Biochemical Pharmacology xxx (2013) xxx–xxx

G Model

BCP-11493; No. of Pages 8

Live-cell imaging of p53 interactions using a novel Venus-based bimolecularfluorescence complementation system

Joana Dias Amaral a,b,*, Federico Herrera c, Pedro Miguel Rodrigues a, Pedro Antunes Dionısio a,Tiago Fleming Outeiro c,d,e, Cecılia Maria Pereira Rodrigues a,b

a Research Institute for Medicines and Pharmaceutical Sciences (iMed.UL), Faculty of Pharmacy, University of Lisbon, Lisbon, Portugalb Department of Biochemistry and Human Biology, Faculty of Pharmacy, University of Lisbon, Lisbon, Portugalc Cell and Molecular Neuroscience Unit, Instituto de Medicina Molecular, Lisbon, Portugald Instituto de Fisiologia, Faculty of Medicine, University of Lisbon, Lisbon, Portugale Department of Neurodegeneration and Restorative Research, University Medizin Goettingen, Goettingen, Germany

A R T I C L E I N F O

Article history:

Received 26 September 2012

Accepted 12 December 2012

Available online xxx

Keywords:

BiFC assay

p53–Mdm2 interaction

HCT116 cells

Drug discovery

Cancer

A B S T R A C T

p53 plays an important role in regulating a wide variety of cellular processes, such as cell cycle arrest

and/or apoptosis. Dysfunction of p53 is frequently associated with several pathologies, such as cancer

and neurodegenerative diseases. In recent years substantial progress has been made in developing novel

p53-activating molecules. Importantly, modulation of p53 interaction with its main inhibitor, Mdm2,

has been highlighted as a promising therapeutic target. In this regard, bimolecular fluorescence

complementation (BiFC) analysis, by providing direct visualization of protein interactions in living cells,

offers a straightforward method to identify potential modulators of protein interactions. In this study, we

developed a simple and robust Venus-based BiFC system to screen for modulators of p53–p53 and p53–

Mdm2 interactions in live mammalian cells. We used nutlin-3, a well-known disruptor of p53–Mdm2

interaction, to validate the specificity of the assay. The reduction of BiFC signal mediated by nutlin-3 was

correlated with an increase in Puma transactivation, PARP cleavage, and cell death. Finally, this novel

BiFC approach was exploited to identify potential modulators of p53–Mdm2 complex formation among a

commercially available chemical library of 33 protein phosphatase inhibitors. Our results constitute

‘‘proof-of-concept’’ that this model has strong potential as an alternative to traditional target-based drug

discovery strategies. Identification of new modulators of p53–p53 and p53–Mdm2 interactions will be

useful to achieve synergistic drug efficacy with currently used anti-tumor therapies.

� 2012 Elsevier Inc. All rights reserved.

Contents lists available at SciVerse ScienceDirect

Biochemical Pharmacology

jo u rn al h om epag e: ww w.els evier .c o m/lo cat e/b io c hem p har m

1. Introduction

The tumor suppressor protein p53 is a ubiquitous transcriptionfactor that controls genome integrity and cell homeostasis inresponse to diverse forms of stress [1,2]. p53 plays a major role incell cycle arrest, DNA repair, apoptosis, senescence or differentia-tion following stress, facilitating the repair and survival ofdamaged cells, or the elimination of severely damaged cells fromthe replicative pool. p53 dysfunction is a hallmark of multiplepathological conditions associated with excessive levels ofapoptosis, such as neurodegeneration, ischemia, cholestasis, andatherosclerosis [3]. However, p53 is best known as a tumorsuppressor protein. Approximately 50% of all human tumorsharbor p53 gene mutations or deletions that disable its tumor

* Corresponding author at: iMed.UL, Faculty of Pharmacy, University of Lisbon,

Lisbon 1649-003, Portugal. Tel.: +351 21 794 6490; fax: +351 21 794 6491.

E-mail address: jamaral@ff.ul.pt (J.D. Amaral).

Please cite this article in press as: Amaral JD, et al. Live-cell imagfluorescence complementation system. Biochem Pharmacol (2013),

0006-2952/$ – see front matter � 2012 Elsevier Inc. All rights reserved.

http://dx.doi.org/10.1016/j.bcp.2012.12.009

suppressor function [4]. Moreover, in wild-type p53 tumors thelevels of negative regulators of p53 function are frequentlyincreased. Therapeutic strategies aimed at reactivation of p53 intumors emerge as a promising approach for the treatment ofcancer patients.

The murine double minute-2 gene (Mdm2) inhibits p53 activityby means of at least three different pathways [5]. Mdm2 binds tothe p53 transactivation domain, thus inhibiting its transcriptionalactivity [6]. It also acts as an E3 ubiquitin ligase, promoting p53degradation [7]. Finally, after binding to p53, Mdm2 favors p53nuclear export through a nuclear export signal [8]. The modulationof p53–Mdm2 interaction is therefore an attractive moleculartarget for the development of new therapies against cancer andother p53-related pathologies. Several approaches have been takento modulate p53–Mdm2 interaction, including inhibition of Mdm2expression by antisense oligonucleotides, microinjection of anti-Mdm2 antibodies and, more recently, the development of highaffinity peptides and small molecules that bind at the interfacebetween p53 and Mdm2 to prevent protein interaction [9–11].

ing of p53 interactions using a novel Venus-based bimolecularhttp://dx.doi.org/10.1016/j.bcp.2012.12.009

J.D. Amaral et al. / Biochemical Pharmacology xxx (2013) xxx–xxx2

G Model

BCP-11493; No. of Pages 8

Analogs of the cis-imidazoline nutlin are the prototypical disruptorsof p53–Mdm2 interaction. For example, nutlin-3 is able to induceeither cell cycle arrest or apoptosis in tumor cells in vivo, whilehealthy cells remained unharmed [12,13]. RG7112, a novel memberof the nutlin family, is currently in a pioneering clinical trial for thetreatment of acute myeloid leukemia (AML) [14].

