Attenuation of sleep deprivationdependent deterioration in male fertilityparameters by vitamin CNermin I. Rizk1, Mohamed S. Rizk2, Asmaa S. Mohamed3 and Yahya M. Naguib1*
Abstract
Purpose: Male fertility is multifaceted and its integrity is as well multifactorial. Normal spermatogenesis isdependent on competent testicular function; namely normal anatomy, histology, physiology and hormonalregulation. Lifestyle stressors, including sleep interruption and even deprivation, have been shown to seriouslyimpact male fertility. We studied here both the effects and the possible underlying mechanisms of vitamin C onmale fertility in sleep deprived rats.
Methods: Thirty male Wistar albino rats were used in the present study. Rats were divided (10/group) into: control(remained in their cages with free access to food and water), sleep deprivation (SD) group (subjected to paradoxicalsleep deprivation for 5 consequent days, rats received intra-peritoneal injections of vehicle daily throughout thesleep deprivation), and sleep deprivation vitamin C-treated (SDC) group (subjected to sleep deprivation for 5consequent days with concomitant intra-peritoneal injections of 100 mg/kg/day vitamin C). Sperm analysis,hormonal assay, and measurement of serum oxidative stress and inflammatory markers were performed. Testiculargene expression of Nrf2 and NF-κβ was assessed. Structural changes were evaluated by testicular histopathology,while PCNA immunostaining was conducted to assess spermatogenesis.
Results: Sleep deprivation had significantly altered sperm motility, viability, morphology and count. Serum levels ofcortisol, corticosterone, IL-6, IL-17, MDA were increased, while testosterone and TAC levels were decreased.Testicular gene expression of Nrf2 was decreased, while NF-κβ was increased. Sleep deprivation caused structuralchanges in the testes, and PCNA immunostaining showed defective spermatogenesis. Administration of vitamin Csignificantly countered sleep deprivation induced deterioration in male fertility parameters.
Conclusion: Treatment with vitamin C enhanced booth testicular structure and function in sleep deprived rats.Vitamin C could be a potential fertility enhancer against lifestyle stressors.
Keywords: Male fertility, Sleep deprivation, Stress, Spermatogenesis, Oxidative stress, Nrf2
IntroductionInfertility is a reasonably common condition with med-ical, psychological, and financial consequences. Infertilitycan be defined as the inability of a couple to conceiveafter 1 year of attempting conception. Infertility affectsan estimated 15% of couples worldwide, of which, maleare considered to be solely responsible for 20–30% of in-fertility cases [1]. Accumulating data suggest that there
is a progressive reduction in human sperm quality and50–60% reduction in sperm counts in men in recent de-cades [2]. Male infertility can be influenced by environ-mental, occupational, and modifiable lifestyle factorssuch as psychological stress, obesity, smoking, mobilephone radiations and lack of sleep [3, 4].Sleep is a physiological periodic state of rest. Sleep is a
bio-vital phenomenon that is associated with neuro-endocrin and immunity changes [5]. Adequate sleep is abasic inquiry for healthy life and proper fertility; there isa strong correlation between adequate sleep and gonado-tropin releasing hormone (GnRH) secretion which plays
* Correspondence: [email protected] Physiology Department, Faculty of Medicine, Menoufia University,Menoufia, EgyptFull list of author information is available at the end of the article
Rizk et al. Reproductive Biology and Endocrinology (2020) 18:2 https://doi.org/10.1186/s12958-020-0563-y
a basic role in the productive functions [6]. Furthermore,adequate sleep positively affects the sexual behaviour. Itwas reported that increasing the night sleep 1 h en-hances the sexual activity by 14% [7]. Sleep deprivation(SD) is a common social stress that affects a wide rangeof population. According to the National Sleep Founda-tion, there is a marked increase in the incidence of sleepdeprivation in the last few years. Night shift workers andpatient suffering psycho-social disturbances are the mostvulnerable populations. SD involves a wide range of dis-orders such as; behaviourally induced insufficient sleepsyndrome, sleep apnea and insomnia [8].SD has serious adverse effects on different body func-
tions resulting in cardiovascular diseases, immune distur-bances and neuro-endocrinal changes [9]. Furthermore,SD and psychological stress alter the activity of thehypothalamic-pituitary-adrenal (HPA) axis and the sympa-thetic nervous system with negative impact on both sexual-ity and fertility [10]. Inadequate sleep has been reported todecrease semen quality [11]. Previously published studieshave shown that the immune function could be impairedby sleep deprivation [12]. The level of the immunoglobu-lins G, A and M was enhanced in a sleep deprived cohortstudy, suggesting that the serum humoral immunity pa-rameters could be altered following insufficient sleep [13].It was reported that short sleep duration, long sleep dur-ation and late bedtime impair semen quality partly via theincreased production of seminal anti-sperm antibody [14].One could produce antibodies to his own sperms in cer-tain conditions such as varicocele [15], intercourse [16], aswell as testicular inflammation [17]. Spermatogenesis is anactive replecative process generating about 1000 sperm/second. The high rate of cell division requires rationallyhigher mitochondrial oxygen consumption [18]. Understressful conditions, spermatozoa generate small amountsof reactive oxygen species (ROS). Minimal amounts ofROS are essential for acrosomal reaction and fertilization,however, excessive production of ROS can cause damageof normal spermatozoa through lipid peroxidation andDNA damage [19]. Testicular membrane is rich in polyun-saturated fatty acids (PUFA) rendering the testes vulner-able to lipid peroxidation and eventually oxidative stressinjury [18].Great attention has been given to molecules with po-
tentially polymodal protective effects. Vitamin C, ascor-bic acid, is present in the testes presumably playing apivotal role in the testicular antioxidant defence systemand, therefore, supporting spermatogenesis. However, inorder to function effectively as an antioxidant, vitamin Cmust be maintained at high levels in the body [13]. Inaddition, vitamin C has potential anti-inflammatoryproperties; vitamin C has been reported to alleviate theinflammatory status by reducing hsCRP and IL-6 inhypertensive and/or diabetic obese patients [20]. On the
basis of these considerations, the aim of the presentstudy was to test the hypothesis that vitamin C couldcounteract the detrimental effects of SD on male fertility.To achieve that, we examined the effect of vitamin C ad-ministration on semen quality, reproductive hormones,oxidative and inflammatory markers, testicular structure,and testicular expression of genes contributing to oxida-tive and inflammatory homeostasis in sleep-deprivedadult male rats.
