Benzanthrone induced immunotoxicity via oxidative stress

Please cite this article in press as: Tewari, P., et al., Benzanthrone induced immunotoxicity via oxidative stress and inflammatory

mediators in Balb/c mice. Immunobiology (2014), http://dx.doi.org/10.1016/j.imbio.2014.10.011

ARTICLE IN PRESSG Model

IMBIO51229; No. of Pages 13

Immunobiology xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Immunobiology

jo ur nal ho me page: www.elsev ier .com/ locate / imbio

Benzanthrone induced immunotoxicity via oxidative stress and

inflammatory mediators in Balb/c mice

Prachi Tewari a,b, Ruchi Roy a,b, Sakshi Mishra a, Payal Mandal a,b, Ashish Yadav a,Bhushan P. Chaudharid, Rajnish K. Chaturvedib,c, Premendra D. Dwivedi a,b,Anurag Tripathi a,∗, Mukul Das a,b,∗∗

a Food, Drugs and Chemical Toxicology Group, CSIRIndian Institute of Toxicology Research, Indiab Academy of Scientific and Innovative Research (AcSIR), New Delhi, Indiac Developmental Toxicology Division, CSIRIndian Institute of Toxicology Research, Indiad Pathology Laboratory, CSIRIndian Institute of Toxicology Research, Mahatma Gandhi Marg, Lucknow 226001, India

a r t i c l e i n f o

Article history:

Received 14 August 2014

Received in revised form

19 September 2014

Accepted 12 October 2014

Available online xxx

Keywords:

Benzanthrone

Cytokine

Reactive oxygen species

DNA damage

Antioxidant enzyme

Inflammation

Immunotoxicity

a b s t r a c t

Benzanthrone (BA) is an important dye intermediate which is used in the manufacturing of several

polycyclic vat and disperse dyes in textile industries. Several studies have indicated that the general

population is also exposed to BA owing to its release from furnace effluents and automobile exhausts in

the environment. In several clinical studies, it has been shown that workers exposed to BA developed

itching, burning sensation, erythema and hyperpigmentation of the skin, which could be an outcome of

the dysregulated immune response. In this study, we have used female Balb/c mice as a model to study the

immunoinflammatory changes after systemic administration of BA (7.5 mg/kg b.w. and 15 mg/kg b.w.)

for one week. BA exposed animals exhibited the signs of intense systemic inflammation as evident by

enhanced DTH response, MPO activity, hyperplastic and dysplastic histopathological organization of

spleen and lung tissue. Splenic evaluation revealed enhanced oxidative stress, upregulation of promi

nent inflammatory markers like iNOS and COX2 and DNA damage. In coherence with the observed

immunoinflammatory alterations, the levels of several inflammatory and regulatory cytokines (IL17,

TNFa, IFNg, IL1, IL10, IL4) were significantly enhanced in serum as well as the spleen. In addition,

BA administration significantly induced the activation of ERK1/2, p38, JNK MAPKs and their downstream

transcription factors AP1 (cfos, cjun), NFkB and Nrf2 which comprise important mechanistic path

ways involved in inflammatory manifestations. These results suggest the immunotoxic nature of the

BA and have implications for the risk assessment and management of occupational workers, and even

common masses considering its presence as an environmental contaminant.

© 2014 Elsevier GmbH. All rights reserved.

Introduction

Dye manufacturing units are an integral component of several

industrial sectors of the modern world. Production of synthetic dyes

and colors in India is about 25,000 metric tons every year, which

raises the possibility of its chronic exposure and potential toxicity

to occupational workers and common masses. BA is an important

Abbreviations: BA, benzanthrone; DCNB, 2,5dichloronitrobenzene; MPO,

myeloperoxidase; DTH, delayed type hypersensitivity.∗ Corresponding author. Tel.: +91 522 2963826; fax: +91 522 2628227.

∗∗ Corresponding author at: Food, Drug and Chemical Toxicology Division, CSIR

Indian Institute of Toxicology Research, India.

Email addresses: [email protected] (A. Tripathi), [email protected]

(M. Das).

dye intermediate, which is used in the manufacturing of a num

ber of polycyclic vat and disperse dyes in textile industries (Colour

Index, 1971; Venkatraman, 1952). With the expansion of textile

and color industries, the demand of BA dye intermediate is con

stantly increasing. Several studies have suggested that the general

population can also be exposed to BA due to its presence in the envi

ronment as a contaminant (Handa et al., 1984; Ramdahl, 1983). It

has been reported during air quality monitoring surveys, that BA

is also released from diesel and gasoline engine vehicles (Sawacki

et al., 1965). BA has also been found to be present in furnace efflu

ents, effluents from the open burning of leaves, grass, municipal

refuses and automobile exhausts (Sawacki, 1967). Earlier studies

have shown that the liver, kidney, testis, urinary bladder and skin

are the target organs for BA induced toxicity, which involves the

depletion of ascorbic acid (Singh et al., 1990; Das et al., 1991a,b;

Das et al., 1994). In a recent study conducted by our group, we

http://dx.doi.org/10.1016/j.imbio.2014.10.011

01712985/© 2014 Elsevier GmbH. All rights reserved.





2 P. Tewari et al. / Immunobiology xxx (2014) xxx–xxx

have demonstrated that BA showed skin tumorigenic potential

(Dwivedi et al., 2013). The process of absorption and disposition

are key determinants that influence the rate of delivery of a xeno

biotic to the site of pharmacological or toxicological effect (Walker

and Oesch, 1983). It has been shown in a guinea pig model, that

even after a single exposure, BA exhibited comparatively slower

urinary and fecal clearance and higher hepatic and testicular reten

tion (Das et al., 1991b). Similarly, a single exposure of BA to male

rabbits (0.2 g/kg of body weight, i.p.) and guinea pigs (0.03 g/kg of

body weight, i.p.) resulted in a multitude of inflammatory responses

(Pandya et al., 1976; Singh and Tripathi, 1973). In a study, where the

BA was administered intraperitoneally (0.05 g/kg of body weight)

to rats for 10–20 days, the animals developed normocytic anemia

due to hemolysis (Chandra and Singh, 1968). BA can also induce

a significant increase in plasma fibrinogen levels and decrease in

blood coagulation time (Mehrotra et al., 1975).

Despite several investigations on the toxicological effects of

BA, the information on the immunomodulatory potential of

BA is scanty. Exposure to environmental chemicals, such as

polychlorinated biphenyls, polycyclic aromatic hydrocarbons and

heavy metals can alter the immune system (Love et al., 2003;

Pabello and Lawrence, 2006; Rice and Hayward, 1997; Shridhar

et al., 2001). Immunotoxicity is defined as any adverse effect on

the structure and function of the immune system and can be

divided into immunosuppression, immunostimulation, hypersen

sitivity and autoimmunity (Duramad and Holland, 2011; Descotes,

2005). Modulation of the immune system may lead to increased

incidences of inflammation and allergic reactions toward environ

mental agents (Burnet, 1970). Hypersensitivity allergic reactions

like DTH are the most frequently detected immunotoxic effects

of chemicals. This process involves coordinated signaling events

mediated by proinflammatory cytokines and chemokines (Gotte,

2003; Vestweber, 2007). In several clinical studies, it has been

shown that workers exposed to BA during manufacture, pulveriza

tion and storage developed itching, burning sensation, erythema,

roughness, dryness, hyperpigmentation of the skin and allergic

reactions (NIOSH, 1979; Singh and Zaidi, 1969; Trivedi and Niyogi,

1968). BA induced skin inflammation manifested by hyperpigmen

tation, edema, dermatitis and redness of the skin could be an

outcome of hypersensitive response of immune cell types present

in dermal tissue. Taken together, all these studies suggest that a

dysregulated immune response could contribute to BA induced tox

icity. Keeping this in view, the present study was undertaken to

comprehensively assess the immunotoxicity risk associated with

BA exposure in experimental mice model and further delineate the

important inflammatory mediators aggravating the pathology.

