+ All Categories
Home > Documents > Bem vindos ao Setulab! - iq.usp.br · PDF file Grafo de de Bruijn ... As the ship steams...

Bem vindos ao Setulab! - iq.usp.br · PDF file Grafo de de Bruijn ... As the ship steams...

Date post: 10-Mar-2018
Category:
Upload: phunghanh
View: 216 times
Download: 2 times
Share this document with a friend
106
Metagenômica João Carlos Setubal 2017
Transcript
Page 1: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Metagenômica

João Carlos Setubal

2017

Page 2: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Reads vs. contigs

• Reads: o que sai da máquina sequenciadora

• Contigs: resultado da montagem

Page 3: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

JC Setubal 3

DNA

A comunidade

SEQ BIOINFO

Page 4: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Reads

• Essencial usar reads para análises de abundância

• Também é melhor usar reads para identificação taxonômica por causa do possível quimerismo

Page 5: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Contigs

• Bons para achar genes

– Mais provável achar ORFs completas em contigs

• Para simples presença de genes quimerismo não é um problema sério

Page 6: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Taxonomia

• Filo: proteobacteria

– Classe: proteobacteria gama

• Ordem: xanthomonadales

–Família: xanthomonadácea

»Gênero: xanthomonas

• Espécie: citri

Page 7: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

OTU

• Unidade taxonômica operacional

• Se for conhecida, leva um rótulo padronizado

• Mas pode ser desconhecida

Page 8: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Identificação taxonômica

• Estrutura da comunidade microbiana

– Descoberta de quais OTUs conhecidos estão presentes na amostra

– Descoberta de novos OTUs

– Os “conhecidos” podem ser na verdade novas OTUs parentes próximas de reais conhecidos

– Quem são os agentes principais?

• Nem sempre são os mais abundantes

• Dinâmica temporal da comunidade

Page 9: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Dados (sequências)

• 16S

– Primers específicos

• Dados de DNA total (WMS)

– Maior parte das sequências vem de genes codificadores de proteínas, mas também tem 16S

• Qual escolher depende dos objetivos do projeto

Page 10: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Muitas variáveis

Variável valores

Data type WMS, 16S amplicon

Sequencing technology Illumina, 454, Ion, pacBio

WMS Reference database NR, NT, M5NR

16S Reference database Greengenes, RDP, Silva

WMS identification program Many programs available

Taxonomy level Phylum, class, order, family, genus, species

Page 11: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Muitos programas disponíveis!

Bazinet & Cummings, 2012

Page 12: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Muitas fontes de erro

• Amostragem

• Preparação da biblioteca

• Sequenciamento

• Tamanho da sequência (pode ser curta demais)

• Algoritmo de identificação

• Viéses dos bancos de dados

Page 13: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Binning e classificação

• Binning

– Juntamos em diferentes caixinhas as sequências que são parecidas entre si

• Não sabemos o que contém cada caixinha

• OTU1, OTU2, OTU3, etc

• Classificação

– Procuramos associar um rótulo taxonômico a cada caixinha (ou a cada read ou fragmento)

Page 14: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Análise de abundância

• Que organismos ou funções são mais abundantes num nicho?

• Usar contagem de reads como indicador de abundância

Page 15: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Classificação de reads de DNA total

• Similaridade com sequências de origem conhecida

– BLAST

• Propriedades intrínsicas de cada sequência

– Assinaturas genômicas

• Apropriado para binning

Page 16: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Classificação com base na frequência

de palavras de k bases k = 4: AAAA, AAAC, AAAG, AAAT, CAAA, etc…

Dada uma janela de x kb, podemos contar as ocorrências de cada uma dessas palavras dentro da janela

Exemplo:

AGATTAGCGACTATTATAGCCTAGATCGATCATTACC

AGAT ocorre 2 vezes

ATTA ocorre 3 vezes

etc

Palavras de k bases: k-mers (kâmeros)

Page 17: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Matriz de frequências

janela AAAA AAAC AAAG AAAT ACAA ACAC ACAG ACAT

1 15 2

2 16 3

3 14 0

4 13 2

5 15 4

6 12 0

7 18 1

8 17 3

9 16 1

Page 18: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Zho

u, O

lman

, Xu

, BM

C B

ioin

form

ati

cs, 2

00

9

Genome “barcodes”

E. coli K12 E. coli O157

Burkholderia pseudomallei

Pyrococcus furiosus random

Page 19: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Não funciona bem com fragmentos curtos