Interestingly, recent studies have demonstrated that thedominant-negative activity of conformational p53 mutants resultfrom increased protein aggregation propensity [15,16]. p53 isactive as a homotetramer and its aggregation into a mixture ofoligomers and amyloid fibrils apparently renders p53 inactive.Mutant p53 not only induces misfolding and co-aggregation ofwild-type p53, but also of its paralogs p63 and p73, causingdeficient transcription of antitumoral and pro-apoptotic genes[15]. Therefore, this amyloid-like behavior of oncogenic p53mutants could also serve as a potential target for cancer therapy.

Here, we present a simple and robust assay that allows thedirect visualization and quantification of p53–p53 and p53–Mdm2interaction in live cells. This system is based on bimolecularfluorescence complementation (BiFC) assays, where the proteins ofinterest are fused to non-fluorescent fragments of a fluorescentreporter protein. When the proteins of interest interact, the non-fluorescent halves get close enough to fold together andreconstitute the functional fluorophore (Fig. 1A). Fluorescence istherefore proportional to the amount of dimers generated, and canbe analyzed in live cells by flow cytometry or microscopy, forexample. Here, we present a ‘‘proof-of-concept’’ of the potential ofour model for the identification of modulators of p53–p53 andp53–Mdm2 interactions in live mammalian cells.

2. Materials and methods

2.1. Construct generation

Expression plasmids for p53 and Mdm2 were kind gifts from Dr.Guido Kroemer (INSERM, Villejuif, France) and Dr. Karen Vousden(The Beatson Institute for Cancer Research, Glasgow, UnitedKingdom), respectively. p53 and Mdm2 open reading frames wereextracted from these plasmids by PCR using the following primers:50GCTAATCTTAAGGAGGAGCCGCAGTCAGATCCT30 and 50GCTAATC-TCGAGTCAGTCTGAGTCAGGCCCTTCTGTT30 for the V1-p53 con-struct; 50GCTAATCTTAAGCACTGCCATGGAGGAGCCGC30 and 50GC-TAATCTCGAGGTCTGAGTCAGGCCCTTCTGTT30 for p53-V1 and -V2constructs; 50GCTAATCTTAAGGTGAGGAGCAGGCAAATGTGC30 and50GCTAATCTCGAGCTAGGGGAAATAAGTTAGCACAATCATTTGAATT-GCTAATCTCGAGCTAGGGGAAATAAGTTAGCACAATCATTTGAATTG-G30 for the V1-Mdm2 construct; and 50GCTAATCTTAAGAT-TCACCATGGTGAGGAGCAGG30 and 50GCTAATCTCGAGGGGGAAA-TAAGTTAGCACAATCATTTGAATTG30 for Mdm2-V1 and -V2 con-structs. PCR fragments were digested, cloned into AflII/XhoI sites ofpCS2 plasmids containing the Venus N-terminal (V1, amino acids 1–158) or C-terminal (V2, amino acids 159–238) sequences, andverified by DNA sequencing. Plasmids containing the V2 half fused tothe NH2-terminus of the interacting proteins were not constructed,and were not considered essential to develop and validate the p53–Mdm2 BiFC assay.

2.2. Cell culture

HCT116 human colorectal carcinoma cells rendered p53-null bysomatic knockout [17] were a kind gift from Dr. Bert Vogelstein(Johns Hopkins University, Baltimore, MD). Cells were grown inMcCoy’s 5A supplemented with 10% fetal bovine serum (Invitrogen,Grand Island, NY, USA), 1% GlutaMAXTM (Invitrogen) and 1%penicillin/streptomycin solution (Sigma–Aldrich, St Louis, MO,USA) and maintained at 37 8C in a humidified atmosphere of 5% CO2.

Please cite this article in press as: Amaral JD, et al. Live-cell imagfluorescence complementation system. Biochem Pharmacol (2013),

2.3. Cell transfections and treatments

Cells were seeded at 1.5 � 104 cells/cm2 for protein isolationand 3 � 104 cells/cm2 for cytometry, fluorescence microscopy andtoxicity assays 16–24 h prior to transfections. Co-transfectionswere performed with the different combinations of plasmids using1 mg of each BiFC pair and Lipofectamine 2000 (Invitrogen). Whenindicated, 500 ng of a puma promoter-driven luciferase (Luc)reporter construct was also used (PUMA Frag1-Luc, Addgene16591, a gift from Dr. Bert Vogelstein). Wild-type p53 over-expression and mdm2 gene silencing were used as positive andnegative controls, respectively. HCT116 p53�/� cells were trans-fected with the pCMV-p53 wt expression plasmid [18]. Genesilencing was performed with a pool of 4 mdm2 short interferenceRNA (siRNA) nucleotides and a control scrambled siRNA (Dhar-macon, Waltham, MA). The final concentration of siRNAs wasalways 100 nM. 4–6 h after transfection, the medium was replacedfor fresh medium. Nutlin-3 (Sigma–Aldrich) was added to a finalconcentration of 10 and 50 mM. Phosphatase inhibitors (Enzo LifeSciences, Inc., Farmingdale, NY, USA) were added at the same time.The concentrations of phosphatase inhibitors were variable,according to the IC50 described in the literature for each inhibitor(Appendix A). Samples were collected or analyzed 24 h aftertransfection. Transfection efficiency was determined by cotrans-fecting pCS2-Venus plasmid in combination with pT2/CAGGS//DsRed2 (a gift from Dr. Clifford Steer). The percentage of double-positive cells was �25% (Fig. 1C).

2.4. Luciferase activity

Firefly and renilla luciferase activities were measured using theDual-Luciferase1 Reporter Assay System (Promega). Renillaluciferase activity and total protein levels were used as normali-zation controls.