Materials and methods

Chemicals, biochemicals and kits

BA (Indian Dyestuff Industries, Kalyan, India) was purified on

a neutral alumina column using 1,2dichloroetane as an eluent as

described earlier (Das et al., 1989). Phosphate buffered saline (PBS),

2′,7′dichlorodihydrofluorescein diacetate (H2DCFDA), protease

inhibitor cocktail and propidium iodide (PI) were purchased from

Sigma Chemical Co. (St. Luois, MO). Dulbecco’s modified Eagles

medium (DMEM) was purchased from Invitrogen Co. (Carlsbad,

CA), Cytometric Bead Assay Kit for TH1/TH2/TH17 cytokines was

purchased from BD Biosciences (San Diego, CA). Fetal bovine

serum (FBS) and antibiotic–antimycotic solution (10,000 U/ml

penicillin,10 mg/ml streptomycin sulfate) were purchased from

Gibco, Invitrogen Cor. (Grand Island, NY). Tris buffer, triton X

100, bovine serum albumin (BSA), were obtained from Sigma

Chemicals Co. (St. Louis, MO). AntigH2AX (Ser139), antip

JNK (Thr183/Tyr185), antiCOX2 and antiiNOS were procured

from Cell Signaling Technology (Beverly, MA). Antibactin, anti

tubulin, antipextracellular signalregulated kinases (ERK1/2)

(Thr202/Tyr204), antip38, anticjun Nterminal kinase (JNK),

antipNFkB were purchased from Santa Cruz Biotechnology

(Santa Cruz, CA). Halt Protease and Phosphatase Inhibitor Cocktail

were procured from Thermo Scientific (Rockford, IL). All other

chemicals used were of the highest purity commercially available.

Endotoxin detection

Limulus amebocyte lysate (LAL) was performed to detect endo

toxin contamination in BA with Pierce LAL Chromogenic Endotoxin

Quantification Kit (U.BEE. Scientific, USA) according to manufactur

ers protocol. It was found that the BA used in the present study was

free of endotoxin (data not shown).

Animals

Inbred strains of female Balb/c mice (6–8 weeks old, 18–20 g)

were procured from the animal breeding colony of Indian Institute

of Toxicology Research (Lucknow, India) and were acclimatized

under standard laboratory condition for one week prior to the

experiment. Animals were housed in polycarbonate cage main

tained at 22 ± 2 ◦C under standard laboratory conditions of light

and dark cycles (12–12 h). Animals were kept on a normal diet and

water ad libitum.

BA treatment schedule for intraperitoneal dosing

The experimental animals were divided into four groups. Ani

mals of group I served as control and received 0.1 ml corn

oil intraperitoneally. Animals of group II, III and IV received

3.25 mg/kg, 7.5 mg/kg and 15 mg/kg endotoxin free BA intraperi

toneally in 0.1 ml corn oil daily for one week, respectively

(n = 6 animals/group). The doses of BA were selected based on our

earlier studies where in i.p. doses of BA in rats (40 mg/kg) for

3, 7 and 21 days resulted in alterations of xenobiotic metaboliz

ing enzymes (Das et al., 1991a). The 3 doses of BA selected were

1/20th (15 mg/kg), 1/40th (7.5 mg/kg) and 1/80th (3.25 mg/kg) of

the intraperitoneal LD50 (i.p. 290 mg/kg) which was determined

by (Lundy and Eaton, 1994). The intraperitoneal exposure route

was selected to identify the effects of BA exposure on spleen. The

animals were sacrificed by cervical dislocation 24 h after the last

treatment for the analysis of below mentioned parameters. This

study was carried out after the approval by the Institutional Ethical

Committee (Approval no. IITR/IAEC/10/13).

Collection of blood samples and histopathological processing

After the treatment schedule, blood was collected by retro

orbital bleeding and serum was separated. After sacrificing the

mice, a portion of the spleen and lungs was washed with cold

normal saline, blotted dry over filter paper and fixed in 10% neu

tral formalin and embedded in paraffin. Serial sections of 5 mm

thickness were cut and stained with hematoxylin and eosin for

microscopic examination.

MPO activity

MPO activity was determined by the method of Bradley et al.

(1982). In brief, spleen and lung samples of control as well as

treated mice were weighed. A 100 mg of tissue was homogenized

in 3 ml of 0.5% hexadecyl trimethyl ammonium bromide in 50 mM

phosphate buffer, pH 6.0, by using homogenizer on ice. After three

freeze thaw cycles, homogenates were centrifuged at 40,000 × g for

15 min, and the MPO activity in the supernatant was measured by





P. Tewari et al. / Immunobiology xxx (2014) xxx–xxx 3

incubating 20 ml of diluted sample with 180 ml of 50 mM potassium

phosphate buffer, pH 6.0, containing 0.157 mg/ml odianisidine

dihydrochloride Sigma Chemicals Co. (St. Louis, MO) and 0.0005%

of H2O2. Absorbance was measured at 450 nm using an ELISA plate

reader (BioTek, Winooski, VT). The MPO activity was expressed as

absorbance per 100 mg weight of tissue.

Preparation of splenocytes

Spleens from control and BA treated mice were taken out,

washed with cold phosphate buffered saline and cell suspension

was prepared by mincing tissue in incomplete Dulbecco’s modified

Eagles medium (DMEM) (Yadav et al., 2012, 2013). In brief, eryth

rocytes were lysed with erythrocytes lysis buffer (0.15 M NH4Cl,

1 mM NaHCO3, 0.1 mM EDTA, pH 7.4). The cells were then washed

two times with incomplete medium and centrifuged (300×g). Cells

were resuspended in DMEM containing 10% fetal bovine serum,

2 mM lglutamine, 100 U/ml of penicillin, 100 mg/ml of strepto

mycin, 25 mM HEPES, 1 mM sodium pyruvate, 25 mM dextrose and

50 mM 2mercaptoethanol. The total number of splenocytes/spleen

was determined by counting cells in a hemocytometer. 100 ml

volume of culture medium containing cells at a concentration of

2 × 106 cells/ml were seeded into black 96 well plates and used for

the assay of investigative parameter (ROS).

ROS measurement by DCFDA method and Western blot analysis of

DNA damage ( H2AX), MAPKs, NFкB, Nrf2, AP1 (cfos, cjun),

COX2 and iNOS

The treatment schedule was same as described under the sec

tion of “BA treatment schedule for intraperitoneal dosing”. For

estimaton of ROS, cells were incubated in presence of 100 mM

DCFDA (Saxena et al., 2009) for 30 min at 37 ◦C, in a 96 well plate

(black bottom), and relative fluorescence intensity was measured in

SYNERGYHT multiwall plate reader (BioTek, Winooski, VT) using

the KC4 software at excitation and emission wavelengths of 485

and 528 nm, respectively.

