the viral protein capsule, is subject to rapid deterioration in the environment. The finding that substantially less heat-inactivated virus was recov ered is less easily explained. One possible interpretation concerns the effect of heat on the surface proteins of the virus particles. The capture of viruses by the positively

Results 37

Lane # 12 3 4 5 6 7 8 9 10 11 12 13

Key: Lane 1 123-base-pair markerLanes 2-4 Heat inactivated poliovirus—100, 10, 1 pfuLanes 5-7 Extracted poliovirus RNA—100, 10, 1 pfuLanes 8-10 "Live" poliovirus—100, 10, 1 pfuLane 11 Positive control—10 pfuLane 12 Negative controlLane 13 123-base-pair marker

Figure 5.1 Agarose gel of recovery of poliovirus by RT-PCR experiments

Table 5.4 Summary of seeded recovery testsVirus type 100 pfu/reaction 1 0 pfu/reaction 1 pfu/reaction

InfectiousInactivatedRNA

+ = faintest positive band++ = next brightest positive brand+++ = next brightest positive band++++ = brightest possible band+/- = questionable result- = negative result


charged filter depends upon the charge interaction of the filter with the proteins surrounding the viral RNA. These proteins, in their native state, assume a particular three-dimensional shape, but when the proteins are heated, this shape may perma nently change. The charged sites on a protein are largely dependent on the shape of protein; thus, changing the shape may change the charges and prevent their interaction with the filter during sampling. This same configuration change is likely responsible for the loss of infectivity encountered in the cell culture assay.

RT-PCR Analysis of Cell Harvests___________

RT-PCR was performed on the cell culture flask contents of the first 44 samples. These "cell harvests" consisted of cell culture flask contents that, at the conclusion of the cell culture assay, were frozen and thawed several times to disrupt the cells and release virus particles from the cells. The resulting mixture of cellular debris and cell culture media was filtered through a molecular weight cutoff filter to concentrate any potential viruses and then subjected to PCR analysis. The purpose of this experiment was to confirm the presence of enterovirus in the cultures deemed positive. All samples determined to be positive by cell culture also exhibited amplification when the cell harvest was subjected to RT-PCR. In addition, one sample thought to be negative by cell culture also showed amplification of nucleic acid by RT-PCR. This sample was obtained from a well that had previously tested positive by both cell culture and RT-PCR for enterovirus contamination and had a history of fecal coliform contamination problems. A summary of the results of RT-PCR on cell culture harvests is presented in Table 5.5.

Chemical Analyses___________________

With each sample collected, a 1-L portion of the raw water was also obtained and subjected to a complete minerals and metals analysis and TOC analysis. The results were then statistically analyzed, comparing virus PCR results with the chemical analyses. The objectives of these analyses were to investigate any possible relationship between the concentrations of organic and inorganic sub stances and inhibition of the PCR reaction. A descriptive summary of the various substances assayed is listed in Table 5.6.

Several statistical analyses were done on the chemical data using the computer software product SigmaStat (Jandel Scientific Software, San Rafael Calif.). First, an analysis of the data's normality was performed. None of the measured values were normally distributed, i.e., distributed in the familiar "bell- shaped" curve. This fact dictated the use of nonparametric statistical tests.

Correlation analysis measures the strength of association between two variables, without the assumption that a change of one variable causes a change in the other. The correlation coefficient may be either positive or negative. A positive correlation coefficient results when the values of two variables both increase or both decrease. A negative correlation coefficient results when the values of the variables move in opposite directions i.e., one increases while the other decreases. Regres sion analysis tests whether the value of one variable, the dependent variable, can be

Results 39

Table 5.5 Cell harvest RT-PCR results


PCR positive

7 1

PCR negative

0 36

Table 5.6 Summary of chemical analyses

Substance

AluminumBariumBerylliumBoronCadmiumCalciumChlorideChromiumCobaltCopperFluorideIronLeadMercuryMagnesiumManganeseMolybdenumNickelNitratePotassiumSeleniumSilverSodiumStrontiumSulfateThalliumVanadiumZinc

Mean(mg/L)

0.0090.1130.0000.0590.000

63.67843.618

0.0010.0290.0100.2550.6300.0010.000

20.2680.1450.1170.0041.3002.9300.0010.000

30.0841.170

58.5130.0000.0030.027

Median(mg/L)

0.0000.0600.0000.0000.000

50.44027.900

0.0000.0000.0000.2000.0500.0000.000

14.8100.0200.0000.0000.5602.2500.0000.000

20.1300.220

35.4000.0000.0000.000

Low(mg/L)

0.0000.0000.0000.0000.0000.0201.3000.0000.0000.0000.0000.0000.0000.0000.0500.0000.0000.0000.0000.0500.0000.0000.0000.0001.0000.0000.0000.000

High(mg/L)

0.4261.0400.0031.3600.003

257.400906.100

0.0330.1000.3502.900

13.9800.0190.001

151.6804.5000.4000.010

15.20020.150

0.0070.001

331.04034.980

507.5000.0010.0300.480

USEPAmethod used

200.8 (USEPA200.8200.8200.8200.8200.7 (USEPA300.0 (USEPA200.8200.8200.8300.0200.7200.8200.8200.7200.8200.8200.8300.0200.7200.8200.8200.7200.8300.0200.8200.8200.8

1994)

1994)1993)

predicted by another, independent variable. The relationship between the two variables is assumed to be causal.