Fragment size, bp

Accuracy, %

Zhou et al, 2009 simulated data

Page 20: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Exercício

• S1 = TTCTACTACT

• S2 = TTGTACTAGG

• S3 = ACTTCTACTA

• Contar palavras de tamanho 2

Page 21: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Kraken

• Wood & Salzberg: Genome Biology, 2014

• Ideia: um banco de dados com k-mers e o LCA (ancestral comum mais baixo/próximo) de todos os organismos que contém aquele k-mer

Page 22: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on
Page 23: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

myTaxa

• Luo, Rodriguez-R, Konstantinidis: Nucleic Acids Research, 2014

• The distinguishing aspect of MyTaxa is that it employs all genes present in an unknown sequence as classifiers, weighting each gene based on its (predetermined) classifying power at a given taxonomic level and frequency of horizontal gene transfer

Page 24: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on
Page 25: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Uma comparação usando dados reais

Page 26: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Dados de entrada

Variable value

dataset ZC4, day 15 (metazoo)

Data type WMS

Sequencing technology Illumina miSeq

WMS program Kraken [Wood & Salzberg, 2014]

WMS Reference database: Kraken database

Taxonomy level Phylum

Page 27: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Resultado

Unclassified 85%

Classified 15%

Page 28: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Dentre os reads classificados como bactérias (99%)

Proteobacteria, 29%

Actinobacteria, 27%

Bacteroidetes, 25%

Firmicutes, 11%

Chloroflexi, 4% other, 4%

Page 29: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Outro tipo de análise

Variable value

dataset ZC4, day 15

Data type 16S

Data type details V3 and V4, read size ~416 bp

Sequencing technology Illumina (miSeq)

16S analysis pipeline Qiime (RDP classifier + Greengenes)

Taxonomy level Phylum

Qiime (Caporaso et al., 2010)

Page 30: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Resultados

Unclasssified, 23%

Classified, 77%

Page 31: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Dentre os classificados

Firmicutes, 39%

Proteobacteria, 25%

Bacteroidetes, 14%

Actinobacteria, 12%

Acidobacteria, 3%

Verrucomicrobia, 2%

Chloroflexi, 2% other, 3%

Page 32: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

WMS e 16S

0%

5%

10%

15%

20%

25%

30%

35%

40%

45%

Proteobacteria Actinobacteria Bacteroidetes Firmicutes Chloroflexi

WGS

16S

Page 33: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Comentários

• Concordância qualitativa

– boa

• Concordância quantitativa (abundância relativa)

– fraca

• esp. Firmicutes

• Kraken deixa muitos reads não classificados

Page 34: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Vamos mudar o programa identificador

• myTaxa

Page 35: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Resultados

Unclassified, 27%

Classified, 73%

Unclasssified, 23%

Classified, 77%

Kraken 16S

Page 36: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Dentre os classificados como bactéria (99%)

Proteobacteria, 29%

Firmicutes, 27%

Actinobacteria, 16%

Bacteroidetes, 15%

Chloroflexi, 5%

Deinococcus-Thermus, 2%

Cyanobacteria, 1%

Planctomycetes, 1%

Acidobacteria, 1%

other, 3%

Page 37: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Prokaryotes in Genbank

filo # genomas %

Actinobacteria 4059 13

Bacteroidetes/chlorobi 932 3

Cyanobacteria 340 1

Firmicutes 9628 31

Proteobacteria 14268 46

Spirochaetes 525 2

Others 1500 5

Source: Land et al. 2015

Page 38: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Comparação de todos os resultados

0%

5%

10%

15%

20%

25%

30%

35%

40%

45%

Proteobacteria Actinobacteria Bacteroidetes Firmicutes Chloroflexi

Kraken

myTaxa

16S

Page 39: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Réplica

• Outro conjunto de dados: ZC4, day 99

• Mesmas metodologias

– Kraken

– myTaxa

– 16S

Page 40: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Resultados

Unclass 90%

10% Unclass 30%

Classified, 70%

Unclassified, 28%

Classified, 72%

kraken 16S

myTaxa

Page 41: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

comparação

0%

5%

10%

15%

20%

25%

30%

35%

40%

45%

Proteobacteria Actinobacteria Firmicutes Bacteroidetes Chloroflexi Acidobacteria Planctomycetes

kraken

myTaxa

16S

Page 42: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Conclusões

• WMS vs. 16S

– 16S pode perder OTUs pela especificidade dos primers

• Menos sensibilidade

– É mais difícil chegar ao nível de espécie

– Identificações positivas são confiáveis

• Especificidade boa

– WMS tem melhor sensibilidade (pega tudo)

