Date post: | 26-Dec-2015 |
Category: |
Documents |
Upload: | margaretmargaret-simmons |
View: | 216 times |
Download: | 2 times |
Biochemistry 611Biochemistry 611Nucleic AcidsNucleic Acids
8-28-078-28-07
Chad WilkersonChad Wilkerson
• Post-doctoral fellow in Kevin Sarge’s labPost-doctoral fellow in Kevin Sarge’s lab• Dept. Biochemistry, BBSRB BuildingDept. Biochemistry, BBSRB Building• Lab phone 257-7349Lab phone 257-7349• Email: dcwilk2 @ uky.eduEmail: dcwilk2 @ uky.edu
Topics To Be CoveredTopics To Be Covered• IsolatingIsolating
Dissociation/deproteinizationDissociation/deproteinization PrecipitationPrecipitation
• QuantitatingQuantitating UV absorptionUV absorption
• SeparatingSeparating Gel electrophoresis: Agarose & PolyacrylamideGel electrophoresis: Agarose & Polyacrylamide
• AnalysisAnalysis DNA: Southern blot, gel shift (EMSA), DNase footprinting, DNA: Southern blot, gel shift (EMSA), DNase footprinting, ChIP, Promoter pull-down, PCRChIP, Promoter pull-down, PCR RNA: RT-PCR, RACE, Exon trapping, PCR-based cDNA cloning,RNA: RT-PCR, RACE, Exon trapping, PCR-based cDNA cloning, RNase Protection, northern blot, nuclear run-off, primer RNase Protection, northern blot, nuclear run-off, primer
extension extension
Isolation of Nucleic AcidsIsolation of Nucleic AcidsTwo Main Steps for IsolationTwo Main Steps for Isolation
1)1) Dissociation/deproteinizationDissociation/deproteinization
• detergent (e.g. SDS, Triton X-100, NP40, CHAPS)detergent (e.g. SDS, Triton X-100, NP40, CHAPS)
• An organic (e.g. phenol)An organic (e.g. phenol)DNA DNA phenol:chloroform:isoamyl alcohol (25:24:1) at pH 8.0 phenol:chloroform:isoamyl alcohol (25:24:1) at pH 8.0RNA RNA acidic pH (below 7) DNA will denature and partition into acidic pH (below 7) DNA will denature and partition into
the organic phasethe organic phase
• Strong electrolyte (e.g. guanidinium isothiocyanate –Trizol and RNA Stat-Strong electrolyte (e.g. guanidinium isothiocyanate –Trizol and RNA Stat-60)60)
2)2) PrecipitationPrecipitation
• Raising the salt concentration to at least 0.1M and adding an alcohol (67% Raising the salt concentration to at least 0.1M and adding an alcohol (67% ethanol or 50% isopropanol) precipitates nucleic acids from the aqueous ethanol or 50% isopropanol) precipitates nucleic acids from the aqueous phasephase
• Common salts include: sodium acetate (NaAc) – samples brought to Common salts include: sodium acetate (NaAc) – samples brought to 0.3M0.3M
potassium acetate (KAc) – samples brought to 0.3M potassium acetate (KAc) – samples brought to 0.3M ammonium acetate (NH4Ac) – samples brought to ammonium acetate (NH4Ac) – samples brought to
2M2M
Isolation of Nucleic AcidsIsolation of Nucleic Acids
Things to keep in mind when isolating nucleic acidsThings to keep in mind when isolating nucleic acids
1)1) The integrity of the nucleic acidThe integrity of the nucleic acid • low and high pH can lead to hydrolysis of nucleic acidslow and high pH can lead to hydrolysis of nucleic acids• Excess pipetting or vortexing can shear DNAExcess pipetting or vortexing can shear DNA
2)2) Any enzyme requirementsAny enzyme requirements• Specific salts and salt concentrations can inhibit enzymesSpecific salts and salt concentrations can inhibit enzymes• EDTA can inhibit reactionsEDTA can inhibit reactions
3)3) Any functional requirementsAny functional requirements• Some technologies require higher purification of nucleic acidsSome technologies require higher purification of nucleic acids
Isolation of Nucleic AcidsIsolation of Nucleic Acids
Additional topics related to isolation of nucleic acidsAdditional topics related to isolation of nucleic acids
1)1) Tissue disruptionTissue disruption • Dounce homogenizerDounce homogenizer• Mortar and pestleMortar and pestle• SonicationSonication
2)2) Cellular fractionationCellular fractionation • Examples: nuclei, mitochondria, polysomesExamples: nuclei, mitochondria, polysomes
3)3) Chromatographic purificationsChromatographic purifications• Examples: CsCl gradients, DEAE cellulose, oligo dT celluloseExamples: CsCl gradients, DEAE cellulose, oligo dT cellulose
Quantitating Nucleic AcidsQuantitating Nucleic Acids
Definition of O.D. at A260 refers to the O.D. reading when the sample in Definition of O.D. at A260 refers to the O.D. reading when the sample in question is diluted to 1.0ml of ddH20 and read in a 1cm quartz question is diluted to 1.0ml of ddH20 and read in a 1cm quartz cuvette at 260nm.cuvette at 260nm.