Materials and methodsAnimalsThirty male Wistar albino rats were used in the presentstudy. The experimental procedures were conducted inadherence to the Guiding Principles in the Use and Careof Animals published by the National Institutes ofHealth (NIH Publication No 85–23, Revised 1996). Ani-mal care and use was approved by the Menoufia Univer-sity Ethics Committee. Animals were kept for 10 daysprior to the start of the study to allow properacclimatization. The animals were fed standard labora-tory chow and allowed free access to water in an air-conditioned room with a 12 h light-dark cycle.
Animal groupsFollowing acclimatization, rats were assigned randomlyinto three experimental groups of 10 rats each:
1- Control group (C): rats remained in their cageswith free access to water and balanced diet.
2- Sleep deprivation group (SD): rats were subjected toparadoxical sleep deprivation for 5 consequent days.Rats had water and food ad libitum during the sleepdeprivation period. Rats received intra-peritonealinjections of vehicle daily throughout the sleepdeprivation phase.
3- Sleep deprivation + vitamin C-treated group (SDC):rats were subjected to sleep deprivation for 5 conse-quent days with concomitant intra-peritoneal injec-tions of 100 mg/kg/day vitamin C (20% vials, GlobalCosmetic Solutions, SL, Spain). Rats had water andfood ad libitum during the sleep deprivation period.
Sleep deprivationSleep deprivation was induced according to the methodof Choi et al., 2016 with slight modifications [9]. Ratswere kept in a custom-made glass tank (120 × 40 × 40cm) containing 10 platforms. The platforms were care-fully designed to allow alert standing of each rat, but donot allow them to sleep. When rats tend to fall asleep,they lose their balance; hence they fall in water andawaken. Animals could move only by jumping from oneplatform to another. Before filling the glass tank withwater, rats were left in the glass tank 1 h/day for 3
Rizk et al. Reproductive Biology and Endocrinology (2020) 18:2 Page 2 of 13
consequent days for acclimatization. After theacclimatization period, the glass tank was filled withwater 3 cm beneath the surface of the platforms.
Blood sample collectionAt the end of the study, all rats were fasted overnight.Blood was drawn from each rat via cardiac puncture. Theblood was allowed to coagulate for 30min at roomtemperature. Blood samples were then centrifuged at4000 rpm for 15min to separate serum samples. Serumsamples were stored at − 20 °C. Finally, all rats were scari-fied by cervical dislocation.
Biochemical assessmentSerum levels of cortisol (BioVision, USA), testosterone(CUSABIO, Shanghai, Chaina), interleukin 17 (IL-17,Abcam, USA), and interleukin 6 (IL-6, Abcam, USA)were determined by quantitative sandwich enzyme im-munoassay technique using an automatic optical reader(SUNRISE Touchscreen, TECHAN, Salzburg, Austria).Malondialdehyde (MDA) and total antioxidant capacity(TAC) (Abcam, USA) were determined by routine kin-etic and fixed rate colorimetric methods on a JenwayGenova autoanalyser (UK).
Evaluation of testicular GSH, MDA and GPxRats were sacrificed by cervical dislocation. Both testeswere dissected, weighed and then washed with cold sa-line. The left testes were homogenized in lysis buffer so-lution (abcam, USA, 1:5 w/v). The homogenate wascentrifuged and the supernatant was used for colorimet-ric estimation of glutathione (GSH, QuantiChrom™, Bio-Assay Systems, USA), glutathione peroxidase (GSH-Px,EnzyChrom™, BioAssay Systems, USA) and MDA tissuelevels using fixed rate colorimetric method.
Collection of semenCauda epididymis was dissected free in a Petri dish con-taining 5 ml warm saline solution (37 °C). Then, it wascut into pieces by a fine medical scissor and incubatedfor 5 min with frequent shaking to yield semen suspen-sion. Semen suspension was used for further assessmentof sperm motility (%), viability (%), abnormal forms (%)and total sperm count (in millions) [9].
Assessment of sperm motilityAfter 5–10 min of dissection, a drop of semen suspen-sion was smeared on a glass slide and examined underlight microscope (power 400X) to assess sperm motility.A minimum of three different fields were examined todetermine the mean percentage of sperm motility [21].
Sperm viabilityEqual volumes (100 μl) of semen suspension and eosinstain (1%) were mixed and incubated for 2 min. A dropof this mixture was smeared on a clean glass slide andexamined under light microscope. Living sperms werenot affected by the stain, while dead sperms stained pinkby eosin [22]. The percentage of viability was determinedin the field examined (number of alive sperm/total num-ber sperm*100). In each sample, a minimum of three dif-ferent fields were examined to determine the meanpercentage of sperm viability.
Assessment of sperm morphologyA drop of semen suspension was smeared on a glassslide and examined by light microscope (power 400X).The percentage of abnormal forms, in each field, was de-termined (number of abnormal sperms/total number ofsperms*100). Ten fields were examined in each slide todetermine the mean percentage of abnormal forms [23].
Sperm countTenmicroliter of the semen suspension was smeared onthe counting haemocytometer. Sperm counting wasdone under light microscope (200X). The results wereexpressed as million/ml of suspension. The sperm countwas repeated at least twice and the average was taken.Total sperm count was calculated as (Count*dilution*5*104) [24].
Histopathology examinationSpecimens from the right testes were fixed in 10% for-mol saline for 5–7 days. The specimens were washed intap water for 10 min and then dehydrated in gradedethanol solutions (70, 90% over night and 100% ethanolsolution for three changes 1 h each). The specimenswere cleared in xylene (20–30 times). After that, speci-mens were impregnated in soft paraffin wax at 55–60 °Cfor 2 h then in hard paraffin wax at room temperaturein moulds. Tissue blocks were cut into section of 5 μmthickness by using rotator microtome. Tissue sectionswere dipped in a warm water-bath, picked up on cleanslides, and placed on hot plate for 2 min. Finally, tissuesections were stained with haematoxylin and eosin stainfor general architecture of the studied tissues.
PCNA immunostainingImmunostaining staining was carried out using primaryantiserum to proliferating cell nuclear antigen (PCNA)(PC10, Santa Cruz Biotechnology Inc., Heidelberg,Germany). Briefly, the primary antibody was diluted inTris buffer with a dilution of 1:50 (as determined by thedata sheet). The sections were incubated with the pri-mary antibody overnight at + 4 °C. The binding of theprimary antibody was observed using a commercial
Rizk et al. Reproductive Biology and Endocrinology (2020) 18:2 Page 3 of 13
avidinbiotin- peroxidase detection system recommendedby the manufacturer (DAKO, Carpenteria, USA). Finally,the slides were stained with diaminobenzene (DAB).