Statistical tests were performed analyzing the relationship of individual minerals or metals, as well as various combinations of minerals and metals, to cell culture results and PCR results. Neither the correlation analyses nor the regression analyses revealed any relationship between virus PCR results and any of the chemical measurements, suggesting that the presence and viability of viruses in groundwater do not depend on the chemical composition of the water.

An attempt was made to learn whether any particular organic or inorganic substance in the source water was related to the inhibition of the PCR reaction. In


this effort, based on an analysis of variance, chemical levels of samples that inhibited the PCR reaction were compared with chemical levels of samples that did not inhibit reactions. Again, no relationship was observed between the concentra tion or presence of any particular substance in the source water and the inhibition of the PCR reaction. Also analyzed was the possible effect of the specific ultraviolet absorbance on PCR inhibition. The SUVA is a derived number and is defined as the absorbance of the raw water sample at 254 nm divided by the measured TOC. A SUVA value higher than 4.0 represents TOC composed largely of humic sub stances, whereas SUVA values below 3.0 represent TOC consisting of nonhumic material. No significant differences were seen between the SUVAs of inhibited and noninhibited samples, nor was any correlation noted between SUVA and the results of the PCR analyses. The SUVA results are listed in Appendix B.

The exact nature of inhibitors of the PCR reaction remains undetermined. Many different substances such as humic substances, proteases, DNase and RNase, or excessive amounts of magnesium, iron, and chelating materials are known to be inhibitory. The pretreatment protocol outlined earlier in this report was designed to eliminate or neutralize as many of these as possible. Phenol and chloroform, for example, are effective at dissolving and segregating proteins, such as DNase and RNase, from RNA and DNA in aqueous solution. The passage of the sample through a column of Sephadex (Pharmacia, Piscataway, NJ.) separates the molecules in the sample according to size, and Chelex (Bio-Rad, Hercules, Calif.) removes metallic ions. The fact that certain samples inhibit PCR after this treatment seems to suggest that the inhibitors are nonprotein, nonmetallic, and of approxi mately the same size as the RNA collected following fractionization through Sephadex. Humic material, which comprises a range of differently sized and diverse macromolecules, is the likely source of the observed inhibition.

DNA is a long, linear molecule much longer than it is wide. For example, the DNA of the E. coli bacteria possesses a length-to-width ratio of approximately 700,000 (Stryer 1988). Because of their unusual shape, DNA molecules are susceptible to conformation changes caused by twisting, looping, and turning due either to conditions of the physical environment, such as temperature and pH, or to interactions with other molecules. Many organic molecules, such as certain dyes and some antibiotics, bind to DNA and cause changes in the three-dimensional structure (Brock and Madigan 1991). In order for a PCR reaction to succeed, the DNA polymerase enzyme must bind to the site of the DNA-primer complex. If another molecule occupies this site or if a structural change, such as a loop or turn, has occurred at the site, the DNA polymerase enzyme cannot bind and function. Since only 3.3 percent of the samples showed inhibition with all three sets of primers (enterovirus, rotavirus, and hepatitis A virus), it seems that some of the inhibitors act at specific sites on the DNA complex and adversely alter the desired interaction of the template DNA and the reaction primers. It is unlikely that inhibitors are inactivating or impairing the reaction enzymes, reverse transcriptase, or AmpliTaq polymerase (Perkin Elmer, Foster City, Calif.) since all but three of the samples showed amplification when seeded with at least one of three viruses.

Results 41

Summary of Physicochemical Characteristics of Groundwater Sites____________________

The average depth of the wells surveyed was 269 ft. (82.3 m) and ranged from 19 ft (6.9 m) to 2,247 ft (816.4 m). The sites positive by cell culture had an average well depth of 418 ft (151.9 m) whereas the average depth of the sites positive by RT-PCR was 213 ft (77.4 m). The average pH was 7.16 for all wells and ranged from 4.83 to 9.20. The average pH was 7.18 for cell culture positive samples and 7.10 for samples positive for RT-PCR. The average temperature for all wells was 14.8 C (58.6 F), with a range of 7.0 to 34.0 C (44.6 to 93.2 F). The average temperature was 12.9 C (55.2 F) for samples positive by cell culture and 13.5 C (56.3 F) for all RT-PCR positive samples. The average turbidity was 1.4 ntu and ranged from 0.039 to 15.6 ntu. The average TOC was 0.97 mg/L, ranging from 0.12 to 5.21 mg/L. The physicochemical characteristics of the groundwater sites are summarized in Table 5.7.

Site selection for the project was based on different chemical and physical criteria. Geological settings were also used in the selection process to ensure a variety of samples and to ensure the best evaluation of the applicability of the PCR method for the detection of viruses in groundwater. Table 5.8 shows the number of wells sampled within each geology type and deposit type. The percentages of water production for wells sampled (relative to the total production for all wells sampled) are also listed in terms of geology type and deposit type.

Statistical Analyses___________________

The analyses performed for this study included some basic statistics and assessment of distributions for all variables. Exploratory analyses were also performed to determine correlations between each of the variables. Correlation analyses were conducted in the form of both numeric analyses using Pearson correlations and rank analyses using Spearman correlations.

