Biology Journal 10/14/2013

Biology Journal 10/14/2013

What do the letters in the acronym DNA stand for?

What 5 elements are found in DNA?

Deoxyribonucleic Acid

Carbon, Hydrogen, Oxygen, Nitrogen, Phosphorous

What are the 4 most commonly occurring elements in living things?

Carbon, Hydrogen, Oxygen, Nitrogen

New Seating Chart Today!

New Seating Chart Today!

Be ready to pack up and

Be ready to pack up and

move…move…

Mr. Gatewood is accepting IB test registration and payment through this Friday.

• Come see him if you need any guidance on which tests to take.

• Come see him if you would like to test, but are having trouble coming up with the fees.

Assessment statement

3.3.1 Outline DNA nucleotide structure in terms of sugar (deoxyribose), base and phosphate.

3.3.2 State the names of the four bases in DNA.

3.3.3 Outline how DNA nucleotides are linked together by covalent bonds into a single strand.

3.3.4 Explain how a DNA double helix is formed using complementary base pairing and hydrogen bonds.

3.3.5 Draw and label a simple diagram of the molecular structure of DNA. An extension of the diagram in 3.3.3 is sufficient to show the complementary base pairs of A–T and G–C, held together by hydrogen bonds and the sugar–phosphate backbones.

3.3 DNA Structure

DNAyeeeeeeeDNAyeeeeeee

What do you call these types of carbohydrates?

A

DB

CDisaccharide Disaccharide

Monosaccharide Polysaccharide

Review!

Review!

What is the name of these carbohydrates?

A

DB

CLactose Sucrose

Ribose Starch

Review!

Review!

What are the products of this reaction?

H2O+ → +

Review!Review!

What kind of reaction is this?It is a condensation synthesis (it’s called condensation because water is made from the OH and H groups of the reactants)

Lactose and water.

What are the reactants of this reaction?2 glucose molecules.

The Parts of DNADeoxyribose: a monosaccharide,

or “sugar.” C5H10O4.

What is the difference between ribose What is the difference between ribose and deoxyribose?and deoxyribose?

C5H10O5C5H10O4

Ribose Deoxyribose

The Parts of DNA

Phosphate: PO4

The Parts of DNADeoxyribose and phosphate alternate to

make up the “sugar-phosophate backbone.”

The Parts of DNA

The bases (aka nitrogenous bases, aka nucleic acids, aka nucleotides)

• Adenine, cytosine, thymine, guanine

What is a hydrogen bond?

Hydrogen bonds are attractions between positive and negative sides of molecules.

Review!Review!

A always pairs with T

C always pairs with G

A and G are larger, 2-ringed bases.

T and C are smaller, 1-ringed bases.

Thus, every base pair consists of a 1-ringed base and a 2-ringed base.

How might this help find and correct errors (mutations) in DNA?

A and T are joined by 2 hydrogen bonds.

G and C are joined by 3 hydrogen bonds.

How might this help find and correct errors (mutations) in DNA?

DNA Can be represented in many ways…

Which of the following are not found in pairs?

Dookies

Aces

Twins

Adenine and Thymine

Thymine and Cytosine

Phosphate

Deoxyribose

Hydrogen bonds

A

GT

C

Where’s the backbone?

Where’s the base pairs?

The double helix is a twisted ladder shape that helps the DNA take up less space.

Histones are a protein that the DNA wraps around to take up less space

The way that DNA wraps around histones is called the “pearl necklace” shape.

Histones are like little stones that the DNA wraps

around.How long would this ball of yarn be if it wasn’t wrapped around something?

Histones are a Histones are a protein. protein.

What is another What is another word for a word for a protein?protein?

What are What are proteins made proteins made out of?out of?


3.3.1 Outline DNA nucleotide structure in terms of sugar (deoxyribose), base and phosphate.

3.3.2 State the names of the four bases in DNA.

3.3.3 Outline how DNA nucleotides are linked together by covalent bonds into a single strand.

3.3.4 Explain how a DNA double helix is formed using complementary base pairing and hydrogen bonds.

3.3.5 Draw and label a simple diagram of the molecular structure of DNA. An extension of the diagram in 3.3.3 is sufficient to show the complementary base pairs of A–T and G–C, held together by hydrogen bonds and the sugar–phosphate backbones.

3.3 DNA Structure


DNA is a huge molecule! There are 2 ways in which DNA compacts itself to take up less space. What are they?


Standard 3.3.5 is “Draw and label a simple diagram of the molecular structure of DNA.” Can you do it?


3.4.1 Explain DNA replication in terms of unwinding the double helix and separation of the strands by helicase, followed by formation of the new complementary strands by DNA polymerase.