Analysis of gene expression by quantitative RT-PCR (qRT-PCR)Real time quantitative reverse transcription-polymerasechain reaction (RT-PCR) assay was used to examinemRNA expression of nuclear factor (erythroid-derived 2)-like 2 (Nrf2) and nuclear factor kappa beta (NF-κβ) genesin the studied groups. To extract RNA, frozen testicularspecimens were ground using a mortar and pestle and li-quid nitrogen. Total RNA was extracted with TRI reagent(Sigma-Aldrich, New South Wales, Australia). To generatethe template for PCR amplification, 2 μg of testicular RNAwas reverse transcribed into cDNA using the high capacityRNA-to-cDNA kit (Applied Biosystems, Foster City, CA,USA). This cDNA was used to determine the mRNA ex-pression for the genes of interest by quantitative real-timePCR as previously described using gene specific primers(Table 1), designed using Primer Express Software version2.0 (Applied Biosystems, Victoria, Australia). GAPDH wasused as the housekeeping control loading gene. SYBRgreen PCR assays for each target molecule and internalreference GAPDH were performed in duplicate on thesecDNA samples in a 10 μL reaction using Applied Biosys-tems 7500 FAST 96-well PCR machine. From the amplifi-cation curves, relative expression was calculated using thecomparative Ct (2 −ΔCt) method, with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) serving as the en-dogenous control and the expression data as a ratio (targetgene/GAPDH).
Statistical analysisKolmogorov-Smirnov test was performed on all data setsto ensure normal distribution (p > 0.5). Results areexpressed as mean ± standard deviation (SD). Analysesof Variances (ANOVA) with Tukey’s honesty significantdifference (HSD) tests were used for statistical analysisusing Origin® software and the probability of chance (pvalues). P values < 0.05 were considered significant.
ResultsAlthough there was no significant difference in bodyweight between the experimental groups at the start ofthe experiment; the body weight was significantly lowerin the SD group when compared to the control group(142.31 ± 0.89 g vs. 181.66 ± 1.85 g, p < 0.05) following 5days of sleep deprivation. Interestingly, administration ofvitamin C resulted in significant increase in body weightin the in SDC group (153.99 ± 3.02 g, p < 0.05) whencompared to the SD group, albeit it was still significantlylower if compared to the corresponding values in thecontrol group, or the SDC group itself at the start of theexperiment (Fig. 1a). Unsurprisingly, there was signifi-cant increase in the testicular index in the SD groupwhen compared to the control group (0.54 ± 0.018 vs.0.44 ± 0.012, p < 0.05), while there was significant reduc-tion in the SDC group (0.492 ± 0.016, p < 0.05) whencompared to SD group. Testicular index was signifi-cantly higher in the SDC group when compared to thecontrol group (Fig. 1b).As shown in Fig. 1c, d, e, and f, there was significant
decrease in sperm count, viability and motility, with sig-nificant increase in abnormal forms of sperms in SDgroup when compared to the control group (16.15 ±1.07 × 106, 70.6 ± 1.96%, 80 ± 2.74% and 15.6 ± 1.33% vs.49.42 ± 2.88 × 106, 93.2 ± 0.97%, 94 ± 2.45% and 7 ±0.95% respectively, p < 0.05). Sperm count, viability andmotility were significantly higher, while the abnormalforms of sperms were significantly lower in the SDCgroup (38.86 ± 4.34 × 106, 87.6 ± 1.12%, 88 ± 2.55% and11.4 ± 0.68% respectively, p < 0.05) compared to the SDgroup. However, sperm count, viability and motility stillsignificantly lower and abnormal forms still significantlyhigher in SDC group when compared to control group.Serum cortisol and corticosterone levels were signifi-
cantly higher, while testosterone level was significantlylower in the SD group when compared to the controlgroup (212.58 ± 18.44 ng/ml, 224.6 ± 8.12 ng/ml and1.79 ± 0.14 ng/ml vs. 72.15 ± 6.98 ng/ml, 52.4 ± 3.17 ng/ml and 3.95 ± 0.11 ng/ml respectively, p < 0.05). In thevitamin C treated sleep-deprived rats, serum cortisol andcorticosterone levels were significantly lower, while tes-tosterone level was higher (90.43 ± 9.35 ng/ml, 73.48 ±9.36 ng/ml and 3.48 ± 0.25 ng/ml respectively, p < 0.05)when compared to the SD group. However, cortisol andcorticosterone levels were significantly higher and testos-terone level was significantly lower in the SDC groupwhen compared to the control group (Fig. 2).Serum levels of IL-6 and IL-17 were significantly higher
in the SD group when compared to the control group(26.6 ± 1.6 pg/ml and 46.1 ± 3.16 pg/ml vs. 13.4 ± 0.51 pg/ml and 23 ± 1.41 pg/ml respectively, p < 0.05). IL-6 and IL-17 levels were significantly lower in the SDC group(19.8 ± 0.58 and 31.4 ± 1.33 pg/ml) when compared SD
Table 1 Sequence of the primers used for assessing Nrf2 andNF-κβ gene expression
Nrf2 Forward CACATCCAGACAGACACCAGT
Reverse CTACAAATGGGAATGTCTCTGC
NF-κβ Forward CGCCACCGGATTGAAGAAAA
Reverse TTGATGGTGCTGAGGGATGT
GAPDH Forward TGCACCACCAACTGCTTAGC
Reverse GGCATGGACTGTGGTCATGAG
Rizk et al. Reproductive Biology and Endocrinology (2020) 18:2 Page 4 of 13
Fig. 1 Effect of vitamin C on body weight, testicular index and sperm evaluation in sleep deprived rats. a Body weight in control (white column),sleep deprived (black column) and sleep deprived + vitamin C treated (grey column) groups. b Testicular index in control (white column), sleepdeprived (black column) and sleep deprived + vitamin C treated (grey column) groups. c Sperm count in control (white column), sleep deprived(black column) and sleep deprived + vitamin C treated (grey column) groups. d Sperm viability in control (white column), sleep deprived (blackcolumn) and sleep deprived + vitamin C treated (grey column) groups. e Sperm motility in control (white column), sleep deprived (black column)and sleep deprived + vitamin C treated (grey column) groups. f Abnormal forms in control (white column), sleep deprived (black column) andsleep deprived + vitamin C treated (grey column) groups. (Significant = p < 0.05, * significant when compared to the control group, • significantwhen compared to the sleep deprived group, # significant when compared to the same group at the start of the experiment. Numberof rats = 10/group)
Rizk et al. Reproductive Biology and Endocrinology (2020) 18:2 Page 5 of 13
groups, yet they were still significantly higher than the cor-responding values in the control group (Fig. 3a and b).Sleep deprivation resulted in significant reduction in theTAC and significant elevation in MDA levels when com-pared to the control group (0.79 ± 0.01mM/ml and 2.05 ±0.09 uM/ml vs. 1.05 ± 0.05mM/ml and 0.46 ± 0.07 uM/mlrespectively, p < 0.05). TAC was significantly higher andMDA was significantly lower in the SDC group (0. 9 ±0.05mM/ml and 1.04 ± 0.06 uM/ml respectively, p < 0.05)when compared to the SD group, while the TAC remainedsignificantly lower with significantly higher MDA levels inthe SDC group if compared to the control group (Fig. 3cand d).Testicular GSH and GPx tissue levels were significantly