Cross tabulations were done to determine whether there was a relationship between (1) cell culture and (2) the parameters of microbial indicators and PCR. The

Table 5.7 Summary of physicochemical characteristics

Average (n = 150)MinimumMaximumAverage — cell culture

positive (n = 13)Average — enterovirus PCR

positive (n = 40)

Depth («)

26919

2,247418

213

PH

7.164.839.207.18

7.10

Turbidity (ntu)

1.400.039

15.61.75

1.02

Temperature (°C)

14.87.0

34.012.9

13.5

TOC (mg/L)

0.970.125.211.18

0.97


Table 5.8 Summary of geological characteristics of groundwater sitesPercentage

Percentage of totalNumber of of water production

Geology or wells wells (relative to deposit type sampled sampled all wells sampled)

Percentage of water

production, national average*

UnconsolidatedAlluvial sand and gravel 44 Coastal plain 5 Fluvial and eolian 0 Glacial valley 8 Glacial outwash 2 Glacial valley and outwash 0 Other 3 Unknown 8

70

29.333.330.005.331.330.002.005.33

46.67

45.27 3.44 0.00 4.23 0.90 0.00 1.89 6.75

"62A8

32.717.12.42.3

13.81.2

69.5

BedrockCarbonatesSandstone and

conglomerateSiltstonePlutonic igneous and

metamorphicVolcanicUnknown

Unknown

1315

20

04

34

46

Total 150

8.6710.00

1.330.00

0.002.67

22.67

30.67

5.884.88

1.570.00

0.000.65

12.98

24.54

18.18.3

0.20.6

3.4—

30.5

—

* Data are from USGS 1990 and from the firm of Leggette, Brashears, and Graham, Inc., Professional Ground-Water and Environmental Services, Trumbull, Conn.— indicates <0.1%

results indicated that there was no positive relationship between the cell culture results and any of the parameters tested.

In addition, analyses of variance on cell culture and PCR values by well depth, by distance from surface water sources, and by distance from sewage sources were performed. The results indicated that the mean distances for cell culture positive and negative values were not significantly different at any of the distance parameters tested. The mean distances for PCR positive and negative values were not significantly different by well depth or by distance from surface water sources, but they were significantly different by distance from sewage sources.

Chapter 6

DiscussionThe objective of this project was to develop a simple, rapid, and low-cost

PCR-based assay to be used by water utilities for virus monitoring in groundwater samples. Molecular techniques are now widely used in environmental research and monitoring, with the necessary tools and techniques available from a variety of sources. The strategy outlined here fulfills the water industry's need for a rapid, reliable, inexpensive, and easily performed analysis of groundwater for virus contamination.

As results were generated during the course of this study, the authors have informed the participating utilities when a water sample was positive for enterovirus contamination by cell culture analyses. The authors advised the utilities that maintaining a disinfection residual is crucial for the source. However, since the samples were taken before any disinfection, the positive results did not necessarily indicate a health risk for the communities served by the water provider.

A Strategy for the Detection of Viruses by PCR____

PCR is a powerful technique for the detection of organism-specific nucleic acids and can differentiate types of enteric viruses, such as enterovirus, rotavirus, hepatitis A virus, and Norwalk virus. The strategy developed in this research project involves the following: the removal or inactivation of PCR-inhibiting substances, the use of a large-volume PCR that allows for analysis of a larger equivalent volume of a water sample, the seeding of water concentrates with viruses to test the applicability of PCR to each sample, and the use of assay controls.

PCR cannot be performed on most of the concentrated water samples unless interfering substances are removed before the reverse transcription and amplifica tion reactions. The treatment protocol outlined in this report organic extraction and size exclusion chromatography enabled more than 95 percent of the samples to be successfully assayed by PCR for at least one virus of interest and more than 90 percent of the samples to be successfully assayed for two of the three viruses. Eighty-four percent of the samples could be assayed for all three viruses, whereas only five samples (3.3 percent) could not be assayed for any virus. Other treatment protocols are available, such as the use of magnetic beads conjugated to DNA sequence-specific probes, that may increase the percentage of samples that could be assayed, but they are more costly and more technically challenging.

43


Although virus contamination of groundwater may be at very low concen trations, RT-PCR techniques can potentially reveal the presence of the viral RNA molecule. This report has shown that some untreated environmental samples, even when seeded with high virus concentrations, will mask detection of the viral RNA by this technique. However, in dilution experiments, the authors have shown that simply diluting a sample concentrate lowers the level of inhibitors and allows amplification. For instance, a 100-uL environmental sample, that had been seeded with 100 pfu was subjected to RT-PCR and failed to show any DNA amplification; the same sample diluted 10 times and 100 times showed increasing amplification with each dilution.

Positive and Negative Controls for PCR AssaysTwo different types of positive control reactions were used in this study.

