Bax∆2 Promotes Apoptosis through Caspase-8 Activation
in Microsatellite Unstable Colon Cancer
Honghong Zhang1, Yuting Lin1, Adriana Mañas1, Yu Zhao1, Mitchell F. Denning2,
Li Ma3, and Jialing Xiang1*
1Department of Biological and Chemical Sciences, Illinois Institute of Technology,
Chicago, IL 60616
2Department of Pathology, Loyola University Medical Center, Maywood, IL 60153
3Mumetel, LLC, University Technology Park, Illinois Institute of Technology, Chicago, IL
60616
Running title: BaxΔ2 activates caspase-8 pathway
Keywords: Bax; tumor suppressor; microsatellite instability; alternative splicing; caspase-8
*To whom the correspondence should be addressed: Jialing Xiang, Department of Biological and
Chemical Sciences, Illinois Institute of Technology, 3101 South Dearborn Street, Chicago,
Illinois, USA. Tel.: (312) 567-3491; Fax: (312)-567-3494; E-mail: [email protected]
Note:
This study was supported by a National Institute of Health grant (R01 CA128114).
Conflict of interest: The authors (Xiang and Ma) filed a patent application on the anti-Bax∆2
antibody used in this study. There is no potential conflict of interest.
Word count: 4,462; Figures: 4; Tables: 2
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
2
Abstract
Loss of apoptotic Bax due to microsatellite mutation contributes to tumor development and
chemoresistance. Recently a Bax microsatellite mutation was uncovered in combination with a
specific alternative splicing event that could generate a unique Bax isoform (Bax∆2) in otherwise
Bax-negative cells. Like the prototype Baxα, Bax∆2 is a potent pro-apoptotic molecule.
However, the pro-apoptotic mechanism and therapeutic implication of Bax2 remain elusive.
Here, the isolation and analysis of isogenic sub-cell lines are described that represent different
Bax microsatellite statuses from colorectal cancer. Colon cancer cells harboring Bax
microsatellite G7/G7 alleles are capable of producing low levels of endogenous Bax∆2
transcripts and proteins. Interestingly, Bax∆2-positive cells are selectively sensitive to a
subgroup of chemotherapeutics compared with Bax∆2-negative cells. Unlike other Bax isoforms,
Bax∆2 recruits caspase-8 into the proximity for activation, and the latter, in turn, activates
caspase-3 and apoptosis independent of the mitochondrial pathway. These data suggest that the
expression of Bax∆2 may provide alternative apoptotic and chemotherapeutic advantages for
Bax-negative tumors.
Implications
“Bax-negative” colorectal tumors expressing a Bax isoform are sensitive to selective
chemotherapeutics.
Introduction
A microsatellite is a short stretch of repeating DNA sequence that is prone to deletion or
insertion due to the slippage of DNA polymerase (1-3). Dysfunction of the DNA mismatch
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
3
repair (MMR) system often results in microsatellite instability (MSI) (4,5). The classic example
of MSI is Lynch syndrome (6), in which patients have a high risk of developing many types of
cancer, especially hereditary nonpolyposis colorectal cancer (HNPCC) (7,8). Over 90% of Lynch
syndrome patients have a high level of microsatellite instability (MSI-H) (9-11). If a
microsatellite sequence is in the DNA coding region, frameshift mutations can disrupt the
translational reading frame and cause truncation or premature termination. Many genes with
microsatellite frameshift mutations are cancer related, such as Bax, TGF-II, IGFRII, and TCF-4,
which are closely associated with MSI-H colon cancer (12-16). Loss of these key components
significantly contributes to tumor development and chemoresistance (17-19).
Bax is a pro-apoptotic Bcl-2 family member (20-22). Typically, Bax promotes apoptosis
through the activation of the mitochondrial death pathway (23,24). Under a non-stimulated
condition, Bax localizes in the cytosol as monomers. Upon stimulation by a death signal, Bax
translocates to the mitochondrial membrane where it disrupts the mitochondrial membrane,
causes the release of cytochrome C, and sequentially activates caspase-9 and caspase-3 for cell
death (24,25). Bax has several isoforms, mostly generated by alternative splicing between exon 1
and exon 3 or between exon 5 and exon 6 from the prototype Bax pre-mRNA (21,26-30).
These isoforms either universally exist in normal and cancer cells or are only detectable in
certain tissues (29). The pro-apoptotic activity of Bax isoforms can be well preserved as long as
the Bax functional BH domains remain intact (31,32). Some of the Bax isoforms, such as Baxβ,
change the stability of proteins, while others change their potencies of cell death (30,33).
Nevertheless, most Bax isoforms promote apoptosis using the same mechanism as the prototype
Bax, i.e., through the activation of the mitochondrial death pathway (23,30,33,34).
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
4
Bax is one of the genes that are frequently mutated in MSI tumors (16,35). The inactivation of
Bax by a frameshift mutation is found in 50% of HNPCC (16). The deletion of a single guanine
nucleotide (G) in the Bax exon 3 microsatellite tract (from G8 to G7) results in a reading
frameshift and “Bax-negative” phenotype due to a premature termination codon. The loss of Bax
often promotes tumor growth and increases resistance to chemotherapeutics (17-19). Recently,
we found that the mutation-mediated loss of Bax could be restored by unique alternative splicing
that produces a novel Bax isoform, Bax∆2, which exists only in cells harboring the Bax
microsatellite G7 mutation (36,37). Bax∆2 transcripts can be detected in both MSI cancer cell
lines and primary tumors (36). Bax∆2 is a more potent apoptotic inducer than Bax(36). In this
study, we show that Bax∆2 proteins determine the chemosensitivity of colon cancer cells. Unlike
Baxthe pro-apoptotic activity of Bax∆2 is mediated by the activation of the caspase-8 pathway
rather than the mitochondrial death pathway. Our results uncover a distinct mechanism by which
Bax2 induces apoptosis and suggest that Bax∆2 is a potential target for cancer therapy.