Nucleic Acids absorb UV light at a maximum of 260nmNucleic Acids absorb UV light at a maximum of 260nm
There is a direct relationship between the concentration of a nucleic There is a direct relationship between the concentration of a nucleic acid acid
and its absorption of UV light at 260nmand its absorption of UV light at 260nm
40 x OD260 of sample = concentration of RNA (ug/mL)40 x OD260 of sample = concentration of RNA (ug/mL)50 x OD260 of sample = concentration of DNA (ug/mL)50 x OD260 of sample = concentration of DNA (ug/mL)33 x OD260 of sample = concentration of oligonucleotide (ug/mL)33 x OD260 of sample = concentration of oligonucleotide (ug/mL)
1 A260 dsDNA = 50ug1 A260 dsDNA = 50ug1 A260 ssDNA = 33ug1 A260 ssDNA = 33ug1 A260 ssRNA = 40ug1 A260 ssRNA = 40ug
The relative purity of nucleic acid samples can be determined by measuring their absorption at other wavelengths.
2 main contaminates include proteins and polysaccarides which have absorption maximas at 280nm and 230nm respectively.
An uncontaminated RNA sample would have a 230, 260, 280 ratio of 1:2:1
An uncontaminated DNA sample would have a ratio of 1:1.8:1
Quantitating Nucleic AcidsQuantitating Nucleic Acids
Separating Nucleic AcidsSeparating Nucleic Acids
Gel ElectrophoresisGel Electrophoresis
AgaroseAgarose• Less analyticalLess analytical• Typically used to separate nucleic acids greater than 100 bpTypically used to separate nucleic acids greater than 100 bp• Concentrations range from 0.4% - 3%Concentrations range from 0.4% - 3%• Buffers commonly used include TAE or TBE (non-denaturing) and Buffers commonly used include TAE or TBE (non-denaturing) and
MOPS-formaldehyde (denaturing)MOPS-formaldehyde (denaturing)
PolyacrylamidePolyacrylamide• High resolution capacityHigh resolution capacity• Concentrations range from 4% - 20%Concentrations range from 4% - 20%• Buffers commonly used include TBE or TTE (Tris-taurine EDTA)Buffers commonly used include TBE or TTE (Tris-taurine EDTA)• For denaturing nucleic acids urea is added to a final concentration of For denaturing nucleic acids urea is added to a final concentration of
7-8M7-8M
Separating Nucleic AcidsSeparating Nucleic Acids
Agarose Agarose PolyacrylamidePolyacrylamide
0.30.3 60-560-5
0.60.6 20 – 120 – 1
0.70.7 10 – 0.810 – 0.8
0.90.9 7 – 0.57 – 0.5
1.21.2 6 – 0.46 – 0.4
1.51.5 4 – 0.24 – 0.2
2.02.0 3 – 0.13 – 0.1
3.53.5 100 - 1000100 - 1000
5.05.0 80 - 50080 - 500
8.08.0 60 - 40060 - 400
12.012.0 40 - 20040 - 200
20.020.0 10 - 10010 - 100
Agarose (%)Agarose (%)
Effective Range of Effective Range of Separation of LinearSeparation of LinearDNA molecules (kb)DNA molecules (kb) Acrylamide (%)Acrylamide (%)
Effective Range of Effective Range of Separation (nucleotides)Separation (nucleotides)
Analysis of Nucleic AcidsAnalysis of Nucleic Acids
DNA AnalysisDNA Analysis• Southern blotSouthern blot • PCRPCR
DNA:Protein InteractionsDNA:Protein Interactions
• Gel shift (EMSA)Gel shift (EMSA)• DNase footprinting DNase footprinting • Chromatin immunoprecipitation (ChIP)Chromatin immunoprecipitation (ChIP)• Promoter pull- downPromoter pull- down
RNA AnalysisRNA Analysis
• RT-PCRRT-PCR• Race and Exon TrappingRace and Exon Trapping• PCR based cDNA cloningPCR based cDNA cloning• northern blotnorthern blot• RNase ProtectionRNase Protection• Primer extensionPrimer extension• Nuclear run-offNuclear run-off
Southern BlotSouthern BlotSouthern Blot Southern Blot (named after Edward M. Southern)(named after Edward M. Southern)
Commonly used to determine the molecular weight of a restriction Commonly used to determine the molecular weight of a restriction fragment, to measure relative amounts in different samples and to fragment, to measure relative amounts in different samples and to locate a particular sequence of DNA within a complex mixturelocate a particular sequence of DNA within a complex mixture
