+ All Categories
Home > Documents > BIOINFORMATICS Ency Lee. What is Bioinformatics? Bioinformatics is a fast-field within the...

BIOINFORMATICS Ency Lee. What is Bioinformatics? Bioinformatics is a fast-field within the...

Date post: 18-Dec-2015
Category:
View: 220 times
Download: 2 times
Share this document with a friend
Popular Tags:
13
BIOINFORMATICS Ency Lee
Transcript
Page 1: BIOINFORMATICS Ency Lee. What is Bioinformatics? Bioinformatics is a fast-field within the biological sciences that was developed because of the need.

BIOINFORMATICS

Ency Lee

Page 2: BIOINFORMATICS Ency Lee. What is Bioinformatics? Bioinformatics is a fast-field within the biological sciences that was developed because of the need.

What is Bioinformatics? Bioinformatics is a fast-field within the biological science

s that was developed because of the need to handle large amounts of genetic and biochemical data.

Bioinformatics includes the concept of the flow of the nucleotide sequence – DNA, and its translation into molecules of life – proteins.

Molecular biology provides the basis for investigating the genotype by means of bioinformatics.

Bioinformatics is the use of computers to handle biological information.

Bioinformatics = Bioinformatics = Biology + Computer Biology + Computer ScienceScience

Page 3: BIOINFORMATICS Ency Lee. What is Bioinformatics? Bioinformatics is a fast-field within the biological sciences that was developed because of the need.

Purpose of bioinformatics

Improve content and utility of databases. Develop better tools for data generation, capture, a

nd annotation. Develop and improve tools and databases for comp

rehensive functional studies. Develop and improve tools for representing and ana

lyzing sequence similarity and variation. Create mechanisms to support effective approache

s for producing robust, exportable software that can be widely shared.

Page 4: BIOINFORMATICS Ency Lee. What is Bioinformatics? Bioinformatics is a fast-field within the biological sciences that was developed because of the need.

Outline of Bioinformatics

Page 5: BIOINFORMATICS Ency Lee. What is Bioinformatics? Bioinformatics is a fast-field within the biological sciences that was developed because of the need.

Sequence Analysis

All of the proteins are made up of the same basic building blocks, called amino acids.

When you know a DNA(deoxyribonucleic acid) sequence, you can translate it into the corresponding protein sequence by using the genetic code which is the very same way the cell itself generates a protein sequence.

TCAACAACCGCTATGTATTTCAACAACCGCTATGTATTTCGTACATTACTGCCAGCTCGTACATTACTGCCAGCCACCATGAATATTGTACGGCACCATGAATATTGTACGGTACCATAAATACTACCATAAATAC

For example… Cytosine

Adenine Guanine Thymine

Page 6: BIOINFORMATICS Ency Lee. What is Bioinformatics? Bioinformatics is a fast-field within the biological sciences that was developed because of the need.

Tools for Sequence Analysis

1. PubMed on the NCBI Websitehttp://www.ncbi.nlm.nih.gov/Education/

This site will be a source for data and analysis of DNA sequences, protein sequences and a variety of other data.

The site is extremely organized and it allows many different kinds of studies to be performed with the data that it provides.

Page 7: BIOINFORMATICS Ency Lee. What is Bioinformatics? Bioinformatics is a fast-field within the biological sciences that was developed because of the need.
Page 8: BIOINFORMATICS Ency Lee. What is Bioinformatics? Bioinformatics is a fast-field within the biological sciences that was developed because of the need.
Page 9: BIOINFORMATICS Ency Lee. What is Bioinformatics? Bioinformatics is a fast-field within the biological sciences that was developed because of the need.
Page 10: BIOINFORMATICS Ency Lee. What is Bioinformatics? Bioinformatics is a fast-field within the biological sciences that was developed because of the need.

2. BLAST (Basic Local Alignment Search Tool) www.ncbi.nlm.nih.gov/Education/BLAST/

This tool can be used for comparison of different sequences that you would find in the database search.

This can be used to compare proteins and genes depending on your goals.

BLAST is based on computer algorithm system which converts biological algorithm system into Alphabet letters.

Page 11: BIOINFORMATICS Ency Lee. What is Bioinformatics? Bioinformatics is a fast-field within the biological sciences that was developed because of the need.

BLAST OUTLINE

Page 12: BIOINFORMATICS Ency Lee. What is Bioinformatics? Bioinformatics is a fast-field within the biological sciences that was developed because of the need.

3. ClustalW www.expasy.org/sprot FASTA by European Bioinformatics Institutions

Page 13: BIOINFORMATICS Ency Lee. What is Bioinformatics? Bioinformatics is a fast-field within the biological sciences that was developed because of the need.

Genome analysis It can determine locations of genes o

n chromosomes and give information on heritability and linkage to other genes.

Bioinformatics tools and databases are gradually becoming an integrated system that reflects the complexity of organisms. With genome projects of small organisms being completed one by one, an understanding of the differences of genomes from the tree urkingdoms (eubacteria, archaea, and eukaryotes) and the relationship of genome organization to the form and function of an organism may be clarified.


Recommended