2.5. Western blot analysis

Total protein extracts from transfected HCT116 p53�/� cellswere prepared following standard protocols [19]. Protein con-centrations were determined using the Bio-Rad protein assay kit,according to the manufacturer’s specifications. Sixty to 80 mg oftotal protein extracts were separated on 8 and 15% (w/v) sodiumdodecyl sulphate (SDS)-polyacrylamide gel electrophoresis. Afterelectrophoretic transfer onto nitrocellulose membranes, andblocking with a 5% (w/v) non-fat dry milk solution, membraneswere incubated overnight at 4 8C with primary mouse monoclonalantibodies reactive to p53 (DO-1), Mdm2 (SMP 14) and Bcl-2 (C-2),and rabbit polyclonal antibody reactive to PARP-1/2 (H-250) (SantaCruz Biotechnology, Santa Cruz, CA). Finally, a secondary goat anti-mouse IgG antibody conjugated with horseradish peroxidase(BioRad Laboratories, Hercules, CA, USA) was added for 3 h at roomtemperature. The membranes were processed for protein detectionusing the SuperSignal substrate (Pierce Biotechnology, Rockford,IL, USA). b-Actin (AC-15; Sigma–Aldrich) was used as a loadingcontrol. The relative intensities of protein bands were analyzedusing the QuantityOne Version 4.6 densitometric analysis program(Bio-Rad) and normalized to the corresponding loading control.

2.6. Flow cytometry

Cells were washed twice with Ca2+- and Mg2+-free phosphate-buffered saline (PBS) (Invitrogen Corp.), treated with accutase andharvested with culture medium. Cell suspensions were centrifuged,supernatants discarded and cell pellets resuspended and fixed withparaformaldehyde (1% w/v) in PBS for 20 min. Fluorescence wasmeasured using a FACSCalibur (Becton Dickinson, Mountain View,

ing of p53 interactions using a novel Venus-based bimolecularhttp://dx.doi.org/10.1016/j.bcp.2012.12.009

Fig. 1. p53 interactions in cells. (A) Principles of the BiFC assay. The proteins of interest are fused to non-fluorescent fragments of a fluorescent reporter protein. When the

proteins of interest interact, the non-fluorescent halves get close enough to fold together and reconstruct the functional fluorophore. (B) Schematic diagram illustrating the

p53 and Mdm2 BiFC constructs generated in this study. (C) Transfection efficiency as determined by cotransfecting pCS2-Venus plasmid in combination with pT2/CAGGS//

DsRed2. The percentage of double-positive cells was �25%. (D) Complementation results driven by the different combinations of BiFC constructs, 24 h after transfection of

HCT116 p53�/� cells. (+++), strong; (++), medium; (�), residual fluorescent signal. (E) Detection and sub-cellular localization of p53–p53 and p53–Mdm2 complementation

reactions by fluorescence microscopy. Scale bar, 50 mm. (F) Representative flow cytometry profiles of cells co-transfected with all combinations of p53 and Mdm2 BiFC

contructs. Representative images from at least 3 independent experiments.

J.D. Amaral et al. / Biochemical Pharmacology xxx (2013) xxx–xxx 3

G Model

BCP-11493; No. of Pages 8

Please cite this article in press as: Amaral JD, et al. Live-cell imaging of p53 interactions using a novel Venus-based bimolecularfluorescence complementation system. Biochem Pharmacol (2013), http://dx.doi.org/10.1016/j.bcp.2012.12.009

J.D. Amaral et al. / Biochemical Pharmacology xxx (2013) xxx–xxx4

G Model

BCP-11493; No. of Pages 8

CA). Ten thousand events were examined per group and dataanalyzed using FlowJo software (Tree Star, Inc., Ashland, OR).

2.7. Cell imaging

Cells were plated on poly-D-lysine-coated glass-bottom 35 mmdishes (MatTek Cultureware, Ashland, MA, USA), and transfectedthe following day with the corresponding BiFC pair. 24 h aftertransfection, cells were fixed with 4% paraformaldehyde in PBS, for10 min. Cells were imaged on a Zeiss Axiovert 200 M fluorescencemicroscope.

2.8. Toxicity assay

Toxicity was analyzed 24 h after transfection by measuring therelease of lactate dehydrogenase (LDH) from damaged cells intothe culture medium using the LDH Cytotoxicity Detection Kit(Roche Diagnostics, Indianopolis, Indiana, USA) according to themanufacturer’s protocol.

3. Results

3.1. BiFC assay development for the visualization of p53–p53 and

p53–Mdm2 interactions

We developed a fluorescent protein-fragment complementa-tion assay in order to visualize and study p53–p53 and p53–Mdm2interactions in living cells. The Venus fluorescent protein waschosen because of its high fluorescence intensity and fast andefficient maturation properties at 37 8C [20]. Several fusionconstructs were made, containing p53 or Mdm2 fused to non-fluorescent Venus fragments, which we named V1 (amino acids 1–158) and V2 (amino acids 159–238) (Fig. 1B). HCT116 p53�/�

human colorectal carcinoma cells were transfected with differentcombinations of BiFC constructs, where Venus fragments werefused to the N- or C-termini of p53 and Mdm2. The reconstitutionof Venus fluorescence was analyzed by fluorescence microscopyand flow cytometry (Fig. 1D–F). We used cells lacking p53 to avoidthe interference of endogenous p53 in the system. As expected,none of the constructs exhibited detectable fluorescence whenexpressed alone (data not shown).