Basic Protocol:Basic Protocol:1)1) Fragment DNA using restriction enzymesFragment DNA using restriction enzymes
2)2) Separate fragments by agarose gel Separate fragments by agarose gel electrophoresiselectrophoresis
3)3) DNA fragments are denatured and DNA fragments are denatured and transferred to transferred to
a nitrocellulose membranea nitrocellulose membrane
4)4) These membrane-bound fragments are These membrane-bound fragments are assayed assayed
for their ability to hybridize with a specific for their ability to hybridize with a specific labeled labeled
nucleotide sequence (probe).nucleotide sequence (probe).Probes:Probes:• Range in size from small (16 mers) to Range in size from small (16 mers) to very very large (500+) DNA fragmentslarge (500+) DNA fragments
• Labeled at their terminus through Labeled at their terminus through kinase treatment kinase treatment or internally through nick translationor internally through nick translation
• Labels can be in the form of isotopic or Labels can be in the form of isotopic or chromogenicchromogenic
Polymerase Chain Reaction Polymerase Chain Reaction (PCR)(PCR)
Polymerase Chain Reaction (PCR)Polymerase Chain Reaction (PCR)• Invented in 1983 by Kary Mullis – Nobel Prize in Invented in 1983 by Kary Mullis – Nobel Prize in
Chemistry 1993Chemistry 1993• Allows the rapid amplification of DNAAllows the rapid amplification of DNA
Core components Core components include:include:
TemplateTemplate• Purity, source, concentration Purity, source, concentration • genomic DNA genomic DNA ~~ 100-250 ng 100-250 ng• plasmid DNA plasmid DNA ~~ 20 ng20 ng
BufferBuffer• MgClMgCl22 necessary necessary • (0.5mM to 3.0mM (0.5mM to 3.0mM 1.5mM default) 1.5mM default)
dNTP’sdNTP’s• Final conc 200Final conc 200M - too high can M - too high can
inhibit rxninhibit rxn
PolymerasePolymerase• Error rate and Conditions (next Error rate and Conditions (next
slide)slide)
Primer(s)Primer(s)• Size (typically 18-30 nt) Size (typically 18-30 nt) • G+C content (40-60%)G+C content (40-60%)• Minimize secondary structure Minimize secondary structure
(hairpins) (hairpins) • Concentration (0.1 and 0.5 mMConcentration (0.1 and 0.5 mM)
Critical ParameterCritical Parameter::Annealing TemperatureAnnealing Temperature• About 5-7°C below Tm of About 5-7°C below Tm of primer pairsprimer pairs
Annealing TimeAnnealing Time• Rule of thumb is 1kb per Rule of thumb is 1kb per minuteminute
Primer DesignPrimer Design• Discussed laterDiscussed later
Taq PolymeraseTaq Polymerase• Isolated from Isolated from Thermus aquaticusThermus aquaticus in 1976 in 1976 • Catalyze template-directed synthesis of DNA from nucleotide Catalyze template-directed synthesis of DNA from nucleotide
triphosphates triphosphates • Requires a primer having a free 3' hydroxyl is required to initiate Requires a primer having a free 3' hydroxyl is required to initiate
synthesis synthesis • Magnesium ion is necessary Magnesium ion is necessary • Has a maximal catalytic activity at 70 to 80 °C (optimal is 72°C)Has a maximal catalytic activity at 70 to 80 °C (optimal is 72°C)• Incorporates approx. 125,000 nucleotides before making an errorIncorporates approx. 125,000 nucleotides before making an error
Other themostable polymerasesOther themostable polymerases
Pfu: Pyrococcus furiosusPfu: Pyrococcus furiosus• Lowest error rate of known thermophilic polymersasesLowest error rate of known thermophilic polymersases• Incorporates approx. 767,000 nucleotides before making an errorIncorporates approx. 767,000 nucleotides before making an error
Vent (or Ttl): Thermococcus litoralis Vent (or Ttl): Thermococcus litoralis • The most heat stable of all (halflife of 7 h at 95°C)The most heat stable of all (halflife of 7 h at 95°C)
