Biomimetic Elastomeric, Conductive and Biodegradable Polycitrate-based Nanocomposites for

Guiding Myogenic Differentiation and Skeletal Muscle Regeneration

Yuzhang Du a, #, Juan Ge a, #,  Yannan Li a, Peter X. Ma d, e, f, Bo Lei a, b, c,*

a Frontier Institute of Science and Technology, Xi׳an Jiaotong University, Xi׳an 710054, China

b State Key Laboratory for Mechanical Behavior of Materials, Xi׳an Jiaotong University, Xi׳an 710054, China

c State Key Laboratory for Manufacturing Systems Engineering, Xi׳an Jiaotong University, Xi׳an 710054, China

d Department of Biomedical Engineering, University of Michigan, Ann Arbor, MI 48109-2009, USA

e Macromolecular Science and Engineering Center, University of Michigan, Ann Arbor, MI 48109-1055,USA

f Department of Materials Science and Engineering, University of Michigan, Ann Arbor, MI 48109-1078,USA

*Corresponding author:

B Lei, rayboo@xjtu.edu.cn and leiboaray@gmail.com, Tel. +86-29-83395361,

1. Materials and methods

1.1. Preparation and characterization of reduced graphene oxide (RGO)

RGO was obtained through the reduction of GO using vitamin C as the reductant. Briefly, 20 mL of

GO solution (0.1 mg/mL) was treated by ultrasonic for 1 h at room temperature, followed by adding 120

mg vitamin C and adjusting the pH to 9－10 by ammonia solution (25%). After reaction for 30 min at 95

with stirring, the resulted dispersions were centrifuged at 10000 rpm for 20 min and washed by℃

ethyl alcohol for three times. Finally, the precipitation was dispersed in DMSO to form 2.0 mg/mL solution

by ultrasonic for further use. The UV-Vis absorption spectra between the wavelength range of 200-700nm

for GO and RGO in water were obtained from a UV-Vis spectrophotometer (Lambda 35, PerkinElmer). The

morphology of GO and RGO were observed on the transmission electron microscopy (TEM, F20, FEI) and

atomic force microscopy (AFM, Cypher, Asylum Research). The samples for AFM analysis were prepared

by depositing a DMSO dispersion of GO or RGO on a clean silicon substrate.

Table S1. The primers used in qRT-PCR measurement

Gene Forward(5’-3’) Reverse(5’-3’)

GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA

MyoD CGGCTACCCAAGGTGGAGAT ACCTTCGATGTAGCGGATGG

Myogenin CTGACCCTACAGACGCCCAC TGTCCACGATGGACGTAAGG

Troponin T TCAATGTGCTCTACAACCGCA ACCCTCCC AGCCCCC

Figure S1. Physiochemical structure and morphology of RGO. (A) UV-vis spectra showing the typical

absorption peaks of RGO at 264nm; (B) FTIR spectra indicating the decreased oxygenous groups of

RGO; (C) TEM image exhibiting the ultrathin 2D nanostructure of RGO; (D) AFM picture

demonstrating the thickness of 2.2 nm for RGO nanosheet. In the UV-Vis spectra (Figure S1A), two

absorption peaks at 229 nm and 293 nm observed in pure GO spectrum were presumably due to the π→π*

transition of aromatic C═C bonds and the n→π* transition of the C═O bonds, respectively [1]. The peak at

229 nm was shifted to 264 nm and the peak at 293 disappeared in RGO spectrum after reduction by vitamin

C, suggesting the successful reduction of GO [1]. The RGO was further identified by ATR-FTIR spectra

(Figure S2B). Compared with GO, the intensities of peaks associated with the oxygen functional groups of

RGO (carboxyl and hydroxyl and epoxy groups) were dramatically decreased. These decreased absorption

bands demonstrated that most of oxygen functional groups in GO were reduced by vitamin C. TEM showed

the representative two-dimensional (2D) nanostructure of RGO (Figure S2C). A number of wrinkles on the

surface of RGO indicated the increased Van der Waals' force between the sheets due to the decrease of

oxygen-containing groups. Moreover, AFM analysis showed the single layer nanostructure of RGO with a

thickness about 2.2 nm (Figure S2D).

[1] J. Gao, F. Liu, Y. Liu, N. Ma, Z. Wang, X. Zhang. Environment-friendly method to produce graphene

that employs vitamin C and amino acid, Chem. Mater., 22(7) (2015) 2213-2218.

Figure S2. SEM images of PCEG nanocomposites.

Figure S3. Swelling behavior of PCEG nanocomposites in PBS. The swelling ratio was expressed as

the water uptake percentage after soaking samples for 1, 2, 3 days.

Figure S4. Elongation at break of PC, PCE and PCEG nanocomposites elastomers.

0

50

100

150

200

250

300

350

400

PCEG(2.0)

PCEG(1.0)PCEG(0)

Elo

ngat

ion

(%)

Before soaking After soaking**

Figure S5. Elongation at break of PCEG nanocomposites after soaking in PBS for 24 h.

Figure S6. Electroactivity evaluation of PCEG nanocomposites. (A) Cyclic voltammogram curves

showing the electrochemical properties of nanocomposites solution and films; (B) Conductivity

analysis indicating the current transport ability of nanocomposites with different RGO content.

Significant enhanced electroactivity for PCEG nanocomposites was observed after adding RGO into

PCE polymer matrix.

Figure S7. Myotube formation morphology on PCE elastomers after culture for 5 days, as well as

TCP, PLGA, PCEG (0), PCEG (1.0) on day 1. The myotube formation was showed through MHC

protein immunofluorescence staining.