Protein complementation was �5-fold stronger in p53–p53combinations comparing to p53–Mdm2 pairs (Fig. 1D–F), andmicroscopy analysis showed a marked nuclear localization (Fig. 1E).This may be explained by the homotetrameric nature of the p53transcription complex and strong nuclear localization signal thatfacilitates the immediate relocation of p53 to the nucleus [21,22].Interestingly, cytoplasmic inclusions can also be observed in cellsexpressing both p53 pairs of BiFC constructs. p53 was recentlyshown to undergo amyloid-like aggregation leading to nucleatedassemblies that can abrogate function of wild-type p53 [15,16]. Theirreversible nature of the split–Venus interaction also allowstrapping of otherwise transient interactions [23]. This interestingfeature of the p53–p53 BiFC system may enable the enrichment inthe pool of p53 aggregates in living cells, and the identification ofnew anticancer agents that prevent p53 aggregation.

p53–Mdm2 combinations had weaker fluorescence than p53–p53 combinations and showed both nuclear and cytoplasmicdistribution, often with cytoplasmic inclusions (Fig. 1D–F). Weinterpret these inclusions as the consequence of p53 sequestrationin the cytosol by Mdm2 [8]. Since both p53–Mdm2 combinationshad similar profiles, we used the V1-p53/Mdm2-V2 combinationfor all the experiments described below, unless otherwiseindicated. Combinations containing a construct where V1 wasfused to the C-terminus of the interacting proteins, p53-V1 andMdm2-V1, barely showed fluorescence (Fig. 1D–F). As expected, no

Please cite this article in press as: Amaral JD, et al. Live-cell imagfluorescence complementation system. Biochem Pharmacol (2013),

complementation occurred in cells expressing Mdm2 BiFC pairs,indicating that Mdm2 is not prone to dimerize or aggregate.

3.2. Nutlin-3 decreases p53 and Mdm2 BiFC

Nutlins are a class of cis-imidazoline analogs that function asinhibitors of Mdm2, therefore activating the p53 pathway [24].Nutlin-3 specifically binds to the p53-binding pocket of Mdm2 anddisplaces p53 from the complex, resulting in a dramatic stabiliza-tion of p53 and activation of the p53 pathway. The efficiency ofnutlin-3 as a disruptor of Mdm2 interaction with p53 turns it intoan excellent tool compound to control the specificity of our BiFCapproach. As expected, HCT116 p53�/� cells expressing the V1-p53/Mdm2-V2 BiFC pair and exposed to nutlin-3 (10 and 50 mM)showed a significant, dose-dependent decrease of �30% in Venusfluorescence reconstitution as assessed by flow cytometry(p < 0.01) (Fig. 2A). In addition, we used a novel compound thatis part of a small library of newly synthesized spiro-oxindolederivatives [25], currently under investigation, obtaining similarresults (unpublished data). Fluorescence microscopy analysis alsoclearly showed a marked reduction in the fluorescent signal(Fig. 2B), including the disappearance of the cytoplasmic p53–Mdm2 aggregates.

In parallel, we validated the expression of the fusion proteins byWestern blot. As depicted in Fig. 2C, transfection of cells with theMdm2-V2 plasmid resulted in increased levels of Mdm2 (lane 5)compared to the endogenous levels detected in control cells (lane7). We used siRNA-mediated silencing of endogenous Mdm2 as anegative control (lane 6). In turn, transfection of wild-type p53 inHCT116 lacking p53 resulted in p53 expression and was used as apositive control. Transfection with the constructs resulted incorrect expression of the fusion proteins. As expected, themolecular weight of V1-p53 is higher than endogenous p53 dueto the fusion of V1. In the case of Mdm2, we could not detect asignificant change in the molecular weight of Mdm2-V2 comparingto endogenous Mdm2. This may be related to the smaller size of V2that corresponds to a fragment of 252 bp, in comparison with V1 of510 bp, and also to the percentage of the gel that may beinadequate to resolve the difference in molecular weight.Nevertheless, our results reflect the different expression levelsof endogenous Mdm2 and overexpressed Mdm2-V2. In addition,treatment with nutlin-3 did not affect the expression levels ofeither p53 or Mdm2 (Fig. 2C; lane 4). This confirms that nutlin-3-mediated decrease in Venus complementation is a specific effect ofthe compound on p53–Mdm2 interaction and not an artifactresulting from the inhibition of protein expression.

3.3. Inhibition of p53 and Mdm2 BiFC by nutlin-3 correlates with

increased cell death

Stabilized p53 accumulates in the nucleus to regulate theexpression of numerous pro-apoptotic genes, such as bax, noxa,and puma, among others [26–28]. However, in many cell types,including the HCT116 cells, p53 activation preferentially inducespuma expression compared to bax or p21 [29,30]. We investigatedpuma transactivation by co-transfecting HCT116 p53�/� cells withthe V1-p53/Mdm2-V2 BiFC pair of plasmids and a constructcontaining luciferase under the control of the puma gene promoter.24 h after transfection, cells expressing V1-p53 and Mdm2-V2showed a slight but significant increase of puma transactivation ascompared to control (p < 0.05) (Fig. 3A), probably due to theresidual presence of p53 not-complexed with Mdm2. Thetreatment with nutlin-3 caused a marked �50% increase of puma

transcription (p < 0.05), consistent with nutlin-mediated releaseof p53 from the grip of Mdm2. Finally, poly(ADP-ribose)polymerase (PARP) cleavage was assessed by Western blot, and

ing of p53 interactions using a novel Venus-based bimolecularhttp://dx.doi.org/10.1016/j.bcp.2012.12.009

Fig. 2. Nutlin-3 decreases p53–Mdm2 interaction by BiFC. HCT116 p53�/� cells were

co-transfected with the V1-p53/Mdm2-V2 BiFC combination for 24 h. Vehicle or

nutlin-3 (10 or 50 mM) was included in the culture medium 4 h after transfection.

(A) Representative flow cytometry profiles of the nutlin-3-mediated reduction of

V1-p53/Mdm2-V2 complementation (left) and respective quantification data

(right). (B) Detection and sub-cellular localization of V1-p53/Mdm2-V2 dimers

by fluorescence microscopy. Scale bar, 50 mm. (C) Representative immunoblots of

Mdm2 and p53 total protein levels. Blots were normalized to endogenous b-actin.