For Western blot analysis of H2AX (a marker of double stranded

DNA damage), MAPKs, NFкB, Nrf2, AP1, COX2 and iNOS; spleen of

control and BA treated mice were taken, washed with normal saline

and homogenized in icecold lysis buffer (50 mM Tris–HCl [pH 7.5],

150 mM NaCl, 1% Triton X100, 0.5% sodium deoxycholate, 0.1%

SDS, 1 mM dithiothreitol [DTT], 1 mM phenylmethanesulfonylflu

oride [PMSF], supplemented with protease inhibitor cocktail kept

on ice for 10 min with intermittent vortexing, and then centrifuged

at 14,000 × g for 20 min at 4 ◦C. The supernatant was collected and

protein concentration in each sample was measured by the bicin

choninic acid protein assay kit (Thermo Fisher Scientific, Waltham,

MA), using BSA (1 mg/ml) as a standard. Sixty micrograms of total

protein were resolved by 10% SDS polyacrylamide gel electrophore

sis and electrotransferred on polyvinylidene fluoride membranes.

The blotted membrane was blocked with either 5% nonfat dry

milk or 2% BSA in PBS containing 0.1% Tween 20 (blocking solu

tion), and incubated with specific antibodies against gH2AX, NFкB,

pERK1/2, pp38, pJNK, ERK1/2, p38, JNK, Nrf2, AP1, COX2 and

iNOS at dilutions indicated by the manufacturer. The blots were

further incubated with HRP conjugated secondary antibody (Sigma

Chemical Co., St. Louis, MO) and developed by ECL Western Blotting

Detection Kit as described in the manufacturer’s protocol (Amer

sham, Fairfield, CT). All the blots were stripped and reprobed with

bactin or the respective total nonphospho form of protein to

ensure equal loading.

Oxidative stress markers

To study the effect of BA on various oxidative stress mark

ers, spleens of control and treated mice were taken and washed

in chilled phosphate buffer. 10% (w/v) spleen homogenate was

prepared in 0.2 M phosphate buffer using an Ultra Turrax Poly

tron. Reduced glutathione (GSH) content was assayed in the spleen

homogenate according to the method of Ellman (1959). Lipid per

oxidation (LPO) in the spleen homogenate was determined by

estimating the formation of malondialdehyde (MDA) using the

method of Utley et al. (1967). Protein carbonyl content was mea

sured in the spleen homogenate according to the method of Levine

et al. (1990). Catalase activity was determined by the method of

Sinha (1972). Glutathione reductase (GR) and glutathione S trans

ferase (GST) activities were assayed according to the method of

Moron et al. (1979). Superoxide dismutase (SOD) activity was mea

sured by the method of Mishra and Fridovich (1972), whereas

glutathione peroxidase was determined by the method of Rotruck

et al. (1973).

Separation of serum

Blood was collected in dry centrifuge tubes and allowed to clot

at room temperature for 1 h. The tubes were then placed at 4 ◦C

overnight. Serum was separated by centrifugation at 3000 × g for

10 min and stored at −20 ◦C until further analysis.

Cytokine analysis

Serum from different groups was collected for the estimation

of TH1/TH2/TH17 cytokines by using Cytometric Bead Array (CBA)

Kit (BD Biosciences, San Diego, CA). Samples were prepared for

cytokine analysis as directed by the kit manufacturer and analyzed

on the same day. CBAFCAP array software evaluated the level of

cytokines present in the samples on the basis of standard curve

obtained for each cytokine.

Semiquantitative reverse transcriptasepolymerase chain

reaction (RTPCR) of cytokines in spleen

A semiquantitative RTPCR analysis of Th1/Th2 cytokines (IL

4, IL1 and IL10, IFNg, TNFa) in the spleen of mice was carried

out using genespecific primers in control and BA treated groups.

The oligonucleotide primers used are listed in Table 1. Total RNA

from spleen was isolated with RNAzol®RT (Molecular Research

Table 1

Primer sequences used for qPCR.

Gene Forward primer Reverse primer

IL4 5′TCGGCATTTTGAACGAGGTC3′ 5′AAAAGCCCGAAAGAGTCTC3′

IL1 5′GCCAGTTGAGTAGGATAAAGG3′ 5′CAGTCTGTCTCCTTCTTGAGG3′

IL10 5′TGCCTGCTCTTACTGACTGG3′ 5′CTGGGAAGTGGGTGCAGTTA3′

IFN 5′ATCTGGAGGAACTGGCAAAA3′ 5’TTCAAGACTTCAAAGAGTCTGAGGTA3′

TNF ̨ 5′AACTAGTGGTGCCAGCCGAT3′ 5′GACTCAT GTACTCCTGCTTGC3′

GAPDH 5′TCTCACTCTCGAGGCAGCATGA3′ 5′CTTCACAGAGCAATGACTCC3′

where IL, interleukin; INFg, interferon gamma; TNFa, tumor necrosis factor; GAPDH is internal control.






Fig. 1. (A) Effect of benzanthrone on histopathological analysis of spleen depicting inflammatory manifestations; (B) effect of benzanthrone on histopathological analysis

of lungs depicting inflammatory manifestations; (C) effect of benzanthrone on MPO activity in spleen and (D) effect of benzanthrone on MPO activity in lungs. Details of

processing of tissues are mentioned in “Materials and methods” section. The data represent mean ± SD (n = 6). *p < 0.05, indicates significant difference from corresponding

control.

Center, Inc., Cincinnati, OH). cDNA from different groups were

prepared by using High Capacity cDNA Reverse Transcription Kit

(Applied Biosystems, Foster City, CA) according to the manufac

turer’s instructions. The RTPCR was carried out using a PCR master

mix (Thermo Scientific, Waltham, MA) according to the manufac

turer’s instructions. After completion of PCR cycles, 20 ml of PCR

products were analyzed by 2% agarose gel electrophoresis. The den

sity of each band was estimated by the Genetool software (Syngene,

Los Altos, CA). GAPDH was taken as an endogenous control and its

respective densitometry values were used for normalizing differ

ent mRNA expressions in the spleen. Normalized values were used

for plotting the bar graphs.

DTH assay and MPO activity in ear pinna

DTH assay was performed as previously described (Corsini et al.,

1977; Gad, 1994). DTH assay was done to analyze whether BA

causes any kind of hypersensitivity. Animals were divided into 3

groups containing 6 mice in each group. 15 mg/kg dose was selected

to analyze the DTH response. Six BALB/c mice in each group were

sensitized by painting the left ear with 25 ml of 0.5% DNCB (w/v)

as a positive control of DTH, or 25 ml of BA (0.3%) dissolved in a

mixture of acetone and olive oil (4:1), or vehicle alone for 3 consec

utive days. Fourteen days after the initial sensitization, the animals

were challenged with 25 ml of 0.25% DNCB or 25 ml of 0.15% BA

on the left ear. The thickness of the ears was measured with an

engineer’s micrometer Vernier Caliper at 24 h after challenge. The

mice were then sacrificed and the left ear pinna of these mice

was dissected out. A portion of ear pinna was washed with cold

normal saline, blotted dry over filter paper and fixed in 10% neu

tral formalin and embedded in paraffin. Serial sections of 5 mm

thickness were cut and stained with hematoxylin and eosin for

microscopic examination, where as MPO activity was determined

by the method of Bradley et al. (1982) as described in MPO activity

section.

