+ All Categories
Home > Documents > Biotechnology Toolbox for Synthetic Biology

Biotechnology Toolbox for Synthetic Biology

Date post: 12-Jan-2016
Category:
Upload: farrah
View: 187 times
Download: 2 times
Share this document with a friend
Description:
Basic Molecular Biology and Genetics. Biotechnology Toolbox for Synthetic Biology. Presenter: Damon Tighe. Outline:. History of biology and biotechnology (highly abbreviated) Crash Course in Molecular Biology Central Dogma of Molecular Biology DNA Replication, Transcription, Translation - PowerPoint PPT Presentation
Popular Tags:
34
Biotechnology Toolbox for Synthetic Biology Basic Molecular Biology and Genetics Presenter: Damon Tighe
Transcript
Page 1: Biotechnology Toolbox for Synthetic Biology

Biotechnology Toolbox for Synthetic Biology Basic Molecular Biology and Genetics

Presenter: Damon Tighe

Page 2: Biotechnology Toolbox for Synthetic Biology

Outline:1. History of biology and biotechnology (highly abbreviated)

2. Crash Course in Molecular Biology

1. Central Dogma of Molecular Biology

2. DNA

3. Replication, Transcription, Translation

4. Protein

3. Basic Tools of Biotechnology

1. DNA Extraction (Lab)

2. Restriction Enzymes

3. Electrophoresis/Chromatography

4. PCR

5. DNA Sequencing

6. Synthetically building DNA

7. Protein technologies

8. Tying them all together - Insulin

15 min break

Page 3: Biotechnology Toolbox for Synthetic Biology

History of biology and biotechnology (highly abbreviated)

Thales of Melitus

Father of Philosophy

Olive Press fortune

624-546BCAristotle

384-322BC

Battle of Halys

Father of Biology

Categorical –Observation

Ethics

Sumerian Beer Recipe 3000BC

Kyui and Kimchi 6000BC

Wine in Armenia 6000BC

Teleology

Page 4: Biotechnology Toolbox for Synthetic Biology

History of biology and biotechnology (highly abbreviated)

Charles DarwinAnton van Leeuwenhoek

Robert Koch

Louis Pasteur Alfred Russel Wallace

Gregor Mendel

Birth of Microbiology Natural Selection Molecular Biology

Fridrich Miescher

Frederick Griffith et al.

Watson, Crick, Franklin

~1650s – 1850s ~1850s – 1900s ~1900s – 1950s

Page 5: Biotechnology Toolbox for Synthetic Biology

History of biology and biotechnology (highly abbreviated)

Ari PatrinosKary Mullis

Francis Collins

Craig Venter

PCR Human Genome Project Semi-Synthetic Life

Craig Venter

Synthetic Genome used to

re-boot/reprogram an existing cell

19831990-2003 2010

Target and amplify specific regions of

DNA

Page 6: Biotechnology Toolbox for Synthetic Biology

Central Dogma of Molecular BiologyFlow of information

Page 7: Biotechnology Toolbox for Synthetic Biology

DNAmacromolecule of information

Page 8: Biotechnology Toolbox for Synthetic Biology

DNAStructure/functionDNA

Structure/function

-

-

Page 9: Biotechnology Toolbox for Synthetic Biology

DNAStructure/function – Eukaryotic packing

Page 10: Biotechnology Toolbox for Synthetic Biology

DNAReplication

5’ to 3’

Page 11: Biotechnology Toolbox for Synthetic Biology

DNA -> RNA

Page 12: Biotechnology Toolbox for Synthetic Biology

RNAStructure/function

mRNA – messenger RNA

tRNA – transfer RNA

polyA

5’cap

Page 13: Biotechnology Toolbox for Synthetic Biology

DNATranscription and Translation

The Protein Code ( Translation of RNA to Amino Acids)

Page 14: Biotechnology Toolbox for Synthetic Biology

DNATranscription and Translation

Page 15: Biotechnology Toolbox for Synthetic Biology

Protein Structure/function

Page 16: Biotechnology Toolbox for Synthetic Biology

Protein Structure/function

Sickle Cell Anemia

Single nucleotide mutation changes protein code, changes protein shape and function