Data represent mean � SEM of at least three independent experiments. *p < 0.01 from

control.

Fig. 3. Inhibition of p53–Mdm2 interaction by nutlin-3 is associated with increased

cell death. Cells were transfected with a construct containing luciferase under the

control of the puma gene promoter alone, or in combination with V1-p53/Mdm2-V2

BiFC constructs, for 24 h. Vehicle or 50 mM nutlin-3 were included in the culture

medium 4 h after transfection. (A) puma promoter activity. Cells were harvested for

the luciferase assays as described in ‘‘Section 2’’. Renilla luciferase activity and total

protein levels were used as normalization controls. yp < 0.05 from control Puma-

Luc transfected cells and §p < 0.05 from corresponding control without nutlin-3. (B)

Representative immunoblots (top) of PARP and Bcl-2 total protein levels and

corresponding densitometry analysis (bottom). (C) LDH cytotoxicity assay. The

results are expressed as mean � SEM arbitrary units for at least three different

experiments. *p < 0.01 and §p < 0.05 from corresponding control without nutlin-3.

flPARP, full length PARP; cPARP, cleaved PARP.

J.D. Amaral et al. / Biochemical Pharmacology xxx (2013) xxx–xxx 5

G Model

BCP-11493; No. of Pages 8

general cell death by LDH activity. Importantly, puma transcrip-tional activation induced by nutlin-3 was correlated with a 2-foldincrease in PARP cleavage (p < 0.05), while expression of the anti-apoptotic protein Bcl-2 was 50% reduced (p < 0.01) (Fig. 3B).Significant increments in LDH release were also noticeable(p < 0.05) (Fig. 3C). These results confirm the specificity of ourBiFC system, and are consistent with previous reports describingthe mechanism of action of nutlin-3 [31].

3.4. Chemical library screening for phosphatase inhibitors

We used this newly developed BiFC system to identify putativemodulators of p53–Mdm2 interaction among a commerciallyavailable chemical library of 33 protein phosphatase inhibitors.Cells transfected with the V1-p53/Mdm2-V2 BiFC pair were

Please cite this article in press as: Amaral JD, et al. Live-cell imagfluorescence complementation system. Biochem Pharmacol (2013),

incubated with the compounds and the recovery of Venusfluorescence was measured by flow cytometry. Interestingly, ingeneral, p53–Mdm2 complex formation was reduced by a group ofcalcineurin inhibitors (Fig. 4A). Two compounds, fenvarelate(5 mM) and gossypol (10 mM), reduced significantly p53–Mdm2complex formation (p < 0.05 and p < 0.01, respectively), althoughnot as effectively as nutlin-3 (50 mM) (Fig. 4B). Other calcineurininhibitors, such as tyrphostin 8 (10 mM) and cyclosporin A (1 mM)showed the same tendency without reaching statistical signifi-cance at the concentrations tested. When analyzing the impact ofcalcineurin inhibitors on cell death, gossypol significantly in-creased LDH release at the concentrations tested (p < 0.05)(Fig. 4C). The other phosphatase inhibitors induced no significantdifferences on p53–Mdm2 complex formation or cell death (datanot shown).

4. Discussion

p53 is commonly referred to as a ‘‘guardian of the genome’’ as itis the principal defense against tumor-associated DNA damage.Half of all known tumors harbor inactive mutated p53 [4]. In the

ing of p53 interactions using a novel Venus-based bimolecularhttp://dx.doi.org/10.1016/j.bcp.2012.12.009

Fig. 4. Screening for protein phosphatase inhibitors. Cells were transfected with the V1-p53/Mdm2-V2 BiFC constructs for 24 h. Vehicle or 33 compounds from a chemical

library for phosphatase inhibitors were included in the culture medium 4 h after transfection. Nutlin-3 (50 mM) was used as control. (A) Quantification of V1-p53/Mdm2-V2

complementation by flow cytometry. (B) Representative flow cytometry profiles showing the effect of nutlin-3 and calcineurin inhibitors in V1-p53/Mdm2-V2

complementation. (C) LDH activity in cells incubated with nutlin-3 and calcineurin inhibitors. Data represent mean � SEM of at least three independent experiments. *p < 0.01

and §p < 0.05 from control. SSC, Side scatter. PP1/PP2A/PP2 C, Protein phosphatase 1/2A/2C; Tyr Phos, Tyrosine phosphatases; Alk Phos, Alkaline phosphatases; PTP1B, Protein

tyrosine phosphatase 1B; Cdc25, Cell division cycle phosphatase 25; PRL1/PRL3, Phosphatase of regenerating liver 1/3; PTPMT1, Protein tyrosine phosphatase mitochondrial 1; JSP1,

JNK stimulatory phosphatase 1.

J.D. Amaral et al. / Biochemical Pharmacology xxx (2013) xxx–xxx6

G Model

BCP-11493; No. of Pages 8

Please cite this article in press as: Amaral JD, et al. Live-cell imaging of p53 interactions using a novel Venus-based bimolecularfluorescence complementation system. Biochem Pharmacol (2013), http://dx.doi.org/10.1016/j.bcp.2012.12.009

J.D. Amaral et al. / Biochemical Pharmacology xxx (2013) xxx–xxx 7

G Model

BCP-11493; No. of Pages 8

other half, p53 itself is not mutated but the pathway is partiallyabrogated. Therefore, although the manipulation of protein–protein interactions is a yet relatively unexplored area oftherapeutics, reactivation of the tumor suppressive properties ofp53 through inhibition of Mdm2 interaction is a key therapeuticgoal [32]. The most thoroughly studied inhibitor of p53–Mdm2interaction is nutlin-3. In response to nutlin-3 treatment, cancercells harboring wild-type p53 undergo either cell cycle arrest orapoptosis [30,33,34], and mice tumor xenografts are significantlyreduced [35].