3.4.2 Explain the significance of complementary base pairing in the conservation of the base sequence of DNA.

3.4.3 State that DNA replication is semi-conservative.

3.3 DNA Replication

The two strands of DNA can be separated, called unzipping.

• Remember, the 2 strands are connected by hydrogen bonds, which are much weaker than covalent bonds.

DNA Helicase is the enzyme that does the unzipping. DNA Helicase un-does the double helix.

In college, all the cool kids In college, all the cool kids wear ironic, pun-driven wear ironic, pun-driven

science t-shirtsscience t-shirts

DNA DNA HelicaseHelicaseSimplified Simplified modelmodel

DNA DNA HelicaseHelicaseSpace-filling Space-filling modelmodel

DNA DNA HelicaseHelicaseModel Model showing showing --helixes and helixes and -sheets.-sheets.

DNA unzips during replication (when DNA copies itself)

When do you think your cells would When do you think your cells would replicate their DNA? replicate their DNA?

Your cells replicate their DNA before they divide to make new cells. They do this…For routine replacement of cells (such as skin cells, blood cells, stomach cells, etc)When you grow or gain weightWhen you are injured and need to replace dead cells

If one strand of DNA has these base pairs, then what are the base pairs on the complementary strand?

CTAATCGTATATAGTCCGATTAGCATATATCAG

G

In replication…DNA helicase unzips DNA.DNA polymerase adds in the complementary (matching) bases to each single strand, creating 2 identical strands.

When DNA replicates, the new DNA molecules both consist of one new strand and one original strand. This is called semi-conservative replication.

It took scientists a while to figure out that DNA replication was semi-conservative, as opposed to some other pattern.

Your assignment:• Show DNA replication using the pieces provided.• Show at least 3 base pairs in the “starting DNA”• Show at least 2 base pairs in each “new strand of DNA”• Label:

– Parent strand of DNA and New strands– DNA helicase– DNA polymerase– Hydrogen bonds– Each of the molecules in DNA (deoxyribose, phosphate, cytosine,

adenine, guanine, thymine)

• Define the job of:– DNA helicase– DNA polymerase


What are the names of the two most important enzymes in DNA replication? What does each one do?

DNA helicase: unzips DNA, making 2 single-strands.

DNA Polymerase: adds in new complementary bases (and backbone) to each single strand, making 2 complete copies of DNA.

Biology Journal 10/17/2013In DNA replication, what do you start with? DNA

What do you end with?

What is the purpose of replication?

2 sets of the original DNA (through semi-conservative replication)

When cells divide, each new cells needs a full set of DNA.

DNA Replication• DNA helicase unzips the DNA• DNA polymerase connects

together matching bases to make 2 new strands.

Making a copy

Assessment statementCompare the structure of RNA and DNA.names of sugarsbasesthe number of strands

Compare the structure of RNA and DNA.names of sugarsbasesthe number of strands

Outline DNA transcription in terms of the formation of an RNA strand complementary to the DNA strand by RNA polymerase.

Outline DNA transcription in terms of the formation of an RNA strand complementary to the DNA strand by RNA polymerase.

Describe the genetic code in terms of codons composed of triplets of bases.

Describe the genetic code in terms of codons composed of triplets of bases.

Explain the process of translation, leading to polypeptide formation.roles of messenger RNA (mRNA) and transfer RNA (tRNA)codons and anticodonsribosomes and amino acids

Explain the process of translation, leading to polypeptide formation.roles of messenger RNA (mRNA) and transfer RNA (tRNA)codons and anticodonsribosomes and amino acids

Discuss the relationship between 1 gene and 1 polypeptide. Originally, it was assumed that 1 gene would invariably code for one polypeptide, many exceptions have been discovered.

Discuss the relationship between 1 gene and 1 polypeptide. Originally, it was assumed that 1 gene would invariably code for one polypeptide, many exceptions have been discovered.

3.3 Transcription and Translation

Transcription and Transcription and TranslationTranslation

DNA has the “recipe” to make proteins.

“Hmmm… how many teaspoons of cytosine was I supposed to add?”

A gene is a segment of DNA that has the instructions to make a particular protein.

The base pairs on DNA determine the amino acids, and thus the specific shape, that the protein will have.

For example… we all have genes for hair color. The base pairs on this DNA determines what proteins are in our hair, and thus, what our hair looks like.

Of course, you can always change it later…

What does it mean What does it mean to be a translator?to be a translator?

What does it What does it mean to mean to transcribe transcribe something?something?

What’s the difference between DNA and RNA?

