Name _______________________________________________ Biochemistry Biol 100 Summer 2014

Jeremy Lee Eryn Wicklow

Midterm Exam July 10, 2014

BE SURE TO PUT YOUR NAME ON ALL PAGES. (14 PAGES TOTAL) The following exam is composed of four parts (112 points total:) Part 1. Multiple-choice (28 points total); Part 2. Fill-in (24 points total); Part 3. Calculation Problem (12 points); Part 4. Written Answer (48 points total.) Part 1. Multiple-choice. Choose the one best answer and fill-in the corresponding bubble

on the Scantron form. (1 point each) 1. Proteins that are to be utilized in the plasma membrane are most commonly A. synthesized on free ribosomes in the cytosol. B. synthesized on ribosomes in the rough ER. C. transported to the plasma membrane in secretory vesicles that bud off from the rough ER. D. A and C E. B and C ANSWER: B 2. Hydrophobic molecules tend to aggregate in aqueous solutions because A. the hydrophobic molecules are negatively charged so are repelled by the positively charged water molecules. B. the hydrophobic molecules are positively charged, so are repelled by the negatively charged water molecules. C. this decreases the entropy of water molecules surrounding the hydrophobic molecules. D. the hydrophobic molecules bind only to the positive charges of polar water molecules. E. this increases the entropy of water molecules surrounding the hydrophobic molecules. ANSWER: E 3. Acetic acid has a pKa of 4.76, whereas pyruvic acid has a pKa of 2.50. Which of the following is/are true? A. Pyruvic acid is a stronger acid than acetic acid. B. The pH at which acetic acid is fully dissociated is 4.76. C. The pH at which acetic acid is half dissociated is 4.76. D. A and B E. A and C ANSWER: E

Name _______________________________________________ 2 4. A characteristic of a buffer is that it A. is a strong acid. B. is a weak acid. C. prevents large changes in pH, even with a significant input of protons. D. A and C E. B and C

ANSWER: E 5. At neutral pH (pH=7), an amino acid typically has A. just its amino group protonated. B. just its carboxyl group protonated. C. both its amino group and its carboxyl group deprotonated. D. both its amino group and its carboxyl group protonated. ANSWER: A 6. An important characteristic of the amino acid cysteine is A. its side chain has a sulfhydryl group. B. it can form a covalent bond with another cysteine. C. its side chain is hydrophobic. D. A and B E. all of the above ANSWER: D 7. At physiological pH, histidine can be A. negatively charged. B. positively charged. C. uncharged. D. A and C E. B and C ANSWER: E 8. In a polypeptide, rotation does not occur around which bond? A. -carbon to amino nitrogen bond. B. -carbon to carbonyl carbon bond C. peptide bond D. A and B E. all of the above ANSWER: C 9. In an alpha helix, the amino acid side chains are oriented A. toward the inside of the helix. B. toward the outside of the helix. C. parallel to the long axis of the helix. D. randomly with respect to the helix. E. all of the above ANSWER: B

Name _______________________________________________ 3 10. In proteins, a difference between a beta sheet composed of two antiparallel -strands and a beta sheet composed of two parallel strands is that in a beta sheet composed of antiparallel strands A. there are fewer hydrogen bonds between amino acids on the two strands. B. each amino acid on a strand forms one hydrogen bond with each of two amino acids on the other strand. C. each amino acid on a strand forms two hydrogen bonds with only one amino acid on the other strand. D. A and B E. A and C