Several imaging-based systems have been developed in the lastfew years to visualize interactions of protein complexes in cells,namely p53–Mdm2 interaction [36]. The vast majority relies onresonance energy transfer (RET) assays, including fluorescence(FRET), luminescence (LRET) and bioluminescence (BRET) [37–39].In this study, we developed a cellular model to visualize andquantify small-molecule-induced disruption of p53–Mdm2 inter-actions in living cells, based on a BiFC assay. This assay involves thefusion of two non-fluorescent fragments of a reporter protein tothe proteins of interest. In the case of interaction, the reporterfragments come together, fold into an almost-native conformationand thereby reconstitute the functional fluorophore as observed inseveral BiFC models previously developed by us [40]. RET and BiFCare fundamentally different approaches and have complementaryadvantages and disadvantages. BiFC enables the detection ofinteractions at lower protein concentrations and is predicted lessaffected by changes in cellular conditions that can alter fluores-cence intensity and lifetime of fluorescent proteins. In addition, theproteins are expressed in a relevant biological context, whichincreases the likelihood that the results reflect the properties ofnative proteins more accurately, including potential effects ofpost-translational modifications. These are all fundamental issuesin the case of p53, and should be taken in consideration. Finally, theBiFC assay is particularly valuable for determining the subcellularlocation of protein–protein interactions, which may be paramountto clarify the biological function of p53–Mdm2 complex in aspecific cellular context. BiFC has been used successfully in variousmodel organisms, including mammalian cell lines, plants, nema-todes, yeast and bacteria [36]. Moreover, this technique can also beused as a platform for genetic or chemical screens [41].

We have generated expression plasmids containing wild-typep53 and Mdm2 coding sequences fused to non-fluorescent halvesof the fluorescent protein Venus and transfected them in HCT116human colorectal cancer cells lacking p53. Reconstitution of Venusfluorescence was assessed by flow cytometry and fluorescencemicroscopy analysis. We carefully compared the results obtainedfor all BiFC pair and selected V1-p53/Mdm2-V2 as the bestcombination to study p53 interaction with Mdm2. Importantly, thewell-described nutlin-3 molecule validated our assay. We ob-served that increasing concentrations of nutlin-3 suppressed thebinding of p53 to Mdm2 in a dose-dependent manner. Moreover,the reduction of BiFC mediated by nutlin-3 was correlated with anincrease in Puma transactivation, PARP cleavage and cell death.Finally, the capacity of nutlin-3 to inhibit p53-Mdm2 interaction,but not p53 oligomerization, further evidences the specificity ofthis approach.

Increasing evidence supports a role for p53 aggregation incancer [15]. It was already known that many p53 missensemutations result in structural mutants with dominant-negativeactivity and oncogenic gain of function. However, how thosestructural defects led to a tumorigenic gain of function remainedunclear. Recent findings demonstrated that conversion of p53 froma tumor suppressor to an oncogene by structurally destabilizingp53 mutations resulted from the increased propensity of thesemutants to aggregate [15]. In addition, mutant p53 induces co-aggregation of wild-type p53, p63 and p73, rendering these native

Please cite this article in press as: Amaral JD, et al. Live-cell imagfluorescence complementation system. Biochem Pharmacol (2013),

proteins inactive. This mechanism of p53 aggregation resemblesthe pathological processes observed during neurodegeneration[42]. However, in contrast to neurodegenerative diseases, thecellular effects of p53 aggregation in cancer are associated with cellsurvival and proliferation rather than cell death. Surprisingly, wewere able to detect nuclear p53–p53 BiFC interaction in our model.Wild-type p53 also forms aggregates, although in a less extent thanp53 structural mutants [16]. p53 oligomerization is a research areastill poorly explored and worth to pursue. The potential use of thiscell-based assay for small to medium size screening of drugstargeting not only p53–Mdm2, but also other facets of p53inactivation, including p53 oligomer formation, highlights therelevance of the method.

Finally, we screened a commercially available chemical libraryof 33 protein phosphatase inhibitors as an example of theapplicability of this novel assay, and identified two compounds,fenvarelate and gossypol, that significantly reduced p53–Mdm2complex formation in our model system. Curiously, they are bothinhibitors of calcineurin that was recently implicated in a signalingpathway of cancer development [43,44]. Calcineurin dephosphor-ylates and activates human nuclear factor of activated T cells(NFAT) 1 transcription factor, which in turn binds to the mdm2 P2promoter resulting in upregulation of mdm2 transcription [45].Interestingly, our results suggest that fenvarelate and gossypol alsointerfere with Mdm2 at the post-transcriptional level. The Mdm2BiFC plasmid contains only the coding sequence of the gene,therefore lacking the promoter region where eventually NFAT1binds to exert its function. As a consequence, the BiFC assay onlytakes into account the interaction between p53 and Mdm2 fusionproteins that should not be subjected to NFAT1 regulation.Regarding the impact of calcineurin inhibitors on cell death, onlygossypol increased significantly LDH release. This is in agreementwith other studies showing that gossypol induce apoptosis andinhibit mice xenograft tumor growth by activating p53 [46].

Over the past years, the concept of selective chemotherapy hasdominated the field of drug discovery and development. The majorgoal turned into identifying new compounds that are selective for atarget within a biochemical pathway that underlies a physiologicalor pathological process of interest. In this regard, targeting thep53–Mdm2 protein interaction with small molecules to reactivatep53 function has evolved as a relevant therapeutic strategy for thetreatment of human cancer retaining wild-type p53. Indeed, anumber of these small molecule inhibitors, such as the spiro-oxindole MI-219 and the cis-imidazoline nutlin-3a, have pro-gressed to advanced preclinical development or early-phaseclinical trials as potent and specific inhibitors of the p53-Mdm2interaction. Moreover, the clinical relevance of Mdm2 inhibitorsalso relies on their potential to act as chemoprotective agents byinducing cell cycle arrest in cancer and normal cells, and cell deathselectively in cancer cells [24,47]. This ability of Mdm2 inhibitorsto halt cell cycle progression can be further exploited to protectnormal cells from the toxic effects of chemotherapy.

