Biochemistry 611Biochemistry 611Nucleic AcidsNucleic Acids

8-28-078-28-07

Chad WilkersonChad Wilkerson

• Post-doctoral fellow in Kevin Sarge’s labPost-doctoral fellow in Kevin Sarge’s lab• Dept. Biochemistry, BBSRB BuildingDept. Biochemistry, BBSRB Building• Lab phone 257-7349Lab phone 257-7349• Email: dcwilk2 @ uky.eduEmail: dcwilk2 @ uky.edu

Topics To Be CoveredTopics To Be Covered• IsolatingIsolating

Dissociation/deproteinizationDissociation/deproteinization PrecipitationPrecipitation

• QuantitatingQuantitating UV absorptionUV absorption

• SeparatingSeparating Gel electrophoresis: Agarose & PolyacrylamideGel electrophoresis: Agarose & Polyacrylamide

• AnalysisAnalysis DNA: Southern blot, gel shift (EMSA), DNase footprinting, DNA: Southern blot, gel shift (EMSA), DNase footprinting, ChIP, Promoter pull-down, PCRChIP, Promoter pull-down, PCR RNA: RT-PCR, RACE, Exon trapping, PCR-based cDNA cloning,RNA: RT-PCR, RACE, Exon trapping, PCR-based cDNA cloning, RNase Protection, northern blot, nuclear run-off, primer RNase Protection, northern blot, nuclear run-off, primer

extension extension

Isolation of Nucleic AcidsIsolation of Nucleic AcidsTwo Main Steps for IsolationTwo Main Steps for Isolation

1)1) Dissociation/deproteinizationDissociation/deproteinization

• detergent (e.g. SDS, Triton X-100, NP40, CHAPS)detergent (e.g. SDS, Triton X-100, NP40, CHAPS)

• An organic (e.g. phenol)An organic (e.g. phenol)DNA DNA phenol:chloroform:isoamyl alcohol (25:24:1) at pH 8.0 phenol:chloroform:isoamyl alcohol (25:24:1) at pH 8.0RNA RNA acidic pH (below 7) DNA will denature and partition into acidic pH (below 7) DNA will denature and partition into

the organic phasethe organic phase

• Strong electrolyte (e.g. guanidinium isothiocyanate –Trizol and RNA Stat-Strong electrolyte (e.g. guanidinium isothiocyanate –Trizol and RNA Stat-60)60)

2)2) PrecipitationPrecipitation

• Raising the salt concentration to at least 0.1M and adding an alcohol (67% Raising the salt concentration to at least 0.1M and adding an alcohol (67% ethanol or 50% isopropanol) precipitates nucleic acids from the aqueous ethanol or 50% isopropanol) precipitates nucleic acids from the aqueous phasephase

• Common salts include: sodium acetate (NaAc) – samples brought to Common salts include: sodium acetate (NaAc) – samples brought to 0.3M0.3M

potassium acetate (KAc) – samples brought to 0.3M potassium acetate (KAc) – samples brought to 0.3M ammonium acetate (NH4Ac) – samples brought to ammonium acetate (NH4Ac) – samples brought to

2M2M

Isolation of Nucleic AcidsIsolation of Nucleic Acids

Things to keep in mind when isolating nucleic acidsThings to keep in mind when isolating nucleic acids

1)1) The integrity of the nucleic acidThe integrity of the nucleic acid • low and high pH can lead to hydrolysis of nucleic acidslow and high pH can lead to hydrolysis of nucleic acids• Excess pipetting or vortexing can shear DNAExcess pipetting or vortexing can shear DNA

2)2) Any enzyme requirementsAny enzyme requirements• Specific salts and salt concentrations can inhibit enzymesSpecific salts and salt concentrations can inhibit enzymes• EDTA can inhibit reactionsEDTA can inhibit reactions

3)3) Any functional requirementsAny functional requirements• Some technologies require higher purification of nucleic acidsSome technologies require higher purification of nucleic acids

Isolation of Nucleic AcidsIsolation of Nucleic Acids

Additional topics related to isolation of nucleic acidsAdditional topics related to isolation of nucleic acids

1)1) Tissue disruptionTissue disruption • Dounce homogenizerDounce homogenizer• Mortar and pestleMortar and pestle• SonicationSonication

2)2) Cellular fractionationCellular fractionation • Examples: nuclei, mitochondria, polysomesExamples: nuclei, mitochondria, polysomes

3)3) Chromatographic purificationsChromatographic purifications• Examples: CsCl gradients, DEAE cellulose, oligo dT celluloseExamples: CsCl gradients, DEAE cellulose, oligo dT cellulose

Quantitating Nucleic AcidsQuantitating Nucleic Acids

Definition of O.D. at A260 refers to the O.D. reading when the sample in Definition of O.D. at A260 refers to the O.D. reading when the sample in question is diluted to 1.0ml of ddH20 and read in a 1cm quartz question is diluted to 1.0ml of ddH20 and read in a 1cm quartz cuvette at 260nm.cuvette at 260nm.