ANSWER: C 11. Major and minor grooves are found in a DNA double helix because of A. repellency between phosphate groups on the two strands of DNA. B. the angles of the bonds between the deoxyribose sugars and the bases. C. the angles between phosphodiester bonds on adjacent nucleotides on a chain. D. hydrogen bonding between nucleotides on the same strand of DNA. E. the difference in the number of hydrogen bonds between G-C pairs and A-T pairs. ANSWER: B 12. In DNA replication, the DNA polymerase catalyzes the reaction between the 3 OH of one nucleotide and A. the -phosphate of a deoxyribonucleotide triphosphate. B. the -phosphate of a deoxyribonucleotide triphosphate. C. the -phosphate of a deoxyribonucleotide diphosphate. D. the -phosphate of a deoxyribonucleotide diphosphate. E. the -phosphate of a deoxyribonucleotide phosphate. ANSWER: B 13. The function of DNA helicase in DNA replication is to A. unwind the DNA. B. rewind the DNA. C. maintain DNA polymerases attachment to the template strand. D. A and B E. all of the above. ANSWER: A 14. The function of the sliding clamp in DNA replication is to A. prevent single-stranded DNA from base-pairing to itself. B. unwind DNA. C. increase and maintain DNA polymerases processivity. D. A and B E. all of the above. ANSWER: C

Name _______________________________________________ 4 15. DNA ligase functions in A. base excision repair B. nucleotide excision repair C. lagging strand synthesis in DNA replication D. A and B E. all of the above

ANSWER: E 16. Ultraviolet light damages DNA by creating A. alkylated bases. B. reduced bases. C. dimers of pyrimidines. D. oxidized bases. E. deaminated bases. ANSWER: C 17. In E. coli, the sigma subunit of RNA polymerase is critical for A. binding of the RNA polymerase to the transcription initiation site. B. unwinding of the DNA to allow reading of the DNA template. C. binding of the RNA polymerase to the Shine-Dalgarno sequence of the promoter. D. binding of the RNA polymerase to the operator sequence. E. binding of the RNA polymerase to the -10 and -35 sequences. ANSWER: E 18. A characteristic of RNA polymerase that is not a characteristic of DNA polymerase is that RNA polymerase A. is not a processive enzyme. B. does not need a primer to initiate formation of a new strand. C. reads along the template strand from 3' to 5'. D. A and B E. all of the above ANSWER: B 19. Post-transcriptional modification of a newly transcribed prokaryotic tRNA includes A. addition of a 5 cap. B. addition of a poly A tail. C. addition of the nucleotides C-C-A to the 3 end D. A and B E. all of the above ANSWER: C

Name _______________________________________________ 5 20. When glucose levels are high in E. coli A. there is more cAMP bound to CAP protein, decreasing the CAP protein's binding to the lac operon. B. there is more cAMP bound to CAP protein, increasing the CAP protein's binding to the lac operon. C. there is less cAMP bound to CAP protein, decreasing the CAP protein's binding to the lac operon. D. there is less cAMP bound to CAP protein, increasing the CAP protein's binding to the lac operon.

ANSWER: C 21. A major function of the TFIIH basal transcription factor in eukaryotes is to A. bind to the GC box of the promoter. B. interact with the mediator complex to allow RNA polymerase to bind to the promoter. C. phosphorylate the C-terminal domain of the RNA polymerase, allowing it to escape the promoter. D. phosphorylate the C-terminal domain of TFIID, causing it to release RNA polymerase from the promoter. E. phosphorylate the C-terminal domain of histone proteins, making the promoter more available for binding by RNA polymerase. ANSWER: C 22. In eukaryotic transcription, enhancers A. bind proteins that interact with the mediator complex to affect the levels of transcription. B. bind to basal transcription factors to allow formation of the pre-initiation complex. C. bind to the spliceosome to facilitate intron removal. D. bind to the mediator complex to affect levels of transcription. E. modify histone tails to affect the levels of transcription. ANSWER: A 23. In spliceosome-mediated removal of an intron, the second transesterification reaction involves A. cleavage of the phosphodiester linkage between the nucleotide at the 3 end of the upstream exon and the nucleotide at the 5 end of the intron. B. formation of a bond between the guanosine at the 5 end of the intron and the branch site adenosine. C. formation of a phosphodiester bond between the 3' OH of the nucleotide at the 3 end of the upstream exon and the 5' phosphate of the nucleotide at the 5 end of the downstream exon. D. A and B E. all of the above ANSWER: C

Name _______________________________________________ 6 24. The first step in "charging" a tRNA with an amino acid (forming a bond between the tRNA and an amino acid) involves a reaction between the amino acid and A. the 3' end of the tRNA. B. EF-Tu. C. ATP. D. AMP. E. the small unit of the ribosome.