• Mais sensível aos vieses dos bancos

• myTaxa é um programa melhor do que kraken

Page 43: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Vamos mudar o nível taxonômico

• Ordem

• Dados: ZC4, day 99

Page 44: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Fica mais complicado…

• RDP muitas vezes diz que reads pertencem a uma ordem desconhecida

• Idem myTaxa

• Estimativas de abundância ficam ainda menos confiáveis do que ao nível de filo

• Existe maior sensibilidade ao contéudo dos bancos utilizados

Page 45: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

MG-RAST/M5NR*

Actinomycetales

Rhizobiales

Clostridiales

Burkholderiales

Bacillales

Myxococcales

Chromatiales

Sphaerobacterales

Xanthomonadales

Bacteroidetes Order II. Incertae sedis

Rhodospirillales

Pseudomonadales

Rhodobacterales

Thermoanaerobacterales

Planctomycetales

Chloroflexales

Gemmatimonadales

Cytophagales

Sphingomonadales

Desulfuromonadales

Alteromonadales

Sphingobacteriales

Flavobacteriales

Oceanospirillales

Solibacterales

Thermales

Kraken

Actinomycetales

Sphaerobacterales

Rhizobiales

Burkholderiales

BacteroidetesOrderII.Inc

Myxococcales

Xanthomonadales

Clostridiales

Bacillales

Alteromonadales

Pseudomonadales

Rhodospirillales

Sphingomonadales

Chromatiales

Rhodobacterales

Rhodocyclales

Solirubrobacterales

Caulobacterales

Enterobacteriales

Thermales

Deinococcales

Desulfovibrionales

Desulfuromonadales

Acidimicrobiales

Neisseriales

Oceanospirillales

16S

Actinomycetales

Bacillales

Myxococcales

Xanthomonadales

Rhizobiales

*Meyer et al. 2008

Page 46: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Análise de abundância

• Abundância relativa

– Curvas de rarefação

• Variação

– temporal

– espacial

– Entre diferentes condições

Page 47: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Curvas de rarefação (ou saturamento)

n. especies

n. amostras

Page 48: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Amostras metazoo

0

250

500

750

1000

1250

1500

1750

2000

2250

2500

2750

3000

0 500 1000 1500 2000 2500 3000 3500 4000 4500 5000 5500 6000

Nu

mb

er o

f S

pe

cie

s

Number of Sequences

ZC1

ZC2

2,260

2,816

(16S rRNA)

Page 49: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Schwartz et al. Genome Biology 2012 13:r32 doi:10.1186/gb-2012-13-4-r32

Variação da microbiota intestinal entre bebês amamentados no seio e com

mamadeira

Page 50: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Variação da abundância relativa no tempo

%

dias

Prejeto metagenoma zoológico - compostagem

Page 51: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Montagem de genomas

buraco

contig

Page 52: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Montagem

• Em genomas bacterianos isolados, é um processo razoavelmente bem compreendido

• Em metagenomas há velhas e novas dificuldades

– Mistura de organismos

• Quimeras

• Transferência lateral

– Repetições

– Tamanho dos conjuntos de dados

– Chegando a bilhões de reads

Page 53: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Exemplo de quimerismo

chlorobium firmicutes euryarch.

proteob.

crenarch.

g1 g2 g3 g4 g5 contig

genes

Page 54: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Algoritmos de montagem especializados para metagenômica

• Genovo [Laserson, Jojic, Koller 2011]

• Metavelvet [Namiki et al. 2012]

• Differential-coverage binning [Albertsen et al. 2013]

Page 55: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

metavelvet

• Baseado em velvet

• Velvet é baseado em grafos de de Bruijn

http://chessprogramming.wikispaces.com/De+Bruijn+sequence

Sobreposição de k-mers

k = 1

Page 56: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

http://www.homolog.us/blogs/wp-content/uploads/2011/07/i6.png

Grafo de de Bruijn em montagem

Page 57: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

metavelvet

http://metavelvet.dna.bio.keio.ac.jp/

Permite escolha

de mais de um

valor para k

Page 58: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Na prática, no meu lab

• SoapDeNovo

– Luo et al.: SOAPdenovo2: an empirically improved memory-efficient short-read de novo assembler. GigaScience 2012, 1:18

