Bio-informatics tools

8/14/2019 Bio-informatics tools

1/23

Genome & Protein Sequence Analysis Programsapplication in establishing Epidemiology and

Variability

RAJESH KUMARRAJESH KUMARPh.D 1Ph.D 1stst yryrDairy Microbiology DivisionDairy Microbiology Division

N.D.R.IN.D.R.I


2/23


3/23

Major Research efforts of Bio-informatics:-

Sequence analysis / alignment.

gene finding.

genome assembly.

protein structure alignment.

protein structure prediction.

prediction of gene expression and protein-protein interactions.

modeling of evolution.


4/23

Sequence Analysis

Encompasses the use of various bioinformatic methods todetermine the biological function and structure of genesand the proteins.

DNA sequences Decoded Stored in electronic databases

Analysis

Comparative GenomicsPhylogenetic Tree


5/23

Shotgun Sequencing

Used in genetics for sequencing long DNA strands.

DNA small segments sequenced

Computer programs

Sequence Alignment:-arrangement of two or more sequences & highlighting

their similarity.tcctctgcctctgccatcat---caaccccaaagt

|||| ||| ||||| ||||| ||||||||||||tcctgtgcatctgcaatcatgggcaaccccaaagt


6/23

Structural Alignment

More reliable over long evolutionary distances.

Useful in identifying structurally-conserved regions.

Multiple Alignment

extension of pairwise alignment to incorporate more thantwo sequences into an alignment.

help in the identification of common regions between the

sequences.ProgramsClustal is used in cladistics to build phylogenetic trees


7/23

Framesearch

It is extension of Smith-Waterman, for pairwisealignment between a protein sequence and a nucleotidesequence.

It dynamically considers every possible single-nucleotideinsertion or deletion to generate the translation that

best matches the protein sequence.

Software:-

Ssearch

Smith-Waterman remains thegold standardfor protein-rotein or nucleotide-nucleotide airwise ali nment.


8/23

BLAST

An algorithm for comparing biological sequences.

Widely used tools for searching protein and DNAdatabases for sequence similarities.

It gives answers of following questions:-

Which bacterial species have a protein that is related in lineageto a certain protein whose amino-acid sequence I know?

Where does the DNA that I've just sequenced come from?. What other genes encode proteins that exhibit structures ormotifs such as the one I've just determined?


9/23

To run, BLAST requires two sequences as input:

a query sequence or target sequence

a sequence database.

Search for high scoring sequence alignments.

Three stages of BLAST:-

1st stage, BLAST searches for exact matches of a small fixedlength W between the query and sequences in the database.

2nd stage, BLAST tries to extend the match in both directions,

starting at the seed.

If a high-scoring ungapped alignment is found, the databasesequence is passed on to 3rd stage .


10/23

In 3rd stage BLAST performs a gapped alignmentbetween the query sequence and the database sequence

Alternative to BLAST is BLAT (Blast Like Alignment Tool).

FASTA:-

Slower but more sensitive than BLAST.

DNA and Protein sequence alignment software package.

The original FASTP program was designed for protein

sequence similarity searching.FASTA provided a more sophisticated shuffling programfor evaluating statistical significance.


11/23

Programs in this package:-

"FAST-Aye", and stands for "FAST-All.

"FAST-P" (protein) alignment."FAST-N" (nucleotide) alignment.

Current FASTA package contains programs for:-

protein:proteinDNA:DNA.Protein:translated DNAOrdered or unordered peptide searches.

Recent versions of the FASTA package include specialtranslated search algorithms that correctly handleframeshift errors when comparing nucleotide to proteinsequence data.


12/23

Clustal

Clustal is a widely used multiple alignment computerprogram.

i) ClustalW ii) ClustalX

Sequence Analysis Programmes:-

EMBOSS

European Molecular Biology Open Software Suite (EMBOSS) is aprogram suite for nucleic acid and protein sequence analysis.

EMBOSS programs manipulate, analyze, and display nucleic acid andprotein sequences.

Similar in functionality to the commercial GCG Wisconsin Software.


13/23

PhyloGibbs

Designed to identify where these regulatory molecules bind toDNA.

PhyloGibbs compares DNA from multiple species in order toidentify areas in which the genetic code is statistically similarand filter segments that are most likely to be of interest toscientists.

AutoEditor : Automated correction of sequencing and

basecaller errors

a tool for correcting sequencing and basecaller errors usingsequence alignment and chromatogram data.

On average AutoEditor corrects 80% of erroneous base calls.

It also greatly improves our ability to discover SNPs between

closely related strains and isolates of the same species.