Statistical analysis

All the results were expressed as the mean ± SE. Differences

between groups were analyzed using t test and analysis of vari

ance (oneway ANOVA) with Bonferroni intergroup comparison






tests from GraphPad Prism version 3 Software (San Diego, CA). A

value of (*p < 0.05) was considered as statistically significant.

Results

Histopathological analysis of spleen and lungs

Histological analysis of tissues in control mice showed appar

ently normal structure in spleen and lungs, however tissues from

BA treated animals exhibited profound morphological changes

depicting dose dependent heavy inflammation. The spleens of mice

exposed to higher doses of BA (15 mg/kg) exhibited noteworthy

hyperplasia of the spleen and megakaryocytes infiltration, whereas

the lungs displayed pronounced thickening of alveolar septa and

marked alveolar edema with haemorhhages at a few sites (Fig. 1A

and B). We did not find any noticeable change in the dose of

3.25 mg/kg in histopathological analysis, therefore 3.25 mg/kg dose

was excluded from the rest of the investigative assays and mecha

nistic analysis.

Effect of BA on MPO activity in the spleen and lungs

Myeloperoxidase is secreted by inflammatory cells such as acti

vated macrophages and neutrophils. It catalyzes the conversion of

H2O2 into HOCl and tyrosine into tyrosyl radical. HOCl and tyrosyl

radical are cytotoxic in nature and are key components of oxida

tive burst and inflammatory responses. Therefore the MPO activity

in the spleen and lung tissue was measured following BA expo

sure. Increased MPO activity was observed in both tissues, in a dose

dependent manner. The MPO activity in the spleen was upregulated

by 157% ↑ and 571% ↑ at 7.5 mg/kg b.w., and 15 mg/kg b.w. of BA

dose. Similarly, in the lungs, the enzymatic activity was notably

increased with respect to control by 193% and 666% at 7.5 mg/kg

and 15 mg/kg doses of BA, respectively (Fig. 1 C and D).

Effect of BA on ROS generation and Nrf2 levels in spleen

As shown in Fig. 2A, BA administration induced signifi

cant enhancement in ROS generation by splenocytes in a dose

Fig. 2. Effect of benzanthrone on ROS, oxidative stress markers and DNA damage in spleen. (A) Effect of BA on ROS generation. Single cell suspensions from vehicle control

or BA treated mice spleen were prepared and 1 × 105 cells were incubated with 100 mM H2DCFDA for 30 min at 37 ◦C and relative fluorescence intensity was determined by

spectrofluorimetry (�ex = 488 nm, �em = 520 nm) and represented in terms of fold change; (B) effect of BA on LPO; (C) effect of BA on GSH content; (D) effect of BA on protein

carbonyl (PC); spleens of control and BA treated mice were washed in chilled phosphate buffer and 10% (w/v) spleen homogenate was prepared in 0.2 M phosphate buffer using

an Ultra Turrax Polytron for the assay of LPO, GSH and protein carbonyls. Data represented in terms of n mol MDA/mg protein, mol GSH/mg protein and mol PC/mg protein,

respectively; (E) effect of BA on H2AX; and (F) Nrf2 proteins; (G and H) densitometric analysis of H2AX and Nrf2 proteins were performed and values were normalized with

respect to tubulin and plotted in terms of fold difference. Details of processing of cells and tissues are mentioned in “Materials and methods” section. The data represent

mean ± SD (n = 6) for all the parameters except Western blot analysis of H2AX and Nrf2 wherein mean ± SD of three experiments have been indicated. *p < 0.05, indicates

significant difference from corresponding control.






Fig. 3. Effect of benzanthrone exposure on antioxidant enzymes of spleen. (A) Effect of BA on SOD; (B) GST; (C) GR; (D) catalase; and (E) GPx activities. Spleens from control

and BA treated mice were taken, washed in chilled phosphate buffer and 10% (w/v) spleen homogenate was prepared in 0.2 M phosphate buffer. Details of processing of tissues

are mentioned in “Materials and methods” section. Each value represents mean ± SD of 6 animals. *p < 0.05, indicates significant difference from corresponding control.

dependent manner. It is well known that cells create a homeo

static balance between production and removal of ROS, and Nrf2

transcription factor has been identified as the master regulator

for maintaining ROS balance (Kensler et al., 2007). We found that

the expression of Nrf2 was decreased by BA in a dose dependent

manner, thereby modulating the antioxidant defense system of the

spleen (Fig. 2F).

Effect of BA on oxidative stress markers in spleen

It was observed that BA at the doses of 7.5 mg/kg and 15 mg/kg,

caused a significant increase in LPO (106–450%) and protein car

bonyl content (25–173%) along with a significant decrease in

GSH content (55–73%) (Fig. 2B–D). However the activities of SOD

(24–66%), GST (37–75%), GR (34–55%), catalase (12–29%) and GPx

(74–85%) were found to be significantly downregulated at both the

doses of BA (Fig. 3).

Effect of BA on the DNA integrity of spleen

Since ROS generation has been known to cause DNA damage,

the effect of BA on the integrity of DNA was studied. The West

ern blot analysis revealed that the level of gH2AX protein, a well

established marker of DNA damage was significantly elevated in a

dose dependent manner by BA when compared to control (Fig. 2E).

Effect of BA exposure on serum cytokine levels

Cytokines play an important role in immunoregulation and

inflammation. Treatment of BA at higher dose (15 mg/kg b.w.)

increased the levels of all inflammatory cytokines – IL17 (4.8 fold,

Fig. 4A), TNFa (1.52 fold, Fig. 4B), IFNg (4.2 fold, Fig. 4C), IL4 (4.25

fold, Fig. 4D), IL10 (12.3 fold, Fig. 4E) and IL1 (427 fold, Fig. 4F).

However, at lower dose (7.5 mg/kg) only TNFa (1.2 fold), IL4 (1.5

fold) and IL1 (81 fold) were found to be increased.

Effect of BA exposure on the mRNA level of cytokines in spleen

A dysregulated inflammatory immune response and homeo

static imbalance are characterized by upregulation of proinflam

matory mediators at the transcriptome level and since serum

cytokines are primarily contributed by immune cell types, therefore

we examined the expression level of the cytokines at mRNA level in

the spleen. The RTPCR analysis of cytokines in spleen revealed that

BA treatment (7.5 mg/kg and 15 mg/kg b.w.) increased the expres

sion of cytokines – IL4, IL1, IL10, IFNg and TNFa (Fig. 5A).

Effect of BA on the phosphorylation of ERK1/2, p38 and JNK MAP

kinases levels

ERK1/2, p38 and JNK are a subgroup of a superfamily of ser

ine/threonine kinases known as mitogenactivated protein kinases

(MAPKs) which play a pivotal role in cell survival, proliferation,

inflammation and cell death. As shown in Fig. 6, the phosphory

lation of ERK1/2, p38 and JNK was significantly enhanced in BA

treated mice at both the doses.