lower, while testicular MDA was significantly higher inthe SD group when compared to the control group(18.15 ± 3.63 uM/g tissue, 83.47 ± 12.33 U/g tissue and74.37 ± 2.93 ng/g tissue vs. 46.67 ± 4.41 uM/g tissue,134.12 ± 18.79 U/g tissue and 34.81 ± 0.94 ng/g tissue re-spectively, p < 0.05). In vitamin C treated SD group, tes-ticular tissue levels of GSH and GPx were significantly
higher, while MDA tissue level was significantly lower(33.87 ± 3.92 uM/g tissue, 152.92 ± 21.72 U/g tissue and42.02 ± 1.77 ng/g tissue respectively, p < 0.05) when com-pared to the SD groups. Testicular level of GSH was sig-nificantly lower, while MDA level was significantly higherin the SDC group, when compared to the controlgroup (Fig. 4).Gene expression of Nrf2 in the testicular tissue was
significantly downregulated, while gene expression ofNF-κβ gene was significantly upregulated in the SDgroup when compared to the control group (0.62 ± 0.014and 1.87 ± 0.02, vs. 1 RQ respectively, p < 0.05). Nrf2gene expression was significantly higher, while NF-κβgene expression was significantly lower in the SDCgroup (0.89 ± 0.06 and 1.29 ± 0.04 RQ respectively, p <0.05) when compared to the SD group, however, thegene expression of Nrf2 remained significantly lowerand NF-κβ significantly higher in the SDC if comparedto the corresponding values in the control group (Fig. 5).Histopathological evaluation of testicular biopsies re-
vealed abnormal morphology of seminiferous tubules in
Fig. 2 Effect of vitamin C on serum hormones in sleep deprived rats. a Cortisol level in control (white column), sleep deprived (black column)and sleep deprived + vitamin C treated (grey column) groups. b Corticosterone level in control (white column), sleep deprived (black column)and sleep deprived + vitamin C treated (grey column) groups. c Testosterone level in control (white column), sleep deprived (black column) andsleep deprived + vitamin C treated (grey column) groups. (Significant = p < 0.05, * significant when compared to the control group, • significantwhen compared to the sleep deprived group. Number of rats = 10/group)
Rizk et al. Reproductive Biology and Endocrinology (2020) 18:2 Page 6 of 13
the SD group with cellular degeneration of spermatogoniaand thickening of the basement membrane. Interestingly,in the SDC group, more preserved architecture andmorphology of spermatogonia were observed (Fig. 6).PCNA immunostaining revealed decreased positive im-munostaining of the basal cell layer in the SD group whencompared to the control group. Treatment with vitamin Cresulted in enhancement of PCNA immunostaining whencompared to the SD group, reflecting a qualitative im-provement of spermatogenesis (Fig. 7).
DiscussionInfertility is defined as inability of couples to conceiveafter 1 year of unprotected intercourse. Thereby, infertil-ity affects 13–18% of couples, and male factor accountsfor up to half of all the cases. Development of male in-fertility is influenced by many diseases and/or risk fac-tors. Importantly, increase in risk of infertility can benoted, mostly in male population, when exposed to
environmental stressors including sleep deprivation [25].Better understanding of fertility and semen quality at themolecular levels in the male reproductive system couldlead to a great achievement in treating infertility. Essen-tially, a better treatment for fertility and sexual dysfunc-tion could improve the overall quality of life. Moleculeswith polymodal actions have gained much attention tominimize male reproductive tissue injuries, and enhancemale fertility.In the present study, sleep deprivation resulted in signifi-
cant decrease in sperm count, viability and motility, whilethere was significant increase in abnormal forms and tes-ticular index. Sleep deprivation was linked to alteration ofthe quality of sperm [9, 14], however the precise mechan-ism has not been elucidated. It could be possible that theassociated inflammatory and oxidative stress mediatorsplay an injurious role with consequent reduction in spermquality [26, 27]. Vitamin C has been shown to attenuatemale reproductive dysfunction in diabetic rats [28].Vitamin
Fig. 3 Effect of vitamin C on serum inflammatory and oxidative stress markers in sleep deprived rats. a IL-6 level in control (white column), sleepdeprived (black column) and sleep deprived + vitamin C treated (grey column) groups. b IL-17 level in control (white column), sleep deprived(black column) and sleep deprived + vitamin C treated (grey column) groups. c TAC in control (white column), sleep deprived (black column)and sleep deprived + vitamin C treated (grey column) groups. d MDA level in control (white column), sleep deprived (black column) and sleepdeprived + vitamin C treated (grey column) groups. (Significant = p < 0.05, * significant when compared to the control group, • significant whencompared to the sleep deprived group. Number of rats = 10/group)
Rizk et al. Reproductive Biology and Endocrinology (2020) 18:2 Page 7 of 13
Fig. 4 Effect of vitamin C on testicular oxidative-antioxidative parameters in sleep deprived rats. a GSH level in control (white column), sleepdeprived (black column) and sleep deprived + vitamin C treated (grey column) groups. b MDA level in control (white column), sleep deprived(black column) and sleep deprived + vitamin C treated (grey column) groups. c GPx level in control (white column), sleep deprived (blackcolumn) and sleep deprived + vitamin C treated (grey column) groups. (Significant = p < 0.05, * significant when compared to the control group, •significant when compared to the sleep deprived group. Number of rats = 10/group)
Fig. 5 Effect of vitamin C on testicular Nrf2 and NF-κβ gene expression in sleep deprived rats. a Nrf2 gene expression in control (white column),sleep deprived (black column) and sleep deprived + vitamin C treated (grey column) groups. b NF-κβ gene expression in control (white column),sleep deprived (black column) and sleep deprived + vitamin C treated (grey column) groups. (Significant = p < 0.05, * significant when comparedto the control group, • significant when compared to the sleep deprived group. Number of rats = 10/group)
Rizk et al. Reproductive Biology and Endocrinology (2020) 18:2 Page 8 of 13
C has also been reported to improve sperm count, motility,progression, viability and anomalies in rats subjected toforced swimming stress [22]. These effects were mainly at-tributed to the antioxidant and the testosterone increaseproperties of vitamin C. In our hands vitamin C counteredSD-induced injurious effects on sperm characteristics,testis weight and testicular index. We then went to validatethe underlying mechanisms, studying the possibility ofanti-oxidant, anti-inflammatory, hormone and gene modi-fying effects.SD induces intense alterations in the regulatory