First, to determine whether a sample could be assayed by PCR, each sample was assayed after the addition of either (1) 10 pfu of poliovirus or hepatitis A virus, or (2) 10 TCID50 of rotavirus. The presence or absence of the correctly sized PCR product following the reaction demonstrated whether the sample still contained excessive amounts of inhibitory substances. The other type of positive control, the "reagent positive control," consisted of 10 pfu or 10 TCID50 of virus seeded into sterile, nuclease-free water and then subjected to PCR. One reagent positive control was performed with each set of sample assays, usually 10 to 30 reactions. The presence of the correctly sized PCR product confirmed that the reaction was properly set up and executed. A lack of a PCR product suggested a problem with technique or a reaction component, in which case the associated samples were reassayed.

Each set of sample assays also included a negative control. This reaction was identical to the reagent positive control except that the virus was excluded. The purpose of this control reaction was to ensure the lack of virus or PCR product contamination of reagents. One negative control reaction was performed with each set of sample assays, usually 10 to 30 reactions. If a negative control reaction resulted in the presence of a PCR product, the associated sample reactions were reassayed.

Confirmation

The visualization of a PCR product on an ethidium-stained gel confirms only that the PCR reaction succeeded at amplifying some DNA, not necessarily the DNA sequence intended. It is possible especially if one is using environmental samples that may contain bacterial, algal, or eukaryotic DNA that the PCR product visualized could be similar in size to the expected product but composed of a different sequence. The possibility of this occurrence can be reduced through careful selection of the PCR primers, but the use of a confirmation procedure is needed to report success or failure of the assay reliably. The confirmation process, as described here, also greatly increases the sensitivity of PCR product detection. One to ten nanograms of DNA can be visualized when stained with ethidium bromide and exposed to ultraviolet light, whereas as little as 0.1 pg of DNA can be detected when DNA is hybridized to a radioactive complementary probe an

Discussion 45

increase in sensitivity of 10,000 to 100,000 times (Sambrook, Fritsch, and Maniatis 1989). The confirmation process used in this report utilized a hybridization probe: a strand of DNA exactly complementing the DNA expected in the PCR product and labeled with a radioactive substance. When the correct PCR product has been generated in a reaction, the matching probe will adhere to and allow for the confirmation of the expected PCR product. If the wrong sequence has been amplified in the PCR reaction, the probe will fail to adhere to the product, allowing the researcher to confirm the absence of the targeted PCR product.

Statistical Analyses___________________

Based on the statistical analyses for the 150 samples, the authors did not see a significant correlation between any of the measured water quality parameters and enterovirus occurrence for either RT-PCR or cell culture assays. The results of this project do not support reports showing a high correlation between the presence of F-specific RNA bacteriophages and enteric viruses in fresh water. However, sample collection and processing for bacteriophage analysis were included as part of the enterovirus detection methodology. The adsorption-elution protocol, using a 1MDS filter and beef extract elution at pH 9.5, has been fully optimized for the maximum recovery of human enteric viruses. Despite a good recovery for enteric viruses, this method has not been fully characterized for the maximum recovery of bacterioph ages from water sources. Therefore, additional research is needed to optimize the detection methodology for bacteriophages in groundwater samples.

Sample Inhibition of RT-PCR______________

Several samples assayed by PCR resisted amplification when seeded with the appropriate virus. Many of the same samples could be assayed by PCR when steps were taken to neutralize inhibitors and isolate viruses from the sample. Some samples showed amplification after the initial phenol:chloroform and Sephadex treatment previously described, whereas other samples required a second PCR in which a semi-nested primer (a third primer situated between the initial two primers) was used. Interestingly, several samples that resisted amplification with the primers specific to enterovirus were amplifiable when seeded with rotavirus and assayed using primers specific to rotavirus. This would seem to indicate that inhibition of the reaction may be associated with the annealing of the primers to the template, rather than with the action of the reaction enzymes. It is possible that the use of different primers, or the use of more than two primers in a reaction, may further enhance the detection of viruses.

Differential Recovery of Infectious Virus, Heat-Inactivated Virus, and RNA____________

The results of the recovery efficiency tests using infectious virus, heat- inactivated virus, and RNA suggest that a positive RT-PCR assay is most likely the


result of amplification of intact virus particles rather than "naked" RNA in the sample. This result is expected, in that isolated RNA in the environment is more subject to degradation than the protein-encapsulated virus particle. The lower recovery of heat-inactivated viruses compared with infectious viruses was not expected. The reason for the lower recovery is not known but may be related to changes in viral surface proteins resulting in charge neutralization or disruption of the virus capsule. Either of these phenomena could result in less capture of virus particles by the positively charged 1MDS filter.

PCR Assays Compared With Ceil Culture Assays

The use of cell culture for virus detection differs significantly from the PCR assay for viruses in several ways. However, it may be expected that the results of PCR and cell culture analyses of water samples will correlate well.

The minimum detection level of viruses in any sample by cell culture is, by definition, 1 pfu a quantity of virus that may range from just a few particles to many more at least some of which must be infectious. When a sample tests positive for viral infectivity by cell culture, the infectious agent is not necessarily known. The BGM cell line, routinely used for enterovirus assays, is also susceptible to infection by reoviruses (such as rotavirus), a pathogen often present in environ mental samples in numbers greater than enterovirus (Puigetal. 1994). Additionally, cell culture protocols have yet to be developed for all viruses known to infect humans. Norwalk virus, for instance, has yet to be successfully grown in cell cultures, and therefore environmental samples cannot be assayed for this pathogen. Finally, since each environmental sample is unique, little is known of what possible components of the sample may inhibit the viral infectivity of cells in culture. However, cell culture does offer the advantages of identifying a viral pathogen as infectious and of being widely accepted as the standard method for viral detection.