Effect of BA on phosphorylation of transcription factors NFкB and

AP1 (cfos, cjun)

NFкB and AP1 transcription factors play an important role

downstream to the MAPK pathways in the regulation of several






Fig. 4. Benzanthrone induced alterations in the levels of cytokines in serum. (A) Effect of BA on IL17; (B) TNFa; (C) IFNg; (D) IL4; (E) IL10; and (F) IL1 levels. Serum

from different groups were collected for the estimation of TH1/TH2/TH17 cytokines using Cytometric Bead Array (CBA) Kit. CBAFCAP array software evaluated the level of

cytokines present in the samples on the basis of standard curve obtained for each cytokine. Values represent means ± SD of 6 animals. *p < 0.05, indicates significant difference

from corresponding control.

genes involved in inflammatory responses, therefore we examined

the effect of BA on NFкB as well as AP1 levels. It was observed that

BA administration resulted in a dose dependent enhancement of

NFкB, AP1 levels (Fig. 7A–D) in mouse splenocytes with respect to

control, indicating the plausible role of MAPK pathways in causing

inflammation.

Effect of BA on inflammatory markers iNOS and COX2

Since iNOS and COX2 are well known inflammatory markers,

the expression of iNOS and COX2 in spleens of control and BA

treated mice was undertaken. It was observed that both iNOS and

COX2 were signficantly upregulated in the spleen of BA treated

animals with respect to control (Fig. 7A, E, F).

Histological analysis, ear swelling and MPO activity in auricle

tissues of BA treated mice

DTH response is a complex inflammatory process which

involves an interaction between T lymphocytes, and macrophages

bridged by several inflammatory mediators. To determine if BA

induced toxicity involves DTH reactivity, BA (0.3%) was applied






Fig. 5. Benzanthrone induced expression of cytokines in spleen at mRNA level. (A) IL4, IL1, IL10, IFNg, TNFa. A semiquantitative RTPCR analysis of Th1/Th2 cytokines

(IL4, IL1, IL10, IFNg, TNFa) in the spleen of mice was carried out using genespecific primers in control and BA treated groups. Total RNA from spleen was isolated with

RNAzol®RT and cDNA from different groups were prepared by using High Capacity cDNA Reverse Transcription Kit. After completion of PCR cycles, 20 ml of PCR products

were analyzed on 2% agarose gel electrophoresis. (B) Densitometric analysis was performed and values were normalized with respect to its GAPDH and plotted in terms of

fold difference. Values represent means ± SD of 6 animals. *p < 0.05, indicates significant difference from corresponding control.

to ear pinna of animals, while DCNB (0.5%) was used as a pos

itive control. Histological sections of auricle tissue of control

mice showed apparently normal histological structure. The ear

pinna of DCNBchallenged mice revealed epidermal hyperpla

sia and infiltration of mixed inflammatory cells in the dermis,

whereas BA treated mice also showed hyperplasia of epidermis

protruding within the dermis, along with the presence of few

mixed inflammatory cells in the dermis (Fig. 8A). In line with

the histopathological evaluations, the ear thickness (Fig. 8B) and

MPO activity (Fig. 8C) in the ear tissue was also significantly

increased (69–150% ↑) in BA treated mice when compared to

control.

Discussion

The present study demonstrated the inflammatory effects of BA

and the underlying signaling mechanism in Balb/c mice model.

Although several reports on the toxicity of BA have been docu

mented (Garg et al., 1992a,b; Das et al., 1991a,b; Horakova and

Merhaut, 1966), but the knowledge gap from the immunotoxico

logical perspective is yet to be addressed. In a bid to understand

the association of immune system components in BA induced

inflammation, mice were administered BA intraperitoneally fol

lowed by histopathological evaluations of the spleen from BA

exposed animals showed marked hyperplasia and infiltration of

megakaryocytes, which is suggestive of profound inflammation.

The lungs are one of the primary targets of BA exposure via

inhalation of diesel exhausts (Sawacki et al., 1965). The present

investigation indicates that the lungs of BA administered animals

exhibited thickening of alveolar septa as well as moderate alveo

lar edema. These findings suggest that people affected by several

inflammatory lung pathologies could have BA as one of the con

tributing etiological factor.

Several reports have been published on the relationship

between oxidative stress and inflammation. Environmental xeno

biotics can induce oxidative stress and DNA damage in vitro and

in vivo, which stands as one of the widely cited prominent toxic

ity mechanism (Klaunig et al., 1997; Cooke et al., 2003; Das et al.,

2005a,b). The present study clearly demonstrates that BA adminis

tration creates oxidative imbalance in splenocytes by increasing the

levels of ROS, lipid peroxidation and protein carbonylation. Further

more, the antioxidant defense machinery of the cells was glitched,

causing significant downregulation in the enzymatic activities of

SOD, GST, GR, catalase and GPx. Nrf2 transcription factor plays an






Fig. 6. Benzanthrone induced protein expression of MAPKs in spleen of mice. (A) Effect of BA on pJNK, pERK, pp38 in spleen. For confirmation of equal protein loading, the

blots were probed with an antibody specific for total ERK, JNK, p38. (B–D) Densitometric analysis of JNK, ERK and p38 was performed and the values were normalized with

respect to total nonphospho form of the respective protein and plotted in terms of fold difference. Values represent means ± SD of 3 animals. *p < 0.05, indicates significant

difference from corresponding control.

important role in restoring and maintaining the cellular oxidative

stress at nontoxic levels (Cavin et al., 2007). The present study

demonstrated that BA induced Nrf2 suppression, which might

be the pivotal deregulation affecting the genotoxic and oxidative

damage persistent in the spleens of BA treated animals. MPO,

a hemoprotein stored in azurophilic granules of polymorphonu

clear neutrophils and macrophages, is a significant contributor

to cellular oxidative damage. It plays an important role in the

initiation and progression of acute and chronic inflammatory dis

eases (Takahiko et al., 2002; Sugiyama et al., 2001). Our present

findings showed that BA exposure results in enhancement of

MPO activity in the spleen and lungs. It was noteworthy that

the expression of COX2 and iNOS was also upregulated in the

spleens of BA exposed mice, which are wellestablished molecular

biomarkers of inflammation (Kwon et al., 2007). Severe oxida

tive stress is often accompanied by DNA damage, therefore we

examined whether BA toxic insult causes a breach of DNA integrity.

H2AX, a member of histone protein family H2A, is phosphory

lated on residue serine 139 in cells, when double strand breaks

(DSBs) are introduced into DNA by endogenous or exogenous fac

tors (Rogaku et al., 1998). BA exposure significantly enhanced

the protein levels of gH2AX, confirming DNA damage in spleno

cytes.

The oxidative stress response is known to upregulate several

inflammatory mediators such as COX2, TNFa, IL6, IFNg and

other inflammatory cytokines via the activation of signaling path

ways involving the transcription factor NFкB (Lu and Wahl, 2005;

Lefkowitz et al., 1993). Corroborating with these observations, BA

exposure to mice increased the production of proinflammatory

cytokines IL17, TNF a, IFNg and IL1. These cytokines have been

reported to play a pivotal role in the amplification of inflammatory

responses and progression of inflammatory disorders like asthma






Fig. 7. Benzanthrone induced protein expression of inflammatory mediators and transcription factors in spleen of mice. (A) Effect of BA on NFkb, cjun, cfos, COX2, and iNOS

in spleen of control and BA treated groups. For confirmation of equal protein loading, the blots were probed with an antibody specific for tubulin and bactin. Densitometric

analysis was performed and values were normalized with respect to tubulin or b actin, and plotted in terms of fold difference.

and autoimmune tissue inflammations (Strieter and Kunkel, 1994;

van de Veerdonk et al., 2011; Lu and Wahl, 2005; Awasthi and

Kuchroo, 2009; Wong et al., 2001). Interestingly, the levels of anti

inflammatory cytokines IL10 and IL4 were also elevated in BA

treated animals, which could be a counter response of the body for

damage control. Earlier reports have documented that upregulation

of IL10 and IL4 cytokines along with inflammation plays a pro

tective role in models of inflammation induced injury (Järveläinen

et al., 1999; Frankerberger et al., 1994).