endocrinal axes, including the hypothalamic-pituitary-adrenal (HPA) axis. In the present study SD resulted insignificant increase in serum cortisol and corticosteronelevels, while it caused significant decrease in serum tes-tosterone level. Vitamin C opposed the SD-induced hor-monal alterations. Despite the stress modality, stress-induced increase in corticosterone and decrease in tes-tosterone levels have been reported [9, 29]. In fact, thedecrease in testosterone concentration was attributed tothe increase in corticosterone level, as part of the stress-induced activation of the HPA axis, resulting in
inhibition of the hypothalamic-pituitary-gonadal (HPG)axis [30]. Elevated corticosterone levels not only de-creases testosterone production by Leydig cells, it alsoinduces Leydig cells apoptosis [31, 32]. It has been re-ported that a negative relationship exists between corti-sol and testosterone. Elevated cortisol levels wereassociated with decreased testosterone levels during ex-ercise or even in disease status such as ischemic heartdisease [33, 34]. Vitamin C supplementation has alsobeen reported to attenuate cortisol responses followingpsychological or physical stressors [35]. Vitamin C is se-creted from the adrenals in response to adrenocortico-trophic hormone (ACTH), representing a hormone-regulated paracrine secretion of vitamin C as part of thestress response [36]. Interestingly, and in support to ourfindings, supplementation with vitamin C attenuated theincrease in the blood cortisol, adrenaline, interleukin-10(IL-10) and interleukin-1 receptor antagonist (IL-1Ra)levels following ultra-marathon running [37]. Further-more, vitamin C was shown to reduce corticosteronelevel in non-adrenalectomized rats alleviating stress-related behavior [38].Hence, we could imply that in our
Fig. 6 Vitamin C preserves testicular structure in sleep deprived rats. a Representative photomicrograph of Hx & E stained testis sections fromcontrol group showing normal oriented regular shaped seminiferous tubules with different stages of spermatogenesis, thin basement membrane(arrow) and interstitial spaces showing thin walled blood vessels (X 200). b Representative photomicrograph of Hx & E stained testis sections fromsleep deprived group showing multiple seminiferous tubules with abnormal morphology of spermatogonia (arrows), shrunken nucleus andvacuolated cytoplasm), occasional apoptotic cells and very few late spermatids. Thick walled blood vessels can be seen in interstitial spaces (X200). c Representative photomicrograph of Hx & E stained testis sections from sleep deprived + vitamin C treated group showing seminiferoustubules lined by multiple layers of spermatogonia and spermatocytes, with early and late spermatids filling the lumen(X 200). (Numberof rats = 10/group)
Rizk et al. Reproductive Biology and Endocrinology (2020) 18:2 Page 9 of 13
study vitamin C boosted testosterone concentration andthereby, improved SD-induced diminution in spermquality.It is well documented that oxidative stress is impli-
cated in male factor infertility. In the present study, sleepdeprived male rats showed higher serum and testiculartissue levels of MDA, while they had lower serum TACand testicular tissue GSH and GPx levels when com-pared to the control group. Administration of vitamin Csignificantly attenuated sleep deprivation induced alter-ation in oxidative stress markers. A bidirectional rela-tionship between sleep deprivation and oxidative stresshas been documented [39–41]. Previous data showedevidence that the pathophysiology of male infertility washighly influenced by impairment in seminal antioxidantand lipid peroxidation status. Lifestyle stress, reducesmale fertility; an increasing number of cases of male in-fertility are thought to be primarily due to oxidativestress [42]. MDA serves as an index of lipid peroxidationand a marker of oxidative stress, and could serve as adiagnostic tool for of infertility in asthenozoospermic pa-tients [43, 44]. MDA level in seminal plasma has beenreported to be negatively correlated with sperm viability,motility, morphology and concentration [44]. On thecontrary, TAC levels were positively associated with
sperm concentration, motility, and morphology [45].GPx can be considered as a predictive measure forfertilization capacity. In fact, GPx is thought to be essentialfor structural integrity of spermatozoa, and a significant de-terminant of sperm motility and viability. Alteration in thecontent of GPx, irrespective of the cause, is negatively cor-related with fertility-related parameter [46]. Glutathione(GSH) synthesis is induced in cells exposed to oxidativestress as an adaptive process. The relationship of GSH en-zymatic system with oxidative stress in the ejaculate hasgained much attention and the regulation of its activity inthe semen has been suggested as a therapeutic strategy.Interestingly, intracellular sperm GSH system is altered ininfertile men, which seems to be linked to sperm morph-ology. The quest to find novel antioxidants and/or combi-nations developed for safe and efficient treatment ofoxidative stress induced infertility is likely to continue. Al-most three decades ago, the antioxidant efficacy of vitaminC was shown to be effective for the treatment of spermoxidative stress in smokers [47]. Since then, only few stud-ies were conducted to confirm this finding. Indeed, vitaminC seems indispensible protector of semen from ROS;semen samples with excess ROS where found to be corre-lated with very low vitamin C concentrations [48]. Our re-sults support the idea that vitamin C could be an efficient
Fig. 7 PCNA immunostaining in the studied groups. a Representative photomicrograph of PCNA immunostained sections in testis of controlgroup showing strong positive staining of most of proliferating basal cells in seminiferous tubules. b Representative photomicrograph of PCNAimmunostained sections in testis of sleep deprived group showing patchy positive staining of proliferating basal cells in seminiferous tubules cRepresentative photomicrograph of PCNA immunostained sections in testis sleep deprived + vitamin C treated group showing increased positivestaining of proliferating basal cells in seminiferous tubules. (X 200, Number of rats = 10/group)
Rizk et al. Reproductive Biology and Endocrinology (2020) 18:2 Page 10 of 13
therapeutic option for the treatment of oxidative stresscaused by sleep deprivation, and apparently, other environ-mental stressors via its potent antioxidant properties.Since sleep deprivation can cause a state of inflammation