Materials and Methods
Materials
Antibody against Bax (N20, against the Bax N-terminus) was purchased from Santa Cruz
Biotechnology (Santa Cruz, CA). The Bax∆2 monoclonal antibody was generated as described
(36). Antibodies against cleaved human specific caspase-8 and mouse specific caspase-8, and
human specific Bid were from Cell Signaling Technology (Danvers, MA). The antibody against
full-length caspase-8 (LS-C99287) was from Lifespan BioSciences (Seattle, WA). The pan-
Caspase inhibitor (Z-VAD-FMK), Caspase-1 Inhibitor I (Ac-YVAD-CHO), Caspase-8 Inhibitor
II (Z-IETD-FMK), Caspase-3 Inhibitor II (Z-DEVD-FMK) and Caspase-9 Inhibitor (Z-LEHD-
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
5
FMK) were from Calbiochem (Billerica, MA). Adriamycin, Indomethacin, Cyclophosphamide
(Cytoxan), Cysplatin (CDDP), Fluorouracil (5-FU), Irinotecan (CPT-11), Vinblastine, and
Paclitaxel (Taxol) were from Sigma-Aldrich (St. Louis, MO). Etoposide and MG-132 were from
Calbiochem (Billerica, MA). Hydroxyurea, Daunorubincin and Epirubicin were from Santa Cruz
Biotechnology (Dallas, TX). Bid specific inhibitor (BI-6C9) was from Sigma-Aldrich. The
mitochondrial membrane potential assay kit was from Abcam (Cambridge, MA).
Cell lines and isogenic sublines
Colon cancer cell line HCT116 was obtained from American Type Culture Collection. The cell
line was tested and authenticated by Genetica (Cincinnati. OH) before the experiments. Both
HCT116 and Bax-/- mouse embryonic fibroblasts (MEFs) cells were cultured in DMEM
supplemented with 10% FBS. To isolate single cell population from HCT116 cells, cells were
treated with 500 μM Indomethacin for 72 h to enrich Bax G7 population (17). Single-cell
suspension was plated onto 96-well plates without Indomethacin. Single clones were recovered,
expanded, and validated by both genomic sequencing and RT-PCR analysis.
Bax microsatellite sequencing and RT-PCR
Genomic DNAs were isolated from different HCT116 sublines with DirectPCR lysis reagent
(Viagen Biotech) according to the manufacture’s instruction. Microsatellite region of Bax gene
was amplified by PCR with specific primers surrounding Bax exon 3 microsatellite region, 5’
GAGTGACACCCCGTTCTGAT 3’ (forward) and 5’ ACTCGCTCAGCTTCTTGGTG 3’
(reverse). The PCR products were purified by using MinELute PCR purification kit (QIAGEN)
and subjected to sequence analysis for determination of the Bax microsatellite status. For RT-
PCR, total RNA was isolated using the PureLink RNA Mini kit (Life Technology) according to
the manufacture’s instruction. The cDNAs were reversely transcribed from mRNA using
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
6
ThermoScript RT-PCR System (Invitrogen). The transcripts were amplified with Bax primers,
5’-GCT CTA GAG AGC GGC GGT GAT GGA CGG GT-3’ (forward), and 5’-GGA ATT CCA
GCT GGG GGC CTC AGC CCA T-3’ (reverse), or Bax∆2 specific primers, 5’-CCA GAG GCG
GGG GGT TTC ATC C-3’ (forward), 5’ –GGT TGT CGC CCT TTT CTA CTT TGC CA-3’
(reverse).
Transient transfection and RNA interference
Cells were allowed grown in 6-well plates to 70-80% confluences before transfection. Caspase-
9 dominant negative construct (LZRS-caspase-9, D/N)(38) and Bid siRNA (5’GGGCAAAAGC
UUACAAAUAUU3’), as well as controls, were transfected using lipofectamine 2000 according
to the manufacturer’s instruction (Life Technology).
Co-immunoprecipitation and immunostaining
Cell pellets were lysed in NP-40 buffer (145 mM NaCl, 5 mM MgCl, 1 mM EGTA, 0.25%
NP-40, 20 mM HEPES, pH 7.4) with a cocktail of protease inhibitors at 4 °C for 30 min. Cell
lysates were incubated with the appropriate antibody-conjugated beads overnight at 4 °C. The
beads were washed with NP-40 buffer for 3 times and the immunocomplexes were separated by
SDS-PAGE and subjected to immunoblotting analysis. For immunostaining, cells were grown
on cover slips coated with 1% gelatin. Cells were fixed and permeabilized with ice-cold
methanol and incubated with primary antibodies diluted in PBS plus 0.3%Triton-X and 3%BSA.
Following PBS washing, cells were incubated with Alexa Fluorescence conjugated secondary
antibodies. Cell nuclei were stained with DAPI. The fluorescence images were collected by
Leica SP5 Laser Scanning Confocal microscope using a 40x objective.
Mitochondrial membrane potential assay
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
7
Cells (5×106 per well) in 6-well plates were treated with different stimuli for a period of time
as indicated in the figure legends. For the positive control, cells were treated with FCCP
(Carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone, 100 μM) for 30 min before staining.