Conversely, RT-PCR is a potentially much more sensitive assay technique for virus detection, in that it allows one to detect as little as a single molecule of RNA. The technique has often been used to detect less than 1 pfu of a virus, and the viruses may be either infectious or noninfectious. Also, there is the possibility that "naked" viral RNA (RNA without the protein coat) could be detected in the assay. However, the results presented in Table 5.4 (p. 37) indicate that RT-PCR assays detect intact virus particles, not naked RNA in the sample. The disadvantages of PCR are (1) the possibility of the reaction being inhibited when environmental samples are used, and (2) the inability to easily confirm or deny the infectivity of a viral pathogen when detected. These two different approaches to viral detection differ significantly in capabilities and limitations, and it may not be possible to fully compare the results of both assays on the same set of samples.

The two techniques also differ in their time and cost requirements. Most cell culture protocols (including the proposed Information Collection Rule procedure) call fora 14-day initial passage and a 14-day second passage of the sample on cells, followed by a 7-day confirmation passage of putative positive samples. To test for different viruses, multiple cell lines must be maintained, different growth media must be purchased and stored, and different protocols must be followed. The cost

Discussion 47

of a cell culture assay of one sample, as calculated in the authors' lab, is approxi mately $625. An RT-PCR virus assay of one water sample can easily be accom plished in 2 to 3 days, including the confirmation phase, and costs less than $225. This includes the cost of a large-volume sample collection using a 1MDS filter, elution, and concentration. However, an amplification reaction (RT-PCR) assay costs less than $20.

Given its increased sensitivity and ability to detect any intact virus particle, PCR analysis would be expected to reveal more positive results than cell culture analysis. Since either cell culture analysis or PCR can reveal only a "snapshot" of the quality of the groundwater being sampled, PCR represents a desirable and rapid initial screening tool, in that the presence of even noninfectious ornonintact viruses would suggest that a groundwater supply was subject to contamination.

Although the detection of viral RNA does not show an infectious level of contamination, the presence of viral RNA does suggest a source of viral contami nation and thus the potential for health risk. The most sensitive method of detection would be the most desirable, even in the absence of an ability to confirm the infectivity of the sample contamination.

Appendix A

Bacterial Media Used in Bacteriophage Assays

E. ConMedia used for growing both of the E. Coli strains consisted of the

following components:

Component Amount per liter

Tryptone 10 gYeast extract 1 gGlucose 1 gNaCl 8 gCaCl2 0.22 gAgar 15 g for bottom agar, 7 g for top agar,

0 g for liquid growth media

Solutions were autoclaved for 20 minutes at 121 .

Salmonella_______________________

Media for Salmonella WG-49 consisted of the following components:


Tryptone 10 g Yeast extract 1 g NaCl 8 gAgar 15 g for bottom agar, 7 g for top agar,

0 g for liquid media

49


The following filter-sterilized solutions were added after the medium just described was autoclaved:


Kanamycin sulfate (2 mg/mL) lOmLCaCl2 (0.3 g/mL) lOmLGlucose (0.1 g/mL) 10 mLNaladixic acid (0.1 g/mL) 10 mLMgSO4 10 mL

Appendix B

SUVA Values, Samples 1-150

Sample

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

18

19

20

21

22

23

24

25

SUVA Sample

26

27

28

29

30

31

32

33

34

35

36

37

38

39

40

41

42

43

44

45

46

47

48

49

50

SUVA

1.54

5.27

3.61

2.81

4.48

3.02

3.91

1.80

1.16

3.41

3.42

4.66

3.86

3.32

3.15

18.30

2.94

4.81

3.82

Sample

51

52

53

54

55

56

57

58

59

60

61

62

63

64

65

66

67

68

69

70

71

72

73

74

75

SUVA

0.78

0.97

7.13

1.06

7.36

0.59

5.89

4.72.

6.49

1.47

2.98

9.55

0.41

4.91

3.41

1.90

4.25

0.99

1.63

1.99

0.77

10.72

5.81

2.13

2.10

Sample

76

77

78

79

80

81

82

83

84

85

86

87

88

89

90

91

92

93

94

95

96

97

98

99

100

SUVA

0.32

1.79

4.50

0.83

0.41

1.70

5.45

1.50

3.45

1.02

1.09

0.52

12.75

0.64

0.87

2.07

1.68

1.38

5.42

1.64

2.02

8.56

0.51

0.38

Sample

101

102

103

104

105

106

107

108

109

110

111

112

113

114

115

116

117

118

119

120

121

122

123

124

125

SUVA

0.22

4.04

0.19

2.46

1.98

3.27

0.69

2.31

5.13

4.01

1.15

20.26

25.13

0.34

0.49

0.86

1.10

3.42

2.14

1.49

1.29

2.10

8.67

0.31

0.18

Sample

126

127

128

129

130

131

132

133

134

135

136

137

138

139

140

141

142

143

144

145

146

147

148

149

150

SUVA

1.52

0.80

0.88

1.27

2.46

0.60

1.18

1.70

1.55

2.48

2.15

3.24

1.06

0.15

0.32

1.53

1.14

1.34

0.50

1.92

0.59

1.36

2.80

8.83

3.82

57

Glossary

1MDS. An electropositively charged, glass-and-cellulose medium used as a virus collection filter. Cartridge filters are constructed using two layers of pleated medium and are manufactered by Cuno Inc., Meriden, Conn.