Nucleic Acids absorb UV light at a maximum of 260nmNucleic Acids absorb UV light at a maximum of 260nm

There is a direct relationship between the concentration of a nucleic There is a direct relationship between the concentration of a nucleic acid acid

and its absorption of UV light at 260nmand its absorption of UV light at 260nm

40 x OD260 of sample = concentration of RNA (ug/mL)40 x OD260 of sample = concentration of RNA (ug/mL)50 x OD260 of sample = concentration of DNA (ug/mL)50 x OD260 of sample = concentration of DNA (ug/mL)33 x OD260 of sample = concentration of oligonucleotide (ug/mL)33 x OD260 of sample = concentration of oligonucleotide (ug/mL)

1 A260 dsDNA = 50ug1 A260 dsDNA = 50ug1 A260 ssDNA = 33ug1 A260 ssDNA = 33ug1 A260 ssRNA = 40ug1 A260 ssRNA = 40ug

The relative purity of nucleic acid samples can be determined by measuring their absorption at other wavelengths.

2 main contaminates include proteins and polysaccarides which have absorption maximas at 280nm and 230nm respectively.

An uncontaminated RNA sample would have a 230, 260, 280 ratio of 1:2:1

An uncontaminated DNA sample would have a ratio of 1:1.8:1

Quantitating Nucleic AcidsQuantitating Nucleic Acids

Separating Nucleic AcidsSeparating Nucleic Acids

Gel ElectrophoresisGel Electrophoresis

AgaroseAgarose• Less analyticalLess analytical• Typically used to separate nucleic acids greater than 100 bpTypically used to separate nucleic acids greater than 100 bp• Concentrations range from 0.4% - 3%Concentrations range from 0.4% - 3%• Buffers commonly used include TAE or TBE (non-denaturing) and Buffers commonly used include TAE or TBE (non-denaturing) and

MOPS-formaldehyde (denaturing)MOPS-formaldehyde (denaturing)

PolyacrylamidePolyacrylamide• High resolution capacityHigh resolution capacity• Concentrations range from 4% - 20%Concentrations range from 4% - 20%• Buffers commonly used include TBE or TTE (Tris-taurine EDTA)Buffers commonly used include TBE or TTE (Tris-taurine EDTA)• For denaturing nucleic acids urea is added to a final concentration of For denaturing nucleic acids urea is added to a final concentration of

7-8M7-8M

Separating Nucleic AcidsSeparating Nucleic Acids

Agarose Agarose PolyacrylamidePolyacrylamide

0.30.3 60-560-5

0.60.6 20 – 120 – 1

0.70.7 10 – 0.810 – 0.8

0.90.9 7 – 0.57 – 0.5

1.21.2 6 – 0.46 – 0.4

1.51.5 4 – 0.24 – 0.2

2.02.0 3 – 0.13 – 0.1

3.53.5 100 - 1000100 - 1000

5.05.0 80 - 50080 - 500

8.08.0 60 - 40060 - 400

12.012.0 40 - 20040 - 200

20.020.0 10 - 10010 - 100

Agarose (%)Agarose (%)

Effective Range of Effective Range of Separation of LinearSeparation of LinearDNA molecules (kb)DNA molecules (kb) Acrylamide (%)Acrylamide (%)

Effective Range of Effective Range of Separation (nucleotides)Separation (nucleotides)

Analysis of Nucleic AcidsAnalysis of Nucleic Acids

DNA AnalysisDNA Analysis• Southern blotSouthern blot • PCRPCR

DNA:Protein InteractionsDNA:Protein Interactions

• Gel shift (EMSA)Gel shift (EMSA)• DNase footprinting DNase footprinting • Chromatin immunoprecipitation (ChIP)Chromatin immunoprecipitation (ChIP)• Promoter pull- downPromoter pull- down