ANSWER: C 25. A characteristic of prokaryotic translation that is not a characteristic of eukaryotic translation is that in prokaryotic translation A. the mRNA is associated with the small unit of the ribosome prior to the large subunit of the ribosome joining the complex. B. the initiator-aminoacyl-tRNA initially associates with the mRNA at the start codon. C. the complete ribosome is composed of two subunits. D. the initiator methionine is not formylated. E. peptide bond formation is a catalyzed by an rRNA in the large subunit of the ribosome. ANSWER: B 26. In a reaction at equilibrium, A. G0 D. Can't tell without knowing concentrations of reactants and products. E. G may be >0 or

Name _______________________________________________ 7

Part 2. Fill-in. In each blank, write in the appropriate, and best, word or phrase. (1 point per blank, except where noted.) 1. A bond that forms between atoms, which involves sharing of an electron between the two atoms, is called a(n) ___covalent____________________ bond. 2. In eukaryotic cells, secretory vesicles are produced from an organelle called the ___Golgi complex (or apparatus.) 3. Draw the basic structure of an amino acid (2 points)

(Note: this is worth 2 points. Also, they don't need to put text labels.) ___________________________________________________________ 4. Many membrane proteins, like porins, are said to show inside-out conformation because ___hydrophobic_______________________ amino acids tend to be found on the exterior of the functional protein. 5. The bond in a nucleotide that links the base to the sugar is called a(n) ___N-glycosidic (or -glycosidic) bond (or linkage.) 6. The two major kinds of interactions that occur between bases in double-stranded DNA are ___hydrogen_______________________________ bonds and ____Van der Waals interactions (or forces)_. 7. In eukaryotic DNA, the basic structure of DNA packaging is called a(n) ___nucleosome________________, which is composed of DNA wrapped around a core of eight ___histone___________________ proteins.

Name _______________________________________________ 8 8. If an incorrect nucleotide is added to a growing strand of DNA by DNA polymerase, the incorrect nucleotide is usually detected by the ____proofreading__________________ activity of the DNA polymerase. 9. In base excision repair, the first step is removal of the damaged base by an enzyme called a(n) ____DNA glycosylase______________________________. 10. The following is a portion of the transcribed region of a gene:

5 ACCTGTCGATGCCCAGTCGTGT 3 (strand #1) 3 TGGACAGCTACGGGTCAGCACA 5 (strand #2)

Here is a corresponding portion of the mRNA that is produced by transcription of this gene: 5 ACCUGUCGAUGCCCAGUCGUGU 3 With respect to transcription, DNA strand #1 is the _sense (or coding)___________ strand and DNA strand #2 is the _anti-sense (or template)_ strand. 11. In eukaryotes, phosphorylation of the _C-terminal domain of RNA polymerase_______________ is required for transcription to be initiated. This phosphorylation is catalyzed by the basal transcription factor __TFIIH_________________. 12. In eukaryotes, after cleavage of the pre-mRNA, a(n) _poly(A) tail_______________ is added to the 3 end by the enzyme ___poly (A) polymerase___________________. 13. In a spliceosome, the catalytic activity for intron removal and splicing is a function of the ___snRNA_______________________ molecules within the snRNPs. 14. A nucleotide that is frequently found at the 5' end of tRNA anticodons and which can base pair with three different bases on mRNA is __inosine______________________________. 15. The group of enzymes that catalyze the reactions that form bonds between tRNAs and amino acids is called ____amino-acyl-tRNA-synthetases__________________________. 16. The factor that "escorts" an aminoacyl-tRNA to the ribosome is called ____EF-Tu________________________________. 17. Hydrolysis of _____GTP____________ provides the energy by which the translation factor called ___EF-G (or elongation factor-G)____ translocates the mRNA and the tRNAs along the

Name _______________________________________________ 9 ribosome so that the next codon moves into the position to associate with a new aminoacyl-tRNA.