14/23

MUMmerSystem for aligning whole genome sequences. Using an efficientdata structure called a suffix tree, the system is able rapidly toalign sequences containing millions of nucleotides.

MUMmer 3.0

Open source.

Improved efficiency.

Ability to find non-unique, repetitive matches as well as uniquematches.

New graphical output modules.

Applications:-

MUMmer 1.0 was used to detect numerous large-scale inversionsin bacterial genomes.


15/23

MUMmer 2.1 was used to align all humanchromosomes to one another and to detect numerouslarge-scale.

PROmer was used to compare the human and mousemalaria parasites P.falcipariumand P.yoelii.

Current use of MUMmer 3.0:-

8) Identifying SNPs and other mutations in a largecollection of Bacillus anthracis strains.

2) Comparing different assemblies of the same genomeat different stages of sequencing and finishing.


16/23

PSORT WWW ServerPSORTis a computer program for the prediction of protein localization

sites in cells.

WoLF PSORTWoLF PSORT PredictionPSORT II (Recommended for animal/yeast sequences)

PSORT II Users' ManualPSORT II PredictionPSORT (Old version; for bacterial/plant sequences)PSORT-B (Recommended for Gram-negative bacteria)PSORT-B PredictionPSORT-B, a program applicable to the sequences of Gram-negativebacteria.

E.coliK12 vs. E.coliO157:H7S.cerevisiae vs. S.pombeA.fumigatus vs. A.nidulansP.falciparum vs.P.yoelii


17/23

PSORT Prediction

Source of Input Sequence:

Gram-positive bacteriumGram-negative bacterium

yeast

animal

plant

Sequence ID (Default is MYSEQ):

Enter your Amino Acid sequence below (by copy & paste):

Characters except the standard 20 codes will be removed off

To submit the query, press this button: Submit


18/23

PHIRE

This Visual Basic program performs an algorithmic string-based searchon bacteriophage genome sequences.

Discovering and extracting blocks displaying sequence similarity,without any prior experimental or predictive knowledge.

MB Advanced DNA Analysis

MB is relatively small and easy to use program.

Main features of MB are:

restriction analysisamino acids analysismultiple sequence alignment tooldot plotcalculation of molecular weights and chemical properties of proteinsprediction of 3D structures for small amino acids sequences.


19/23

UniPro DPviewThis is a tool for finding and analyzing matches betweengenomes.

SEQtoolsProgram package for routine handling and analysis of DNAand protein sequences.

The package includes general facilities for sequence andcontig editing, restriction enzyme mapping, translation, andrepeat identification.

DNA ClubDNA analysis software,Features:- remove vector sequence, find ORF, sequenceediting, translate to protein sequence, protein sequenceediting, RE Map, RE Map with translation, PCR primer

selection, primer or probe evaluation.

ZCURVE


20/23

ZCURVENew highly accurate system for recognizing protein codinggenes in bacterial and archaeal genomes based on the Zcurve theory of DNA sequence.

DNA for Windowsis a compact, easy to use DNA analysis program, ideal forsmall-scale sequencing projects.

Webcutteris a free on-line tool to help restriction map nucleotidesequences.Features:-a simple, customizable interface worldwide platform-independent accessibility via the web seamless interfaces to NCBI's GenBank DNA sequence database

restriction enzyme database.


21/23

Multilocus sequence typing (MLST)

Compares sequence variation in numerous housekeeping

gene targets.Developed for Neisseria gonorrhoeae, Streptococcuspneumoniae, andS. aureus.

Based on the classic multilocus enzyme electrophoresis(MLEE) method used to study the genetic variability of aspecies.

Drawbacks:-labor-intensive, time-consuming, and costly.


22/23

Single-locus sequence typing(SLST)

compares sequence variation of a single target.

provides an inexpensive, rapid, objective, and portablegenotyping method to subspeciate bacteria.

Using a single target depends on finding a region forsequencing that is sufficiently polymorphic to provide usefulstrain resolution.

Loci with short sequence repeat (SSR) regions may havesuitable variability for discriminating outbreaks.


23/23

Two S. aureusgenes conserved within the species, protein A (spa) andcoagulase (coa), have variable SSR regions constructed from closely

related 24- and 81-bp tandem repeat units, respectively.

The genetic alterations in SSR regions include both point mutations andintragenic recombination that arise by slipped-strand mispairing duringchromosomal replication and that result in a high degree of

polymorphism.

Date post:	30-May-2018
Category:	Documents
Upload:	dr-rajesh-kumar
View:	217 times
Download:	0 times

Bio-informatics tools

Documents