Oxidative stress induces signaling pathways, including MAPKs,

which further modulate the activity of downstream transcription

factors such as NFкB, AP1 (Zhang and Liu, 2002). The MAP kinases

signaling cascades play a vital role in mediating a number of cellular

fates, including growth, proliferation, apoptosis and survival. More

over, they also regulate the release of several inflammatory proteins

and their mediators such as COX2 and iNOS (Dhillon et al., 2007;

Porter and Vaillancourt, 1998; Zhang and Liu, 2002; Johnson and

Lapadat, 2002; Engelberg, 2004; Lee et al., 2007). The MAPK family

of proteins includes the p38 kinases, extracellular signalregulated

protein kinases (ERK1/2), and cJun NH2terminal kinases (JNK1/2).

Our results showed that BA exposure increased the splenic expres

sion of pERK1/2, pp38 and pJNK in a dosedependent manner.

The MAPKs often lead to activation of transcription factors

such as NFкB and AP1, which are important signaling molecules

implicated in cell proliferation, apoptosis, cell adhesion and inflam

matory responses (Budunova et al., 1999; Poynter et al., 2004;

Sung et al., 2006). Upon activation, NFкB and AP1 translocate to

the nucleus, where they bind to the promoter region of various

target genes, including COX2 and iNOS (Surh and Kundu, 2005).

Corroborating with the earlier reports, our findings demonstrate

that BA affected the activation of NFкB and AP1 transcription

factors.

The large scale migration of inflammatory immune cells into

areas of tissue damage marks the severity of DTH response (Grabbe

and Schwarz, 1998; Gotte, 2003; Vestweber, 2007). To assess the

immunoinflammatory potential of BA on skin, first we topically

applied BA to the mice ear pinna for evaluation of DTH reactiv

ity. DTH and contact hypersensitivity (CHS) models are frequently

employed as preclinical animal models to evaluate the effect

of immunomodulatory agents on inflammatory skin responses

(Cavani et al., 2001; Dearman and Kimber, 2002; Grabbe and

Schwarz, 1998; Enk and Katz, 1992; Wang et al., 2003). It was

observed that even topical application of BA to mice ear pinna

significantly induced DTH response as evident by increased ear

swelling and enhancement of MPO activity. Further, histopatho

logical evaluations showed the dysplastic tissue organization and

thickened epidermal layer protruding into the dermis, with the

presence of few mixed inflammatory cells.






Fig. 8. Effect of Benzanthrone on delayed type hypersensitivity response in ear pinna of mice. (A) Histopathological changes showing epidermal hyperplasia and infiltration

of mixed inflammatory cells in ear pinna by BA; (B) ear swelling was measured with an engineer’s micrometer Vernier Caliper at 24 h after BA challenge as described in

“Materials and methods” section; and (C) MPO activity in ear pinna. Ihe MPO activity was measured in the supernatant of ear homogenate by incubating 20 ml of diluted

sample with 180 ml of 50 mM potassium phosphate buffer, pH 6.0, containing 0.157 mg/ml odianisidine dihydrochloride and 0.0005% of H2O2 as described in “Materials and

Methods”and absorbance was measured at 450 nm. The data represent mean ± SD (n = 6). *p < 0.05, indicates significant difference from corresponding control.

Fig. 9. Schematic representation of BA induced MAPKs signaling pathway involved

in immunotoxicity.

Conclusion

Our studies provide the first evidence for the immunomodula

tory potential of BA. We have shown that BA induced inflammatory

changes are associated with the upregulation of inflammatory

markers such as COX2, iNOS, oxidative stress, enhanced DTH

response and upregualtion of several proinflammatory and regu

latory cytokines. Next, it was attempted to elucidate the signaling

events underlying BA induced pathological manifestation. We

found that BA induced immunotoxic responses were mediated by

activation of MAP kinases ERK1/2, p38, JNK and their downstream

transcription factors NFкB and AP1 (Fig. 9).

Acknowledgments

We are grateful to the Director of our institute for his keen inter

est in this study. One of us (PT) is thankful to the Council of Scientific

and Industrial Research (CSIR) for the award of Senior Research Fel

lowship. PT and RR convey their gratitude to Academy of Scientific

& Innovative Research (AcSIR), New Delhi. The financial assistance

of CSIRINDEPTH Project – BSC 0111 is gratefully acknowledged.

The manuscript is IITR communication # 3250.

References

Awasthi, A., Kuchroo, V.K., 2009. Th17 cells: from precursors to players in inflam

mation and infection. Int. Immunol. 21, 489–498.






Bradley, P.P., Christensen, R.D., Rothstein, G., 1982. Cellular and extracellularmyeloperoxidase in pyogenic inflammation. Blood 60, 618–622.

Budunova, I.V., Perez, P., Vaden, V.R., Spiegelman, V.S., Slaga, T.J., Jorcano, J.L., 1999.

Increased expression of p50NFkB and constitutive activation of NFкB tran

scription factors during mouse skin carcinogenesis. Oncogene 18, 7423–7431.

Burnet, F.M., 1970. The concept of immunological surveillance. Prog. Exp. TumorRes. 13, 1–27.

Cavani, A., Albanesi, C., Traidl, C., Sebastiani, S., Girolomoni, G., 2001. Effector and

regulatory T cells in allergic contact dermatitis. Trends Immunol. 22, 118–120.Cavin, C., Delatour, T., MarinKuan, M., Holzhäuser, D., Higgins, L., et al., 2007.

Reduction in antioxidant defenses may contribute to ochratoxin A toxicity andcarcinogenicity. Toxicol. Sci. 96, 30–39.

Chandra, S.V., Singh, G.B., 1968. Effect of benzanthrone on haemopoietic system of

rats. Indian J. Ind. Med. 14, 102–106.

Colour Index, 1971. The Society of Dyers and Colorists and the American Association

of Textile Chemicals and Colorists. Lund Humphries, Bradford/London.

Cooke, M.S., Evans, M.D., Dizdaroglu, M., Lunec, J., 2003. Oxidative DNA damage:mechanisms, mutation and disease. FASEB J. 17, 1195–1214.

Corsini, A.C., Clayton, C., Askonas, B.A., Ogilvie, B.M., 1977. Supressor cells and loss ofBcell potential in mice infected with Trypanosoma brucei. Clin. Exp. Immunol.

29, 122–131.

Das, M., Ansari, K.M., Dhawan, A., Shukla, Y., Khanna, S.K., 2005a. Correlation of DNAdamage in epidemic dropsy patients to carcinogenic potential of argemone oil

and isolated sanguinarine alkaloid in mice. Int. J. Cancer 117, 709–717.

Das, M., Garg, K., Joshi, A., Singh, G.B., Khanna, S.K., 1991a. Interaction of ben

zanthrone with cytochrome P450: altered patterns of hepatic xenobioticmetabolism in rats. J. Biochem. Toxicol. 6, 37–44.