Part 3. Calculation problem. Complete parts A, B and C. You must show your work to get credit. Equations you might need are listed at the bottom of the page. For the following reaction: A B K'eq = 0.2 For this reaction: A. Calculate Go' for the reaction (3 points).

K'eq = e-Go'/RT 0.2 = e-Go'/RT ln 0.2 = ln e-Go'/RT -1.61 = -Go'/RT -1.61 x 2.47 = -Go' Go' = __3.98____________________________________ B. Determine G for the reaction when the initial concentrations of the two compounds are: [A] = 6 x 10-2 M [B] = 3 x 10-3 M G = Go' + RT ln ([C][D] / [A][B]) G = Go' + RT ln ([products] / [reactants]) G = 3.98 + 2.47 ln (0.003 / 0.06) G = 3.98 + 2.47 ln (0.05) G = 3.98 + 2.47 x (-3.0) G = 3.98 7.41 G = -3.43

G = _-3.43______________________________________ (5 points) C. At the concentrations given in part B, and under standard conditions (25oC, pH=7,) will the reaction occur spontaneously? Explain. (4 points) Yes, the reaction will occur spontaneously since, at those concentrations, G

Name _______________________________________________ 10 Go = - RT ln [C][D] / [A][B] (at equilibrium)

Part 4. Written Answer. The following section contains 5 questions. CHOOSE 3 of the 5 and write thorough answers. Only the first 3 questions you answer will be graded (unless you completely cross out your answer.) Use the bottom and back of the last page if you need more room. (16 points each) 1. Describe all the important functions of each of the following in eukaryotic transcription: RNA polymerase II; TFIID; TFIIH; activator proteins; enhancers; histone acetyltransferases; histone deacetylases; chromatin remodeling engines. In addition, describe how the process of transcription in terminated in eukaryotes.

RNA polymerase II: Binds promoter sequence; unwinds and rewinds DNA; reads anti-sense (template) strand of DNA and adds complementary RNA nucleotides 5' to 3', creating ester bonds between them, to synthesize pre-mRNA.

TFIID: Basal transcription factor that initiates formation of the pre-initiation complex by

binding to the promoter (e.g. TBP subunit of TFIID binds to the TATA box sequence of the promoter.)

TFIIH: Basal transcription factor that induces RNA polymerase to "melt" (initial unwinding of)

DNA at the promoter. Also, catalyzes phosphorylation of C-terminal domain (CTD) of RNA polymerase II, allowing it to escape the promoter and initiate transcription.

Activator proteins: bind enhancer sequences and increase level of transcription by 1)

interacting with mediator complex to facilitate formation of the RNA pol II pre-initiation complex; and/or 2) recruitment of chromatin remodelers and/or histone modifiers that facilitate binding of basal transcription factors/RNA pol II to promoter.

Enhancers: DNA sequences frequently upstream of promoter (also may be in introns) to which

activator proteins (or repressor proteins) bind to influence the level of transcription. Histone acetyltransferases: add acetyl groups to amino acids (especially lysines) in the N-

terminal tails of core histone proteins of nucleosomes. This generally "loosens" the association between the core histones and DNA, facilitating binding of basal transcription factors/ RNA pol II and activity of chromatin remodelers. Activity generally associated with increased transcription.

Histone deacetylases. remove acetyl groups from amino acids in the N-terminal tails of core

histone proteins of nucleosomes. This generally "tightens" the association between the core histones and DNA, inhibiting binding of basal transcription factors/ RNA pol II and the activity of chromatin remodelers. Activity generally associated with decreased transcription.