RNA AnalysisRNA Analysis

• RT-PCRRT-PCR• Race and Exon TrappingRace and Exon Trapping• PCR based cDNA cloningPCR based cDNA cloning• northern blotnorthern blot• RNase ProtectionRNase Protection• Primer extensionPrimer extension• Nuclear run-offNuclear run-off

Southern BlotSouthern BlotSouthern Blot Southern Blot (named after Edward M. Southern)(named after Edward M. Southern)

Commonly used to determine the molecular weight of a restriction Commonly used to determine the molecular weight of a restriction fragment, to measure relative amounts in different samples and to fragment, to measure relative amounts in different samples and to locate a particular sequence of DNA within a complex mixturelocate a particular sequence of DNA within a complex mixture

Basic Protocol:Basic Protocol:1)1) Fragment DNA using restriction enzymesFragment DNA using restriction enzymes

2)2) Separate fragments by agarose gel Separate fragments by agarose gel electrophoresiselectrophoresis

3)3) DNA fragments are denatured and DNA fragments are denatured and transferred to transferred to

a nitrocellulose membranea nitrocellulose membrane

4)4) These membrane-bound fragments are These membrane-bound fragments are assayed assayed

for their ability to hybridize with a specific for their ability to hybridize with a specific labeled labeled

nucleotide sequence (probe).nucleotide sequence (probe).Probes:Probes:• Range in size from small (16 mers) to Range in size from small (16 mers) to very very large (500+) DNA fragmentslarge (500+) DNA fragments

• Labeled at their terminus through Labeled at their terminus through kinase treatment kinase treatment or internally through nick translationor internally through nick translation

• Labels can be in the form of isotopic or Labels can be in the form of isotopic or chromogenicchromogenic

Polymerase Chain Reaction Polymerase Chain Reaction (PCR)(PCR)

Polymerase Chain Reaction (PCR)Polymerase Chain Reaction (PCR)• Invented in 1983 by Kary Mullis – Nobel Prize in Invented in 1983 by Kary Mullis – Nobel Prize in

Chemistry 1993Chemistry 1993• Allows the rapid amplification of DNAAllows the rapid amplification of DNA

Core components Core components include:include:

TemplateTemplate• Purity, source, concentration Purity, source, concentration • genomic DNA genomic DNA ~~ 100-250 ng 100-250 ng• plasmid DNA plasmid DNA ~~ 20 ng20 ng

BufferBuffer• MgClMgCl22 necessary necessary • (0.5mM to 3.0mM (0.5mM to 3.0mM 1.5mM default) 1.5mM default)

dNTP’sdNTP’s• Final conc 200Final conc 200M - too high can M - too high can

inhibit rxninhibit rxn

PolymerasePolymerase• Error rate and Conditions (next Error rate and Conditions (next

slide)slide)

Primer(s)Primer(s)• Size (typically 18-30 nt) Size (typically 18-30 nt) • G+C content (40-60%)G+C content (40-60%)• Minimize secondary structure Minimize secondary structure

(hairpins) (hairpins) • Concentration (0.1 and 0.5 mMConcentration (0.1 and 0.5 mM)

Critical ParameterCritical Parameter::Annealing TemperatureAnnealing Temperature• About 5-7°C below Tm of About 5-7°C below Tm of primer pairsprimer pairs

Annealing TimeAnnealing Time• Rule of thumb is 1kb per Rule of thumb is 1kb per minuteminute

Primer DesignPrimer Design• Discussed laterDiscussed later

Taq PolymeraseTaq Polymerase• Isolated from Isolated from Thermus aquaticusThermus aquaticus in 1976 in 1976 • Catalyze template-directed synthesis of DNA from nucleotide Catalyze template-directed synthesis of DNA from nucleotide

triphosphates triphosphates • Requires a primer having a free 3' hydroxyl is required to initiate Requires a primer having a free 3' hydroxyl is required to initiate

synthesis synthesis • Magnesium ion is necessary Magnesium ion is necessary • Has a maximal catalytic activity at 70 to 80 °C (optimal is 72°C)Has a maximal catalytic activity at 70 to 80 °C (optimal is 72°C)• Incorporates approx. 125,000 nucleotides before making an errorIncorporates approx. 125,000 nucleotides before making an error