amplicon. The portion of DNA that is amplified during a PCR reaction.

complementary DNA (cDNA). DNA that is synthesized using RNA as a tem plate and the enzyme reverse transcriptase. It may subsequently be used in a polymerase chain reaction.

cytopathic effect (CPE). Morphological changes observed in a cell culture when the latter is infected with virus. The effect is often characteristic of the particular virus infecting the cells.

dalton (D). A unit of mass nearly equal to that of a hydrogen atom.

DNA polymerase. The enzyme that synthesizes DNA from deoxynucleoside triphosphates, using a single-stranded nucleic acid as a template.

eluant. The resulting beef extract-glycine mixture following extraction of a 1MDS virus collection filter.

5-prime (5'). One of the ends of a DNA or RNA strand. The 3-prime end is the opposite end.

polymerase chain reaction (PCR). An in vitro method for the enzymatic synthesis of specific DNA sequences, using oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. Starting with even trace amounts of the DNA of interest, PCR can generate millions or billions of exact copies, thereby making analysis relatively simple.

primers. Short (20-50-base-pair) strands of DNA that are chosen for their complementarity to the DNA of interest. Primers bind to the complementary target DNA sequence during an amplification reaction and initiate the action of DNA polymerase.

primer-dimer. An artifact of some PCRs, consisting of primers that have annealed to each other and undergone some amplification. The size of the primer- dimer is usually close to the combined size of the two primers used in the reaction.

53


reverse transcriptase. An enzyme capable of synthesizing single-stranded DNA from RNA template.

RNase. An enzyme that degrades RNA molecules.

RNase inhibitor. An enzyme (RNasin) capable of inhibiting RNase activities. RNasin is added to a sample to eliminate degradation of RNA template.

sample concentrate. The resulting 15-30 mL of solution following a filter elution, flocculation, and centrifugation.

semi-nested PCR. A technique employing a second PCR amplification into which a small portion of the first PCR product has been added. In the first PCR reaction, the entire target DNA should be amplified, whereas in the second reaction, if the target DNA is actually present, only a portion of the target DNA will be amplified. If the target DNA is not present, the nested primer should fail.

Southern hybridization. A technique (named for E.M. Southern) for transfer ring DNA in gels to nylon or nitrocellulose membranes.

3-prime (3'). One of the ends of a DNA or RNA strand. The 5-prime end is the opposite end.

References

Abbaszadegan, M., M.S. Huber, C.P. Gerba, and I.L. Pepper. 1993. Detection ofEnteroviruses in Groundwater With the Polymerase Chain Reaction. Appliedand Environmental Microbiology, 59:1318-1324.

Abbaszadegan, M., R. Manteiga, D. Verges, E. Ibrahim, and M. LeChevallier. 1996.Enhanced and Optimized Coagulation for Removal of MicrobialContaminants. Paper presented at the 96th General Meeting of the AmericanSociety for Microbiology: New Orleans, La.

Abbaszadegan, M., M.S. Huber, C.P. Gerba, and I.L. Pepper. 1997a. Detection ofViable Giardia Cysts by Amplification of Heat Shock-Induced mRNA.Applied and Environmental Microbiology, 63:324-328.

Abbaszadegan, M., R. Manteiga, K. Bell, and M. LeChavallier. 1997b. EnhancedCoagulation for Removal of Microbial Contaminants. In Proc. of the 1997AWWA Water Quality Technology Conference. Denver, Colo.: AWWA.

APHA, AWWA, and WEE (American Public Health Association, American WaterWorks Association, and Water Environment Federation). 1995. StandardMethods for the Examination of Water andWastewater. 9th ed. Washington,D.C.: APHA.

Ball, J.M., P. Tian, C. Zeng, A.P. Morris, and M.K. Estes. 1996. Age-DependentDiarrhea Induced by a Rotaviral Nonstructural Glycoprotein. Science,272:101-104.

Benton, W.H., and R.L. Ward. 1982. Induction of Cytopathogenicity in MammalianCell Lines Challenged With Culturable Enteric Viruses and Its Enhancementby 5-Iododeoxyuridme. Applied and Environmental Microbiology, 43:861-868.

Brock, T.D., and M.T. Madigan. 1991. Biology of Microorganisms. 6th ed.Englewoods Cliffs, N.J.: Prentice Hall.

Craun, G.F. 1984. Health Aspects of Groundwater Pollution. In GroundwaterPollution Microbiology. Edited by G. Bitton and C.P. Gerba. New York:John Wiley & Sons.

. 1988. Surface Water Supplies and Health. Jour. AWWA, 80(2):40-52. . 1992. Waterborne Disease Outbreaks in the United States of America:

Causes and Prevention. World Health Statistics Quarterly. Rapport Trimestriel de Statistiques Sanitaires Mondiales, 45(2-3): 192-9.