DNA Structure RNA Structure•Deoxyribonucleic acid•Double stranded•Uses thymine (T)•Sugar used is deoxyribose (C5H10O4)

•Ribonucleic acid•Single stranded•Uses uracil (U)•Sugar used is ribose (C5H10O5)

DNA and RNA comparison

When does your body need to When does your body need to make different kinds of make different kinds of

proteins?proteins?

Transcription and translation is done every time a cell makes a protein.

Above: the structural protein collagen. This guy will be making lots of it soon to repair his body.

Ancient Egypt was well known for its scribes that made copies of

documents.

Nowadays we don’t really need them, we have

copy machines…

Transcription is making a copy of the DNA onto mRNA (messenger RNA). The enzyme that makes it is called RNA polymerase.

Some people transcribe

their homework all

the time.

mRNA is a temporary, disposable copy of DNA. It’s sent from the nucleus to the ribosome.

DNA is permanent. DNA is permanent. You don’t want to You don’t want to change or mess with change or mess with it. it.

RNA is a disposable RNA is a disposable copy.copy.

If this was a chain of DNA, If this was a chain of DNA, what would the mRNA strand what would the mRNA strand

be?be?

C T G A C T T A G A T AG A C U G A A U C U A U

What does DNA have the What does DNA have the “recipe” to make?“recipe” to make?

DNA is the recipe to make DNA is the recipe to make protein!protein!

What do What do ribosomribosomes do?es do?

Ribosomes make Ribosomes make proteins!proteins!

What are proteins made out of? Why What are proteins made out of? Why do they have the shape that they do they have the shape that they

have?have?

Proteins are made out of amino acids. Proteins are made out of amino acids. The different chemical properties of The different chemical properties of the amino acids cause the chain to the amino acids cause the chain to fold up in specific ways.fold up in specific ways.

Translation: mRNA goes to the ribosome, and it is translated into an amino acid sequence.

tRNA (transfer RNA) brings the correct amino acid for every 3 base pairs.

The 3 bases on mRNA is called a codon.

The 3 bases on tRNA is called an anti-codon.

How many different kinds of How many different kinds of amino acids are used in the amino acids are used in the

human body?human body?

Every 3 base pairs corresponds to a different

amino acid.

What amino acids does this mRNA code for?

AUG UUA GAC CUC UGA

A translator puts information from one language into another.

Translation puts the genetic code (AGTC’s) into the code of amino acids.

What amino acids does this mRNA code for?

GUA AAA CUU CUA UAG

What do we call What do we call this step?this step?

What do we call What do we call this step?this step?

TranscriptionTranscription TranslationTranslation

DNA mRNAProtein

The scribe(RNA polymerase)

The translator(ribosome and tRNA)

Convert the DNA to mRNAConvert the DNA to mRNAThen, Convert the mRNA to amino Then, Convert the mRNA to amino

acids.acids.

AUA AGU GAU GACIsoleucine Serine Aspartic Acid Aspartic Acid

What do we call this step?What do we call this step?


TranscriptionTranscription

TranslationTranslation

TAT TCA CTA CTG

GCCCGG Argenine

Making a ProteinMaking a Protein

Making a Protein

This is called the central dogma of biology. (That just means that it is a really important idea)

Label each molecule (the pictures).Label the process that makes each molecule (the purple arrows).List the name of the enzymes / molecules that carry out each process.Identify the location where each of these molecules / processes are.

DNA

mRNA ProteinReplication

Transcription Translation

DNA helicaseDNA polymerase

DNA helicaseRNA polymerase

RibosometRNA

Happens in the nucleus Happens in the cytoplasm / at the ribosomes


This is called the central dogma of biology. (That just means that it is a really important idea)

Convert the DNA to mRNAConvert the DNA to mRNAThen, Convert the mRNA to amino Then, Convert the mRNA to amino

acids.acids.

ACU GAU CAA UAG Threonine Aspartic Acid Proline Stop





TGA CTA GTT ATCGTGCAC Histidine

DNA Both RNA

Compare and contrast DNA and RNA in a Venn diagram.


DNA Both RNAHas deoxyribose as its sugar

Has a sugar phosphate backbone

Has ribose as its sugar

Has the nitrogenous base T

Has the nitrogenous bases A, C, and G.

Has the nitrogenous base U

Double stranded Contains the genetic code for proteins

Single stranded

Stays in the nucleus Can leave the nucleus

Comes in 1 kind Has several kinds: mRNA, tRNA, and rRNA

Compare and contrast DNA and RNA in a Venn diagram.


DNA

Cell membrane

Nucleus

Cytoplasm

mRNA

Proteinor

Polypeptide(this is the end

product!)

Anti-codon

Codon

Ribosome tRNA

Amino AcidOr

Monopeptide



Label each molecule (the pictures).Label the process that makes each molecule (the purple arrows).List the name of the enzymes / molecules that carry out each process.Identify the location where each of these molecules / processes are.