[49], it was relevant to study the possible effects of inflamma-tion on the male reproductive system. Inflammation hasbeen known to affect the twin testicular functions; steroido-genesis and spermatogenesis. Marked decreases in the circu-lating levels of luteinizing hormone and testosterone weredetected during inflammatory states [50]. Indeed, testicularinflammatory disorders leading to impairment of spermato-genesis are considered to be a primary cause for male infertil-ity. The testis is considered as an immune privileged organ,nevertheless, toxic agents and inflammation may overwhelmimmune suppressor mechanisms resulting in autoimmunereactions against spermatic antigens. Consequently, this mayresult in aspermatogenesis and infertility [51]. In the presentstudy, sleep deprivation resulted in significant rise in IL-6and Il-17, which could be countered by the treatment withvitamin C. Nevertheless, some cytokines such as IL-1, andIL-6 can also produced by Leydig and Sertoli cells [25]. Con-sequently, it is possible that cytokines may act not only to-wards somatic cells, but also towards the germ cells both inan autocrine and paracrine fashion. It is possible that cyto-kines may act during spermatogenesis, sperm maturation,sperm transport, and even during the fertilization process it-self. Cytokines such as interleukins and tumor necrosis fac-tors are involved in signal transduction during inflammatorystates [26]. Despite the existing controversy regarding therole of cytokines in fertility, our results were in agreementwith previously published data reporting that significantly el-evated IL-6 levels were found in infertile patients and re-vealed an apparent negative correlation with sperm number.Moreover, infertile patients with varicocele exhibited an ele-vated levels of IL-6 [52, 53]. Excess IL-17 is commonly asso-ciated with different types of inflammation, and as for ourstudy, IL-17 serum levels were elevated in the sleep deprivedmale rats. It has been reported previously that LI-17 and itssignaling pathway were highly expressed in mice testis ex-posed to high fluoride [51]. IL-17 was found to be criticallyinvolved in male patients with azoospermic testis withchronic inflammation. To our knowledge, this could be thefirst report on the effect of Vitamin C on serum IL-6 or IL-17 vis-à-vis male fertility.In the present study, vitamin C had significantly coun-
tered the sleep deprivation-induced increased expressionof testicular NF-κβ and decreased expression of testicu-lar Nrf2 genes. NF-κβ can be activated by a multiplicityof stimulants including ROS through the phosphoryl-ation of the inhibitory kappa B (IκB) by IκB kinases. NF-κβ is known to activate several genes including the indu-cible nitric oxide synthase (iNOS), resulting eventuallyin excessive generation of nitric oxide (NO) [54]. NO, ifoxidized, generates reactive NO species, which might
behave similarly to ROS. It has been reported previouslythat NO could enhance cellular injury by decreasingintracellular GSH levels [55]. Nrf2, a redox sensitivetranscription factor, is a fundamental contributor to oxi-dative stress homeostasis [56]. Nrf2 is involved in theregulation of the synthesis and conjugation of glutathi-one (glutamate-cysteine ligase catalytic subunit), andantioxidant proteins responsible for the detoxification ofROS [57]. It was reported previously that Nrf2 expres-sion is significantly lower in semen of men with lowsperm motility [58]. Nrf2 plays an important role in pre-venting oxidative disruption of spermatogenesis. In fact,Nakamura et al. demonstrated that male Nrf2 knockoutmice (Nrf2−/−) have decreased fertility compared to thewild type. They also reported that Nrf2−/− male micehad elevated levels of testicular and epididymal lipid per-oxidation, prominent testicular germ cell apoptosis, andreduced antioxidants levels compared to wild type malemice [59].Histopathological and immunostaining studies demon-
strated that vitamin C has protective effects at the struc-tural level. Sleep deprivation resulted in disruption ofthe normal morphology of spermatogonia and occasion-ally apoptosis. Treatment with vitamin C retained muchof the normal morphology and regularity of the semin-iferous tubules and the different stages of spermatogen-esis. Preservation of spermatogenesis was furthersupported by enhancement of the PCNA immunostain-ing in the sleep deprived vitamin C treated rats. PCNAcould serve as a biomarker for spermatogenesis [60].
ConclusionSleep deprivation, whatever the cause is, has serious ef-fects on male fertility. We showed here that vitamin Cmaintained testicular structure and enhanced testicularfunction in sleep deprived rats. Vitamin C counteractedsleep deprivation dependent alteration in sperm analysis,hormonal levels, and inflammatory and oxidative stressbiomarkers. Vitamin C modified the sleep deprivation-dependent altered Nrf2 and NF-κβ gene expression.Consequently, vitamin C could be a potential fertility en-hancer in opposition to lifestyle stresses.
AcknowledgmentsAuthors wish to thank the Faculty of Medicine - Menoufia University forproviding most of the required facilities. Authors would also like toacknowledge the assistance of Prof. Dr. Eman Badr and members of theCentral Lab – Faculty of Medicine – Menoufia University.
Rizk et al. Reproductive Biology and Endocrinology (2020) 18:2 Page 11 of 13
Authors’ contributionsNIR performed the sleep deprivation experiments, collected all the samplesand participated in drafting the manuscript. MSR performed the biochemicalassays and semen analysis. ASM carried out the H&E and immunostainingexperiments and interpreted their data. YMN designed the study, preparedthe figures, interpreted the data and drafted the manuscript. All authorshave read and approved the final draft of the manuscript.
FundingThis research did not receive any specific grant from funding agencies in thepublic, commercial, or not-for-profit sectors.
Availability of data and materialsData supporting findings are presented within the manuscript.
Ethics approval and consent to participateThis study was approved by the Ethical Committee of the Faculty ofMedicine, Menoufia University, Egypt.
Consent for publicationNot applicable.
Competing interestsThe authors declare that they have no competing interests.
Author details1Clinical Physiology Department, Faculty of Medicine, Menoufia University,Menoufia, Egypt. 2Medical Biochemistry and Molecular Biology Department,Faculty of Medicine, Menoufia University, Menoufia, Egypt. 3PathologyDepartment, Faculty of Medicine, Menoufia University, Menoufia, Egypt.
Received: 9 October 2019 Accepted: 6 January 2020
References1. Agarwal A, Mulgund A, Hamada A, Chyatte MR. A unique view on male
infertility around the globe. Reprod Biol Endocrinol. 2015;13:37.2. Levine H, Jorgensen N, Martino-Andrade A, Mendiola J, Weksler-Derri D,
Mindlis I, Pinotti R, Swan SH. Temporal trends in sperm count: a systematicreview and meta-regression analysis. Hum Reprod Update. 2017;23(6):646–59.