Other themostable polymerasesOther themostable polymerases

Pfu: Pyrococcus furiosusPfu: Pyrococcus furiosus• Lowest error rate of known thermophilic polymersasesLowest error rate of known thermophilic polymersases• Incorporates approx. 767,000 nucleotides before making an errorIncorporates approx. 767,000 nucleotides before making an error

Vent (or Ttl): Thermococcus litoralis Vent (or Ttl): Thermococcus litoralis • The most heat stable of all (halflife of 7 h at 95°C)The most heat stable of all (halflife of 7 h at 95°C)

Tgo: Thermus aquaticusTgo: Thermus aquaticus• Highly processive = copies fastHighly processive = copies fast

Tth: Thermus thermophilusTth: Thermus thermophilus• Copies long sequencesCopies long sequences

LOTS OF POLYMERASESLOTS OF POLYMERASES

Primer Design:Primer Design:• Size (typically 18-30 nt) Size (typically 18-30 nt) • G+C content (40-60%)G+C content (40-60%)• Minimize secondary structure →Minimize secondary structure →• Concentration (0.1 and 0.5 mMConcentration (0.1 and 0.5 mM)• Avoid runs of 3 or more G or C at the 3' endAvoid runs of 3 or more G or C at the 3' end• Avoid a T at the 3' end Avoid a T at the 3' end • Avoid mismatches at the 3' endAvoid mismatches at the 3' end• Avoid complementary sequences within a primer and between Avoid complementary sequences within a primer and between

primersprimers

Melting Temperature (Tm):Melting Temperature (Tm): Tm by definition is the temperature in which ½ the molecules in a Tm by definition is the temperature in which ½ the molecules in a

hybridizing pair are single strandedhybridizing pair are single stranded

Calculating the Tm:Calculating the Tm: 1)1) 2 + 4 rule 2 + 4 rule 2)2) Software: Primer PremiereSoftware: Primer Premiere3)3) Online: IDTDNA.com Online: IDTDNA.com 4)4) Trial and errorTrial and error

Primer Design:Primer Design: Calculating the Tm using the 2+4 rule:Calculating the Tm using the 2+4 rule:

TACCTAGGTTGACCATCTACTAA

TACCTAGGTTGACCATCTACTAA = 9 G+CTACCTAGGTTGACCATCTACTAA = 14 A+T

Tm = 2°C x (14) + 4°C x (9)

Tm = 28°C + 36°C = 64°C

200bp

100bp

500bp

300bp

50° 54° 58° 60° 50° 54° 58° 60°

Hsp90 Set 4 Primers Hsp90 Set 5 Primers

62 65 68

Types of PCR:Types of PCR:

Real-time PCRReal-time PCR• More quantitative than conventional PCRMore quantitative than conventional PCR• Measurements are taken early in reaction rather than at the end point as Measurements are taken early in reaction rather than at the end point as

in in conventional PCRconventional PCR

RT-PCRRT-PCR• Makes cDNA from RNAMakes cDNA from RNA

Nested-PCRNested-PCR• Consists on two consecutive PCR reactionsConsists on two consecutive PCR reactions• The amplified product from the first reaction acts as template DNA for the The amplified product from the first reaction acts as template DNA for the

secondsecond• **** See Supplement online See Supplement online

Hot-start PCRHot-start PCR• Reaction starts at 98°C without a slow warm upReaction starts at 98°C without a slow warm up• Primers do not have the chance to anneal at temperatures lower than the Primers do not have the chance to anneal at temperatures lower than the

TmTm• Amplified products tend to be cleanerAmplified products tend to be cleaner

Touchdown PCRTouchdown PCR• PCR cycling begins at annealing temp above the expected annealing tempPCR cycling begins at annealing temp above the expected annealing temp• The annealing temp is decreased every 1-3 cycles until it reaches the The annealing temp is decreased every 1-3 cycles until it reaches the

expected annealing tempexpected annealing temp

Real-Time PCRReal-Time PCR

More than you would ever want to know: http://www.dorak.info/genetics/realtime.html

Based on detecting and quantifying the fluorescence of a reporter

Real-time PCR monitors the fluorescence emitted during the reaction as an indicator of amplicon production at each PCR cycle (in real time) as opposed to the endpoint detection

Three general methods for the quantitative detection: 1. DNA-binding agents (SYBR Green)2. Hydrolysis probes (TaqMan, Beacons, Scorpions) – utilizes exonuclease

activity of polymerase!3. Hybridization probes (Light Cycler)

The fluorescent signal increase in direct proportion to the amount of PCR product in a reaction.