Mitochondrial membrane potentials (MMP) were analyzed by using a mitochondrial specific
cationic dye (JC-1) according to the manufacturer’s instruction and the images were collected by
Nikon TE-2000 fluorescence microscope. The quantitation of MMP was performed using ImageJ
program with at least 5 random fields for each sample.
Colony formation and invasive assays
A standard colony formation assay was performed as described (39). Briefly, total 1.5×104
cells were seeded in each well in a 6-well plate. After culturing for 3-4 weeks, the colonies were
visualized by staining with crystal violet and triplicate samples were counted under the
dissecting microscope. The transwell invasion assay was performed by using transwell inserts
with 8.0 μm pore size in 6-well plates. Total 5 × 105 cells were seeded into the upper chamber
and cultured for 24 h. Cells were fixed in the following day with 5% Glutaraldehyde and stained
by Toluidine Blue. The inner surface of the upper chamber was carefully wiped using a cotton
swab. Invasive cells were counted in three randomly selected fields for each well under a
microscope.
Results
The expression of Bax∆2 proteins can be detected in colon cancer cells harboring the Bax
microsatellite G7 mutation allele
Bax∆2 is a functional Bax isoform produced by a unique combination of a microsatellite
mononucleotide deletion (G8 to G7) in Bax exon 3 and alternative splicing of Bax exon 2 (36).
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
8
HCT116 colon cancer cells contain mixed populations with different Bax microsatellite statuses
as follows: the majority of these cells (94%) have mixed Bax alleles (G8/G7); 4% of these cells
have pure Bax G7/G7; and 2% of these cells have pure Bax G8/G8 (17). It has been shown that
further deletion of the Bax G8 allele in the Bax G8/G7 cells results in a Bax null phenotype and
leads to partial chemoresistance (17). We speculated that the population of HCT116 cells
harboring the Bax G7 mutation is capable of producing Bax∆2, thus remaining sensitive to
chemotherapeutic treatment. To test this scenario, we isolated single-cell populations using a
standard 96-well plating method (Fig. 1A) (17). More than 54 isogenic sub-clones were isolated
and genotyped. The following 20 sub-clones were further analyzed by both genomic sequence
and splicing analyses: 14 clones contained Bax G8/G7; 6 clones contained G7/G7; and none of
the clones contained G8/G8 (Table 1). Interestingly, all 6 Bax G7/G7 clones contained both
detectable transcript products from constitutive splicing and alternative splicing, as determined
by RT-PCR (Table 1). In contrast, all Bax G8/G7 clones contained only constitutive splicing
transcripts, and none of these clones contained a detectable product from alternative splicing
(Table 1). These results suggest that not all alleles containing Bax microsatellite mutations are
capable of alternative splicing.
To study the ability of the isogenic cells to generate Bax2 transcripts, we further analyzed
HCT116 sublines, namely clone #10 (Bax G7/G7) and clone #28 (Bax G8/G7). RT-PCR
analysis with primers in Bax exons 1 and 3 revealed that clone #10 (Bax G7/G7) contained both
constitutive splicing (upper band) and alternative splicing (lower band), although the constitutive
splicing product was predominant (Fig. 1B). In contrast, clone #28 (Bax G8/G7) only contained
constitutive splicing products, albeit the Bax G7 mutated allele. Furthermore, only less than
20% of the total pre-mRNA from the Bax G7/G7 population went through the exon 2 alternative
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
9
splicing (Fig. 1B). To further confirm that the alternative splicing product (lower band) was a
Bax∆2 transcript, the lower band was excised and subjected to sequence analysis. In addition, the
Bax∆2 specific 5’ primer covering the junction of exons 1 and 3 was used in the PCR analysis.
As expected, the Bax2 transcript was only detected in clone #10 and the Bax∆2 positive
control, but it was not detected in clone #28 and the Baxα negative control (Fig. 1B). Thus,
Bax∆2 transcripts can be easily detected in cells containing the Bax G7/G7 allele.
We then determined the expression of endogenous Bax∆2 proteins in the HCT116 clones #10
and #28 subline cells using a specific anti-Bax2 antibody (36). Immunoblotting analysis
revealed that the endogenous Bax∆2 protein levels were extremely low in clone #10 and
undetectable in clone #28 (Fig. 1C). However, Bax∆2 proteins were easily detected in clone #10
when the cells were treated with MG-132, a proteasomal inhibitor (Fig. 1C). Under the same
conditions, clone #28 had no detectable Bax∆2 proteins. This result was consistent with previous
observations (Fig. 1B) that Bax G8/G7 cannot generate detectable Bax∆2 transcript and protein.
Of note, both clone #10 and clone #28 had no detectable parental Baxα proteins, as analyzed by
immunoblotting using several anti-Baxα antibodies (Fig. 1C and data not shown). Taken
together, these results indicate that cancer cells harboring Bax G7/G7 mutations are capable of
generating Bax∆2 proteins, although the Bax2 proteins appear to be unstable and prone to
proteasomal degradation.
To analyze the physiological characteristics of these two HCT116 isogenic sublines, the
growth rate, invasion ability and colony formation of both clones #10 and #28 cells were
analyzed. We found that clones #10 and #28 were quite similar to each other in terms of growth
rate (Fig. 1D) and invasive ability (Fig. 1E). However, the Bax∆2-positive clone #10 had
significantly less capability in colony formation compared with the Bax∆2-negative clone #28
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
10
(Fig. 1F). These results indicate that Bax∆2-positive cells may be less tumorigenic in tumor
development.