Chromatin remodeling engines: modify the interactions between DNA and associated proteins

(e.g. histones.) For example may "spin off" a segment of DNA from histone core of nucleosome to make DNA more available for binding of basal transcription factors and

Name _______________________________________________ 11 RNA pol II. (May be associated with increased or decreased transcription, depending on the type of remodeling.) 2. Address each of the following with respect to a chemical reaction: A. Explain what activation energy is with respect to a chemical reaction. B. Indicate whether the "activation energy" of a chemical reaction is included in the calculation of G for a reaction; explain. C. Describe how enzymes catalyze reactions with respect to activation energy, and draw and explain a graph depicting this effect. D. Describe the effect that an enzyme has on the G of a reaction.

A. Activation energy is the difference in free energy between reactant(s) (substrate(s)) and the transition state, the conformation between the reactant(s) and product(s). In other words, activation energy is the amount of energy that must be added to allow the reactant(s) to reach the transition state.

B. Activation energy is NOT included in calculation of G because all the energy added to

reach transition state is released/recovered when transition state is transformed into the product(s.) (G is simply the difference in free energy of products and reactants.)

C. Enzymes catalyze reactions by lowering the activation energy required to reach the

transition state, thus facilitating formation of the transition state and increasing the rate of the reaction. As shown in the graph below, the effect of an enzyme is to lower the free energy of transition state, meaning that the input of energy to reach transition state, activation energy, is reduced by the enzyme

Graph should look something like this:

D. Enzymes do NOT affect the levels of free energy in the reactants or in the products, and since G is the difference in free energy of products and reactants, enzymes have no effect on G.

Name _______________________________________________ 12 3. Describe, in detail, the processing of a eukaryotic pre-mRNA to produce an mRNA that is ready for translation. Be sure to include then name and functions of the important molecules involved in the various types of processing. Also, indicate how this processing affects the number of proteins that can be encoded by a single gene. 1. Addition of 5' cap (7-methyl guanosine) to 5' end of pre-mRNA:

A. The enzyme RNA triphosphatase cleaves off one phosphate group (gamma phosphate) from the 5' end of the 5' (first) nucleotide of the pre-mRNA

B. The enzyme guanylyltransferase, creates an ester bond between the beta phosphate (now the terminal phosphate) of the 5' nucleotide of the pre-mRNA and the alpha phosphate of an additional guanosine nucleotide.

C. The enzyme methyltransferase adds a methyl (CH3) group to the N-7 of the guanosine.

2. Cleavage of pre-mRNA and addition of poly (A) tail.

A. Several (about 20) nucleotides downstream (3') of the signal sequence (polyadenylation signal) an endonuclease cleaves the pre-mRNA.

B. poly (A) polymerase adds a large number (tens to hundreds) of adenosines to the 3' cut end of the pre-mRNA.

3. Removal of introns and splicing of exons.

A. Spliceosome subunits associate with each intron. B. First transesterification reaction, catalyzed by U2 and U6 snRNAs: Oxygen of branch

site adenosine's 2'OH reacts with phosphate group of nucleotide at 5' end of intron (usually a "G") to form an ester linkage between them.

C. Second transesterifcation reaction, also catalyzed by U2 and U6 snRNAs: Oxygen of the now "free" 3'OH of the nucleotide at the 3' end of the upstream exon reacts with the 5' phosphate of the nucleotide of the 5' end of the downstream exon forming another ester linkage. Intron is released and exons are now spliced together.

Since a given pre-mRNA can be spliced in alternative ways, producing a variety of different mRNAs from the same pre-mRNA, with each mRNA encoding a somewhat different polypeptide, this means that a single gene can encode several different polypeptides/proteins.

Name _______________________________________________ 13 4. Describe, in detail, the process of replication of DNA for creating a lagging strand in prokaryotes. Be sure to name all the molecules involved in the process and their functions.