In conclusion, we developed and optimized a novel assay thatallows the direct visualization and quantification of p53–p53 andp53–Mdm2 protein–protein interactions in living cells. The broadapplications that may emerge from targeting the p53 pathway inthe treatment of the modern world’s most common non-infectiousdiseases, highlights the relevance of the present study in the searchfor new p53-activating drug candidates.

Acknowledgements

We are deeply thankful to Dr. Bert Vogelstein (Johns HopkinsUniversity, Baltimore, MD) for generously providing HCT116 p53�/�

cells. We also thank Dr. Guido Kroemer (INSERM, U848, Villejuif,France), Dr. Karen Vousden (The Beatson Institute for Cancer

ing of p53 interactions using a novel Venus-based bimolecularhttp://dx.doi.org/10.1016/j.bcp.2012.12.009

J.D. Amaral et al. / Biochemical Pharmacology xxx (2013) xxx–xxx8

G Model

BCP-11493; No. of Pages 8

Research, Glasgow, United Kingdom), and Dr. Clifford Steer(University of Minnesota Medical School, Minneapolis, USA) forproviding p53, Mdm2, and pT2/CAGGS//DsRed2 expression plas-mids, respectively.

This work was supported by grants PTDC/SAU-GMG/099162/2008, PTDC/SAU-ORG/119842/2010 and Pest-OE/SAU/UI4013/2011, and fellowship SFRH/BPD/47376/2008 (JDA) from Fundacaopara a Ciencia e Tecnologia, Portugal.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at http://dx.doi.org/10.1016/j.bcp.2012.12.009.

References

[1] Vogelstein B, Lane D, Levine AJ. Surfing the p53 network. Nature2000;408:307–10.

[2] Levine AJ. p53, the cellular gatekeeper for growth and division. Cell1997;88:323–31.

[3] Vousden KH, Lane DP. p53 in health and disease. Nat Rev Mol Cell Biol2007;8:275–83.

[4] Maslon MM, Hupp TR. Drug discovery and mutant p53. Trends Cell Biol2010;20:542–55.

[5] Freedman DA, Wu L, Levine AJ. Functions of the MDM2 oncoprotein. Cell MolLife Sci 1999;55:96–107.

[6] Momand J, Zambetti GP, Olson DC, George D, Levine AJ. The mdm-2 oncogeneproduct forms a complex with the p53 protein and inhibits p53-mediatedtransactivation. Cell 1992;69:1237–45.

[7] Fang S, Jensen JP, Ludwig RL, Vousden KH, Weissman AM. Mdm2 is a RINGfinger-dependent ubiquitin protein ligase for itself and p53. J Biol Chem2000;275:8945–51.

[8] Geyer RK, Yu ZK, Maki CG. The MDM2 RING-finger domain is required topromote p53 nuclear export. Nat Cell Biol 2000;2:569–73.

[9] Chene P. Inhibition of the p53–MDM2 interaction: targeting a protein–proteininterface. Mol Cancer Res 2004;2:20–8.

[10] Weber L. Patented inhibitors of p53–Mdm2 interaction (2006–2008). ExpertOpin Ther Pat 2010;20:179–91.

[11] Phan J, Li Z, Kasprzak A, Li B, Sebti S, Guida W, et al. Structure-based design ofhigh affinity peptides inhibiting the interaction of p53 with MDM2 andMDMX. J Biol Chem 2010;285:2174–83.

[12] Secchiero P, Bosco R, Celeghini C, Zauli G. Recent advances in the therapeuticperspectives of Nutlin-3. Curr Pharm Des 2011;17:569–77.

[13] Popowicz GM, Domling A, Holak TA. The structure-based design of Mdm2/Mdmx-p53 inhibitors gets serious. Angew Chem Int Ed Engl 2011;50:2680–8.

[14] First Clinical Trial Looks At RG7112 As A Way To Disable MDM2 In Leukemia.Medical News Today. MediLexicon, Intl., 9 Dec. 2010. Web. 29 Dec. 2012 in<http://www.medicalnewstoday.com/releases/210729.php>.

[15] Xu J, Reumers J, Couceiro JR, De Smet F, Gallardo R, Rudyak S, et al. Gain offunction of mutant p53 by coaggregation with multiple tumor suppressors.Nat Chem Biol 2011;7:285–95.

[16] Ano Bom AP, Rangel LP, Costa DC, de Oliveira GA, Sanches D, Braga CA, et al.Mutant p53 aggregates into prion-like amyloid oligomers and fibrils: implica-tions for cancer. J Biol Chem 2012;287:28152–62.

[17] Bunz F, Dutriaux A, Lengauer C, Waldman T, Zhou S, Brown JP, et al. Require-ment for p53 and p21 to sustain G2 arrest after DNA damage. Science1998;282:1497–501.

[18] Unger T, Nau MM, Segal S, Minna JD. p53: a transdominant regulator oftranscription whose function is ablated by mutations occurring in humancancer. EMBO J 1992;11:1383–90.

[19] Sola S, Castro RE, Kren BT, Steer CJ, Rodrigues CM. Modulation of nuclearsteroid receptors by ursodeoxycholic acid inhibits TGF-beta1-induced E2F-1/p53-mediated apoptosis of rat hepatocytes. Biochemistry 2004;43:8429–38.

[20] Nagai T, Ibata K, Park ES, Kubota M, Mikoshiba K, Miyawaki A. A variant ofyellow fluorescent protein with fast and efficient maturation for cell-biologicalapplications. Nat Biotechnol 2002;20:87–90.