Bax∆2-positive subline cells are sensitive to a subgroup of chemotherapeutics
We have previously shown that cancer cells with Bax microsatellite mutations, such as prostate
cancer 104-R cells (G7/G7) and colon cancer LoVo cells (G7/G9), are more sensitive to
Adriamycin treatment than cancer cells with wild type Bax (36). However, the heterogeneity of
different cell lines often adds complexity to data interpretation. To address this issue, we
compared HCT116 isogenic subline clone #10 (Bax∆2-positive) and clone #28 (Bax2-negative)
cells for their sensitivities to chemotherapeutic agents. For the initial screening, we selected a
panel of different classes of commonly used chemotherapeutic drugs. Cells were treated with a
series of doses of each drug, and the results of cell death are shown in Table 2. Bax∆2-positive
clone #10 was more sensitive to Adriamycin than Bax2-negative clone #28, which was
consistent with the previous report that Bax∆2-positive cancer cells are more sensitive to
Adriamycin than Bax∆2-negative cancer cells (36). In addition, Bax∆2-positive clone #10 was
also highly sensitive to 5-FU, a pyrimidine analogue compared with the Bax2-negative clone
#28 (Table 2). Interestingly, the sensitivity seems selective, even within the same class of
chemotherapeutic drugs because there was no significant difference when both clones were
treated with Daunorubicin, which is also an anthracycline antibiotic with a similar structure as
Adriamycin (Table 2). These data indicate that Bax∆2-positive cells may have a therapeutic
advantage or preference to a subgroup of chemotherapeutic drugs.
Bax∆2 promotes apoptosis through activation of the caspase-8 pathway
Bax typically targets the mitochondria upon activation and results in the activation of the
caspase-9 and caspase-3 cascade for cell death (40). To determine the underlying mechanism by
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
11
which Bax∆2 promoted cell death, HCT116 clones #10 and #28 were treated with Adriamycin or
5-FU in the presence of different caspase inhibitors. We found that the chemodrug-induced
apoptosis was significantly augmented in clone #10 and could be effectively inhibited by either a
caspase-8 or caspase-3 inhibitor, but not caspase-1 or caspase-9 inhibitor (Fig. 2A). The caspase-
3 activity was confirmed by the caspase-3 fluorometric assay (Fig. 2B). The activation of
caspase-3 was not surprising, because it is an executioner caspase downstream of many caspase-
mediated cell death events, including the Bax mitochondrial death pathway (24,25). However,
the activation of caspase-8 was unexpected, as the Bax family usually utilizes the mitochondrial
death pathway (24,25). Consistent with this notion, immunoblotting analysis using an anti-active
caspase-8 antibody revealed that caspase-8 was activated, as indicated by the appearance of the
cleaved caspase-8 fragments (43 kDa and 18 kDa), in clone #10 when treated with Adriamycin
or 5-FU but not in clone #28 (Fig. 2C). Thus, Bax∆2 promoted apoptosis through the activation
of caspase-8 and its downstream executioner caspase-3.
Activation of the Bid mitochondrial pathway is not essential for the onset of Bax∆2-induced
apoptosis
Caspase-8 is one of the initiator caspases in the extrinsic death receptor pathway (41). Once
activated, caspase-8 directly activates the executioner caspase-3, or cleaves the BH-3-only
protein Bid into tBid, which in turn targets mitochondria and triggers the release of cytochrome c
for apoptosis (42,43). We next determined if the Bid-dependent mitochondrial death pathway
was required for Bax∆2 to promote apoptosis. We found that Bid was partially degraded in the
Bax∆2-positive clone #10 cells treated with 5-FU or Adriamycin but not in the Bax∆2-negative
clone #28 cells (Fig. 3A). However, inhibition of Bid activity by its specific siRNA or inhibitor
did not significantly affect the chemodrug-induced apoptosis (Fig. 3B). Similar results were
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
12
obtained using a caspase-9 inhibitor or ectopic expression of the caspase-9 dominant negative
mutant (44) (Fig. 3C). Furthermore, caspase-8 was activated as early as 8 h and reached to its
maximum activity by 16 h, but the mitochondria membrane potential remained reasonable intact
24 h post-treatment, as evidenced by simultaneously monitoring the caspase activity and
mitochondrial membrane potential (Figs. 3D and E). Taken together, these data indicate that the
Bid-dependent mitochondrial death pathway may not be essential for the onset of chemodrug-
induced apoptosis in the Bax∆2-positive cells. Direct activation of caspase-3 by caspase-8 is
likely required for the onset of the apoptosis.
Bax∆2 activates caspase-8 by recruiting it into proximity
Caspase-8 is usually activated by death receptor-mediated self-processing, i.e., the proximity-
induced dimerization, followed by aggregation and self-cleavage/activation (45). We speculated
whether Bax∆2 oligomers or aggregates might serve as a platform to recruit caspase-8 into the
proximity for activation. To test this hypothesis, we first examined whether Bax∆2 and caspase-8
were localized together. Bax null mouse embryonic fibroblast (MEFs) were transfected with
Bax∆2 and the activation of caspase-8 was confirmed by immunoblotting analysis with an anti-
cleaved caspase-8 antibody (Fig. 4A). Immunostaining showed that in the absence of Bax∆2, the
staining of caspase-8 was weak and appeared as diffused fine granules (Fig. 4B, top panel).
Upon the expression of Bax∆2, caspase-8 became aggregated and co-localized with Bax∆2 (Fig.