Dahling, D.R., and B .A. Wright. 1986. Optimization of the BGM Cell Line Culture and Viral Assay Procedures for Monitoring Viruses in the Environment. Applied and Environmental Microbiology, 51:790-812.

Dahling, D.R.,R.S. Safferman, andB.A. Wright. 1984. Results of a Survey of BGM Cell Culture Practices. Environ. Int., 10:309-313.

55


DeLeon, R.,C. Shieh.R.S. Baric, andM.D. Sobsey. 1990. Detection of Enterovirusesand Hepatitis A Virus in Environmental Samples by Gene Probes andPoly merase Chain Reaction. In Proc. 1990AWWA Water Quality TechnologyConference. Denver, Colo.: AWWA.

Edzwald, J.K., and J.E. Van Benschoten. 1990. Aluminum Coagulation of NaturalOrganic Matter. Proceedings of the 4th Cothenburg Symposium on ChemicalWater and Wastewater Treatment, Madrid, Spain.

Estes, M.K., E.L. Palmer, and J.F. Obijeski. 1983. Rotaviruses: A Review. CurrentTopics in Microbiological Immunity, 105:123-184.

Gerba, C.P., and J.B. Rose. 1990. Viruses in Source and Drinking Water. InDrinking Water Microbiology. Edited by G.A. McFeters. New York:Spring-Verlag.

Gouvea, V., R.I. Glass, P. Woods, K. Taniguchi, H.F. Clark, B. Forrester, and Z-Y.Fang. 1990. Polymerase Chain Reaction Amplification and Typing ofRotavirus Nucleic Acid for Stool Specimens. Journal of ClinicalMicrobiology, 28:276-282.

Havelaar, A.H., M. Van Olphen, and Y.C. Drost. 1993. F-Specific RNABacteriophage Are Adequate Model Organisms for Enteric Viruses inFresh Water. Applied and Environmental Microbiology, 59:2956-2962.

Hyypia, T., P. Auvinen, and M. Maaronen. 1989. Polymerase Chain Reaction for theHuman Picornaviruses. Journal of General Virology, 70:3261-3268.

Jofre, J., E. Olle, F. Ribas, A. Vidal, and F. Lucena. 1995. Potential Usefulness ofBacteriophages That Infect Bacteriodes fragilis as Model Organisms forMonitoring Virus Removal in Drinking Water Treatment Plants. Appliedand Environmental Microbiology, 6 1:3227-3231.

Kapikian, A.Z., and R.M. Chanock. 1990. Norwalk Group of Viruses. In Virology.2nd ed. Edited by B.N. Fields. New York: Raven Press.

Keswick, B.H., C.P. Gerba, S.L. Secor, and I. Cech. 1982. Survival of EntericViruses and Indicator Bacteria in Groundwater. Journal of EnvironmentalScience and Health, A17:903-912.

Keswick, B.H., C.P. Gerba, H.L. DuPont, and J.B. Rose. 1984. Detection ofEnteroviruses in Treated Drinking Water. Applied and EnvironmentalMicrobiology, 47:1290-1294.

Lippy, E.G., and S.C. Waltrip. 1984. Waterborne Disease Outbreaks, 1946-1980:A Thirty-Five-Year Perspective. Jour. AWWA, 72(2):60-67.

Melnick, J.L. 1990. Enteroviruses: Polioviruses, Coxsackieviruses, Echovirusesand Newer Enteroviruses. In Virology. 2nd ed. Edited by B.N. Fields. NewYork: Raven Press.

Mullis, K.B., and F.A. Faloona. 1987. Specific Synthesis of DNA in Vitro via aPolymerase-Catalyzed Chain Reaction. Methods in Enzymology, 155:335-351.

Nakagomi, O., Y. Isegawa, R.L. Ward, D.R. Knowlton, E. Kaga, T. Nakagomi, andS. Ueda. 1994. Naturally Occurring Dual Infection With Human andBovine Rotaviruses as Suggested by the Recovery of G1P8 and G1P5Rotaviruses From a Single Patient. Archives of Virology, 137:381-388.

Payment, P. 1981. Isolation of Viruses From Drinking Water at the Pont-Viau WaterTreatment Plant. Canadian Journal of Microbiology, 21:411-420.

References 57

Pfeffer, U., E. Fecarotta, and G. Vidali. 1995. Efficient One-Tube RT-PCRAmplification of Rare Transcripts Using Short, Sequence-Specific ReverseTranscription Primers. Biotechniques, 18(2):204-206.

Pillai, S.D, K.L. Josephson, R.L. Baily, C.P. Gerba, and I.L. Pepper. 1991. RapidMethod for Processing Soil Samples for Polymerase Chain ReactionAmplification of Specific Gene Sequences. Applied and EnvironmentalMicrobiology, 57:2285-2286.

Puig, M., J. Jofre, F. Lucena, A. Allard, G. Wadell, and R. Girones. 1994. Detectionof Adenoviruses and Enteroviruses in Polluted Waters by Nested PCRAmplification. Applied and Environmental Microbiology, 60:2963-2970.

Rotbart, H.A. 1990. Enzymatic RNA Amplification of the Enteroviruses. Journalof Clinical Microbiology, 28:438^142.