By recording the amount of fluorescence emission at each cycle, it is possible to monitor the PCR reaction during exponential phase where the first significant increase in the amount of PCR product correlates to the initial amount of target template.

Real-time PCR advantages

• not influenced by non-specific amplification • amplification can be monitored real-time • no post-PCR processing of products (no gel analysis, low contamination risk, less loss) • rapid cycling (30 minutes to 2 hours)• range of detection is as low as a 2-fold change up to 1010-fold• requirement of 1000-fold less RNA than conventional assays • confirmation of specific amplification by melting point analysis• not much more expensive than conventional PCR (except equipment cost)Different dilutions of the same template

# PCR CYCLES

Incre

asi

ng

F

luors

cen

c

e →

What are the more common What are the more common techniques used to study techniques used to study

protein:DNA interactions?protein:DNA interactions?

• Gel shift (EMSA)Gel shift (EMSA)• DNase footprinting DNase footprinting • Chromatin immunoprecipitation (ChIP)Chromatin immunoprecipitation (ChIP)• Promoter pull-downPromoter pull-down

Gel Shift or Electrophoretic Mobility Shift Assay (EMSA)

• Assay provides a simple and rapid method for detecting Assay provides a simple and rapid method for detecting in vitroin vitro interactions between DNA and proteinsinteractions between DNA and proteins

• Commonly used to study sequence-specific DNA-binding proteins Commonly used to study sequence-specific DNA-binding proteins such as transcription factorssuch as transcription factors

• The assay is based on the observation that complexes of protein The assay is based on the observation that complexes of protein and DNA migrate through a non-denaturing polyacrylamide gel and DNA migrate through a non-denaturing polyacrylamide gel more slowly than free DNA fragments or double-stranded more slowly than free DNA fragments or double-stranded oligonucleotidesoligonucleotides

Excess unlabeled oligonucleotide

Antibody to DB Protein

DB Protein

Labeled oligonucleotide

Binding Reaction:Protein/ExtractLabeled ProbeBufferAntibody **Competitor DNA **

DNase FootprintingDNase Footprinting

• The method of choice for identifying sequence specific binding of proteins to DNAThe method of choice for identifying sequence specific binding of proteins to DNA• Developed in 1978 by Galas and SchmitzDeveloped in 1978 by Galas and Schmitz

Footprint

Look for papers on Biochemistry website:Galas_and_Schmitz_Footprinting.pdfKang_Footprinting.pdf

Chromatin Immunoprecipitation Assay Chromatin Immunoprecipitation Assay (ChIP)(ChIP)

Chromatin immunoprecipitation (ChIP) is a powerful in vivo method to show interaction of proteins associated with specific regions of the genome.

ChIP allows you to detect recruitment of a particular transcription factor to a promoter region, analyze the interaction of any protein with any DNA sequence in vivo.

Fragments of DNA purified by ChIP can be used for cloning (i.e. Farnham paper)

More information can be found at: http://www.upstate.com/chipand Farnham_ChIP_Cloning.pdf (Biochemistry website)

Protein bound DNA within nuclei (only nuclei shown)

Crosslink DNA+ProteinsIsolate and lyse nuclei

Shear DNA – sonication most common method

Add antibody against protein of interest and IP protein+DNA complex

Wash extensively with various salt buffers and release antibody from protein+DNA complexes with elution buffer (SDS+NaHCO3)

Reverse crosslink by incubating at 67°C with 200mM NaCl

Purify DNA

Purified DNA ready to be assayed (i.e.

PCR)

Promoter Promoter Pull-downPull-downTechnique to identify proteins that bind to a specific DNA sequence Agarose bound Promoter

Region Fragment

Mixture ofProteins

Protein/ DNA complex Complex can be purified by centrifugation

Proteomic Identificationvia Mass Spectroscopy

Proteomic Identificationvia Western Blot

Release

Lyse Cells

Assay Purified Proteins

RNA AnalysisRNA Analysis

• RT-PCRRT-PCR• PCR based cDNA cloningPCR based cDNA cloning• northern blotnorthern blot• RNase ProtectionRNase Protection• Primer extensionPrimer extension• Nuclear run-off Nuclear run-off • Race and Exon TrappingRace and Exon Trapping

Reverse Transcriptase-PCR (RT-Reverse Transcriptase-PCR (RT-PCR)PCR)