4B, bottom panel). To determine whether Bax∆2 and caspase-8 physically interacted with each
other, we transfected Bax∆2 into Bax∆2-negative HCT116 clone #28 cells. Co-
immunoprecipitation in combination with immunoblotting analysis revealed that the amount of
the caspase-8 cleaved fragment (p43) was significantly higher in the immunocomplex with the
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
13
anti-Bax∆2 antibody than that with the IgG control (Fig. 4C). These data suggest that Bax∆2
oligomers may serve as a platform for caspase-8 aggregation and activation.
Discussion
Bax is a pro-apoptotic tumor suppressor and is expressed in almost all types of human cells
(21,46). Exon 3 of Bax contains a microsatellite sequence that is prone to mutation due to
replication slippage if the mismatch repair system is impaired (47,48). A single guanine
nucleotide deletion from G8 to G7 is the most common mutation in colorectal cancer with
microsatellite instability, thus resulting in an apparent Bax null phenotype (47,48). Interestingly,
alternative splicing of Bax exon 2 can rescue the frameshift mutation, generating a unique and
functional Bax∆2 isoform (36). In this report, we demonstrated that cancer cells harboring Bax
G7/G7 alleles were capable of producing Bax∆2 transcripts and proteins, although the levels of
Bax2 transcripts and proteins were extremely low and unstable (Figs. 1B and C). Bax∆2-
positive cells were selectively sensitive to a subgroup of chemotherapeutics, such as 5-FU and
Adriamycin (Table 2 and Fig. 2). Surprisingly, Bax∆2-promoted-apoptosis relied on the
activation of caspase-8 and downstream caspase-3 (Fig. 2). The Bid-mitochondrial pathway
appeared not essential for onset of the apoptosis (Fig. 3). The mechanism underlying caspase-8
activation by Bax2 was most likely through physical interactions between Bax∆2 and caspase-8
resulting in the formation of aggregates thereby triggering the apoptotic process (Fig. 4).
There are two criteria in the generation of BaxΔ2. First, the Bax gene must have the deletion of
a single guanine nucleotide (G8 to G7) in its exon 3 microsatellite tract. Second, the alternative
splicing machinery needs to be able to remove most of exon 2 (36). Previously, we have shown
that the alternative splicing factors for Bax∆2 are universal because cancer or non-cancerous,
human or murine fibroblast cells are all able to process the Bax∆2 alternative splicing in a mini-
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
14
gene assay (37). Thus, any Bax G7 allele, theoretically, is able to generate Bax∆2. However, our
current results showed that Bax∆2 transcripts and proteins were only detected in cells harboring
the Bax G7/G7 alleles (Fig. 1B). Furthermore, only less than 20% of total pre-mRNA from the
Bax G7/G7 population went through exon 2 alternative splicing (Fig. 1B). Neither alternative
splicing nor the Bax∆2 protein was detected in all Bax G8/G7 subclones tested (Table 1).
However, the underlying mechanism is not known. One possibility is that the amount of Bax∆2
generated by Bax G8/G7 is too low to be detected. Another possibility is that there is a potential
inhibitory mechanism for alternative splicing to occur in Bax G8/G7 cancer cells. Future studies
are needed to test these possibilities.
Bax usually promotes apoptosis through activation of the intrinsic mitochondria death pathway
(49,50). Unlike Bax and other known Bax isoforms, Bax2 lacks exon 2, which is critical for
the mitochondria targeting (33). Although ectopically expressed Bax∆2 is able to activate the
mitochondrial death pathway, it does not mean that Bax∆2 directly targets mitochondria (36).
Our results indicate that caspase-8 via caspase-3 is essential for the onset of Bax∆2-induced
apoptosis, and that mitochondria may act as an amplifier for the death process. Future studies are
needed to explore whether this unique pro-apoptotic feature of Bax2 is related to its ability to
sensitize some “Bax-negative” MSI tumor cells to a subgroup of chemotherapeutic drugs.
Acknowledgement
This study was supported by a National Institute of Health grant (R01 CA128114).
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
15
References
1. Loeb, L. A. Microsatellite instability: marker of a mutator phenotype in cancer. Cancer
research 1994; 54: 5059-5063.
2. Sia, E. A., Jinks-Robertson, S., and Petes, T. D. Genetic control of microsatellite stability.
Mutat Res 1997; 383: 61-70.
3. Perucho, M. Cancer of the microsatellite mutator phenotype. Biol Chem 1996; 377: 675-
684.
4. Peltomaki, P. Role of DNA mismatch repair defects in the pathogenesis of human cancer.
J Clin Oncol 2003; 21: 1174-1179.
5. Elliott, B., and Jasin, M. Repair of double-strand breaks by homologous recombination in
mismatch repair-defective mammalian cells. Mol Cell Biol 2001; 21: 2671-2682.
6. Lynch, H. T., and Lynch, P. M. The cancer-family syndrome: a pragmatic basis for
syndrome identification. Diseases of the colon and rectum 1979; 22: 106-110.
7. Aarnio, M., Mecklin, J. P., Aaltonen, L. A., Nystrom-Lahti, M., and Jarvinen, H. J. Life-
time risk of different cancers in hereditary non-polyposis colorectal cancer (HNPCC)
syndrome. International journal of cancer. Journal international du cancer 1995; 64: 430-
433.
8. Aarnio, M., Sankila, R., Pukkala, E., Salovaara, R., Aaltonen, L. A., de la Chapelle, A., et
al. Cancer risk in mutation carriers of DNA-mismatch-repair genes. International journal
of cancer. Journal international du cancer 1999; 81: 214-218.
