Date post: | 02-Jan-2016 |
Category: |
Documents |
Upload: | clarence-austin |
View: | 217 times |
Download: | 4 times |
Biology Chapter 8.5-8.7Review
Aminno Acids mRNAns Misc Vocabulary Mutation
Q $100
Q $200
Q $300
Q $400
Q $500
Q $100 Q $100Q $100 Q $100
Q $200 Q $200 Q $200 Q $200
Q $300 Q $300 Q $300 Q $300
Q $400 Q $400 Q $400 Q $400
Q $500 Q $500 Q $500 Q $500
Final Jeopardy
$100 Question Amino Acids
How many amino acids areUsed to make all the proteinsThe body uses?
$100 Answer Amino Acids
20
$200 Question Amino Acids
How many amino acids are built in thisLine of mRNA
augccauaugcgguaacadaguag
$200 Answer Amino Acid
augccauaugcgguaacacaguag
One start AUGOne end UAG6 amino acids
$300 Question Amino Acids
What are the three nucleitide Bases called that identify anAmino acid?
$300 Answer Amino Acid
Triplet codon
$400 Question Amino Acid
What molecule carries the amino acid coded by mRNA to the ribosome??
$400 Answer Amino Acid
tRNA
$500 Question Amino Acid
What anticodon pairs with the codon AUG?
$500 Answer Amino Acid
TAC
$100 mRNA
What happens if the mRNA reading frame is changed??
$100 Answer mRNA
The amino acid sequence of the resulting protein changes.
$200 Question mRNA
What forms the peptide bonds that link amino acids in a protein??
ribosome
$200 Answer mRNA
$300 Question mRNA
How does the lac operon switch off?
$300 Answer mRNA
A repressor protein binds to the operator.
$400 Question mRNA
What does NOT happen during mRNA processing?
A) introns are cut outB) a cap and tail are added
c) exons are removedd) exons are spliced together
$400 Answer mRNA
C) Exons are removed
$500 Question mRNA
What determines the order ofAmino acids ina protein?
$500 Answer mRNA
The order of the mRNA anticodons
$100 Question Misc.
What is the function of transcription factors in eukaryotic cells?
$100 Answer Misc
They help RNA polymerase know where a gene starts
$200 Question Misc
Genes determine a person’sEye color by coding for _________That affect eye color?
$200 AnswerMisc
proteins
$300 Question Misc
Why type of bond are created duringDehydration synthesis?
$300 AnswerMisc
Polypeptide bonds
$400 Question Misc
Of the 20 amino acids, 12 are found in the cellAnd the remaiinng 8 are made from?a)Proteins floating in the cytoplasmb) Waterc) Hydrogend) The food we eat
$400 Answer Misc
d) From the food we eat
$500 Question Misc
Proteins are sometimes called?
$500 Answer Misc
Polypeptide chains
$100 Question Vocabulary
Define mutagen
$100 Answer Vocabulary
Agents in the environment that can change DNA
$200 Question Vocabulary
What is a mutation?
$200 Answer Vocabulary
Change in the organism’s DNA
$300 Question Vocabulary
What is frameshift?
$300 Answer Vocabulary
Insertion or deletion ofA nucleotide in DNA
$400 Question Vocabulary
What is Point Mutation?
$400 Answer Vocabulary
One nucelotide is substitutedFor another
$500 Question Vocabulary
What is chromosomal mutation?
$500 Answer Vocabulary
Different sized units that have no copy of the gene
$100 Question Mutation
Cystic Fibrosis is an example of a genetic disease caused by a deletion of a nucleotide . What is the term for this type of mutation?
$100 Answer Mutation
frameshift
$200 Question Mutation
What type of mutation has noEffect on phenotype?
$200 Answer Mutation
Translocation
$300 Question Mutation
Which is an example of a mutagen?a)Triglycerideb)UV sunlightc)Thymine
$300 Answer Mutation
UV Sunlight
$400 Question Mutation
Mutations that can affectOffspring occur in what Cell type?
$400 Answer Mutation
Chromosomal
$500 Question Mutation
List two causes of mutations
$500 Answer Mutations
a) Inheritatedb) Environmental Impact on epigenomec) Frame shiftd) Point mutation
Final Jeopardy
What is the difference betweenTranscription and translation?
Final Jeopardy AnswerTranscription is when theNucleotide T is changed to U formRNATranslation is when the tripletCodon is “read” to create a protein