Approaches to Assessing Approaches to Assessing Unintended Health Effects of Unintended Health Effects of

Genetically Engineered Genetically Engineered FoodsFoods

Understanding the Science Understanding the Science Behind the ApproachBehind the Approach

Ann L. Yaktine, Ph.D.Ann L. Yaktine, Ph.D.

Institute of MedicineInstitute of Medicine

The National AcademiesThe National Academies

The USDA, FDA, and EPA asked the The USDA, FDA, and EPA asked the National Academies to convene a National Academies to convene a committee of experts to:committee of experts to:

Outline science-based approaches for Outline science-based approaches for assessing or predicting unintended assessing or predicting unintended health effects of genetically engineered health effects of genetically engineered foods, andfoods, and

Compare the potential for unintended Compare the potential for unintended effects of GE foods with those derived effects of GE foods with those derived from conventional and other methods of from conventional and other methods of genetic modification.genetic modification.

Safety of Genetically Safety of Genetically Engineered Foods: Approaches Engineered Foods: Approaches

to Assessing Unintended to Assessing Unintended EffectsEffects

The Task to the Study PanelThe Task to the Study Panel

Focus on mechanismsFocus on mechanisms by which by which unintended changes in composition unintended changes in composition of food occur as a result of various of food occur as a result of various breeding and propagation methodsbreeding and propagation methods

Assess the extentAssess the extent to which these to which these mechanisms are likely to lead to mechanisms are likely to lead to significant compositional changes in significant compositional changes in foodfood

Assess methods to detectAssess methods to detect unintended unintended changes in food in order to determine changes in food in order to determine potential human health effectspotential human health effects

Identify appropriate scientific Identify appropriate scientific questionsquestions and methods for and methods for determining unintended changes in determining unintended changes in food from GE organismsfood from GE organisms

Outline methods to assessOutline methods to assess the the potential short- and long-term human potential short- and long-term human consequences of such changesconsequences of such changes

The study focused on scientific The study focused on scientific approaches and methodology approaches and methodology

used to predict and assess used to predict and assess unintended effects.unintended effects.

Defining the ScienceDefining the Science

What is Genetic What is Genetic Engineering?Engineering?

One type of genetic modification One type of genetic modification that involves an intended that involves an intended targeted targeted change in a gene change in a gene sequence to achieve a specific sequence to achieve a specific result through the use of result through the use of recombinant DNArecombinant DNA (rDNA) (rDNA) technology.technology.

rDNA TechniquesrDNA Techniques

Microbial VectorsMicrobial Vectors

ElectroporationElectroporation

MicroinjectionMicroinjection

Transposable ElementsTransposable Elements

TCGATAGCGCAAAACTAAATGCCAAGCATCAATCAA

ATGCCAAGCA

Genetic engineering is targeted, that Genetic engineering is targeted, that is, the gene sequence is specific and is, the gene sequence is specific and the insertion site is known.the insertion site is known.

ATGCCAAGCA

CATATTCTC

TCGATAGCGCAAAACTAA

Non-GE Techniques of Genetic Non-GE Techniques of Genetic ModificationModification

Mutation Breeding:Mutation Breeding:

Radiation MutagenesisRadiation Mutagenesis

Chemical MutagenesisChemical Mutagenesis

Induced mutagenesis causes Induced mutagenesis causes random changes in the DNA random changes in the DNA sequence.sequence.

ATGCCAA CATATTCTC AGCGCAAAACTAATCGAGCA

Other Non-GE Techniques of Other Non-GE Techniques of Genetic ModificationGenetic Modification

Simple SelectionSimple Selection CrossingCrossing

Interspecies Interspecies CrossingCrossing

The progeny of cross-breeding The progeny of cross-breeding cannot always be predicted.cannot always be predicted.

TargetedTargeted, , Non-TargetedNon-Targeted, and , and ConventionalConventional Methods of Methods of

Genetic Modification All Have Genetic Modification All Have the Potential to Produce the Potential to Produce

Unintended Effects.Unintended Effects.