9. Liu, B., Parsons, R., Papadopoulos, N., Nicolaides, N. C., Lynch, H. T., Watson, P., et al.
Analysis of mismatch repair genes in hereditary non-polyposis colorectal cancer patients.
Nature medicine 1996; 2: 169-174.
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
16
10. Abdel-Rahman, W. M., Ollikainen, M., Kariola, R., Jarvinen, H. J., Mecklin, J. P.,
Nystrom-Lahti, M., et al. Comprehensive characterization of HNPCC-related colorectal
cancers reveals striking molecular features in families with no germline mismatch repair
gene mutations. Oncogene 2005; 24: 1542-1551.
11. Duval, A., and Hamelin, R. Mutations at coding repeat sequences in mismatch repair-
deficient human cancers: toward a new concept of target genes for instability. Cancer
research 2002; 62: 2447-2454.
12. Yamaguchi, T., Iijima, T., Mori, T., Takahashi, K., Matsumoto, H., Miyamoto, H., et al.
Accumulation profile of frameshift mutations during development and progression of
colorectal cancer from patients with hereditary nonpolyposis colorectal cancer. Diseases
of the colon and rectum 2006; 49: 399-406.
13. Ham, M. F., Takakuwa, T., Luo, W. J., Liu, A., Horii, A., and Aozasa, K. Impairment of
double-strand breaks repair and aberrant splicing of ATM and MRE11 in leukemia-
lymphoma cell lines with microsatellite instability. Cancer Sci 2006; 97: 226-234.
14. Miquel, C., Jacob, S., Grandjouan, S., Aime, A., Viguier, J., Sabourin, J. C., et al.
Frequent alteration of DNA damage signalling and repair pathways in human colorectal
cancers with microsatellite instability. Oncogene 2007; 26: 5919-5926.
15. Schwartz, S., Jr., Yamamoto, H., Navarro, M., Maestro, M., Reventos, J., and Perucho,
M. Frameshift mutations at mononucleotide repeats in caspase-5 and other target genes in
endometrial and gastrointestinal cancer of the microsatellite mutator phenotype. Cancer
research 1999; 59: 2995-3002.
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
17
16. Rampino, N., Yamamoto, H., Ionov, Y., Li, Y., Sawai, H., Reed, J. C., et al. Somatic
frameshift mutations in the BAX gene in colon cancers of the microsatellite mutator
phenotype. Science 1997; 275: 967-969.
17. Zhang, L., Yu, J., Park, B. H., Kinzler, K. W., and Vogelstein, B. Role of BAX in the
apoptotic response to anticancer agents. Science 2000; 290: 989-992.
18. Olejniczak, S. H., Hernandez-Ilizaliturri, F. J., Clements, J. L., and Czuczman, M. S.
Acquired resistance to rituximab is associated with chemotherapy resistance resulting
from decreased Bax and Bak expression. Clin Cancer Res 2008; 14: 1550-1560.
19. Jeong, S. H., Lee, H. W., Han, J. H., Kang, S. Y., Choi, J. H., Jung, Y. M., et al. Low
expression of Bax predicts poor prognosis in resected non-small cell lung cancer patients
with non-squamous histology. Jpn J Clin Oncol 2008; 38: 661-669.
20. Korsmeyer, S. J. BCL-2 gene family and the regulation of programmed cell death.
Cancer research 1999; 59: 1693s-1700s.
21. Oltvai, Z. N., Milliman, C. L., and Korsmeyer, S. J. Bcl-2 heterodimerizes in vivo with a
conserved homolog, Bax, that accelerates programmed cell death. Cell 1993; 74: 609-
619.
22. Chipuk, J. E., Moldoveanu, T., Llambi, F., Parsons, M. J., and Green, D. R. The BCL-2
family reunion. Mol Cell 2010; 37: 299-310.
23. Er, E., Oliver, L., Cartron, P. F., Juin, P., Manon, S., and Vallette, F. M. Mitochondria as
the target of the pro-apoptotic protein Bax. Biochimica et biophysica acta 2006; 1757:
1301-1311.
24. Goping, I. S., Gross, A., Lavoie, J. N., Nguyen, M., Jemmerson, R., Roth, K., et al.
Regulated targeting of BAX to mitochondria. J Cell Biol 1998; 143: 207-215.
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
18
25. Jurgensmeier, J. M., Xie, Z., Deveraux, Q., Ellerby, L., Bredesen, D., and Reed, J. C. Bax
directly induces release of cytochrome c from isolated mitochondria. Proc Natl Acad Sci
U S A 1998; 95: 4997-5002.
26. Zhou, M., Demo, S. D., McClure, T. N., Crea, R., and Bitler, C. M. A novel splice variant
of the cell death-promoting protein BAX. The Journal of biological chemistry 1998; 273:
11930-11936.
27. Thomas, A. L., Price, C., Martin, S. G., Carmichael, J., and Murray, J. C. Identification of
two novel mRNA splice variants of bax. Cell death and differentiation 1999; 6: 97-98.
28. Schmitt, E., Paquet, C., Beauchemin, M., Dever-Bertrand, J., and Bertrand, R.
Characterization of Bax-sigma, a cell death-inducing isoform of Bax. Biochemical and
biophysical research communications 2000; 270: 868-879.
29. Cartron, P. F., Oliver, L., Martin, S., Moreau, C., LeCabellec, M. T., Jezequel, P., et al.
The expression of a new variant of the pro-apoptotic molecule Bax, Baxpsi, is correlated
with an increased survival of glioblastoma multiforme patients. Human molecular
genetics 2002; 11: 675-687.