Das, M., Garg, K., Singh, G.B., Khanna, S.K., 1989. Benzanthrone: a new substrate for

hepatic microsomal cytochrome P450. Biochem. Int. 18, 1237–1244.Das, M., Garg, K., Singh, G.B., Khanna, S.K., 1991b. Bioelimination and organ reten

tion profile of benzanthrone in scorbutic and non scorbutic guinea pigs. Biochem.Biophys. Res. Commun. 178, 1405–1412.

Das, M., Garg, K., Singh, G.B., Khanna, S.K., 1994. Attenuation of benzanthrone toxicity

by ascorbic acid in guinea pigs. Fundam. Appl. Toxicol. 22, 447–456.

Das, M., Babu, K., Reddy, N., Srivastava, L.M., 2005b. Oxidative damage of plasma

proteins and lipids in epidemic dropsy patients: alterations in antioxidant status.Biochem. Biophys. Acta 1722, 209–217.

Dearman, R.J., Kimber, I., 2002. Cytokine profiling and chemical allergy. Toxicol. Appl.

Pharmacol. 185, 228–229.

Descotes, J., 2005. Immunotoxicolgy: role in the safety assessment of drugs. Drug

Saf. 28, 127–136.

Dhillon, A.S., Hagan, S., Rath, O., Kolch, W., 2007. MAP kinase signalling pathways incancer. Oncogene 26, 3279–3290.

Duramad, P., Holland, N.T., 2011. Biomarkers of immunotoxicity for environmental

and public health research. Int. J. Environ. Res. Public Health 8, 1388–1401.

Dwivedi, N., Kumar, S., Ansari, K.M., Khanna, S.K., Das, M., 2013. Skin tumorigenicpotential of benzanthrone: prevention by ascorbic acid. Food Chem. Toxicol. 59,687–695.

Ellman, G.L., 1959. Tissue sulphydryl groups. Arch. Biochem. Biophys. 82, 70–77.

Engelberg, D., 2004. Stressactivated protein kinasestumor suppressors or tumor

initiators? Semin. Cancer Biol. 14, 271–282.Enk, A.H., Katz, S.I., 1992. Early events in the induction phase of contact sensitivity.

J. Invest. Dermatol. 99, 39S–41S.

Frankerberger, M., Pechumer, H., ZieglerHeitbrock, H.W.L., 1994. Interleukin10 isupregulated in LPS tolerance. J. Inflamm. 150, 2017–3007.

Gad, S.C., 1994. The mouse ear swelling test (MEST) in the 1990s. Toxicology 93,33–46.

Garg, K., Khanna, S.K., Das, M., Singh, G.B., 1992a. Comparative study of bio

disposition profile of benzanthrone in different rodent species. Food Chem.Toxicol. 30, 517–520.

Garg, K., Khanna, S.K., Das, M., Singh, G.B., 1992b. Role of extraneous supplementation of ascorbic acid on the biodisposition profile of benzanthrone in guineapigs. Food Chem. Toxicol. 30, 967–971.

Gotte, M., 2003. Syndecans in inflammation. FASEB J. 17, 575–591.

Grabbe, S., Schwarz, T., 1998. Immunoregulatory mechanisms involved in elicitation

of allergic contact hypersensitivity. Immunol. Today 19, 37–44.

Handa, T., Yamauchi, T., Sawai, K., Yamamura, T., Koseki, Y., Ishii, I., 1984. In situ emission levels of carcinogenic and mutagenic compounds from diesel and gasoline

engine vehicles on an express way. Environ. Sci. Technol. 18, 895–902.

Horakova, E., Merhaut, J., 1966. Health of workers producing benzanthrone. Prac.

Lek. 18, 78–81.

Järveläinen, H.A., Fang, C., IngelmanSundberg, M., Lindros, K.O., 1999. Effect ofchronic coadministration of endotoxin and ethanol on rat liver pathology and

proinflammatory and antiinflammatory cytokines. Hepatology 29, 1503–1510.Johnson, G.L., Lapadat, R., 2002. Mitogenactivated protein kinase pathways medi

ated by ERK, JNK, and p38 protein kinases. Science 298, 1911–1912.

Kensler, T.W., Wakabayashi, N., Biswal, S., 2007. Cell survival responses to environmental stresses via the Keap1Nrf2ARE pathway. Annu. Rev. Pharmacol.

Toxicol. 47, 89–116.

Klaunig, J.E., Xu, Y., Bachowski, S., Jiang, J., 1997. Freeradical oxygeninducedchanges in chemical carcinogenesis. In: Free Radical Toxicology. Taylor and

Francis, London, pp. 375–400.Kwon, K.H., Barve, A., Yu, S., Huang, M.T., Kong, A.N., 2007. Cancer chemoprevention

by phytochemicals: potential molecular targets, biomarkers and animal models.Acta Pharm. Sin. 28, 1409–1421.

Lee, J.C., Kundu, J.K., Hwang, D.M., Na, H.K., Surh, Y.J., 2007. Humulone inhibits phorbol esterinduced COX2 expression in mouse skin by blocking activation of

NFкB and AP1: IкB kinase as respective potential upstream targets. Carcino

genesis 28, 1491–1498.

Lefkowitz, D.L., Mills, K.C., Moguilevsky, N.A., Bollen, A., Vaz Lefkowitz, S.S., 1993.

Regulation of macrophage functions by human recombinant myeloperoxidase.Immunol. Lett. 36, 43–49.

Levine, R.L., Garland, D., Oliver, C.N., Amici, A., Climent, I., et al., 1990. Determination

of carbonyl content of oxidatively modified proteins. Methods Enzymol. 186,464–478.

Love, O.P., Shutt, L.J., Silfies, J.S., Bortolotti, G.R., Smits, J.E., Bird, D.M., 2003. Effectsof dietary PCB exposure on adrenocortical function in captive American kestrels(Falco sparverius). Ecotoxicology 12, 199–208.

Lu, Y., Wahl, L.M., 2005. Oxidative stress augments the production of matrixmetalloproteinase1, cyclooxygenase2, and prostaglandin E2 through enhance

ment of NFKappa B activity in lipopolysaccharideactivated human primarymonocytes. J. Immunol. 175, 5423–5429.

Lundy, D., Eaton, J., 1994. Occupational Health Hazards Posed by Inventory U.S.

Army Smoke/Obscurant Munitions (Review Update). WRAIR/RT94001. ADA276774. U.S. Army Medical Research Detachment, WrightPatterson Air Force

Base, Ohio for Walter Reed Army Institute of Research, Washington, DC.

Mehrotra, N.K., Singh, G.B., Khanna, S.K., 1975. Blood coagulation disturbances dueto benzanthrone. Ind. Health 13, 101–103.

Mishra, H.P., Fridovich, I., 1972. The role of superoxide anion in the autoxidationof epinephrine and a simple assay for superoxide dismutase. J. Biol. Chem. 247,

3170–3175.Moron, M.S., Depierre, J.W., Mannervik, B., 1979. Levels of glutathione, glutathione

reductase and glutathione Stransferase activities in rat lung and liver. Biochim.

Biophys. Acta 582, 67–78.NIOSH, 1979. Toxic Effects of Chemical Substances – BA. USNTIS Report US

AMBRDLTR7704., pp. 34–45.