Tgo: Thermus aquaticusTgo: Thermus aquaticus• Highly processive = copies fastHighly processive = copies fast
Tth: Thermus thermophilusTth: Thermus thermophilus• Copies long sequencesCopies long sequences
LOTS OF POLYMERASESLOTS OF POLYMERASES
Primer Design:Primer Design:• Size (typically 18-30 nt) Size (typically 18-30 nt) • G+C content (40-60%)G+C content (40-60%)• Minimize secondary structure →Minimize secondary structure →• Concentration (0.1 and 0.5 mMConcentration (0.1 and 0.5 mM)• Avoid runs of 3 or more G or C at the 3' endAvoid runs of 3 or more G or C at the 3' end• Avoid a T at the 3' end Avoid a T at the 3' end • Avoid mismatches at the 3' endAvoid mismatches at the 3' end• Avoid complementary sequences within a primer and between Avoid complementary sequences within a primer and between
primersprimers
Melting Temperature (Tm):Melting Temperature (Tm): Tm by definition is the temperature in which ½ the molecules in a Tm by definition is the temperature in which ½ the molecules in a
hybridizing pair are single strandedhybridizing pair are single stranded
Calculating the Tm:Calculating the Tm: 1)1) 2 + 4 rule 2 + 4 rule 2)2) Software: Primer PremiereSoftware: Primer Premiere3)3) Online: IDTDNA.com Online: IDTDNA.com 4)4) Trial and errorTrial and error
Primer Design:Primer Design: Calculating the Tm using the 2+4 rule:Calculating the Tm using the 2+4 rule:
TACCTAGGTTGACCATCTACTAA
TACCTAGGTTGACCATCTACTAA = 9 G+CTACCTAGGTTGACCATCTACTAA = 14 A+T
Tm = 2°C x (14) + 4°C x (9)
Tm = 28°C + 36°C = 64°C
200bp
100bp
500bp
300bp
50° 54° 58° 60° 50° 54° 58° 60°
Hsp90 Set 4 Primers Hsp90 Set 5 Primers
62 65 68
Types of PCR:Types of PCR:
Real-time PCRReal-time PCR• More quantitative than conventional PCRMore quantitative than conventional PCR• Measurements are taken early in reaction rather than at the end point as Measurements are taken early in reaction rather than at the end point as
in in conventional PCRconventional PCR
RT-PCRRT-PCR• Makes cDNA from RNAMakes cDNA from RNA
Nested-PCRNested-PCR• Consists on two consecutive PCR reactionsConsists on two consecutive PCR reactions• The amplified product from the first reaction acts as template DNA for the The amplified product from the first reaction acts as template DNA for the
secondsecond• **** See Supplement online See Supplement online
Hot-start PCRHot-start PCR• Reaction starts at 98°C without a slow warm upReaction starts at 98°C without a slow warm up• Primers do not have the chance to anneal at temperatures lower than the Primers do not have the chance to anneal at temperatures lower than the
TmTm• Amplified products tend to be cleanerAmplified products tend to be cleaner
Touchdown PCRTouchdown PCR• PCR cycling begins at annealing temp above the expected annealing tempPCR cycling begins at annealing temp above the expected annealing temp• The annealing temp is decreased every 1-3 cycles until it reaches the The annealing temp is decreased every 1-3 cycles until it reaches the
expected annealing tempexpected annealing temp
Real-Time PCRReal-Time PCR
More than you would ever want to know: http://www.dorak.info/genetics/realtime.html
Based on detecting and quantifying the fluorescence of a reporter
Real-time PCR monitors the fluorescence emitted during the reaction as an indicator of amplicon production at each PCR cycle (in real time) as opposed to the endpoint detection
Three general methods for the quantitative detection: 1. DNA-binding agents (SYBR Green)2. Hydrolysis probes (TaqMan, Beacons, Scorpions) – utilizes exonuclease
activity of polymerase!3. Hybridization probes (Light Cycler)
The fluorescent signal increase in direct proportion to the amount of PCR product in a reaction.