30. Fu, N. Y., Sukumaran, S. K., Kerk, S. Y., and Yu, V. C. Baxbeta: a constitutively active
human Bax isoform that is under tight regulatory control by the proteasomal degradation
mechanism. Mol Cell 2009; 33: 15-29.
31. Wang, K., Gross, A., Waksman, G., and Korsmeyer, S. J. Mutagenesis of the BH3
domain of BAX identifies residues critical for dimerization and killing. Mol Cell Biol
1998; 18: 6083-6089.
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
19
32. Letai, A., Bassik, M. C., Walensky, L. D., Sorcinelli, M. D., Weiler, S., and Korsmeyer,
S. J. Distinct BH3 domains either sensitize or activate mitochondrial apoptosis, serving as
prototype cancer therapeutics. Cancer cell 2002; 2: 183-192.
33. Cartron, P. F., Priault, M., Oliver, L., Meflah, K., Manon, S., and Vallette, F. M. The N-
terminal end of Bax contains a mitochondrial-targeting signal. The Journal of biological
chemistry 2003; 278: 11633-11641.
34. Shi, B., Triebe, D., Kajiji, S., Iwata, K. K., Bruskin, A., and Mahajna, J. Identification
and characterization of baxepsilon, a novel bax variant missing the BH2 and the
transmembrane domains. Biochemical and biophysical research communications 1999;
254: 779-785.
35. Shima, K., Morikawa, T., Yamauchi, M., Kuchiba, A., Imamura, Y., Liao, X., et al.
TGFBR2 and BAX mononucleotide tract mutations, microsatellite instability, and
prognosis in 1072 colorectal cancers. PLoS One 2011; 6: e25062.
36. Haferkamp, B., Zhang, H., Lin, Y., Yeap, X., Bunce, A., Sharpe, J., et al. BaxDelta2 is a
novel bax isoform unique to microsatellite unstable tumors. The Journal of biological
chemistry 2012; 287: 34722-34729.
37. Haferkamp, B., Zhang, H., Kissinger, S., Wang, X., Lin, Y., Schultz, M., et al. BaxDelta2
Family Alternative Splicing Salvages Bax Microsatellite-Frameshift Mutations. Genes &
cancer 2013; 4: 501-512.
38. Sitailo, L. A., Tibudan, S. S., and Denning, M. F. Activation of caspase-9 is required for
UV-induced apoptosis of human keratinocytes. The Journal of biological chemistry 2002;
277: 19346-19352.
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
20
39. Puck, T. T., and Marcus, P. I. Action of x-rays on mammalian cells. The Journal of
experimental medicine 1956; 103: 653-666.
40. Garrido, C., Galluzzi, L., Brunet, M., Puig, P. E., Didelot, C., and Kroemer, G.
Mechanisms of cytochrome c release from mitochondria. Cell death and differentiation
2006; 13: 1423-1433.
41. Chang, D. W., Xing, Z., Capacio, V. L., Peter, M. E., and Yang, X. Interdimer processing
mechanism of procaspase-8 activation. The EMBO journal 2003; 22: 4132-4142.
42. Gross, A., Yin, X. M., Wang, K., Wei, M. C., Jockel, J., Milliman, C., et al. Caspase
cleaved BID targets mitochondria and is required for cytochrome c release, while BCL-
XL prevents this release but not tumor necrosis factor-R1/Fas death. The Journal of
biological chemistry 1999; 274: 1156-1163.
43. Kantari, C., and Walczak, H. Caspase-8 and bid: caught in the act between death
receptors and mitochondria. Biochimica et biophysica acta 2011; 1813: 558-563.
44. Denning, M. F., Wang, Y., Tibudan, S., Alkan, S., Nickoloff, B. J., and Qin, J. Z.
Caspase activation and disruption of mitochondrial membrane potential during UV
radiation-induced apoptosis of human keratinocytes requires activation of protein kinase
C. Cell death and differentiation 2002; 9: 40-52.
45. Jin, Z., Li, Y., Pitti, R., Lawrence, D., Pham, V. C., Lill, J. R., et al. Cullin3-based
polyubiquitination and p62-dependent aggregation of caspase-8 mediate extrinsic
apoptosis signaling. Cell 2009; 137: 721-735.
46. Knudson, C. M., Tung, K. S., Tourtellotte, W. G., Brown, G. A., and Korsmeyer, S. J.
Bax-deficient mice with lymphoid hyperplasia and male germ cell death. Science 1995;
270: 96-99.
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
21
47. Miquel, C., Borrini, F., Grandjouan, S., Auperin, A., Viguier, J., Velasco, V., et al. Role
of bax mutations in apoptosis in colorectal cancers with microsatellite instability.
American journal of clinical pathology 2005; 123: 562-570.
48. Molenaar, J. J., Gerard, B., Chambon-Pautas, C., Cave, H., Duval, M., Vilmer, E., et al.
Microsatellite instability and frameshift mutations in BAX and transforming growth
factor-beta RII genes are very uncommon in acute lymphoblastic leukemia in vivo but
not in cell lines. Blood 1998; 92: 230-233.
49. Korsmeyer, S. J., Shutter, J. R., Veis, D. J., Merry, D. E., and Oltvai, Z. N. Bcl-2/Bax: a
rheostat that regulates an anti-oxidant pathway and cell death. Semin Cancer Biol 1993;
4: 327-332.
50. Reed, J. C. Proapoptotic multidomain Bcl-2/Bax-family proteins: mechanisms,
physiological roles, and therapeutic opportunities. Cell death and differentiation 2006;
13: 1378-1386.
