Supplementary material Supplementary table 1 – Description of the genes analyzed by qRT-PCR and respective forward and reverse sequences. Symbol Gene name Forward Primer (5'-3') Reverse primer (5'- 3') PTPRC Protein tyrosine phosphatase, receptor type, C ACCACAAGTTTACTAACGCAAGT TTTGAGGGGGATTCCAGGTA AT CD163 Cluster of differentiation 163 TTTGTCAACTTGAGTCCCTTCAC TCCCGCTACACTTGTTTTCA C CD68 Cluster of differentiation 68 CTTCTCTCATTCCCCTATGGACA GAAGGACACATTGTACTCCA CC CCR7 C-C Motif Chemokine Receptor 7 TGAGGTCACGGACGATTACAT GTAGGCCCACGAAACAAATG AT CFS1R Colony Stimulating Factor 1 Receptor TCCAAAACACGGGGACCTATC CGGGCAGGGTCTTTGACATA HRPT1 Hypoxanthine Phosphoribosyltransferase 1 CCTGGCGTCGTGATTAGTGAT AGACGTTCAGTCCTGTCCAT AA RPL22 Ribossomal protein L22 CACGAAGGAGGAGTGACTGG TGTGGCACACCACTGACATT Supplementary table 2 - Quantitative analysis of CD68 and CD163 immunohistochemistry staining in the different culture groups, expressed as the percentage of positive staining among the total cell area. Data are mean + SD of a minimum of 7 capsules per condition. Tumour Monocyte CAF Monocyte Tumour Monocyte 3D-3- culture CD68 (%) - ≥ 99 ≥ 95 21.8 ± 9.2 21.4 ± 8.6 CD163 (%) - 0.11 ± 0.08 2.1 ± 1.3 3.9 ± 1.5 3.2 ± 1.9 Ratio CD163/CD68 (%) - ≤1 ≤3 15-20 15-20
Transcript
Supplementary material
Supplementary table 1 – Description of the genes analyzed by qRT-PCR and respective forward and reverse sequences.
Symbol Gene name Forward Primer (5'-3') Reverse primer (5'-3')
PTPRCProtein tyrosine phosphatase, receptor type, C
ACCACAAGTTTACTAACGCAAGT TTTGAGGGGGATTCCAGGTAAT
CD163 Cluster of differentiation 163 TTTGTCAACTTGAGTCCCTTCAC TCCCGCTACACTTGTTTTCAC
CD68 Cluster of differentiation 68 CTTCTCTCATTCCCCTATGGACA GAAGGACACATTGTACTCCACC
RPL22 Ribossomal protein L22 CACGAAGGAGGAGTGACTGG TGTGGCACACCACTGACATT
Supplementary table 2 - Quantitative analysis of CD68 and CD163 immunohistochemistry staining in the different culture groups, expressed as the percentage of positive staining among the total cell area. Data are mean + SD of a minimum of 7 capsules per condition.
Supplementary figure 1 - Analysis of tumour spheroid diameter over time (day 3 and day 21) for the different culture groups: tumour monocultures, tumour-CAF and tumour-monocyte co-cultures and 3D-3-culture. Data are mean ± SD from 12 capsules from independent experiments. Statistical analysis was performed using an unequal variances t-test.
Supplementary figure 2 - Mean fluorescence intensity of cells double positive for the leucocyte marker CD45 and M2-associated markers CD163 and CD206 of peripheral blood derived macrophages 4 days after isolation in monolayer mono-culture (2D PBM) and microencapsulated mono-culture (Microencapsulated PBM) and in 3D-3-cultures (with tumour cells and CAF). Data are mean ± SEM from up to six independent experiments.
Supplementary figure 3 – Comparison between methods to determine cell viability in tumour monocultures, when exposed to the half maximal inhibitory concentrations (IC50) of Cisplatin and Paclitaxel. Cell titer Glo measures ATP levels, Presto blue measures resazurin reduction capacity and Picogreen measures dsDNA. Data are mean + SEM of up to 3 independent experiments.
Supplementary figure 4 - Analysis of apoptosis and proliferation of cultures upon drug treatment. Immunofluorescence images of monocultures after treatment and respective controls for analysis of (A) apoptosis: Nucview (green) - apoptotic cells; tdTomato (red) – NCI-H157; DAPI (blue) - nuclei; and (B) proliferation: Edu (green) - proliferative cells; tdTomato (red) – NCI-H157; DAPI (blue) – nuclei. Scale bars represent 100 µm. C) Quantitative analysis of apoptotic cells in the tumour cell subset in mono- and 3D-3-cultures (green vs. red channel). Data are mean + SEM of a minimum of three images per condition.
Supplementary video 1 – 3D rendering of alginate microcapsules of the 3D-3-cultures in the 1 st (A) and 3rd (B) week of culture visualized by light-sheet fluorescence microscopy. The cellular types are labelled by tdTomato (red) – NSCLC spheroids; GFP (green) – CAF; Cell tracker™ (blue) – THP-1.
