Date post: | 25-Dec-2015 |
Category: |
Documents |
Upload: | nitinkumar |
View: | 3 times |
Download: | 0 times |
Transcription: a primer (eukaryotic)
Aurnab Ghose; 150202
Same genome!
Anise swallowtail, Papilio zelicaon
Same genome!
Gene mRNA Translation at ribosome
Protein
Transcription
Transcription • Requires
– Transcription initiation site • where transcription begins
– Promoter • to which RNA polymerase binds
• In multicellular eukaryotes – RNA polymerase binds to promoter (TATA
box)
Eukaryotic promoter elements. A eukaryotic promoter usually contains a TATA box located 25-35 bp upstream from the transcription initiation site. One or more UPEs (upstream promoter elements) is usually present.
TATA box Transcription initiation
site UPE TATA A
pre-mRNA
A A
T T
Enhancers
• Located far away from promoter – control some gene expression
• Help form active transcription initiation complex
• Specific regulatory proteins – bind to enhancer elements – activate transcription by interacting with
proteins bound to promoters
Enhancers
actcaaaaaaaaaacggttgggttgcgccatacatatgaaagagtatagaataatgatgtatttcccaaatcaaatatcatggt
aaaatttaaCAATgacccattcggattcattgataatattagttgatggatcatttgtaaaaaggttttattaactcctaagt
tatgtcgagtagaccttgttgttgttgcTATAATTcttaatcATGcgttgtagggggagatttatgtcaccacaaacagaaacgaaagcaaaggttgggttcaaagctggtgttaaagactgaacgtagcagctacgatcgatcgactagctgcatcgggctagcgaagcttcgatcgatcgatcgagctagcgagcccccagttttaggtcgagctttcagctcagctaggcgcgaaatctcgagcgcagctcactagctgctctagcatcgagctacgatcgcgatcgagctagctagaattatccgtgaagcttgcaaatggagtcctgaattagctgctgcttgtgaagtctggaaggaaatcaaatttga
attcccagcaatggatactttgTAAtccagtaataatcattcgttctattaatttccattaaactcggcccaatctt
Transcription • Is the process of making messenger RNA (mRNA) from a DNA template
• RNA polymerase • Very similar to DNA replica;on • Remember: as in replica;on, in transcrip;on, addi0on of a new nucleo0de occurs at the 3’ end!
• Transcrip;on occurs by base pairing: – A-‐U: 2 H bonds; G-‐C: 3 H bonds
Three Steps of transcription
Complementary Base-pairing of DNA to mRNA
• If the template strand reads: T-‐A-‐C-‐C-‐T-‐T-‐A-‐A-‐C-‐C-‐G-‐G-‐T-‐T-‐A
• The transcribed mRNA is: A-‐U-‐G-‐G-‐A-‐A-‐U-‐U-‐G-‐G-‐C-‐C-‐A-‐A-‐U
Transcrip;on
The structure of mRNA
1. 5’ Guanine cap (G-‐cap) 2. Leader sequence: does not get made into protein 3. Protein coding region begins with AUG & ends with a STOP
codon 4. Trailing sequence does not get made into protein. 5. 3’ poly-‐A tail
1. 5’ Guanine cap (G-cap) 2. Leader sequence: does not get made into protein 3. Protein coding region begins with AUG & ends with
a STOP codon 4. Trailing sequence does not get made into protein. 5. 3’ poly-A tail
Gene Expression: Translation • Central Dogma: DNA → RNA → Protein
– Proposed by Francis Crick
• DNA: 3' ACC AAA CCG AGT • mRNA: 5' UGG UUU GGC UCA • Protein: Trp Phe Gly Ser
• The string of amino acids has a direct rela;onship to nucleo;de bases in RNA and DNA
• Every three nucleo;des is called a Codon • Each Codon corresponds to ONE amino acid
• Amino acid subunits are added at the carboxyl terminus of the growing protein
The elements of eukaryotic transcription
• Cis-acting elements – Basal promoter elements – UPEs – Enhancers
• Trans-acting factors – RNA polymerase – Transcription factors – Accessory proteins
Modulating eukaryotic transcription
Promoter proximal elements (UPEs) Enhancer elements: Can function in either orientation.
Can occur far (<50 kb) from the gene. Can be up- or downstream.
Three RNA polymerases in eukaryotes"
I: pre-rRNA"II: mRNA"III: tRNAs, 5S rRNA, " small stable RNAs""!Also differentiated by sensitivity to α-amanitin.!
Complexity of eukaryotic RNA polymerases"
Function of most subunits is unclear, but nearly all the subunits
are essential
Transcription initiation at eukaryotic protein-coding genes
# of subunits Activity
RNA pol II 12 RNA synthesis
General TX factorsTFIID 9 Promoter recognitionTFIIB 1TFIIE 2TFIIF 2TFIIH 9 helicase
Mediator 20
TBP binds to TATA-box DNA"
TATA-binding protein = TBP!!
TBP is a subunit of TFIID!
Pol II won’t bind unless TFs bind first.
Stepwise assembly of Pol II transcription-initiation complex"
Transcriptional control requires still more proteins
RNA pol II (12 proteins) General transcription factors (23 proteins) chromatin remodeling complex (15 proteins) specific transcription factors (? proteins) Mediator complex (20 proteins)