By recording the amount of fluorescence emission at each cycle, it is possible to monitor the PCR reaction during exponential phase where the first significant increase in the amount of PCR product correlates to the initial amount of target template.
Real-time PCR advantages
• not influenced by non-specific amplification • amplification can be monitored real-time • no post-PCR processing of products (no gel analysis, low contamination risk, less loss) • rapid cycling (30 minutes to 2 hours)• range of detection is as low as a 2-fold change up to 1010-fold• requirement of 1000-fold less RNA than conventional assays • confirmation of specific amplification by melting point analysis• not much more expensive than conventional PCR (except equipment cost)Different dilutions of the same template
# PCR CYCLES
Incre
asi
ng
F
luors
cen
c
e →
What are the more common What are the more common techniques used to study techniques used to study
protein:DNA interactions?protein:DNA interactions?
• Gel shift (EMSA)Gel shift (EMSA)• DNase footprinting DNase footprinting • Chromatin immunoprecipitation (ChIP)Chromatin immunoprecipitation (ChIP)• Promoter pull-downPromoter pull-down
Gel Shift or Electrophoretic Mobility Shift Assay (EMSA)
• Assay provides a simple and rapid method for detecting Assay provides a simple and rapid method for detecting in vitroin vitro interactions between DNA and proteinsinteractions between DNA and proteins
• Commonly used to study sequence-specific DNA-binding proteins Commonly used to study sequence-specific DNA-binding proteins such as transcription factorssuch as transcription factors
• The assay is based on the observation that complexes of protein The assay is based on the observation that complexes of protein and DNA migrate through a non-denaturing polyacrylamide gel and DNA migrate through a non-denaturing polyacrylamide gel more slowly than free DNA fragments or double-stranded more slowly than free DNA fragments or double-stranded oligonucleotidesoligonucleotides
Excess unlabeled oligonucleotide
Antibody to DB Protein
DB Protein
Labeled oligonucleotide
Binding Reaction:Protein/ExtractLabeled ProbeBufferAntibody **Competitor DNA **
DNase FootprintingDNase Footprinting
• The method of choice for identifying sequence specific binding of proteins to DNAThe method of choice for identifying sequence specific binding of proteins to DNA• Developed in 1978 by Galas and SchmitzDeveloped in 1978 by Galas and Schmitz
Footprint
Look for papers on Biochemistry website:Galas_and_Schmitz_Footprinting.pdfKang_Footprinting.pdf
Chromatin Immunoprecipitation Assay Chromatin Immunoprecipitation Assay (ChIP)(ChIP)
Chromatin immunoprecipitation (ChIP) is a powerful in vivo method to show interaction of proteins associated with specific regions of the genome.
ChIP allows you to detect recruitment of a particular transcription factor to a promoter region, analyze the interaction of any protein with any DNA sequence in vivo.
Fragments of DNA purified by ChIP can be used for cloning (i.e. Farnham paper)
More information can be found at: http://www.upstate.com/chipand Farnham_ChIP_Cloning.pdf (Biochemistry website)
Protein bound DNA within nuclei (only nuclei shown)
Crosslink DNA+ProteinsIsolate and lyse nuclei
Shear DNA – sonication most common method
Add antibody against protein of interest and IP protein+DNA complex
Wash extensively with various salt buffers and release antibody from protein+DNA complexes with elution buffer (SDS+NaHCO3)
Reverse crosslink by incubating at 67°C with 200mM NaCl
Purify DNA
Purified DNA ready to be assayed (i.e.