3. Gorpinchenko I, Nikitin O, Banyra O, Shulyak A. The influence of directmobile phone radiation on sperm quality. Central Eur J Urol. 2014;67(1):65–71.
4. Durairajanayagam D. Lifestyle causes of male infertility. Arab J Urol. 2018;16(1):10–20.
5. Siegel JM. Clues to the functions of mammalian sleep. Nature. 2005;437(7063):1264–71.
6. Tsutsumi R, Webster NJ. GnRH pulsatility, the pituitary response andreproductive dysfunction. Endocr J. 2009;56(6):729–37.
7. Kalmbach DA, Arnedt JT, Pillai V, Ciesla JA. The impact of sleep on femalesexual response and behavior: a pilot study. J Sex Med. 2015;12(5):1221–32.
8. Ayas NT, White DP, Manson JE, Stampfer MJ, Speizer FE, Malhotra A, Hu FB.A prospective study of sleep duration and coronary heart disease inwomen. Arch Intern Med. 2003;163(2):205–9.
9. Choi JH, Lee SH, Bae JH, Shim JS, Park HS, Kim YS, Shin C. Effect of sleepdeprivation on the male reproductive system in rats. J Korean Med Sci.2016;31(10):1624–30.
10. Goldstein CA, Smith YR. Sleep, circadian rhythms, and fertility. Curr SleepMed Rep. 2016;2(4):206–17.
11. Jensen TK, Andersson A-M, Skakkebæk NE, Joensen UN, Jensen MB, LassenTH, Nordkap L, Olesen IA, Hansen ÅM, Rod NH, et al. Association of SleepDisturbances with Reduced Semen Quality: a cross-sectional study among953 healthy Young Danish men. Am J Epidemiol. 2013;177(10):1027–37.
12. Besedovsky L, Lange T, Born J. Sleep and immune function. Pflugers Arch.2012;463(1):121–37.
13. Hui L, Hua F, Diandong H, Hong Y. Effects of sleep and sleep deprivation onimmunoglobulins and complement in humans. Brain Behav Immun. 2007;21(3):308–10.
14. Liu MM, Liu L, Chen L, Yin XJ, Liu H, Zhang YH, Li PL, Wang S, Li XX, Yu CH.Sleep deprivation and late bedtime impair sperm health through increasing
Antisperm antibody production: a prospective study of 981 healthy men.Med Sci Monit. 2017;23:1842–8.
15. Agarwal A, Deepinder F, Cocuzza M, Agarwal R, Short RA, Sabanegh E,Marmar JL. Efficacy of varicocelectomy in improving semen parameters:new meta-analytical approach. Urology. 2007;70(3):532–8.
16. Wang YX, Zhu WJ, Jiang H. Sperm exposure during menses is a risk factorfor developing antisperm antibody (ASA) in female. Arch Gynecol Obstet.2013;288(5):1145–8.
17. Silva CA, Cocuzza M, Carvalho JF, Bonfa E. Diagnosis and classification ofautoimmune orchitis. Autoimmun Rev. 2014;13(4–5):431–4.
18. Aitken RJ, Roman SD. Antioxidant systems and oxidative stress in the testes.Oxidative Med Cell Longev. 2008;1(1):15–24.
19. Agarwal A, Saleh RA. Role of oxidants in male infertility: rationale,significance, and treatment. Urol Clin North Am. 2002;29(4):817–27.
20. Ellulu MS, Rahmat A, Patimah I, Khaza'ai H, Abed Y. Effect of vitamin C oninflammation and metabolic markers in hypertensive and/or diabetic obeseadults: a randomized controlled trial. Drug Des Devel Ther. 2015;9:3405–12.
21. Sonmez M, Yuce A, Turk G. The protective effects of melatonin and vitaminE on antioxidant enzyme activities and epididymal sperm characteristics ofhomocysteine treated male rats. Reprod Toxicol. 2007;23(2):226–31.
22. Vijayprasad S, Bb G, Bb N. Effect of vitamin C on male fertility in ratssubjected to forced swimming stress. J Clin Diagn Res. 2014;8(7):HC05–8.
23. Soleimanzadeh A, Saberivand A. Effect of curcumin on rat sperm morphologyafter the freeze-thawing process. Vet Res Forum. 2013;4(3):185–9.
24. D'Souza UJ. Toxic effects of 5-fluorouracil on sperm count in wistar rats.Malays J Med Sci. 2003;10(1):43–5.
25. Havrylyuk A, Chopyak V, Boyko Y, Kril I, Kurpisz M. Cytokines in the bloodand semen of infertile patients. Cent Eur J Immunol. 2015;40(3):337–44.
26. Sarkar O, Bahrainwala J, Chandrasekaran S, Kothari S, Mathur PP, Agarwal A.Impact of inflammation on male fertility. Front Biosci (Elite edition). 2011;3:89–95.
27. Wagner H, Cheng JW, Ko EY. Role of reactive oxygen species in maleinfertility: an updated review of literature. Arab J Urol. 2017;16(1):35–43.
28. Fernandes GSA, Fernandez CDB, Campos KE, Damasceno DC, Anselmo-Franci JA, Kempinas WDG. Vitamin C partially attenuates male reproductivedeficits in hyperglycemic rats. Reprod Biol Endocrinol. 2011;9(1):100.
29. Andersen ML, Bignotto M, Machado RB, Tufik S. Different stress modalitiesresult in distinct steroid hormone responses by male rats. Braz J Med BiolRes. 2004;37(6):791–7.
30. Retana-Márquez S, Bonilla-Jaime H, Vázquez-Palacios G, Martínez-García R,Velázquez-Moctezuma J. Changes in masculine sexual behavior,corticosterone and testosterone in response to acute and chronic stress inmale rats. Horm Behav. 2003;44(4):327–37.
31. Chen Y, Wang Q, Wang FF, Gao HB, Zhang P. Stress induces glucocorticoid-mediated apoptosis of rat Leydig cells in vivo. Stress (Amsterdam,Netherlands). 2012;15(1):74–84.
32. Gao HB, Tong MH, Hu YQ, Guo QS, Ge R, Hardy MP. Glucocorticoid inducesapoptosis in rat leydig cells. Endocrinology. 2002;143(1):130–8.
33. Brownlee KK, Moore AW, Hackney AC. Relationship between circulatingcortisol and testosterone: influence of physical exercise. J Sports Sci Med.2005;4(1):76–83.
34. Smith GD, Ben-Shlomo Y, Beswick A, Yarnell J, Lightman S, Elwood P.Cortisol, testosterone, and coronary heart disease: prospective evidencefrom the Caerphilly study. Circulation. 2005;112(3):332–40.