Please cite this article in press as: Amaral JD, et al. Live-cell imagfluorescence complementation system. Biochem Pharmacol (2013),

[21] Tidow H, Melero R, Mylonas E, Freund SM, Grossmann JG, Carazo JM, et al.Quaternary structures of tumor suppressor p53 and a specific p53 DNAcomplex. Proc Natl Acad Sci USA 2007;104:12324–29.

[22] Li Q, Falsey RR, Gaitonde S, Sotello V, Kislin K, Martinez JD. Genetic analysis ofp53 nuclear importation. Oncogene 2007;26:7885–93.

[23] Magliery TJ, Wilson CG, Pan W, Mishler D, Ghosh I, Hamilton AD, et al.Detecting protein–protein interactions with a green fluorescent proteinfragment reassembly trap: scope and mechanism. J Am Chem Soc 2005;127:146–57.

[24] Vassilev LT, Vu BT, Graves B, Carvajal D, Podlaski F, Filipovic Z, et al. In vivoactivation of the p53 pathway by small-molecule antagonists of MDM2.Science 2004;303:844–8.

[25] Ribeiro CJA, Kumar SP, Moreira R, Santos MM. Efficient synthesis of spiroisox-azoline oxindoles. Tetrahedron Lett 2012;53:281–4.

[26] Miyashita T, Reed JC. Tumor suppressor p53 is a direct transcriptional activatorof the human bax gene. Cell 1995;80:293–9.

[27] Oda E, Ohki R, Murasawa H, Nemoto J, Shibue T, Yamashita T, et al. Noxa, aBH3-only member of the Bcl-2 family and candidate mediator of p53-inducedapoptosis. Science 2000;288:1053–8.

[28] Nakano K, Vousden KH. PUMA. a novel proapoptotic gene, is induced by p53.Mol Cell 2001;7:683–94.

[29] Kaeser MD, Iggo RD. Chromatin immunoprecipitation analysis fails to supportthe latency model for regulation of p53 DNA binding activity in vivo. Proc NatlAcad Sci USA 2002;99:95–100.

[30] Yu J, Wang Z, Kinzler KW, Vogelstein B, Zhang L. PUMA mediates the apoptoticresponse to p53 in colorectal cancer cells. Proc Natl Acad Sci USA2003;100:1931–6.

[31] Zhang Q, Lu H. Nutlin’s two roads toward apoptosis. Cancer Biol Ther2010;10:579–81.

[32] Amaral JD, Castro RE, Steer CJ, Rodrigues CM. p53 and the regulation ofhepatocyte apoptosis: implications for disease pathogenesis. Trends MolMed 2009;15:531–41.

[33] Du W, Wu J, Walsh EM, Zhang Y, Chen CY, Xiao ZX. Nutlin-3 affects expressionand function of retinoblastoma protein: role of retinoblastoma protein incellular response to nutlin-3. J Biol Chem 2009;284:26315–21.

[34] Tovar C, Rosinski J, Filipovic Z, Higgins B, Kolinsky K, Hilton H, et al. Small-molecule MDM2 antagonists reveal aberrant p53 signaling in cancer: implica-tions for therapy. Proc Natl Acad Sci USA 2006;103:1888–93.

[35] Kunkele A, De Preter K, Heukamp L, Thor T, Pajtler KW, Hartmann W, et al.Pharmacological activation of the p53 pathway by nutlin-3 exerts anti-tu-moral effects in medulloblastomas. Neuro Oncol 2012;14:859–69.

[36] Michnick SW, Ear PH, Manderson EN, Remy I, Stefan E. Universal strategies inresearch and drug discovery based on protein-fragment complementationassays. Nat Rev Drug Discov 2007;6:569–82.

[37] Kerppola TK. Visualization of molecular interactions by fluorescence comple-mentation. Nat Rev Mol Cell Biol 2006;7:449–56.

[38] Mazars A, Fahraeus R. Using BRET to study chemical compound-induceddisruptions of the p53–HDM2 interactions in live cells. Biotechnol J2010;5:377–84.

[39] Colas P. High-throughput screening assays to discover small-molecule inhi-bitors of protein interactions. Curr Drug Discov Technol 2008;5:190–9.

[40] Herrera F, Goncalves S, Outeiro TF. Imaging protein oligomerization in neu-rodegeneration using bimolecular fluorescence complementation. MethodsEnzymol 2012;506:157–74.

[41] Gehl C, Waadt R, Kudla J, Mendel RR, Hansch R. New GATEWAY vectors for highthroughput analyses of protein–protein interactions by bimolecular fluores-cence complementation. Mol Plant 2009;2:1051–8.

[42] Goncalves SA, Matos JE, Outeiro TF. Zooming into protein oligomerization inneurodegeneration using BiFC. Trends Biochem Sci 2010;35:643–51.

[43] Muller MR, Rao A. NFAT, immunity and cancer: a transcription factor comes ofage. Nat Rev Immunol 2010;10:645–56.

[44] Mancini M, Toker A. NFAT proteins: emerging roles in cancer progression. NatRev Cancer 2009;9:810–20.

[45] Zhang X, Zhang Z, Cheng J, Li M, Wang W, Xu W, et al. Transcription factorNFAT1 activates the mdm2 oncogene independent of p53. J Biol Chem2012;287:30468–76.

[46] Volate SR, Kawasaki BT, Hurt EM, Milner JA, Kim YS, White J, et al. Gossypolinduces apoptosis by activating p53 in prostate cancer cells and prostatetumor-initiating cells. Mol Cancer Ther 2010;9:461–70.

[47] Shangary S, Qin D, McEachern D, Liu M, Miller RS, Qiu S, et al. Temporalactivation of p53 by a specific MDM2 inhibitor is selectively toxic to tumorsand leads to complete tumor growth inhibition. Proc Natl Acad Sci USA2008;105:3933–8.

ing of p53 interactions using a novel Venus-based bimolecularhttp://dx.doi.org/10.1016/j.bcp.2012.12.009