PCR)
Promoter Promoter Pull-downPull-downTechnique to identify proteins that bind to a specific DNA sequence Agarose bound Promoter
Region Fragment
Mixture ofProteins
Protein/ DNA complex Complex can be purified by centrifugation
Proteomic Identificationvia Mass Spectroscopy
Proteomic Identificationvia Western Blot
Release
Lyse Cells
Assay Purified Proteins
RNA AnalysisRNA Analysis
• RT-PCRRT-PCR• PCR based cDNA cloningPCR based cDNA cloning• northern blotnorthern blot• RNase ProtectionRNase Protection• Primer extensionPrimer extension• Nuclear run-off Nuclear run-off • Race and Exon TrappingRace and Exon Trapping
Reverse Transcriptase-PCR (RT-Reverse Transcriptase-PCR (RT-PCR)PCR)
Technique used to make cDNA from RNATechnique used to make cDNA from RNA
Template: RNATemplate: RNA
Two consecutive reactionsTwo consecutive reactions• Reaction #1 Reaction #1 Reverse transcription of RNA into cDNA Reverse transcription of RNA into cDNA
(RNA:DNA hybrid)(RNA:DNA hybrid)• Reaction #2 Reaction #2 Standard PCR reaction to make double stranded Standard PCR reaction to make double stranded
cDNAcDNA
Most Common Uses:Most Common Uses:• Looking at gene expression (mRNA levels)Looking at gene expression (mRNA levels)• Assaying viral systemsAssaying viral systems
RT-PCRRT-PCR
Basic Reaction Mixture:Basic Reaction Mixture:RNARNAdNTPsdNTPsPrimersPrimers1x Buffer1x BufferReverse TranscriptaseReverse TranscriptaseRNase InhibitorRNase InhibitorThermophilic PolymeraseThermophilic Polymerase
PCR based PCR based cDNA cDNA
CloningCloning
Commonly used to make a cDNAlibrary from mRNA
Northern BlotsNorthern BlotsSimilar to southern blots in that it involves the separation of RNA species on agarose gels and their transfer to nitrocellulose. Unlike Southern blots, Northern blots are separated on a denaturing formaldehyde-agarose gel and gels are not treated with NaOH prior to transferring to nitrocellulose.
Nuclease Protection Assay (NPA)Nuclease Protection Assay (NPA)
The basis method involves:The basis method involves:1)1) Hybridize in solution a single-stranded antisense probe(s) to an Hybridize in solution a single-stranded antisense probe(s) to an
RNA sample RNA sample 2)2) After hybridization, any unhybridized probe and sample RNA are After hybridization, any unhybridized probe and sample RNA are
removed by digestion with nucleases removed by digestion with nucleases 3)3) The nucleases are inactivated and the remaining probe:target The nucleases are inactivated and the remaining probe:target
hybrids are precipitated. hybrids are precipitated. 4)4) These products are separated on a denaturing polyacrylamide gel These products are separated on a denaturing polyacrylamide gel
and are visualizedand are visualized
Nuclease protection assaysNuclease protection assays (NPAs) include both ribonuclease (NPAs) include both ribonuclease protection assays (RPAs) and S1 nuclease assaysprotection assays (RPAs) and S1 nuclease assays
These two assays are an extremely sensitive method for the These two assays are an extremely sensitive method for the detection, quantification and mapping of specific RNAs in a detection, quantification and mapping of specific RNAs in a complex mixture of total cellular RNA.complex mixture of total cellular RNA.
There are several advantages to this technique including (1) There are several advantages to this technique including (1) multiple mRNAs can be assayed in a single RNA preparation (2) multiple mRNAs can be assayed in a single RNA preparation (2) the length of each gene fragment is unique allowing multiple the length of each gene fragment is unique allowing multiple probes to be synthesized together and hybridized to a single probes to be synthesized together and hybridized to a single target sample (3) highly specific and sensitive assay allowing the target sample (3) highly specific and sensitive assay allowing the detection of sub-picograms quantities of specific mRNAdetection of sub-picograms quantities of specific mRNA
Detailed Information can be found at: Detailed Information can be found at: http://www.ambion.com/techlib/basics/npa/http://www.ambion.com/techlib/basics/npa/
RNase Protection RNase Protection AssayAssay
What in the world would you use this for??Example: You knockout a transcription factor in a mouse. You want to know
if the lack of thistranscription factor affects the transcription of gene X, gene Y,
and gene Z.You can probe for the presence of the mRNA for each of the genes
in question usingRNase Protection Assays
Primer ExtensionPrimer ExtensionPrimer extensionPrimer extension is used to map the 5' ends of DNA or RNA is used to map the 5' ends of DNA or RNA
fragments. fragments.
For more information see:http://www.promega.com/tbs/tb113/tb113.pdf
Basic Protocol:Basic Protocol:
1. A specific oligonucleotide primer is labeled, 1. A specific oligonucleotide primer is labeled, usually at usually at
its 5' end, with its 5' end, with 3232PP
2. The labeled primer is annealed to a position 2. The labeled primer is annealed to a position downstream of that 5' end of the templatedownstream of that 5' end of the template
3. The primer is extended with reverse 3. The primer is extended with reverse transcriptase transcriptase
(making a fragment that ends at the 5' end of (making a fragment that ends at the 5' end of the template). the template).