– Mais rápido, consegue dar conta de conjuntos grandes de dados, resultados suficientemente bons

• Mira (http://www.chevreux.org/projects_mira.html)

Page 59: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Anotação funcional

• Pipeline para genomas completos pode ser usado

– Exemplo: IMG/M

• Cobertura

– Quanto cada genoma é coberto pelos reads obtidos

– Ambientes de grande riqueza: cobertura baixa

• Cobertura baixa cria contigs pequenos

– maioria das ORFs são parciais

– Dificulta atribuição de função • Potencial gerador de erros

Page 60: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Comparação de metagenomas

• Genomicamente

• Taxonomicamente

• Funcionalmente

• Recursos oferecidos pelo IMG/M

Page 61: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Figure 1. Distribution of the GC content percentage for ZC1 and ZC2 compared with selected metagenomes.

Martins LF, Antunes LP, Pascon RC, de Oliveira JCF, Digiampietri LA, et al. (2013) Metagenomic Analysis of a Tropical Composting

Operation at the São Paulo Zoo Park Reveals Diversity of Biomass Degradation Functions and Organisms. PLoS ONE 8(4):

e61928. doi:10.1371/journal.pone.0061928

http://127.0.0.1:8081/plosone/article?id=info:doi/10.1371/journal.pone.0061928

Page 62: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Genome clustering (IMG/M)

Page 63: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Figure 8. Hierarchical clustering of functional gene groups of ZC1 and ZC2 and seven public metagenomes.

Martins LF, Antunes LP, Pascon RC, de Oliveira JCF, Digiampietri LA, et al. (2013) Metagenomic Analysis of a Tropical Composting

Operation at the São Paulo Zoo Park Reveals Diversity of Biomass Degradation Functions and Organisms. PLoS ONE 8(4):

e61928. doi:10.1371/journal.pone.0061928

http://127.0.0.1:8081/plosone/article?id=info:doi/10.1371/journal.pone.0061928

Categorias COG COGs

Page 64: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Normalização

• É um assunto que requer competência em estatística

• A seguir são apresentadas duas regras práticas

• Motivação: Metagenômica comparativa requer normalização do número de reads das amostras

• Variação pode ser grande; por exemplo:

– Amostra 1: 200 mil reads

– Amostra 2: 2 milhões de reads

Page 65: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Método 1

• Determinar a amostra com menor número de reads (suponha nmin)

• Para cada outra amostra

– Selecionar aleatoriamente nmin reads

• Desvantagem

– Pode jogar muito dado fora

Page 66: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Método 2

• Seja nA o numero de reads da amostra A

• Seja σ o número médio de reads por amostra

• Seja x a contagem da característica de interesse em A (ou seja, x reads tem essa característica)

• Então normalizamos x pela fórmula

– log10𝑥

𝑛𝐴

. σ + 1

Page 67: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Abundância de funções

• BLASTX de reads contra um banco de COGs Cluster of Orthologous Groups

67

Example of a COG: monoamine oxidase

http://www.ncbi.nlm.nih.gov/books/NBK21090/ eggNOG [Jensen et al. 2008]

Page 68: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

• COGs diferencialmente representados

• Semelhante a genes diferencialmente expressos

• Heat maps, clusterização hierárquica

Abundância relativa espacial

Page 69: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Projeto Metagenômica do Mar Vermelho

• Colaboração com a American University in Cairo

Page 70: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Ocean water columns

surface

bottom

samples

Page 71: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

2,200 m

Africa Saudi Arabia

Brine pool Atlantis II

Discovery

Kebrit

Page 72: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

The brine pools are a special niche

• High salinity (10X more than surface water)

• Enriched with heavy metals: iron, manganese, copper,

zinc (1000X more concentrated than normal water)

• High temperatures (70 C)

• High pressure

• No light

Page 73: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

The Oceanus research ship belongs to the Woods Hole Oceanographic Institute.