Saiki, R.K., D.H. Gelfand, S. Stoffel, S.J. Scharf, R. Higuchi, G.T. Horn, K.B.Mullis, and H.A. Erlich. 1988. Primer-Directed Enzymatic Amplificationof DNA With a Thermostable DNA Polymerase. Science, 239:487-494.

Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A LaboratoryManual. 2nd ed. Plainview, N.Y.: Cold Spring Harbor Laboratory Press.

Smith, E.M., and C.P. Gerba. 1982. Laboratory Methods for the Growth andDetection of Animal Viruses. In Methods in Environmental Virology.Edited by C.P. Gerba and S.M. Goyal. New York: Marcel Dekker.

Sobsey, M.D. 1990. Simple Membrane Filter Method to Concentrate and EnumerateMale-Specific RNA Coliphages. Jour. AWWA, 82(9): 52-59.

Sobsey, M.D., P.A. Shields, F.S. Hauchman, A.L. Davis, V.A. Rullman, and A.Bosch. 1988. Survival and Persistence of Hepatitis A Virus in EnvironmentalSamples. In Viral Hepatitis and Liver Disease. Edited by A.J. Zuckerman.New York: Alan R. Liss, Inc.

Southern, E.M. 1975. Detection of Specific Sequences Among DNA FragmentsSeparated by Gel Electrophoresis. Journal of Molecular Biology, 98:503.

Stryer, L. 1988. Biochemistry. 3rd ed. New York: W.H. Freeman Co. Tsai, Y.-L., and B.H. Olson. 1992. Rapid Method for Separation of Bacterial DNA

From Humic Substances in Sediments for Polymerase Chain Reaction.Applied and Environmental Microbiology, 59:2292-2295.

USEPA (United States Environmental Protection Agency). 1990. Methods for theInvestigation and Prevention of Waterborne Disease Outbreaks. EPA/600/l-90/005a. Washington, D.C.: USEPA, Office of Research and Development.

. 1993. Methods for the Determination of Inorganic Substances in Environmental Samples. EPA-600/R-93/100. Cincinnati, Ohio: USEPA.

. 1994. Methods for the Determination of Metals in Environmental Samples- Supplement 1. EPA-600/R-94/111. Cincinnati, Ohio: USEPA.

USGS (United States Geological Survey). 1990. Estimated Use of Water in the United States in 1990. U.S. Geological Survey Circular 1081. Denver, Colo.: USGS.

Wayne, S.B., R.R. Pierce, and H.A. Perlman. 1993. Estimated Use of Water in the United States in 1990. U.S. Geological Survey Circular 1081. Denver, Colo.: U.S. Geological Survey.

Abbreviations and Acronyms

A adenine HPLC ATCC American Type Culture Collection AWWA American Water Works Association AWWARF American Water Works Association ICR

Research Foundation in.

high-performance liquid chromatography

Information Collection Rule inch

BGM Buffalo Green monkeybp base pairBSA bovine serum albumin

C cytosine C degrees CelsiusCi curiecm centimeterCPE cytopathic effectCxT disinfectant concentration times

contact time cDNA complementary DNA

D daltonddH2 O double distilled waterDMSO dimethyl sulfoxideDNA deoxyribonucleic aciddNTP deoxynucleotide triphosphateDOC dissolved organic carbonDTT dithiothreitol

ESWTR Enhanced Surface Water Treatment Rule

F degrees Fahrenheitft feet

g gravity force; gramG guaninegal gallongpm gallons per minuteGWDR Groundwater Disinfection RuleHAV hepatitis A virus

L liter

M molarm metermg milligramMg++ magnesium ionjag microgramuJ microjoulejaL microliter\\M micromolarmin minutemL millilitermM millimolarmmol millimoleMPN most probable numberMS-2 phage F-specific coliphage MS-2

n number of samplesN2 nitrogen gasnm nanometerNTR nontranslated regionntu nephelometric turbidity unit

32P phosphorus-32, radioactive form PI, P2, P3 primer 1, primer 2, primer 3PAC Project Advisory CommitteePBS phosphate buffered salinePCR polymerase chain reactionpfu plaque-forming unitpg picogrampH negative log of hydrogen ion

concentration (measure of acidity or basicity)

pmol picomole

59


RNA ribonucleic acid SUVA specific ultraviolet absorbance RT reverse transcription or reverse

transcriptase T thymine RT-PCR reverse transcription followed by TCID50 tissue culture infectious dose

polymerase chain reaction resulting in the development of

CPE in 50 percent of cultures

s second TOC total organic carbon

SDS sodium dodecyl sulfateSRSV small round structured virus USEPA United States Environmental

SSC sodium chloride-sodium citrate Protection Agencybuffer UV ultraviolet

SSS primer short, sequence-specific primer (a UV-254 ultraviolet light of 254-nmtype of PCR primer) wavelength

American Waterworks AssociationRESEARCH FOUNDATION

6666 W. Quincy Avenue, Denver, CO 80235 (303)347-6100

1P-3C-90740-5/98-CG ISBN 0-89867-934-6

Date post:	27-Mar-2018
Category:	Documents
Upload:	hoangcong
View:	218 times
Download:	3 times

Application of PCR Technologies for - Water Research · PDF file ·...

Documents