Technique used to make cDNA from RNATechnique used to make cDNA from RNA

Template: RNATemplate: RNA

Two consecutive reactionsTwo consecutive reactions• Reaction #1 Reaction #1 Reverse transcription of RNA into cDNA Reverse transcription of RNA into cDNA

(RNA:DNA hybrid)(RNA:DNA hybrid)• Reaction #2 Reaction #2 Standard PCR reaction to make double stranded Standard PCR reaction to make double stranded

cDNAcDNA

Most Common Uses:Most Common Uses:• Looking at gene expression (mRNA levels)Looking at gene expression (mRNA levels)• Assaying viral systemsAssaying viral systems

RT-PCRRT-PCR

Basic Reaction Mixture:Basic Reaction Mixture:RNARNAdNTPsdNTPsPrimersPrimers1x Buffer1x BufferReverse TranscriptaseReverse TranscriptaseRNase InhibitorRNase InhibitorThermophilic PolymeraseThermophilic Polymerase

PCR based PCR based cDNA cDNA

CloningCloning

Commonly used to make a cDNAlibrary from mRNA

Northern BlotsNorthern BlotsSimilar to southern blots in that it involves the separation of RNA species on agarose gels and their transfer to nitrocellulose. Unlike Southern blots, Northern blots are separated on a denaturing formaldehyde-agarose gel and gels are not treated with NaOH prior to transferring to nitrocellulose.

Nuclease Protection Assay (NPA)Nuclease Protection Assay (NPA)

The basis method involves:The basis method involves:1)1) Hybridize in solution a single-stranded antisense probe(s) to an Hybridize in solution a single-stranded antisense probe(s) to an

RNA sample RNA sample 2)2) After hybridization, any unhybridized probe and sample RNA are After hybridization, any unhybridized probe and sample RNA are

removed by digestion with nucleases removed by digestion with nucleases 3)3) The nucleases are inactivated and the remaining probe:target The nucleases are inactivated and the remaining probe:target

hybrids are precipitated. hybrids are precipitated. 4)4) These products are separated on a denaturing polyacrylamide gel These products are separated on a denaturing polyacrylamide gel

and are visualizedand are visualized

Nuclease protection assaysNuclease protection assays (NPAs) include both ribonuclease (NPAs) include both ribonuclease protection assays (RPAs) and S1 nuclease assaysprotection assays (RPAs) and S1 nuclease assays

These two assays are an extremely sensitive method for the These two assays are an extremely sensitive method for the detection, quantification and mapping of specific RNAs in a detection, quantification and mapping of specific RNAs in a complex mixture of total cellular RNA.complex mixture of total cellular RNA.

There are several advantages to this technique including (1) There are several advantages to this technique including (1) multiple mRNAs can be assayed in a single RNA preparation (2) multiple mRNAs can be assayed in a single RNA preparation (2) the length of each gene fragment is unique allowing multiple the length of each gene fragment is unique allowing multiple probes to be synthesized together and hybridized to a single probes to be synthesized together and hybridized to a single target sample (3) highly specific and sensitive assay allowing the target sample (3) highly specific and sensitive assay allowing the detection of sub-picograms quantities of specific mRNAdetection of sub-picograms quantities of specific mRNA

Detailed Information can be found at: Detailed Information can be found at: http://www.ambion.com/techlib/basics/npa/http://www.ambion.com/techlib/basics/npa/

RNase Protection RNase Protection AssayAssay

What in the world would you use this for??Example: You knockout a transcription factor in a mouse. You want to know

if the lack of thistranscription factor affects the transcription of gene X, gene Y,

and gene Z.You can probe for the presence of the mRNA for each of the genes

in question usingRNase Protection Assays

Primer ExtensionPrimer ExtensionPrimer extensionPrimer extension is used to map the 5' ends of DNA or RNA is used to map the 5' ends of DNA or RNA

fragments. fragments.

For more information see:http://www.promega.com/tbs/tb113/tb113.pdf

Basic Protocol:Basic Protocol:

1. A specific oligonucleotide primer is labeled, 1. A specific oligonucleotide primer is labeled, usually at usually at

its 5' end, with its 5' end, with 3232PP

2. The labeled primer is annealed to a position 2. The labeled primer is annealed to a position downstream of that 5' end of the templatedownstream of that 5' end of the template

3. The primer is extended with reverse 3. The primer is extended with reverse transcriptase transcriptase

(making a fragment that ends at the 5' end of (making a fragment that ends at the 5' end of the template). the template).