Source: Hamza El Dorry

Page 74: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

A CTD determines the essential physical properties of

ocean water. It gives scientists a precise and

comprehensive charting of the distribution and variation

of water temperature, salinity, and density that helps to

understand how the oceans affect life. (Media

Relations, Woods Hole Oceanographic Institution)

As the ship steams slowly ahead, scientists in a lab on the ship

will guide the CTD up and down in the water column,

occasionally sending the instrument an electronic signal to

collect a water sample in a bottle mounted on the instrument's

cage. (© C.A. Linder, WHOI)

A CTD: Conductivity, Temperature, and Depth (CTD) sensors

One of the labs on OCEANUS

Source: Hamza El Dorry

Page 75: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Data

• Pyrosequencing with Roche 454 (AUC)

• 2 columns (above two different brine pools)

– 5 samples in each column

• Esta aula – data for the column above the brine pool Atlantis II (ATIIC)

Page 76: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

2,200 m

Africa Saudi Arabia

Water column

1,500m

700m

200m

50m

ATIIC brine pool

Page 77: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

First results

• Comparison among several ocean water columns

– 11 locations worldwide

– 24 samples at different depths

Page 78: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on
Page 79: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Comparison: gene functions

• Based on COG assignments

– BLASTX against eggNOG [Jensen et al. 2008]

• What functions were present in one site but not in others

• What functions were present at a certain depth but not in others

• Rather than presence/absence

– Differentially represented COGs

– Similar to differentially expressed genes

– Heat maps, hierarchical clustering

Page 80: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Methodological issues

• Comparative metagenomics

• How to determine whether an assigned COG is differentially represented

– Normalization, statistics

Page 81: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

First result: COGs per water column

site #COGs

ATIIC 483

ALOHA 337

BATS 360

Iquique 174

Total unique 790

Page 82: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Based on 386 COGs

shared by ATIIC,

Aloha, BATS with

differential

representation

Iquique not included

COGs

Page 83: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

And Iquique?

Page 84: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on
Page 85: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Why is Iquique different?

• Humboldt current

• Upwelling phenomenon

– Cold nutrient-rich water is taken to the surface

Page 86: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

http://what-when-how.com/marine-mammals/south-american-aquatic-mammals

http://mynasadata.larc.nasa.gov/glossary.php?&word=upwelling

upwelling

iquique

Page 87: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

PAR values (Photosynthetically active radiation )

Page 88: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

“Photic and aphotic COGs”

Page 89: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

41 COGs with higher

abundance in photic

zones

34 COGs with

higher abundance in

aphotic zones

Page 90: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Photic COGs

• Photosyntesis

• biosynthesis of light-harvesting pigments

• assimilation of CO2 by photosynthetic bacteria

• Light-induced DNA repair

• oxidative stress response

• N2 fixation

• phosphate metabolism

Page 91: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Aphotic COGs

• Catabolism of proteins and aminoacids

• Methane oxidation

• sulfate assimilation and metabolism

• selenocysteine metabolism

• terpenoid biosynthesis

Page 92: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Deoxyribodipyrimidine photolyase (repairs DNA

damage caused by exposure to ultraviolet light, COG0415)

photic

aphotic

“mixed

layer”

?

Page 93: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Abundance ratios

Page 94: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Another puzzle: Marmara

Relatively high ratio photic:aphotic COGs for the depth

Overrepresentation of the photolyase COG

Page 95: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Sea of Marmara

Page 96: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Conjectured explanation

• The Marmara sea receives saltier water inflow from the Mediterranean through the Dardanelles strait (65m)

• This water is denser therefore it sinks

• Effect: Greater ratio between photic and aphotic COGs even at 1,000m

http://www.sciencedirect.com/science/article/pii/S0034666703001179 Mudie et al., 2004

Page 97: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Oxygen limitation

• Hypoxic regions in Iquique

• 85, 110, 200m

• Lowest O2 values among all samples

• Are there COGs significantly associated with lack of oxygen?

• We removed 383 photic/aphotic COGs and verified the rest

• Result: 22 differentially represented COGs (11 up, 11 down)

Page 98: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on
Page 99: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Gene favored by low oxygen levels: narG, involved in denitrification

Page 100: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Summary

• A metagenomics-enabled functional profiling analysis

– Light

– Oxygen

• Reference sets of functional biological activities

– diagnosis of the physiological and biochemical capabilities of marine microorganisms

• May help monitor “the oceans’ health”

Page 101: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

http

://h

utt

enhow

er.sph.h

arv

ard

.ed

u/m

eta

ph

lan

Page 102: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Platformas web de processamento

• Laboratórios governamentais

• Serviços padronizados de processamento

Page 103: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on
Page 104: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on
Page 105: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on
Page 106: Bem vindos ao Setulab! - iq.usp.br · PDF file  Grafo de de Bruijn ... As the ship steams slowly ... collect a water sample in a bottle mounted on

Sugestão de leitura


Recommended