Genetic Engineering (Targeted Genetic Engineering (Targeted Genetic Modification)Genetic Modification)

Impact of expressing proteins from an Impact of expressing proteins from an unrelated species?unrelated species?

Brazil nut gene into soybeanBrazil nut gene into soybean

Effects of new proteins operating through Effects of new proteins operating through unexpected pathways?unexpected pathways?

Non-targeted Genetic ModificationNon-targeted Genetic Modification Cannot predict outcome due to Cannot predict outcome due to

random changes to the gene random changes to the gene sequencesequence

Conventional CrossingConventional Crossing Expression pattern of new traits Expression pattern of new traits

cannot always be predictedcannot always be predicted Lenape potatoLenape potato

Mechanisms of genetic engineering Mechanisms of genetic engineering overlap with those of other types of overlap with those of other types of genetic modification.genetic modification.

Techniques used to alter the Techniques used to alter the genetic composition of an organism genetic composition of an organism are mechanistically different.are mechanistically different.

Why is predicting an unintended Why is predicting an unintended effect difficult?effect difficult?

It is unlikely that all It is unlikely that all methods of either genetic methods of either genetic engineering or engineering or conventional breeding conventional breeding will have equal will have equal probability for unintended probability for unintended effects.effects.

It is more likely that the It is more likely that the product of the modification product of the modification rather than the process rather than the process itself will produce an itself will produce an unintended effect.unintended effect.

What Scientific Approaches What Scientific Approaches Can Be Used to Identify Can Be Used to Identify Compositional Changes in Food Compositional Changes in Food that May Lead to an that May Lead to an Unintended Effect?Unintended Effect?

Targeted Quantitative AnalysisTargeted Quantitative Analysis

Profiling (Untargeted) AnalysisProfiling (Untargeted) Analysis

Targeted AnalysisTargeted Analysis Predefined Predefined

CompoundsCompounds Amino acidsAmino acids LipidsLipids VitaminsVitamins Other nutrients, Other nutrients,

toxicants, allergenstoxicants, allergens Isolated for Isolated for

AnalysisAnalysis QuantifiedQuantified

Profiling AnalysisProfiling Analysis Multiple Multiple

Compounds in a Compounds in a SampleSample

Compounds Compounds Identified and Identified and Quantified:Quantified: Electrophoretic Electrophoretic

separationseparation SpectrometrySpectrometry Genomic, proteomic, Genomic, proteomic,

etc.etc.

Profiling:Profiling:Genomics and ProteomicsGenomics and Proteomics

Genomic technology can measure Genomic technology can measure the level of thousands of transcripts the level of thousands of transcripts simultaneouslysimultaneously

Proteomic analysis detects and Proteomic analysis detects and quantifies individual or groups of quantifies individual or groups of proteinsproteins

Toxicity TestingToxicity Testing

Agronomic Agronomic ComparisonsComparisons

Feeding TrialsFeeding Trials

Application, Validation, and Application, Validation, and Limitations of Tools for Limitations of Tools for

Identifying and Predicting Identifying and Predicting Unintended EffectsUnintended Effects

Any adverse health effect from Any adverse health effect from unintended compositional unintended compositional

changes will be a consequence changes will be a consequence of:of:

The inherent toxicity of the compoundThe inherent toxicity of the compound AllergensAllergens Toxins/toxicantsToxins/toxicants Anti-nutrientsAnti-nutrients

The level of dietary exposureThe level of dietary exposure Exposure to high-level consumersExposure to high-level consumers Food habits related to cultureFood habits related to culture Effect of food preparation/processingEffect of food preparation/processing

Agronomic ComparisonAgronomic Comparison Agronominc traits are evaluated in the Agronominc traits are evaluated in the

laboratory, greenhouse, and fieldlaboratory, greenhouse, and field

APPLICATIONAPPLICATION

Varieties with Varieties with unusual features unusual features are discardedare discarded