DNA polymerase can also be used with DNA DNA polymerase can also be used with DNA templates.templates.

4. The newly synthesized labeled fragment is 4. The newly synthesized labeled fragment is analyzed by gel analyzed by gel

electrophoresiselectrophoresis

What in the world would you use this for??1. Can identify the transcription start

site2. RPA can tell you if a mRNA species is

present but primer extension can provide sequence size

Nuclear Run-off AssaysNuclear Run-off Assays• Sensitive method for measuring rates of expression (transcription) of Sensitive method for measuring rates of expression (transcription) of a specific genea specific gene• Based on incorporation of radiolabeled NTPs into elogating mRNAs Based on incorporation of radiolabeled NTPs into elogating mRNAs and counting the and counting the radioactivityradioactivity

General Protocol:General Protocol:1)1) Isolate nucleiIsolate nuclei2)2) Incubate with Incubate with 3232P-UTPP-UTP3)3) Treat with DNaseTreat with DNase4)4) Hybridize to denatured-immobilized cDNA corresponding to the mRNAHybridize to denatured-immobilized cDNA corresponding to the mRNA5)5) Treat with RNaseTreat with RNase6)6) Count radioactivityCount radioactivity

Biochemistry Website:Baldassare_NRO.pdfLi_Chaikof_NRO.pdf

Nuclear Runoff Nuclear Runoff AssayAssay

Assaying the effect of SB203580 (imidazole) on IL-1 (cytokine) gene Assaying the effect of SB203580 (imidazole) on IL-1 (cytokine) gene transcription in RAW264.7 cellstranscription in RAW264.7 cells Raw264.7 cells were stimulated with LPS (endotoxin from E. coli) in the Raw264.7 cells were stimulated with LPS (endotoxin from E. coli) in the presence or absence of SB203580 at the indicated concentrations and presence or absence of SB203580 at the indicated concentrations and analyzed by nuclear run-on analysisanalyzed by nuclear run-on analysis

Equal cpm of radiolabeled run-on RNA were used to probe individual nylon Equal cpm of radiolabeled run-on RNA were used to probe individual nylon strips carrying an excess of the indicated denatured cDNA probes. The strips carrying an excess of the indicated denatured cDNA probes. The Bluescript plasmid (BS) was included as a background control because the Bluescript plasmid (BS) was included as a background control because the murine IL-1 and IL-1ß, and TNF-   cDNAs were all subcloned into this murine IL-1 and IL-1ß, and TNF-   cDNAs were all subcloned into this plasmid. The blots were exposed for 2–3 wk, and the resultant films were plasmid. The blots were exposed for 2–3 wk, and the resultant films were scanned and digitized on a PhosphorImager. Shown are representative data scanned and digitized on a PhosphorImager. Shown are representative data from four separate similar experiments. from four separate similar experiments.

Conclusion: the imidazole does inhibit transcription of the cytokine IL-1Conclusion: the imidazole does inhibit transcription of the cytokine IL-1Baldassare et al., J. Immunol. 1999 May 1;162(9):5367-73

Endotoxin (stimulates Tc)

Imidazole

Rapid Amplification of cDNA Ends Rapid Amplification of cDNA Ends (RACE)(RACE)

RACERACE is a procedure for amplification of nucleic acid is a procedure for amplification of nucleic acid sequences from a messenger RNA template between a defined sequences from a messenger RNA template between a defined internal site and unknown sequences at either the 3' or the 5' -internal site and unknown sequences at either the 3' or the 5' -end of the mRNAend of the mRNA

2 Types of RACE: 5′ RACE and 3′ RACE2 Types of RACE: 5′ RACE and 3′ RACE

Detailed Information can be found at:http://www.invitrogen.com/content/sfs/manuals/5prime_race_man.pdf

Why would you use RACE?Amplify and characterize regions of unknown sequences -or-amplification of rare messages for which little sequence information is known

AAAAAA 3′mRNA 5′GSP1

cDNA 3′ 5′

Anneal a Gene Specific Primer (GSP1) to mRNA

Copy mRNA to cDNAusingreverse transcriptase and GSP1

AAAAAA 3′mRNA 5′

cDNA 3′ 5′

Degrade mRNA with RNase

5′3′-CCCCCC

Treat cDNAand withTdT and dCTPand Purify

5′3′-CCCCCCGSP2

PCR is performed using nested GSP2 and Anchor Primer Companies offer special/ custom