DNA

mRNA ProteinReplication

Transcription Translation

DNA helicaseDNA polymerase

DNA helicaseRNA polymerase

RibosometRNA

Happens in the nucleus Happens in the cytoplasm / at the ribosomes

https://www.youtube.com/watch?v=h3b9ArupXZg

Transcription and translation videos:

https://www.youtube.com/watch?v=41_Ne5mS2ls

Real-time molecules moving with narration (4 min)

Description, live narrator and pictures (12 min)

https://www.youtube.com/watch?v=41_Ne5mS2ls

We are going to make a model of all of these pieces and steps!

•Ribosomes have 2 “subunits” or pieces.

Large SubunitLarge Subunit

Small SubunitSmall Subunit

•At the start of every gene is a TATA box. It tells the mRNA polymerase where to start copying.

TCCACGACTATACCGACTACTCTACGGGAATATGGGCUGAUGAGAUGCCCUUAUAC

DNA strand:

mRNA strand:

TATA boxActual gene being transcribed

•mRNA gets a 5’GTP and a poly-A tail to mark the beginning and end. This helps identify it and “protect” it.

PPPG AAAAAAAAA

5’ GTP Poly-A tail

Just like words, the base pairs have to be in a specific order to make sense.

“incredibleincredible” = some letters that have meaning.“iberalideieiberalideie” = some letters with no meaning.

Don’t screw up the Don’t screw up the reciperecipe

“ATTAGCCGCATGATGCTGATGCTAGTCGATGCATGCTAGCTTACGATGCTAGCTAGCTAGCTGACAAACACACCCCACTGACTGATCGATCGATGCATCGCTTTACGATCGATCGATCGATCGATCGATCGATGCATCGAAAGATGAGAAAGGGTCGATCGATCGATCGTTTTATCGATCGATCGATCGATCGATCGATGATCGATCGTTATGCATGCACACACACTAGCTAGCTAGCTAGTGCTGTTTTGATCATCACAACCACCCAGCATGACTATGTGTGTGTGAAAAGTGCTACATAAACGTGATGTGTGGGCCCGGCGCGAAAGCGCTGTGTAGCTTACGATTTACGATGCTAGCTAGCTAGCTGACAAACTGCTGATGCTAGTCGATAGCTTACGATTTACGATGCTAGCTAGCTAGCTGACAAACTGCTGATGCTAGTCGATGCATGCTAGCTTACGATGCTAGCTAGCTAGCTGACAAACGCTAGTCGATGCATGCTAGCTTACGATGCTAGCTAGCTAGCTGACAAACTGCTGATGCTAGTCGATGCATGCTAGCTTACGATGCTAGCTAGCTAGCTGACAAACCTAGCTTTGCTGATGCTAGTCGATGCATGCTAGCTTACGATGCTAGCTAGCTAGCTGACAAACACGATGCTAGCTAGCTAGCTGACAAACACACCCCACTGACTGATCGATCGATGCATCGCTTTACGATCGATCGATCGATCGATCGATCGATGCATCGAAAGATGAGAAAGGGTCGATCGATCGATCGTTTTATCGATCGATCGATCGATCGATCGATGATCGATCGTTATGCATGCACACACACTAGCTAGCTAGCTAGTGCTGTTTTGATCATCACAACCACCCAGCATGACTATGTGTGTGTGAAAAGTGCTACATAAACGTGATGTGTGGGCCCGGCGCGAAAGCGCTGTGTACGTGATGCTGTGATCGATGCCTAGCTAGCTAGCTAGCTAGCTAGAATATAATGGGAA”

= hemoglobin. If it were “spelled” a little differently, hemoglobin would be made with the wrong amino acids and wouldn’t work!

If a protein is “spelled” a little differently (called a mutation), then it would be made with the wrong amino acids and it wouldn’t work!

Hemoglobin

With a change to the DNA, hemoglobin is shaped differently, clumps together and causes sickle cell anemia.

Your skin color is a pigment that Your skin color is a pigment that is the result of many proteins. is the result of many proteins. But, if the DNA is mutated, you But, if the DNA is mutated, you could have no pigment at all!could have no pigment at all!

Evolution you can see: skin color correlates Evolution you can see: skin color correlates to intensity of UV-radiation throughout the to intensity of UV-radiation throughout the year.year.

WrestlingWrestlingFirst Meeting: Today Afterschool First Meeting: Today Afterschool

in room 128in room 128

Date post:	11-Jan-2016
Category:	Documents
Upload:	maleah
View:	28 times
Download:	0 times

Biology Journal 10/14/2013

Documents