1. DNA helicase unwinds DNA at the replication fork. 2. Single-strand binding proteins (SSBs) bind to single-stranded DNA template strand

to prevent formation of stem loops in that DNA strand (intra-strand base pairing,) re-annealing of the two strands, or binding of other nucleic acids.

3. As above occurs, (DNA) primase creates an RNA primer complementary to a short stretch

of single-stranded template being produced by DNA helicase. 4. Detachment of DNA polymerase from previous Okazaki fragment changes conformation

of (Tau protein) clamp loader subunit of DNA polymerase holoenzyme, inducing (gamma subunit of) clamp loader to load a sliding clamp around DNA at 3' end of new RNA primer.

5. DNA polymerase re-localizes from previous Okazaki fragment to 3' end of new primer

and new clamp is attached to/loaded on DNA polymerase. Enzyme is ready for synthesizing next Okazaki fragment

6. Starting at 3' end of an RNA primer made by (DNA) primase, DNA polymerase reads

template strand 3 to 5, adding complementary nucleotides one-by-one to new strand. Catalyzes reaction between 3 OH of last nucleotide and -phosphate of incoming (next) nucleotide to create an ester linkage (phosphodiester bond.) Creates Okazaki fragment that lengthens in a direction opposite the movement of the replication fork.

7. When DNA polymerase reaches 5' end of the RNA primer at the 5' end of previously

synthesized Okazaki fragment, DNA polymerase detaches from template and moves to next primer (back to step 4.)

8. RNaseH digests most of RNA primer; exonuclease activity of DNA polymerase (DNA pol I)

digests remainder of primer. 9. DNA polymerase fills in "gap" created by digestion of RNA primer. 10. DNA ligase seals "nick" by creating phosphodiester bond between 3' end of DNA that

replaced primer and 5' end of the previous Okazaki fragment.

Name _______________________________________________ 14 5. Assume a eukaryotic ribosome is in the middle of translation; i.e. it has already synthesized part of the encoded polypeptide. Describe one full cycle of translation, i.e. the events that occur to add the next amino acid to the growing chain and to prepare the ribosome for adding the next amino acid to the polypeptide. 1. A new aminoacyl-tRNA, associated with EF-Tu-GTP, and with an anticodon

complementary to mRNA codon now in small subunit of the A (aminoacyl) site, enters the A-site of the ribosome.

2. The anticodon of this aminoacyl-tRNA base pairs with the mRNA codon in small subunit portion of the A-site.

3. EF-Tu binding to A-site activates GTPase of EF-Tu, hydrolyzing its GTP to GDP. 4. EF-Tu-GDP leaves ribosome and the new aminoacyl-tRNA's 3'end with attached amino

acid is moved into peptidyl transferase center of the large ribosomal subunit. 5. Peptidyl transferase (an activity of an rRNA in the large subunit) catalyzes formation

of peptide bond between the amino group nitrogen of the amino acid on the tRNA in the A-site and the terminal carbonyl group carbon of the polypeptide attached to the tRNA in the P-site.

6. The "new" polypeptide (one amino acid longer) is transferred to the "newest" tRNA residing in the A-site (though partially displaced from the A site in the large ribosomal subunit, as it is within the peptidyl transferase center.)

7. The elongation factor EF-G-GTP enters the large subunit portion of the A site of the ribosome. Binding here brings EF-G-GTP into factor binding center, which activates the GTPase of EF-G; it's converted to EF-G-GDP causing a change in the conformation of EF-G.

8. EF-G's change of conformation "pushes" tRNA in the A-site completely from A-site into the P-site of ribosome; mRNA with codon base-paired to this tRNA is "pulled" through ribosome one codon to bring the next codon into A-site. Movement also "pushes" tRNA that had been in the P-site to the E-site.

9. EF-G-GDP leaves ribosome, freeing A site for entry of next aminoacyl-tRNA-EF-Tu complex.

10. tRNA in E-site leaves the ribosome.