Page 17: Biotechnology Toolbox for Synthetic Biology

Protein function

Enzymes – catalyze reactions by lowering activation energy

Structural- collagen, keratin, etc

Storage – act as a reservoir of amino acids – ovalalbumin

Antibodies – immune system ability to pin point antigens

Hormones – signaling molecules that travel long distance in the body

Contractile – myosin, muscle fibers

Form defines Function:

Protein function

Page 18: Biotechnology Toolbox for Synthetic Biology

Protein Enzymatic Pathways

Carbs, fats, proteins

Page 19: Biotechnology Toolbox for Synthetic Biology
Page 20: Biotechnology Toolbox for Synthetic Biology

DNA Technology – Extraction/Isolation

Scale to fit your application

Ethanol Extraction – quick/crude, damaged DNA, but can work with it

Phenol-Chloroform – laborious, but high quality DNA

Animation of Fugu Fish Extraction

Spin Columns – quick and easy, use resin to isolate DNA

Page 21: Biotechnology Toolbox for Synthetic Biology

DNA Technology - Extraction

2ml

Page 22: Biotechnology Toolbox for Synthetic Biology

DNA Technology – Restriction Enzymes

Endonucleases

Palindrome

Restriction site

Page 23: Biotechnology Toolbox for Synthetic Biology

DNA Technology - Chromatography

Page 24: Biotechnology Toolbox for Synthetic Biology

DNA Technology - Amplification

PCR Animation

Polymerase Chain Reaction (PCR)

Page 25: Biotechnology Toolbox for Synthetic Biology

DNA Technology - Cloning

Restriction Enzyme PCR Product

Page 26: Biotechnology Toolbox for Synthetic Biology

DNA Technology - Sequencing

Capillary Electrophoresis

Illumina – highly parallelIon Torrent

Page 27: Biotechnology Toolbox for Synthetic Biology

DNA Technology - SequencingPacific Biosciences Oxford Nanopore

Page 28: Biotechnology Toolbox for Synthetic Biology

Protein Technology – Production

Bovine Growth Hormone $14

Gold* $53

Insulin $60

Human Growth Hormone $227,000

Granulocyte Colony Stimulating Factor

$1,357,000

Price Per Gram

Prices in US Dollars* As of 4/4/2012

Page 29: Biotechnology Toolbox for Synthetic Biology

Protein Technology – Production

PROTEIN: USED IN THE TREATMENT OF:

Cell Production

Insulin Diabetes E. coli

Human growth hormone Growth disorders E. coli

Granulocyte colony stimulating factor

Cancers E. Coli

Erythropoietin Anemia CHO cells

Tissue plasminogen activator Heart attack CHO cells

Hepatitis B virus vaccine Vaccination Yeast

Human papillomavirus vaccine Vaccination Yeast

Production is constrained by the organism we use to produce the protein in. We are constrained in part by the choices of history and the momentum of technology.

Page 30: Biotechnology Toolbox for Synthetic Biology

Protein Technology – Chromatography

•Ion Exchange (protein charge)

•Size Exclusion (separates on size)

•Hydrophobic Interaction (hydrophobicity)

•Affinity:•Protein A tail of Antibodies•His-tagged metal complexes (Ni)•Glutathione-s-transferase glutathione

Page 31: Biotechnology Toolbox for Synthetic Biology

DNA -> Protein -> consumer product

Insulin – protein used to treat Diabetes Melitus

Thales of Melitus Eli Lilly (Indianapolis)

Insulin Olive Oil Insulin

Genentech

Page 32: Biotechnology Toolbox for Synthetic Biology

DNA -> Protein -> consumer product

Extract DNA

PCR Insulin

Clone into plasmid

Transform E.coli

Grow E.coli

Induce E.coli

Harvest E.coli

Proteins

Purify Insulin via Chromatography

Selective pressure

Page 33: Biotechnology Toolbox for Synthetic Biology

DNA Technology – Chemical DNA Synthesis

oligonucleotide

ligase

ligase

Page 34: Biotechnology Toolbox for Synthetic Biology

GGTCCTCGCGCCAGCTTAAGACGCTAATCCCTAACTGCTGGCGGAAAAGATGTGACAGACGCGACGGC

Synthetic Biology


Recommended