35. Brody S, Preut R, Schommer K, Schurmeyer TH. A randomized controlledtrial of high dose ascorbic acid for reduction of blood pressure, cortisol, andsubjective responses to psychological stress. Psychopharmacology. 2002;159(3):319–24.
36. Padayatty SJ, Doppman JL, Chang R, Wang Y, Gill J, Papanicolaou DA,Levine M. Human adrenal glands secrete vitamin C in response toadrenocorticotrophic hormone. Am J Clin Nutr. 2007;86:145–9.
37. Peters EM, Anderson R, Nieman DC, Fickl H, Jogessar V. Vitamin Csupplementation attenuates the increases in circulating cortisol, adrenalineand anti-inflammatory polypeptides following Ultramarathon running. Int JSports Med. 2001;22(07):537–43.
38. Choi JY, dela Peña IC, Yoon SY, Woo TS, Choi YJ, Shin CY, Ryu JH, Lee YS, YuGY, Cheong JH. Is the anti-stress effect of vitamin C related to adrenal glandfunction in rat? Food Sci Biotechnol. 2011;20(2):429–35.
39. Hill VM, O'Connor RM, Sissoko GB, Irobunda IS, Leong S, Canman JC,Stavropoulos N, Shirasu-Hiza M. A bidirectional relationship between sleepand oxidative stress in drosophila. PLoS Biol. 2018;16(7):e2005206.
Rizk et al. Reproductive Biology and Endocrinology (2020) 18:2 Page 12 of 13
40. Noguti J, Andersen ML, Cirelli C, Ribeiro DA. Oxidative stress, cancer, andsleep deprivation: is there a logical link in this association? Sleep Breath.2013;17:905–10.
41. Villafuerte G, Miguel-Puga A, Rodríguez EM, Machado S, Manjarrez E, Arias-Carrión O, et al. Sleep deprivation and oxidative stress in animal models: asystematic review. Oxid Med Cell Longev. 2015;2015:15.
42. Tremellen K. Oxidative stress and male infertility--a clinical perspective. HumReprod Update. 2008;14(3):243–58.
43. Tavilani H, Goodarzi MT, Doosti M, Vaisi-Raygani A, Hassanzadeh T, Salimi S,Joshaghani HR. Relationship between seminal antioxidant enzymes and thephospholipid and fatty acid composition of spermatozoa. Reprod BioMedOnline. 2008;16(5):649–56.
44. Collodel G, Moretti E, Micheli L, Menchiari A, Moltoni L, Cerretani D. Semencharacteristics and malondialdehyde levels in men with differentreproductive problems. Andrology. 2014;3(2):280–6.
45. Subramanian V, Ravichandran A, Thiagarajan N, Govindarajan M,Dhandayuthapani S, Suresh S. Seminal reactive oxygen species and totalantioxidant capacity: correlations with sperm parameters and impact onmale infertility. Clin Exp Reprod Med. 2018;45(2):88–93.
46. Foresta C, Flohe L, Garolla A, Roveri A, Ursini F, Maiorino M. Male fertility islinked to the selenoprotein phospholipid hydroperoxide glutathioneperoxidase. Biol Reprod. 2002;67(3):967–71.
48. Lewis SE, Sterling ES, Young IS, Thompson W. Comparison of individualantioxidants of sperm and seminal plasma in fertile and infertile men. FertilSteril. 1997;67(1):142–7.
49. Mullington JM, Simpson NS, Meier-Ewert HK, Haack M. Sleep loss andinflammation. Best Pract Res Clin Endocrinol Metab. 2010;24(5):775–84.
50. O'Bryan MK, Schlatt S, Gerdprasert O, Phillips DJ, de Kretser DM, Hedger MP.Inducible nitric oxide synthase in the rat testis: evidence for potential rolesin both normal function and inflammation-mediated infertility. Biol Reprod.2000;63(5):1285–93.
51. Huo M, Han H, Sun Z, Lu Z, Yao X, Wang S, Wang J. Role of IL-17 pathwaysin immune privilege: a RNA deep sequencing analysis of the mice testisexposure to fluoride. Sci Rep. 2016;6:32173.
52. Qian L, Sun G, Zhou B, Wang G, Song J, He H. Study on the relationshipbetween different cytokines in the semen of infertility patients. Am JReprod Immunol. 2011;66:157–61.
53. Nallella KP, Allamaneni SSR, Pasqualotto FF, Sharma RK, Thomas AJ Jr,Agarwal A. Relationship of interleukin-6 with semen characteristics andoxidative stress in patients with varicocele. Urology. 2004;64(5):1010–3.
54. Sinke AP, Jayakumar AR, Panickar KS, Moriyama M, Reddy PVB, NorenbergMD. NFkappaB in the mechanism of ammonia-induced astrocyte swelling inculture. J Neurochem. 2008;106(6):2302–11.
55. Fan J, Sarah JR, Srinivasa Raju D, Gregory JD. NO modulates NADPH oxidasefunction via Heme Oxygenase-1 in human endothelial cells. Hypertension.2006;48:950–7.
56. Wang A, Fanning L, Anderson DJ, Loughlin KR. Generation of reactiveoxygen species by leukocytes and sperm following exposure to urogenitaltract infection. Arch Androl. 1997;39(1):11–7.
57. Yamashita Y, Ueyama T, Nishi T, Yamamoto Y, Kawakoshi A, Sunami S,Iguchi M, Tamai H, Ueda K, Ito T, et al. Nrf2-inducing anti-oxidation stressresponse in the rat liver--new beneficial effect of lansoprazole. PLoS One.2014;9(5):e97419.
58. Chen K, Mai Z, Zhou Y, Gao X, Yu B. Low NRF2 mRNA expression inspermatozoa from men with low sperm motility. Tohoku J Exp Med. 2012;228(3):259–66.
59. Nakamura BN, Lawson G, Chan JY, Banuelos J, Cortés MM, Hoang YD, OrtizL, Rau BA, Luderer U. Knockout of the transcription factor NRF2 disruptsspermatogenesis in an age-dependent manner. Free Radic Biol Med. 2010;49(9):1368–79.
60. Tousson E, Ali EMM, Ibrahim W, Mansour MA. Proliferating cell nuclearantigen as a molecular biomarker for spermatogenesis in PTU-inducedhypothyroidism of rats. Reprod Sci. 2011;18(7):679–86.
Publisher’s NoteSpringer Nature remains neutral with regard to jurisdictional claims inpublished maps and institutional affiliations.
Rizk et al. Reproductive Biology and Endocrinology (2020) 18:2 Page 13 of 13