DNA polymerase can also be used with DNA DNA polymerase can also be used with DNA templates.templates.
4. The newly synthesized labeled fragment is 4. The newly synthesized labeled fragment is analyzed by gel analyzed by gel
electrophoresiselectrophoresis
What in the world would you use this for??1. Can identify the transcription start
site2. RPA can tell you if a mRNA species is
present but primer extension can provide sequence size
Nuclear Run-off AssaysNuclear Run-off Assays• Sensitive method for measuring rates of expression (transcription) of Sensitive method for measuring rates of expression (transcription) of a specific genea specific gene• Based on incorporation of radiolabeled NTPs into elogating mRNAs Based on incorporation of radiolabeled NTPs into elogating mRNAs and counting the and counting the radioactivityradioactivity
General Protocol:General Protocol:1)1) Isolate nucleiIsolate nuclei2)2) Incubate with Incubate with 3232P-UTPP-UTP3)3) Treat with DNaseTreat with DNase4)4) Hybridize to denatured-immobilized cDNA corresponding to the mRNAHybridize to denatured-immobilized cDNA corresponding to the mRNA5)5) Treat with RNaseTreat with RNase6)6) Count radioactivityCount radioactivity
Biochemistry Website:Baldassare_NRO.pdfLi_Chaikof_NRO.pdf
Nuclear Runoff Nuclear Runoff AssayAssay
Assaying the effect of SB203580 (imidazole) on IL-1 (cytokine) gene Assaying the effect of SB203580 (imidazole) on IL-1 (cytokine) gene transcription in RAW264.7 cellstranscription in RAW264.7 cells Raw264.7 cells were stimulated with LPS (endotoxin from E. coli) in the Raw264.7 cells were stimulated with LPS (endotoxin from E. coli) in the presence or absence of SB203580 at the indicated concentrations and presence or absence of SB203580 at the indicated concentrations and analyzed by nuclear run-on analysisanalyzed by nuclear run-on analysis
Equal cpm of radiolabeled run-on RNA were used to probe individual nylon Equal cpm of radiolabeled run-on RNA were used to probe individual nylon strips carrying an excess of the indicated denatured cDNA probes. The strips carrying an excess of the indicated denatured cDNA probes. The Bluescript plasmid (BS) was included as a background control because the Bluescript plasmid (BS) was included as a background control because the murine IL-1 and IL-1ß, and TNF- cDNAs were all subcloned into this murine IL-1 and IL-1ß, and TNF- cDNAs were all subcloned into this plasmid. The blots were exposed for 2–3 wk, and the resultant films were plasmid. The blots were exposed for 2–3 wk, and the resultant films were scanned and digitized on a PhosphorImager. Shown are representative data scanned and digitized on a PhosphorImager. Shown are representative data from four separate similar experiments. from four separate similar experiments.
Conclusion: the imidazole does inhibit transcription of the cytokine IL-1Conclusion: the imidazole does inhibit transcription of the cytokine IL-1Baldassare et al., J. Immunol. 1999 May 1;162(9):5367-73
Endotoxin (stimulates Tc)
Imidazole
Rapid Amplification of cDNA Ends Rapid Amplification of cDNA Ends (RACE)(RACE)
RACERACE is a procedure for amplification of nucleic acid is a procedure for amplification of nucleic acid sequences from a messenger RNA template between a defined sequences from a messenger RNA template between a defined internal site and unknown sequences at either the 3' or the 5' -internal site and unknown sequences at either the 3' or the 5' -end of the mRNAend of the mRNA
2 Types of RACE: 5′ RACE and 3′ RACE2 Types of RACE: 5′ RACE and 3′ RACE
Detailed Information can be found at:http://www.invitrogen.com/content/sfs/manuals/5prime_race_man.pdf
Why would you use RACE?Amplify and characterize regions of unknown sequences -or-amplification of rare messages for which little sequence information is known
AAAAAA 3′mRNA 5′GSP1
cDNA 3′ 5′
Anneal a Gene Specific Primer (GSP1) to mRNA
Copy mRNA to cDNAusingreverse transcriptase and GSP1
AAAAAA 3′mRNA 5′
cDNA 3′ 5′
Degrade mRNA with RNase
5′3′-CCCCCC
Treat cDNAand withTdT and dCTPand Purify
5′3′-CCCCCCGSP2
PCR is performed using nested GSP2 and Anchor Primer Companies offer special/ custom
Anchor Primers
5′-GGGGGG
5′ RACEPCR product
5′ RACE5′ RACE
AAAAAA 3′mRNA 5′
cDNA 3′
Anneal a oligodT Primer (with anchor sequence) to mRNA
Copy mRNA to cDNAusing reverse transcriptase and oligodT Primer+AnchorSequence
AAAAAA 3′mRNA 5′
cDNA 3′
Degrade mRNA with RNaseH
Perform PCR using Gene Specific Primer (GSP1)And Anchor Primer Complement (APC1)
3′ RACEPCR product
TTTTTT - 5′
GSP1
TTTTTT - 5′
TTTTTT - 5′
cDNA 3′ TTTTTT - 5′
APC1
3′ RACE3′ RACE
Exon TrappingExon TrappingExon TrappingExon Trapping is used to isolate the transcribed sequences (exons) of a is used to isolate the transcribed sequences (exons) of a
gene from genomic DNAgene from genomic DNA
The exon trapping methods and vector were developed Alan Buckler The exon trapping methods and vector were developed Alan Buckler et et al.al.