LIMITATIONLIMITATION

Not sufficient for Not sufficient for identifying all identifying all unintended unintended changeschanges

Feeding TrialsFeeding TrialsTest Animals are Fed Modified Whole Test Animals are Fed Modified Whole

Foods or Food ExtractsFoods or Food Extracts

APPLICATIONAPPLICATION

Compares Compares nutritional quality nutritional quality of GE crop with its of GE crop with its conventional conventional counterpartcounterpart

LIMITATIONSLIMITATIONS

Nutrient Nutrient requirements of requirements of animal modelsanimal models

Volume of food that Volume of food that can be administeredcan be administered

Limited test dosage Limited test dosage and exposure timeand exposure time

Food is a Complex MixtureFood is a Complex Mixture

The use of targeted and non-The use of targeted and non-targeted (profiling) methods to targeted (profiling) methods to assess the safety of genetically assess the safety of genetically modified foods is increasing, modified foods is increasing, however, there are limitations to however, there are limitations to our ability to interpret and utilize our ability to interpret and utilize the information generated.the information generated.

The complexity of food composition The complexity of food composition challenges the ability of modern challenges the ability of modern analytical chemistry and analytical chemistry and bioinformatics to identify bioinformatics to identify compositional changes and compositional changes and determine their biological relevance.determine their biological relevance.

Looking to the FutureLooking to the Future

Although the array of analytical and Although the array of analytical and epidemiological techniques has epidemiological techniques has increased,increased, gaps remain in our ability gaps remain in our ability to:to:

Identify compositional changes that Identify compositional changes that result from genetic modificationresult from genetic modification

Determine the biological relevance of Determine the biological relevance of such changes to human healthsuch changes to human health

Devise appropriate scientific methods to Devise appropriate scientific methods to predict and assess unintended effectspredict and assess unintended effects

Recommendations from the Recommendations from the StudyStudy

Develop and employ:Develop and employ:

Standardized Sampling MethodologiesStandardized Sampling Methodologies

Validation ProceduresValidation Procedures

Performance-based Techniques for Targeted Performance-based Techniques for Targeted Analysis and ProfilingAnalysis and Profiling

Integrated Database of Food Composition Integrated Database of Food Composition from Industrial and Regulatory Agency from Industrial and Regulatory Agency SourcesSources

Standardized Sampling Standardized Sampling MethodologiesMethodologies

Should include:Should include:

Comparison of modified foods to Comparison of modified foods to unmodified varieties developed under a unmodified varieties developed under a variety of environmental conditionsvariety of environmental conditions

Comparison of modified foods to Comparison of modified foods to commonly consumed commercial varietiescommonly consumed commercial varieties

Validation ProceduresValidation Procedures

The tracking potential of allThe tracking potential of allgenetically modified foods should be genetically modified foods should be

improved , including:improved , including:

Pre-market to post-market feedback loopPre-market to post-market feedback loop

Dietary survey toolsDietary survey tools

Performance-Based Techniques Performance-Based Techniques for Targeted Analysis and for Targeted Analysis and

Profiling Profiling Scientific methods to detect unintended Scientific methods to detect unintended

compositional changes must be continually compositional changes must be continually scrutinized for accuracy, validity, and scrutinized for accuracy, validity, and applicationapplication

Current databases of novel and naturally-Current databases of novel and naturally-occurring compounds must be improved and occurring compounds must be improved and expanded expanded

AcknowledgementsAcknowledgements

The Institute of Medicine and the Division The Institute of Medicine and the Division of Earth and Life Sciences, The National of Earth and Life Sciences, The National AcademiesAcademies

The Committee to Identify and Assess The Committee to Identify and Assess Unintended Effects of GE Foods on Unintended Effects of GE Foods on Human Health, Dr. Bettie Sue Masters, Human Health, Dr. Bettie Sue Masters, ChairChair