Anchor Primers

5′-GGGGGG

5′ RACEPCR product

5′ RACE5′ RACE

AAAAAA 3′mRNA 5′

cDNA 3′

Anneal a oligodT Primer (with anchor sequence) to mRNA

Copy mRNA to cDNAusing reverse transcriptase and oligodT Primer+AnchorSequence

AAAAAA 3′mRNA 5′

cDNA 3′

Degrade mRNA with RNaseH

Perform PCR using Gene Specific Primer (GSP1)And Anchor Primer Complement (APC1)

3′ RACEPCR product

TTTTTT - 5′

GSP1

TTTTTT - 5′

TTTTTT - 5′

cDNA 3′ TTTTTT - 5′

APC1

3′ RACE3′ RACE

Exon TrappingExon TrappingExon TrappingExon Trapping is used to isolate the transcribed sequences (exons) of a is used to isolate the transcribed sequences (exons) of a

gene from genomic DNAgene from genomic DNA

The exon trapping methods and vector were developed Alan Buckler The exon trapping methods and vector were developed Alan Buckler et et al.al.

Basic Protocol:Basic Protocol:

1)1) Random segments of chromosomal DNA are inserted into an intron Random segments of chromosomal DNA are inserted into an intron present within a mammalian expression vector present within a mammalian expression vector

2)2) The cloned DNA is transfected into COS-7 cellsThe cloned DNA is transfected into COS-7 cells3)3) Amplified exons are spliced such that the vector and genomic exons Amplified exons are spliced such that the vector and genomic exons

are pairedare paired4)4) Cytoplasmic mRNA is harvested and screened by PCR amplification Cytoplasmic mRNA is harvested and screened by PCR amplification

for the acquisition of an exon from the genomic fragment for the acquisition of an exon from the genomic fragment the the presence of two BstX I restriction sites flanking the MCS helps presence of two BstX I restriction sites flanking the MCS helps minimize the recovery of vector-vector splicing or cryptic splicingminimize the recovery of vector-vector splicing or cryptic splicing

Publication: Buckler_Orig_Paper.pdf (Biochemistry website)Publication: Buckler_Orig_Paper.pdf (Biochemistry website)More information can be found at:More information can be found at:http://www.invitrogen.com/content/sfs/manuals/18449017.pdfand Online Supplementand Online Supplement

AG GU AGUAG

NCAG G

exon intron exonintron

Splicing consensus sequences

5 splice sitesplice donor site

3 splice sitesplice acceptor site

Genomic DNAcontaining an exon flanked by introns

AG GU AGUAG

NCAG G

exon intron exonintronintron intronexon

DS ASAS DS

AG G

exon exonexon

MCS

mammalian expression vector

Microarray TechnologyMicroarray TechnologyA technique scientist use to allow them to easily detect and measure A technique scientist use to allow them to easily detect and measure the expression of thousands of genes at one time.the expression of thousands of genes at one time.Involves a DNA glass slide that is fixed with tiny amounts of a large Involves a DNA glass slide that is fixed with tiny amounts of a large number of single-stranded DNA fragments.number of single-stranded DNA fragments.

Uses:Uses:• Studying differences in gene expression amongst a variety of Studying differences in gene expression amongst a variety of genes in one organismgenes in one organism• Studying differences in gene expression between genetically Studying differences in gene expression between genetically similar organisms similar organisms • Compare cancerous tissue with noncancerous tissueCompare cancerous tissue with noncancerous tissue

General Protocol:General Protocol:1)1) Hybridization: Make labeled cDNA from mRNA and apply to the DNA Hybridization: Make labeled cDNA from mRNA and apply to the DNA

chip chip 2)2) Rinse off excess cDNA and scan for fluorescenceRinse off excess cDNA and scan for fluorescence3)3) Each fluorescent spot will indicate that the cDNA strand was Each fluorescent spot will indicate that the cDNA strand was

complimentary to the strand complimentary to the strand on the DNA chipon the DNA chip4)4) Ratio of fluorescence emission indicates relative abundance of each Ratio of fluorescence emission indicates relative abundance of each

mRNAmRNAInteresting articles on the Interesting articles on the Biochemistry website:Biochemistry website:EricLander_Microarray.pdfEricLander_Microarray.pdfBrown_Botstein_Microarray.pdfBrown_Botstein_Microarray.pdf

ENDEND