Basic Protocol:Basic Protocol:
1)1) Random segments of chromosomal DNA are inserted into an intron Random segments of chromosomal DNA are inserted into an intron present within a mammalian expression vector present within a mammalian expression vector
2)2) The cloned DNA is transfected into COS-7 cellsThe cloned DNA is transfected into COS-7 cells3)3) Amplified exons are spliced such that the vector and genomic exons Amplified exons are spliced such that the vector and genomic exons
are pairedare paired4)4) Cytoplasmic mRNA is harvested and screened by PCR amplification Cytoplasmic mRNA is harvested and screened by PCR amplification
for the acquisition of an exon from the genomic fragment for the acquisition of an exon from the genomic fragment the the presence of two BstX I restriction sites flanking the MCS helps presence of two BstX I restriction sites flanking the MCS helps minimize the recovery of vector-vector splicing or cryptic splicingminimize the recovery of vector-vector splicing or cryptic splicing
Publication: Buckler_Orig_Paper.pdf (Biochemistry website)Publication: Buckler_Orig_Paper.pdf (Biochemistry website)More information can be found at:More information can be found at:http://www.invitrogen.com/content/sfs/manuals/18449017.pdfand Online Supplementand Online Supplement
AG GU AGUAG
NCAG G
exon intron exonintron
Splicing consensus sequences
5 splice sitesplice donor site
3 splice sitesplice acceptor site
Genomic DNAcontaining an exon flanked by introns
AG GU AGUAG
NCAG G
exon intron exonintronintron intronexon
DS ASAS DS
AG G
exon exonexon
MCS
mammalian expression vector
Microarray TechnologyMicroarray TechnologyA technique scientist use to allow them to easily detect and measure A technique scientist use to allow them to easily detect and measure the expression of thousands of genes at one time.the expression of thousands of genes at one time.Involves a DNA glass slide that is fixed with tiny amounts of a large Involves a DNA glass slide that is fixed with tiny amounts of a large number of single-stranded DNA fragments.number of single-stranded DNA fragments.
Uses:Uses:• Studying differences in gene expression amongst a variety of Studying differences in gene expression amongst a variety of genes in one organismgenes in one organism• Studying differences in gene expression between genetically Studying differences in gene expression between genetically similar organisms similar organisms • Compare cancerous tissue with noncancerous tissueCompare cancerous tissue with noncancerous tissue
General Protocol:General Protocol:1)1) Hybridization: Make labeled cDNA from mRNA and apply to the DNA Hybridization: Make labeled cDNA from mRNA and apply to the DNA
chip chip 2)2) Rinse off excess cDNA and scan for fluorescenceRinse off excess cDNA and scan for fluorescence3)3) Each fluorescent spot will indicate that the cDNA strand was Each fluorescent spot will indicate that the cDNA strand was
complimentary to the strand complimentary to the strand on the DNA chipon the DNA chip4)4) Ratio of fluorescence emission indicates relative abundance of each Ratio of fluorescence emission indicates relative abundance of each
mRNAmRNAInteresting articles on the Interesting articles on the Biochemistry website:Biochemistry website:EricLander_Microarray.pdfEricLander_Microarray.pdfBrown_Botstein_Microarray.pdfBrown_Botstein_Microarray.pdf
ENDEND