Figure legends
Figure 1. Generation and characterization of the isogenic subline cells with the different Bax
microsatellite status. A, Schematic diagram of generating the HCT116 sublines. Cells were
treated with 500 μM Indomethacin for 72 h. A single cell suspension was plated into 96-well
plates without Indomethacin. Bax microsatellite statuses (G8/G8, G8/G7, or G7/G7) of each
sublines were determined by genomic sequencing as described in the methods. B, RT-PCR
analysis of Bax alternative splicing and BaxΔ2 production. The cDNAs were generated from
HCT116 clones #10 (G7/G7 genotype) and clone #28 (G8/G7 genotype) with a set of primers
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
22
that cover Bax exon 1 through exon 6, or primers specific for Bax∆2 as described in the
methods. The PCR products of Baxα and BaxΔ2 plasmid DNA were used as controls. C,
Immunoblotting of Baxα and BaxΔ2 proteins with an anti-Bax antibody (N20) or an anti-Bax∆2
antibody (2D4), respectively, in clones #10 and #28 after treatment with MG-132 (10 μM) for 8
h. Inputs of transfected BaxΔ2 and Baxα were used as positive controls. D, Cell growth curve
assay of clone #10 and clone #28. Total 1×104 cells were seeded onto 24-well plates and the cell
numbers were counted every 24 h up to 96 h. E, Trans-well invasion assay. F, Colony formation
assay. All experiments were performed independently at least three times.
Figure 2. Bax∆2 promotes apoptosis through activation of caspase-8. A, Cell death assay of
HCT116 clone #10 and clone #28 cells treated with or without 5-FU (500 μM) or Adriamycin
(Adr, 4 μg/ml) for 24 h in the presence of inhibitors (50 μM each) for caspase-3 (DEVD),
caspase-8 (IETD), caspase-1 (YVAD), and caspase-9 (LEHD) as indicated. ** P < 0.01. inh.,
inhibitor. B, Caspase-3 assay of HCT116 clone #10 and #28 cells treated as described in (A).
The activity of caspase-3 was measured using fluorogenic caspase-3 substrate DEVD-AFC (50
μM) with a microplate spectrofluorometer. C, Immunoblotting analysis for the detection of
cleaved casapase-8 in the chemodrug treated clone #10 and #28 cells with an anti-cleaved
caspase-8 antibody.
Figure 3. The Bid-dependent mitochondrial death pathway is not essential for the onset of
chemodrug-induced apoptosis in Bax∆2-positive cells. A, Immunoblotting analysis of cleaved
Bid in HCT116 clone #10 and #28 cells treated with or without 5-FU (500 μM) or Adriamycin (4
μg/ml) as indicated. The intensities of truncated Bid bands were quantitated relevant to the actin
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
23
control and are presented as arbitrary numbers. B, Cell death assay of HCT116 clone #10 cells
treated with 5-FU (500 μM) in the presence of a Bid specific inhibitor (BI-6C9; 10 μM) or Bid
siRNA. C, Cell death assay of clone #10 cells treated with 5-FU (500 μM) in the presence of a
caspase-9 inhibitor (LEHD; 50 μM) or transfected with a caspase-9 dominant negative (D/N)
mutant construct. D, Quantitative analysis of cleaved caspase-8 and mitochondrial membrane
potential (MMP) in a time course indicated for clone #10 cells treated with 5-FU (500 μM). The
MMP was measured by JC-1 staining (20 μM) and quantitated by Image-J software for the
decrease in the ratio of red (Em 590) versus green (Em 529) fluorescence intensity. Cleaved
caspase-8 was quantitated from the immunoblots by Image-J software from three independent
experiments. E, Representative images of JC-1 staining from (D). Carbonyl cyanide 4-
(trifluoromethoxy) phenylhydrazone (FCCP; 100 μM) was used as a positive control. JC-1
monomer green fluorescence as observed by excitation with 488 nm and emission with 529 nm
(top panel). JC-1 aggregate red fluorescence as observed by excitation at 546 nm and emission at
590 nm (bottom panel).
Figure 4. BaxΔ2 activates caspase-8 through physical interaction. A, Bax-/- MEFs were
transfected with BaxΔ2 for 16 h, and the cleavage of caspase-8 was confirmed by
immunoblotting with anti-cleaved caspase-8 antibody. B, Cells from (a) were immunostained
with an anti-BaxΔ2 (green) and anti-cleaved caspase-8 antibodies (red), and they were imaged
using a confocal microscope. Nuclei were stained with DAPI (blue). C, Cells from clone #28
were transfected with BaxΔ2 for 16 h and subjected to immunoprecipitation (IP) with a BaxΔ2
antibody or control IgG. The immunocomplexes were analyzed by immunoblotting (IB) with
anti-caspase-8 and anti-Bax∆2 antibodies. Actin was used as an input control.
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162
Published OnlineFirst May 19, 2014.Mol Cancer Res Honghong Zhang, Yuting Lin, Adriana Manas, et al. Microsatellite Unstable Colon CancerBaxdelta2 Promotes Apoptosis through Caspase-8 Activation in
Updated version
10.1158/1541-7786.MCR-14-0162doi:
Access the most recent version of this article at:
Manuscript
Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been
E-mail alerts related to this article or journal.Sign up to receive free email-alerts
Subscriptions
Reprints and
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Permissions
Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)
.http://mcr.aacrjournals.org/content/early/2014/05/17/1541-7786.MCR-14-0162To request permission to re-use all or part of this article, use this link
on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162