Pandya, K.P., Singh, G.B., Dhasmana, A., 1976. Urinary excretion of benzanthrone.Toxicol. Appl. Pharmacol. 38, 217–219.

Pabello, N.G., Lawrence, D.A., 2006. Neuroimmunotoxicology: modulation of neuroimmune networks by toxicants. Clin. Neurosci. Res. 6, 69–85.

Porter, A.C., Vaillancourt, R.R., 1998. Tyrosine kinase receptoractivated signal transduction pathways which lead to oncogenesis. Oncogene 17, 1343–1352.

Poynter, M.E., Cloots, R., van Woerkom, T., Butnor, K.J., Vacek, P., Taatjes, D.J., Irvin,

C.G., JanssenHeininger, Y.M., 2004. NFkappa B activation in airways modulates allergic inflammation but not hyper responsiveness. J. Immunol. 173,

7003–7009.Ramdahl, T., 1983. Polycyclic aromatic ketones in environmental samples. Environ.

Sci. Technol. 17, 666–670.

Rice, D.C., Hayward, S., 1997. Effects of postnatal exposure to a PCB mixture in

monkeys on nonspatialdiscrimination reversal and delayed alternation perfor

mance. Neurotoxicology 18, 479–494.

Rogaku, E.P., Pilch, D.R., Orr, A.H., Ivanova, V.S., Bonner, W.M., 1998. DNA doublestranded breaks induce histone H2AX phosphorylation on serine 139. J. Biol.

Chem. 273, 5858–5868.

Rotruck, J.T., Pope, A.L., Ganther, H.E., Swanson, A.B., Hafeman, D.G., Hoekstra, W.G.,

1973. Selenium: biochemical role as a component of glutathione peroxidase.Science 179, 588–590.

Sawacki, E., 1967. Airborne carcinogens and allied compounds. Arch. Environ. Health

14, 46–53.

Sawacki, E., Stanley, T.W., Elbert, W.C., 1965. Analysis of urban atmosphere and

air pollution source effluents for phenalcnlone and 7Hbenz (de)anthracen7one. Mikrochim. Acta 5–6, 1110–1123.

Saxena, N., Ansari, K.M., Kumar, R., Dhawan, A., Dwivedi, P.D., Das, M., 2009. Patulin

causes DNA damage leading to cell cycle arrest and apoptosis through modulation of Bax, p53 and p21/WAF1 proteins in skin of mice. Toxicol. Appl. Pharmacol.

234, 192–201.

Shridhar, S., Farley, A., Reid, R.L., Foster, W.G., Van Vugt, D.A., 2001. The effect of2,3,7,8tetrachlorodibenzopdioxin on corticotrophinreleasing hormone, argi

nine vasopressin, and proopiomelanocortin mRNA levels in the hypothalamusof the cynomolgus monkey. Toxicol. Sci. 63, 181–188.

Sinha, A.K., 1972. Colorimetric assay of catalase. Anal. Biochem. 47, 389–394.

Singh, G.B., Zaidi, S.H., 1969. Preliminary clinical and experimental studies on benzanthrone toxicity. J. Indian Med. Assoc. 53, 558–560.

Singh, G.B., Tripathi, V.N., 1973. Effect of benzanthrone on the urinary bladder ofguinea pig. Experientia 29, 683–684.

Singh, G.B., Khanna, S.K., Das, M., 1990. Recent studies on toxicity of benzanthrone.J. Sci. Ind. Res. 49, 288–296.

Strieter, R.M., Kunkel, S.L., 1994. Acute lung injury: the role of cytokines in the

elicitation of neutrophils. J. Investig. Med. 42, 640–651.Sugiyama, S., Okada, Y., Sukhova, G.K., Virmani, R., Heinecke, J.W., Libby, P., 2001.

Macrophage myeloperoxidase regulation by granulocyte macrophage colony

stimulating factor in human atherosclerosis and implications in acute coronarysyndromes. Am. J. Pathol. 158, 879–891.

Sung, B., Park, S., Yu, B.P., Chung, H.Y., 2006. Amelioration of agerelated inflammationand oxidative stress by PPARgamma activator: suppression of NFkappaB by2,4thiazolidinedione. Exp. Gerontol. 41, 590–599.

Surh, Y.J., Kundu, J.K., 2005. Signal transduction network leading to COX2 induction:a road map in search of cancer chemopreventives. Arch. Pharm. Res. 28, 1–15.

Takahiko, N., Makiko, V., Kazuo, H., et al., 2002. Neutrophil infiltration of culpritlesions in acute coronary syndromes. Circulation 106, 2894–2900.






Trivedi, D.H., Niyogi, A.K., 1968. BA hazard in dye factory. Indian J. Ind. Med. 14,13–22.

Utley, G.H., Bernheim, F., Hochstein, P., 1967. Effect of sulphydryl reagents on peroxidation in microsomes. Arch. Biochem. Biophys. 118, 29–32.

van de Veerdonk, F.L., Joosten, L.A., Shaw, P.J., Smeekens, S.P., Malireddi, R.K., van derMeer, J.W., Kullberg, B.J., Netea, M.G., Kanneganti, T.D., 2011. The inflammasomedrives protective Th1 and Th17cellular responses in disseminated candidiasis.Eur. J. Immunol. 41, 2260–2268.

Venkatraman, K., 1952. The chemistry of synthetic dyes: BZ derivatives. In: Fiescr,

L.F., Fieser, M. (Eds.), Organic and Biological Chemistry. A Series of Monographs.

Academic Press, New York, pp. 958–983.

Vestweber, D., 2007. Adhesion and signaling molecules controlling the transmigration of leukocytes through endothelium. Immunol. Rev. 218, 178–196.

Wang, B., Esche, C., Mamelak, A., Freed, I., Watanabe, H., Sauder, D.N., 2003. Cytokineknockouts in contact hypersensitivity research. Cytokine Growth Factor Rev. 14,

381–389.

Walker, C.H., Oesch, F., 1983. In: Cadwell, J., Jakoby, W.B. (Eds.), Biological Basis ofDetoxification. Academic Press, New York, pp. 349–368.

Wong, C.K., Ho, C.Y., Ko, F.W., Chan, C.H., Ho, A.S., Hui, D.S., Lam, C.W., 2001.

Proinflammatory cytokines (IL17, IL6, IL18 and IL12) and Th cytokines

(IFNgamma, IL4, IL10 and IL13) in patients with allergic asthma. Clin. Exp.Immunol. 125, 177–183.

Yadav, A., Kumar, A., Dwivedi, P.D., Tripathi, A., Das, M., 2012. In vitro studies onimmunotoxic potential of Orange II in splenocytes. Toxicol. Lett. 208, 239–245.

Yadav, A., Kumar, A., Tripathi, A., Das, M., 2013. Sunset yellow FCF, a permitted fooddye, alters functional responses of splenocytes at noncytotoxic dose. Toxicol.

Lett. 217, 197–204.

Zhang, W., Liu, H.T., 2002. MAPK signal pathways in the regulation of cell proliferation in mammalian cells. Cell. Res. 12, 9–18.

Date post:	18-Feb-2017
Category:	Documents
Upload:	prachi-tewari
View:	21 times
Download:	0 times

Benzanthrone induced immunotoxicity via oxidative stress

Documents